1 1 2 3 architecture of the yeast rna polymerase ii open complex

Architecture of the yeast RNA polymerase II open complex and regulation of

activity by TFIIF

James Fishburn and Steven Hahn*

Fred Hutchinson Cancer Research Center

PO Box 10924

1100 Fairview Ave N

MS A1-162

Seattle, WA 98109

*email: [email protected]

*phone: 206 667 5261

Running Title: yeast RNA Polymerase II open complexes

Word Count: introduction, results and discussion = 5640

Word count: materials and methods = 2491

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Mol. Cell. Biol. doi:10.1128/MCB.06242-11 MCB Accepts, published online ahead of print on 24 October 2011

on April 13, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Abstract

To investigate the function and architecture of the open complex state of RNA

polymerase (Pol) II, S. cerevisiae minimal open complexes were assembled using

a series of heteroduplex HIS4 promoters, TBP, TFIIB, and Pol II. The yeast

system demonstrates great flexibility in the position of active open complexes,

spanning 30-80 base pairs downstream from TATA, consistent with the

transcription start site scanning behavior of yeast Pol II. TFIIF unexpectedly

modulates activity of the open complexes, either repressing or stimulating

initiation. The response to TFIIF was dependent on the sequence of the template

strand within the single stranded bubble. Mutations in the TFIIB reader and

linker region, which were inactive on duplex DNA, were suppressed by the

heteroduplex templates, showing that a major function of the TFIIB reader and

linker is in initiation or stabilization of single stranded DNA. Probing the

architecture of the minimal open complexes with TFIIB-FeBABE derivatives

showed that the TFIIB core domain is surprisingly positioned away from Pol II,

and addition of TFIIF repositions the TFIIB core domain to the Pol II wall

domain. Together, our results show an unexpected architecture of minimal open

complexes and regulation of activity by TFIIF and the TFIIB core domain.

Introduction

Transcription initiation is a multistep process that is conserved in all organisms

(6, 17, 29). RNA polymerase (Pol) first recognizes and binds to promoter DNA

with the assistance of one or more factors forming a state termed the closed

complex. Subsequently, DNA surrounding the transcription start site is unwound

and the template strand is positioned in the Pol active site, forming the open

complex (24). Transcription initiation then commences, initially producing short

RNA products in an abortive initiation reaction, until Pol releases contacts with

the promoter and transitions into a processive elongation mode. Each of these

intermediate steps can be targeted to regulate transcription.

The closed complex state of eukaryotic Pol II is termed the preinitiation complex

(PIC) and contains Pol II and 6 general transcription factors (TFIIA, TBP, TFIIB,


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

TFIIF, TFIIE, and TFIIH) (11, 25). Unlike the closed complex of other Pols, the

Pol II PIC is stable and does not spontaneously form open complexes. Instead,

open complex formation requires ATP hydrolysis and the XPB helicase activity to

unwind the DNA strands from ~ –10 to +2 with respect to the human

transcription start site (14, 28). These open complexes are unstable, with a half-

life of ~1 min, and require continuous ATP hydrolysis to remain in this state (8,

14, 30).

For Archaea and many eukaryotes, the bubble of unwound DNA in the open

complex overlaps the transcription start site, located about 30 bp distant from

the TATA element. One exception is the yeast S. cerevisiae, where transcription

starts within a window of ~50-120 bp downstream from TATA even though yeast

PICs are assembled surrounding the TATA (12, 16, 20, 31). In vivo permanganate

probing suggested that unwinding of yeast promoter DNA begins, with respect to

TATA, at about the same position as in mammals and extends to the distant

transcription start site (10). However, it is not known if all DNA is unwound at

once in a large single stranded bubble or, whether a smaller bubble is propagated

downstream, while Pol II scans for an appropriate initiation site. It is also not

known whether start site scanning involves release of Pol II from the general

factors and promoter DNA. Finally, it is not clear why yeast and mammalian

start site selection is different, since Pol II and the general factors are well

conserved. It was suggested that differences in Pol II and TFIIB can account for

start site preference (18), and mutations that have modest effects on start site

preference have been isolated in Pol II, TFIIF, and TFIIB (reviewed in (9)).

Models for the architecture of the PIC at a TATA-containing promoter have been

proposed based on biochemical probes positioned within the PIC (4, 9, 20) and

from x-ray structures of the Pol II-TFIIB complex (15, 19). In these models, the

TFIIB core domain binds both TATA-TBP and the wall domain of Pol II,

positioning downstream promoter DNA over the Pol II central cleft with

upstream DNA directed toward the top surface of Rpb2, the second largest Pol II

subunit. Two structured domains of TFIIF are positioned at separate sites on


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Rpb2 (5, 9) and one of these domains, the winged helix of the TFIIF small

subunit, is near upstream promoter DNA where it may bind and stabilize the PIC

(9).

Two major questions concerning the mechanism of Pol II initiation are: what is

the architecture of the Pol II open complex and, how does Pol II scan for the

transcription start site? Two models for open complex formation were recently

proposed by combining PIC models and the x-ray structure of the Pol II

elongation complex (15, 19). In one model, the unwound template strand is

positioned in the enzyme active site with upstream single stranded DNA near a

flexible region of TFIIB termed the B-reader, proposed to recognize DNA 8 bp

upstream from the transcription start site (15). Another TFIIB element termed

the B-linker is positioned near the junction of single and double stranded

promoter DNA and is proposed to function in DNA melting (15, 19). In both

models, the TFIIB core domain, TBP, and upstream promoter DNA remain in the

same location compared to the PIC. These models, however, do not explain how

yeast Pol II can initiate mRNA synthesis at distant downstream sites.

In this work, we examine the activity and architecture of a minimal Pol II open

complex. We observe remarkable flexibility in the open complex state that is

consistent with downstream initiation, unexpected sequence-dependent

modulation of open complex activity by TFIIF, and surprising differences with

the previously proposed open complex models for the position of the TFIIB core

domain and the path of upstream promoter DNA.

Materials and Methods

Heteroduplex promoters and immobilized templates

DNA templates were generated by PCR from pSH1271 (containing a single Gal4

binding site upstream from a modified HIS4 promoter; see below) with primers

pBio965 (biotin-taatgcagctggcacgacagg) and pNOT (ggccgctctagctgcattaatg). The

629 bp product was used to generate immobilized templates as in Ranish et. al.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

, and used for transcription and FeBABE cleavage assays. Alternatively, the

product was digested with DraIII and AlwN1 restriction enzymes (NEB), yielding

fragments of 363 bp, 92bp, and 174 bp. These fragments were separated and

purified from 2.5 % agarose gels, and used in the generation of heteroduplex

templates. Heteroduplexes were formed by annealing phosphorylated 92 base

oligos containing 12 bp mismatches at the positions indicated in Fig 1A. The

oligos were designed to leave overhangs complimentary to DraIII and AlwN1 sites

in pSH1271, thus allowing replacement of the HIS4 promoter from the TATA box

through the start sites of in vitro transcription. The 92 bp heteroduplexes were

purified on 2.5 % agarose gels. Heteroduplex promoters were generated by

overnight ligation at 16 °C of the mismatched 92 bp promoter inserts with the

363 bp and 174 bp fragments from pSH1271 templates. T4 DNA Ligase (NEB)

was heat inactivated (10 min at 65 ºC), and the reactions run on 2 % agarose gels.

The 629 bp products were purified by gel extraction kit (Qiagen), ethanol

precipitated, and the DNA resuspended in 10 mM Tris (pH 8.0). The

heteroduplex templates were quantified by ND-1000 spectrophotometer

(NanoDrop), and used to generate immobilized templates as above.

The sequence of the modified HIS4 promoter from plasmid pSH1271 used to

generate immobilized templates is given below, with the HIS4 TATA in bold and

underlined:

taatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaatt

aatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgt

atgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgat

tacgccaagcgcgcaattaaccctcactaaagggaacaaaagctgggtaccgggcccccc

ctcgaggtcgacggtatcgataagcttgatatcgaattcctgcagcccgggggatcgatc

cgggtgacagccctccgaattcgagctcggtacccggggatctgtcgacctcgagaacag

tagcacgctgtgtatataatagctatggaacgttcgattcacctccgatgtgtgttgtac

atacataaaaatatcatagcacaactgcgctgtgtcagcgactgaatagtaatacaatag

tttacaaaattttttttctgaataatgaccggatccggagcttggctgttgcccgtctca

ctggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttg

gccgattcattaatgcagctagagcggcc


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

In vitro transcription and primer extension

20 μl reactions contained the following: 20 mM HEPES (pH 7.6), 100 mM

potassium acetate, 1 mM EDTA, 5 mM magnesium acetate, 3 mM DTT, 38 mM

creatine phosphate, 0.03 units creatine phosphokinase, 2 μg BSA, 4 units RNAse

OUT (Invitrogen), 0.05 % NP40, and 1 μg poly-dGdC competitor DNA. To each

reaction, 1 μl immobilized template (86 ng template) was added, along with 24 ng

VP16 activator and 120 μg nuclear extract, or purified factors (TFs) as follows: 68

ng TBP, 26 ng TFIIB, 54 ng TFIIF, 12 ng TFIIE, 85 ng TFIIH, and 280 ng PolII.

With the exception of TFIIH, all factors were saturating for activity at these

concentrations. Preinitiation complexes were allowed to form for 30-40 min at

room temperature. Transcription was initiated by adding 1 μl NTPs (10 mM

each), and stopped after 3 minutes by adding 180 μl stop mix of 100 mM sodium

acetate, 10 mM EDTA, 0.5 % SDS, and 17 μg/ml tRNA (Sigma). Reactions were

phenol/chloroform (2:1) extracted once, the RNA precipitated ,washed in

ethanol, and dried. The pellets were resuspended in 10 μl primer annealing mix

of 5 mM Tris (pH 8.3), 75 mM potassium chloride, 1 mM EDTA, and either 32P-

labeled lacI primer (~5 x 105 cpm) or 65 μM 700IR-fluorescently labeled lacI (LI-

COR Biosciences). Reactions were incubated for 45 min at 48 ºC (32P-lacI), or 55

ºC (700IR-lacI). Next, 20 μl cDNA synthesis mix (25 mM Tris (pH 8.3), 75 mM

potassium chloride, 4.5 mM magnesium chloride, 15 mM DTT, 150 μM dNTPs,

and 100 units MMLV-RT (Invitrogen)) was added to each reaction, and

incubated 30 min at 37 ºC. Reactions were stopped by ethanol precipitation.

The pellets were washed with 80% ethanol, dried, resuspended in 3 μl RNAse A

(40 μg/ml), and incubated 3 min at room temperature before adding 3 μl

formamide loading dye containing bromophenyl blue. Just before

electrophoresis, samples were heated for 1 minute at 90 ºC, transferred to ice,

and run on denaturing 8 % acrylamide gels. Gels were visualized by

PhosphorImager (32P; Molecular Dynamics), or by Odyssey scanner (700-IR; LI-

COR).


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Transcription initiation assay

Reactions were assembled under the same conditions used for in vitro

transcription with purified factors (TFs). Complexes were allowed to form for

30-40 min at RT on immobilized heteroduplex templates. Transcription was

initiated from Bubble 3 with 1 μl limiting NTPs (10 mM ATP and CTP plus 1 mM

UTP) plus 5 μCi α 32P-UTP (Perkin Elmer), or from Bubble 15 with 1 μl limiting

NTPs (10 mM CTP and UTP plus 1 mM GTP) plus 5 μCi α 32P-GTP, and stopped

after 30 min by adding 180 μl transcription stop mix. The reactions were

extracted once with phenol/chloroform (2:1), the labeled-RNA precipitated,

washed in ethanol, and dried. The pellets were resuspended with formamide

loading dye, heated to 65 °C for 30 sec, and transferred to ice before loading on

denaturing 20 % acrylamide urea gels. The RNA products were visualized by

PhosphorImager (Molecular Dynamics).

FeBABE cleavage assays

TFIIB-FeBABE derivatives were assembled into PICs using immobilized template

DNAs. Cleavage assays and analysis of cleavage products was performed as

described (3, 4).

TFIIB purification

TFIIB was expressed as an N-terminal SUMO fusion protein from pLH237

(pET21a-6(His)-SUMO-yTFIIB) in BL21 (DE3) RIL cells. 2 liters of cells were

collected by centrifugation and resuspended in 20 ml lysis buffer (50 mM HEPES

(pH 7.0), 500 mM NaCl, 10 % glycerol, 40 mM Imidazole). The cells were treated

with lysozyme (0.5 mg/ml) for 45 minutes at 4 °C, and disrupted by sonication.

The extract was clarified by centrifugation, and purified using Ni-Sepharose

affinity media (GE Healthcare). TFIIB was eluted with 50 mM HEPES (pH 7.0),

0.5 M NaCl, 0.5 M Imidazole, 0.05 % NP40, and 10 % glycerol. The eluate was

dialyzed to remove Imidazole and reduce [NaCl] to 375 mM, and subsequently

treated with SUMO protease Ulp1 (1.7 μg/ml) for 1 hour at room temp (RT).

Following cleavage, Ni-Sepharose was used to capture the 6His-SUMO-tag and


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

protease. TFIIB was dialyzed in 20 mM Tris (pH 7.8), 150 mM KOAc, 50 μM

ZnOAc, and 10 % glycerol, and was further purified over BioRex 70 (BioRad) with

a linear gradient of 7.5 – 30 % buffer B [20 mM Tris (pH 7.8), 2 M KOAc, 50 μM

ZnOAc, 10 % glycerol]. TFIIB eluted at ~ 540 mM KOAc, and was stored at -80

°C. All buffers were supplemented with 1 mM DTT and PMSF.

TFIIH purification

SHY810 (RAD3-(Flag)1-TAP tag) cells were grown at 30 °C in YPD (3% glucose,

0.002 % adenine) to OD600 5.0. Cells were washed with cold TAP extraction

buffer (20 mM HEPES (pH 7.6 at 4 °C), 0.2 M KOAc, 20 % glycerol, 1 mM

EDTA). Cells were resuspended in 1 ml TAP extraction buffer per gram wet

pellet, and homogenized using chilled 425-600 μm glass beads (Sigma) using a

Bead Beater (BioSpec Products). The extract was clarified in steps by

centrifugation at 4 °C for 20 min at 25,000 x g followed by 90 min at 200,000 x

g. Clarified extract was added to 33 μl IgG Sepharose (GE Healthcare) per gram

of pellet, and incubated for 2 hours at 4 °C. IgG beads were collected by

centrifugation, washed twice with TAP extraction buffer, and once with TEV

cleavage buffer (20 mM HEPES (pH 7.6 at 4 °C), 0.2 M KOAc, 20 % glycerol, 1

mM EDTA, 0.1 % NP40). One volume TEV cleavage buffer was added to IgG

beads along with 10 μg TEV protease per ml IgG, and incubated for 60 min at

room temperature (RT). IgG beads were collected by centrifugation, and TFIIH

eluate was removed. One volume TEV cleavage buffer was added to IgG beads

and incubated 10 min at RT. The beads were collected and eluate transferred,

and a third 10 min elution step carried out. The eluates were combined and

added to 3 volumes Calmodulin binding buffer (20 mM HEPES (pH 7.6 at 4 °C),

0.2 M KOAc, 20 % glycerol, 1 mM EDTA, 0.1 % NP40, 1 mM MgOAc, 1 mM

Imidazole, 2 mM CaCl2) and adjusted to 3 mM CaCl2. This solution was added to

Calmodulin Affinity Resin (Stratagene) and incubated for 90 min at 4 °C. The

resin was collected by centrifugation, washed twice with Calmodulin binding

buffer, and once with Calmodulin binding buffer- low NP40 (0.01 %). Two

volumes Calmodulin elution buffer (20 mM HEPES (pH 7.6 at 4 °C), 0.2 M


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

KOAc, 20 % glycerol, 1 mM EDTA, 0.01 % NP40, 1 mM MgOAc, 1 mM Imidazole,

3 mM EGTA) was added to the resin and incubated 20 min at RT. The resin was

collected as before, and the elution repeated twice. TFIIH containing eluates

were combined and concentrated with Microcon YM-100 filters (Millipore). DTT

was added to 5 mM, and TFIIH was stored at -80 °C. Buffers were supplemented

with 1 mM DTT, 1 mM PMSF, 2 mM benzamidine, 3 μM leupeptin, 2 μM

pepstatin, and 3.3 μM chymostatin.

RNA Pol II purification

Yeast strain SHy808 (His6 tag at the N-terminus of Rpb3) was grown at 30 °C in

YPD (3 % glucose, 0.002 % adenine) to OD600 5.0, harvested by centrifugation,

and weighed. Pol II was typically prepared from 30 liters of cells. The cells were

resuspended in 0.33 ml freezing buffer (150 mM Tris (pH 7.9 at 4 °C), 3 mM

EDTA, 30 μM ZnCl2, 30% glycerol, 3 % DMSO, 30 mM mercaptoethanol, 3 x

protease inhibitors) per gram wet pellet, and flash frozen before storing at -80 °C.

The cell suspension was thawed in a room temperature water bath, homogenized

by Bead Beater (Biospec Products) and the extract clarified by centrifugation as

done for purification of TFIIH. The clarified extract was transferred to a glass

beaker, and stirred overnight at 4 °C with 291 mg/ml ammonium sulfate. The

sample was centrifuged 30 min at 25,000 x g, and the supernatant discarded.

The pellet was resuspended in 75 μl HSB-0/10 per gram of cells harvested, and

conductivity was adjusted to 400 μS/cm with HSB-0/10 [50 mM Tris (pH 7.9 at 4

°C), 1 mM EDTA, 10 μM ZnCl2, 10 mM Imidazole, 10 % glycerol, 10 mM β-

mercaptoethanol]. The sample was added to HSB-1000/10 [HSB-0/10 plus 1 M

KCl] equilibrated Ni-Sepharose (10 μl resin per gram of cells harvested), and

incubated 2 hours at 4 °C. The beads were collected by centrifugation, washed

for 5 min at 4 °C with 5 volumes HSB-1000/10, and washed twice more with Ni-

20 [20 mM Tris (pH 7.9 at 4 °C), 150 mM KCl, 10 μM ZnCl2, 20 mM Imidazole,

10 % glycerol, 10 mM mercaptoethanol]. Pol II was eluted three times by 10 min

incubation at RT in 2.5 volumes Ni-200 [Ni-20 with 200 mM Imidazole]. The

desired eluates were combined, and slowly adjusted to 55 μS/cm conductivity


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

with Q buffer A [20 mM Tris (pH 7.9 at 4 °C), 0.5 mM EDTA, 10 μM ZnCl2, 10 %

glycerol, 10 mM DTT]. Pol II was further purified over Source 15 Q (GE

Healthcare) using 2 linear gradients of Q buffer B [Q buffer A plus 1.5 M KOAc ]:

10 – 35 % over 15 CV, and 35 – 70 % over 30 CV. The desired fractions were

pooled, and dialyzed in 3 steps (1 liter for 1.5 hours each step) in Pol II buffer [20

mM HEPES (pH 7.6 at 4 °C), 20 % glycerol, 8 mM MgSO4, 60 mM (NH4)2SO4, 10

μM ZnCl2, 10 mM DTT]. Pol II was concentrated using Amicon Ultra-30k filters

(Millipore), and stored at -80 °C. Buffers were supplemented with protease

inhibitors as in the purification of TFIIH.

TBP purification

TBP was expressed from pSH713 (pET21a-6His-TBP) in BL21 (DE3) RIL cells. 4

liters of cells were grown to log phase, induced, and harvested by centrifugation.

The cells were washed, and resuspended in 40 ml 20 mM Tris (pH 7.8), 250 mM

KCl, 10 % glycerol, and 5 mM mercaptoethanol. Cells were treated with 0.5

mg/ml lysozyme for 30 minutes, and disrupted by sonication. The extract was

clarified by centrifugation, and purified using Ni-Sepharose affinity media (GE

Healthcare). TBP was eluted with 20 mM Tris (pH 7.8), 0.25 M KCl, 0.25 M

Imidazole, 10 % glycerol, and 5 mM mercaptoethanol. TBP was adjusted for

conductivity to 50 μS/cm by dilution with buffer A [20 mM Tris (pH 7.8), 10 %

glycerol, 1 mM DTT], and further purified over Source 15 S (GE Healthcare) using

a linear gradient of 2.5 – 30 % buffer B [buffer A plus 2 M KCl] over 20 column

volumes. TBP eluted at approximately 200 mM KCl, and was stored at -80 °C.

All buffers were supplemented with 1 mM PMSF. The TFIIBN-TBP fusion was

also purified using this method.

TFIIF and TFIIE purification

Recombinant TFIIF containing S. mikatae Tfg1 and S. cerevisiae Tfg2 was

expressed and purified as described . Recombinant TFIIE typically had ~2-

fold lower specific activity compared to yeast-purified TFIIE, using the

reconstituted transcription system, so yeast-purified TFIIE was used for all


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

assays. SHY392 (TFA1-(1x Flag)-TAP tag) cells were grown at 30 °C in YPD (3 %

glucose, 0.002 % adenine) to OD600 5.0. 12 liters of cells were harvested by

centrifugation and washed with 100 ml extraction buffer (40 mM HEPES-KOH

(pH 7.5), 350 mM NaCl, 10 % glycerol, 0.1 % Tween-20, 0.5 mM DTT). The cell

pellet was resuspended in 1 ml extraction buffer per gram of cells. The cells were

homogenized, and the extract clarified as in the purification of TFIIH. The

clarified extract was added to 3 ml IgG Sepharose (GE Healthcare), washed 3

times with 10 volumes extraction buffer without DTT) and incubated 3 hours at 4

°C. The beads were collected by centrifugation, washed twice with extraction

buffer, and once in TFIIH cleavage buffer (10 mM Tris (pH 8.0), 150 mM NaCl,

0.5 mM EDTA, 0.1 % NP40, 10 % glycerol, 1 mM DTT). 3 ml TFIIH cleavage

buffer plus 30 μg TEV protease were added to the washed beads, and incubated

45 minutes at RT. The beads were spun down, and the supernatant collected for

elution 1.3 ml cleavage buffer was added to the beads, and incubated 15 minutes

before collected elution 2. This step was repeated for a third elution. The eluates

were combined, and added to 3 volumes binding buffer (10 mM Tris (pH 8.0), 1

mM MgOAc, 1 mM Imidazole, 2 mM CaCl2, 0.1 % NP40, 10 % glycerol, 0.5 mM

DTT) and adjusted to 3 mM CaCl2. This solution was added to 2 ml Calmodulin

Affinity Resin (Stratagene) and incubated for 2 hours at 4 °C. The resin was

collected by centrifugation, washed once with binding buffer, and then twice with

wash buffer (binding buffer with reduced NaCl (150 mM) and without NP40). 1

volume elution buffer (10 mM Tris (pH 8.0), 150 mM NaCl, 1 mM MgOAc, 1 mM

Imidazole, 3 mM EGTA, 10 % glycerol, 0.5 mM DTT) was added to the resin, and

incubated 20 minutes at RT. The resin was collected as before, and the elution

repeated twice. TFIIE containing eluates were combined, adjusted to 0.01%

NP40, and concentrated 10-fold with an Amicon Ultra-4 (10,000 MWCO) filter

device (Millipore) before storing at -80 °C. All buffers were supplemented with

protease inhibitors as in TFIIH purification.

Results

Isolation of yeast minimal open complexes and regulation by TFIIF.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Human Pol II open complexes can be formed in vitro by two methods. In the

first method, PICs containing Pol II and all the general transcription factors are

incubated with ATP or dATP, leading to the unwinding of ~10 bp surrounding the

transcription start site, monitored by KMnO4 reactivity with single stranded

DNA (14, 28). Maintenance of this state requires the continued hydrolysis of

ATP, since addition of excess of ATPγS reverts the open complex back to the PIC

(8, 14, 30). In contrast, ATP addition to S. cerevisiae PICs has not yet been

observed to generate KMnO4 sensitive DNA between TATA and the transcription

start site. One possible reason for this is that ATP may also induce start site

scanning, so that the single stranded DNA is not localized to a single position.

An alternative method of open complex formation involves assembling factors on

promoter DNA containing a preformed heteroduplex bubble (13, 21, 26). In the

human system, the optimal position for the bubble is variable depending on the

promoter used, but is generally located from ~ -9 to +2 relative to the

transcription start site. Transcription from these complexes requires only the

factors TBP, TFIIB and Pol II (21). TBP and TFIIB are presumably necessary to

tether Pol II near the heteroduplex DNA and to assist positioning the DNA within

the Pol II active site. TFIIF has been reported to either stimulate or have little

effect on activity of these minimal human open complexes (21, 26). TFIIE and

TFIIH are unnecessary for activity of the human heteroduplex complexes,

probably because they act primarily in DNA strand separation and/or

stabilization of the open state.

Yeast transcription initiates at variable distances downstream from the site of

PIC formation and it is not clear why the yeast system does not initiate at the

same position as human Pol II. One model consistent with previous results is

that initiation at ~30 bp downstream from TATA is blocked, forcing Pol II to scan

downstream sequences for an appropriate start site. Because of this behavior, it

was not clear whether yeast Pol II open complexes could be formed using

heteroduplex templates and, if so, where best to position the single stranded


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

bubble. To test whether open complexes could be formed, a series of 10

heteroduplex templates were generated based on the yeast HIS4 promoter, each

containing 12 bases of unpaired single stranded DNA. These bubbles span the

region beginning 18 bp downstream of TATA, through the normal HIS4

initiation sites ~80 bp downstream of TATA (Fig 1A). The promoter derivatives

also contained an additional 372 and 165 bp of upstream and downstream DNA

(23) and were attached to magnetic beads via biotin at the 5’ end of the promoter.

The major most upstream HIS4 transcription start is defined as position +1.

We initially characterized the activity of two bubble templates, one coincident

with the position of mammalian transcription initiation (Bubble 3) and the other

overlapping the normal HIS4 transcription start site (Bubble 15). Fig 1B shows

the activity of the Bubble 3 heteroduplex template compared to transcription

using the double stranded HIS4 promoter. In all experiments, nucleotides were

added for 3 min to preformed protein-DNA complexes to limit transcription to

approximately one round of initiation. Fig 1B, lanes 1-2 shows VP16 activated

transcription using yeast nuclear extracts on the double stranded HIS4 template.

This transcription activity is comparable to the level of basal transcription (no

activator) using a system containing highly purified and recombinant yeast

factors (TFs) (Fig 1B, lanes 3-4). As expected, both the crude and reconstituted

complete system requires hydrolysable ATP as ATPγS, a substrate for RNA

synthesis but not open complex formation, does not promote transcription when

substituted for ATP (Fig 1B, lanes 2, 4).

Very high levels of transcription were observed using both the Bubble 3 and

Bubble 15 promoters (Fig 1B,C). High level transcription from Bubble 3 required

Pol II, TBP and TFIIB (Fig 1B, lanes 5-8) and similar behavior was observed with

Bubble 15. As expected, transcription initiation from these promoters was

independent of β-γ hydrolysable ATP, since substitution of ATPγS for ATP gave

similar levels of mRNA (Fig 1C, lanes 1,2,7,8).


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Unexpectedly, transcription from Bubble 3 using the complete set of general

factors was 3-fold lower compared to the minimal system (Fig 1C, lanes 1-2, 5-6).

This repression appeared to be caused by TFIIF, since TFIIF addition to the

minimal set of factors also repressed transcription (Fig 1C, lane 4). In contrast,

TFIIF had no effect on transcription from Bubble 15 at the normal site of HIS4

initiation (Fig 1C, lanes 7-12). Our results demonstrate a surprising flexibility of

the yeast system for the position of the heteroduplex bubble, ranging over 60

bp, and show that there is nothing preventing the minimal set of Pol II factors

from initiation at the position used by mammalian Pol II. Importantly, TFIIF

inhibits initiation by yeast Pol II at the mammalian start site position in

heteroduplex HIS4 templates. This mechanism may also contribute to inhibiting

initiation from the mammalian start site position in double stranded DNA when

all factors are present.

To further investigate the flexibility of open complexes and the ability of TFIIF to

repress initiation, the complete set of heteroduplex templates was tested for

transcription activity and repression by TFIIF (Fig 2A). Bubbles 1-7 spanning

the mammalian start site position from 18-42 bp downstream of TATA were all

active as templates for the minimal set of factors. Bubble 7 had a significant

background of transcription from Pol II alone, while the other templates all gave

significantly higher transcription when TBP and TFIIB were added.

Transcription from all these templates was repressed by the addition of TFIIF. In

contrast, Bubbles 9,10, and 12 (single stranded DNA 42-65 bp from TATA) gave

little or no transcription. Finally, Bubbles 14-16, which all overlap the normal

HIS4 initiation sites, gave high levels of initiation that were either stimulated or

indifferent to the addition of TFIIF. Bubble 14 also had a high background of

transcription from Pol II alone.

Analysis of initiation from Bubble 3 using a high resolution gel shows that

initiation in the absence of TFIIF begins from sites within and just downstream

of the single stranded region, and that TFIIF has its strongest repressive effect on

starts within single stranded DNA (Fig 2B, brackets indicate the region of single


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

stranded DNA). In contrast, transcription from Bubble 15 initiates almost

entirely within the single stranded region and transcription from at least two

initiation sites are stimulated by TFIIF.

To test whether TFIIF repressed transcription initiation from Bubble 3, rather

than a later step such as transition to the elongation mode, minimal open

complexes were incubated with ATP, CTP and α32P UTP for 30 min, generating a

series of short RNAs (Fig 3, lane 2). Synthesis of these short RNAs was inhibited

by TFIIF, showing that TFIIF inhibits initiation (Fig 3, lane 3). In contrast,

addition of TFIIF stimulates production of short RNAs from Bubble 15 and the

nucleotides CTP, UTP and α32P GTP (Fig 3, lanes 5,6). Thus, TFIIF appears to

act by modulation of transcription initiation.

Sequence of the heteroduplex bubble determines the response to

TFIIF

We next investigated why transcription from the different bubble templates

showed different responses to TFIIF. Possible variables include distance of the

bubbles from TATA or DNA sequence differences upstream of and/or within the

bubbles. To test if the sequence upstream of the single stranded region was

important for regulation by TFIIF, 12 bp of DNA upstream from Bubble 3

(repressed by TFIIF) were replaced by 12 bp upstream of bubble 15 (stimulated

by TFIIF) (Fig 4A; Bubble 3 [-54-43]). The replaced upstream DNA is

underlined. Transcription from this new promoter variant was still repressed to

the same extent by TFIIF addition as compared to Bubble 3 (Fig 4B, lanes 1-4),

showing that sequence upstream of the bubble has no effect on the response to

TFIIF. To test the importance of the bubble sequence for the TFIIF response, we

replaced the single stranded Bubble 3 sequence with that of Bubble 15 (Fig 4A;

Bubble 3::15). Surprisingly, we found that transcription from this promoter

variant was slightly stimulated by TFIIF (Fig 4B, lanes 7-8). High resolution gel

analysis showed that initiation from this template used two primary start sites at


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

positions -34 and -32 and that TFIIF addition caused a strong preference for the -

32 transcription start site (Fig 4C, lanes 5,6).

Since TFIIF altered the sequence preference of Pol II at the transcription start

site, we tested the effect of changing the base at one of these TFIIF-dependent

starts. At Bubble 3, initiation is evenly distributed among 3 start sites with two

being within the single stranded bubble (Fig 4C, lane 1). Upon TFIIF addition,

transcription within the bubble is repressed while initiation within double

stranded DNA at -29G is only modestly repressed. However, if -29 G is changed

to T (a non preferred base; Bubble G -29T), the addition of TFIIF represses

nearly all transcription since there is no optimal transcription start site

remaining (Fig 4B, lanes 5-6,Fig 4C, lanes 3,4). These results show that TFIIF

imposes a strong and unexpected sequence preference on the transcription start

site.

Both sequence and distance of the bubble from TATA contributes to

the efficiency of initiation.

We next investigated why transcription initiates poorly from the bubbles located

between the mammalian initiation position and the normal HIS4 transcription

start sites (Bubbles 9-12; 42-65 bp downstream from TATA) (Fig 2A). One

possibility is that this region is at a non-optimal distance from TATA and perhaps

generates a strained, inactive open complex. Alternatively, the DNA sequence

within this region may not be a good substrate for initiation. Several promoter

variants were constructed to test these two possibilities (Fig 5A). The single

stranded region of Bubble 15 was moved 20 bp closer to TATA in two different

ways: (i) 20 bp of internal promoter sequence was deleted (Bubble 15 [Δ20]) such

that the Bubble 15 sequence was moved to the position occupied by the inactive

Bubble 10 with the sequence immediately upstream the same as in Bubble 15 and,

(ii) the Bubble 10 single stranded DNA sequence was precisely replaced by that of

Bubble 15 (Bubble 10::15). In contrast to the nearly inactive Bubble 10 template,

these two new variants promoted initiation, although with less efficiency


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

compared to Bubble 15 (Fig 5B, lanes 1,3,5). The sequence upstream of the

bubble contributed to efficiency of transcription since Bubble 15 [Δ20] was

transcribed more efficiently compared to Bubble 10::15 (Fig 5B, lanes 3,5),

although neither was transcribed as well as Bubble 15. These results show that

the sequence of the bubble is critical for transcription activity, but the position

with respect to TATA and the upstream DNA sequence can also influence

transcription efficiency. In agreement with the previous finding that sequence of

the heteroduplex region determines the responsiveness to TFIIF, transcription

from both of these new bubble variants was stimulated by TFIIF (Fig 5B, lanes

3-6), consistent with the fact that their single stranded DNA is identical with that

of Bubble 15, which is normally stimulated by TFIIF.

A single base change in the heteroduplex region alters the response to

TFIIF.

To further test the finding that DNA sequence of the bubble determines TFIIF

responsiveness, we replaced Bubble 15 sequence with that of Bubble 3 (Bubble

15::3). As predicted, transcription from this new bubble was partially repressed

by TFIIF (Fig 5B, lanes 9-10). High resolution analysis showed that TFIIF

strongly repressed initiation within the bubble, while slightly stimulating

initiation in downstream double stranded DNA, analogous to the behavior

observed with Bubble 3 (Fig 5C, lanes 1,2).

The DNA sequences of Bubbles 3 and 15 just upstream from the 3’ single-double

strand junction are: CTC (Bubble 3) and CGC (Bubble 15) where the G in Bubble

15 (+14) is the major initiation site in the presence of TFIIF. To test if this

sequence difference is responsible for the different TFIIF-response, we altered

Bubble 3 base T -32 to G (Bubble 3 T -32G; Fig 6A) and measured transcription

with and without TFIIF. In comparison to Bubble 3 where initiation within the

single stranded DNA is repressed by TFIIF, the single base change in Bubble 3

switches the response to TFIIF so that transcription from position -32 is now

stimulated by TFIIF. Combined, our results show that the sequence of the


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

heteroduplex near the single-double strand junction can have a strong influence

on the response to TFIIF.

The template strand sequence determines the response to TFIIF.

In principal, modulation of transcription by TFIIF could be in response to

changes in the template, non-template or both strands of the heteroduplex. To

test which DNA strands are responsible for the TFIIF response, four

heteroduplex variants, diagramed in Fig 6B, were tested for transcription with

and without TFIIF. All these variants were created at the site of Bubble 15 (Fig

6B). We chose the Bubble 6 sequence to pair with Bubble 15 since these two

sequences are not complimentary. Bub15/Bub15 is identical to Bubble 15 with

the wild type HIS4 sequence on the template strand (T) and identical bases on

the opposite non-template (NT) strand. The other variants have either the

Bubble 6 heteroduplex, or Bubble 15 and 6 on either the template or non-

template strands as diagramed.

Fig 6C shows that initiation from Bubble 15 at G +14 is stimulated by TFIIF, and

that this pattern is the same when Bubble 15 is only on the template strand

(Bub6/Bub15), (lanes 2,3,8,9). In contrast, initiation from the single stranded

region of Bubble 6 is repressed by TFIIF with initiation starting primarily within

the double stranded region of the promoter. This behavior is identical to that

observed when Bubble 6 is present only on the template strand (Bub15/Bub6)

(lanes 5,6,11,12). Also, note that the pattern of transcription initiation on all the

templates with Pol II alone is nearly identical, but at a lower level, compared to

that when TBP and TFIIB are also present. Therefore, Pol II has an inherent

preference for the initiation sites within the single stranded bubbles that is

enhanced by TBP and TFIIB. Together, our results demonstrate that it is the

template strand that determines that transcription initiation pattern and the

responsiveness to TFIIF.

A primary function of the TFIIB reader and linker regions is in

initiation and/or stability of DNA melting.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

The bubble templates allowed us to test the function of the TFIIB B-reader and

linker regions. Previously, it was shown that mutations in the B-reader of the

Archaeal factor TFB were suppressed to variable extents by pre opening the DNA

and that mutations in the B-linker were suppressed by Archaeal TFE, proposed to

function by stabilizing the DNA bubble (15). Several mutations were generated in

the TFIIB reader and linker regions and tested using the complete reconstituted

transcription system on double stranded DNA (Fig 7, lanes 1-5). These TFIIB

mutations resulted in little or no transcription. In contrast, all of these mutations

were almost fully suppressed by the heteroduplex templates Bubble 3 and Bubble

15 (Fig 7, lanes 6-15). The fact that transcription from these templates is

suppressed so efficiently by pre-opened DNA suggests that a primary function of

the B-reader and linker regions is in formation and/or stabilization of single

stranded DNA in the open complex state.

High resolution analysis of initiation using the reader and linker mutants shows

that they initiate from the same positions within single stranded DNA compared

to wild type TFIIB, however, they initiate poorly from double stranded DNA just

downstream from the Bubble. Transcription using the TFIIB reader mutants,

like with wild type TFIIB, is repressed by addition of TFIIF. In contrast,

transcription using the TFIIB linker mutant L110P is repressed by TFIIF for

single stranded initiation but is stimulated for initiation within downstream

double stranded DNA. This distinct behavior shows that the roles of the linker

and reader are not identical in the response to TFIIF.

Unexpected architecture of open complexes and the role of TFIIF in

TFIIB positioning

An important question is how the architecture of the open complex differs from

that of the PIC. To probe the structure of the minimal open complexes, TFIIB-

FeBABE derivatives were used to form PICs either with double stranded DNA

and the complete reconstituted system or minimal open complexes with the

bubble templates. Activation of FeBABE with H2O2 generates hydroxyl radicals

that cut polypeptides within ~30 Å and allows mapping protein-protein


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

interactions in large complexes (3, 7). Cleavage of the Pol II subunit Rpb1 was

monitored by Western blot using an antibody reactive against the N-terminus of

Rpb1. Fig 8A, lanes 2-3 shows that in the PIC, FeBABE positioned within the

TFIIB Zn ribbon at either residue 37 or 53 generates strong cleavage within the

Rpb1 active site and dock region (A/D) and within the Rpb1 clamp domain as

previously shown (2, 3). Probing open complexes formed on Bubble 3 with these

same TFIIB derivatives gives an identical pattern, showing that the position of

the Zn ribbon domain is similar in PICs and open complexes (Fig 8A, lanes 8,9).

Similarly, FeBABE positioned at TFIIB residues 67 and 118, in the B-reader and

linker regions respectively, give similar cleavage patterns in both PICs and open

complexes (Fig 8A, lanes 4,5 and 10-11) showing that the reader and linker loops

are positioned similarly in both complexes.

In contrast is cleavage generated by FeBABE linked to the TFIIB core domain at

residue 135 (green residue in Fig 8D). In fully assembled PICs, this derivative

generates strong cleavage in the Rpb1 clamp domain (Fig 8A, lane 6; blue

highlighted surface in Fig 8D) and in the fork/protrusion domain of Rpb2 (pink

surface) (2). Importantly, this strong Rpb1 cleavage is absent the open complex

(Fig 8A, lane 12). These results suggest that while the TFIIB Zn ribbon and

reader/linker regions are positioned on Pol II similarly in both the PIC and open

complexes, the position of the TFIIB core domain is very different, with the TFIIB

core domain in the minimal open complex positioned away from the Pol II wall

domain.

These mapping results suggested that one of the other general factors is

responsible for positioning the TFIIB core domain within the PIC. To test

whether TFIIF contributes to TFIIB positioning, PICs or minimal open

complexes were assembled with TFIIB-FeBABE (at residue 135) and with or

without TFIIF (Fig 8B). PICs assembled lacking TFIIF contained all added

general factors and Pol II (not shown), likely due to the high concentrations of

factors used for assembly. These incomplete PICs were not active in initiation

from double stranded DNA. Rpb1 cleavage was monitored using the antibody


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

reactive against the N-terminus of Rpb1. These results show that Rpb1 cleavage

is observed only when TFIIF is present.

To extend these findings, TFIIB derivatives with FeBABE at either residue 135 or

184 on the core domain were used to probe cleavage of Rpb2 containing a triple

Flag-tag at the C-terminus (Fig 8C, D). In complete PICs, FeBABE at residue

184 primarily cleaves the Rpb2 wall domain (brown surface in Fig 8D) while

FeBABE at 135 cleaves the fork/protrusion. Rpb2 cleavage from both these

FeBABE-labeled positions was observed only upon addition of TFIIF (Fig 8C,

lanes 2,4). Together, these results show that the TFIIB core domain is positioned

differently in the PIC and minimal open complexes, and that TFIIF is primarily

responsible for this difference.

TFIIF-dependent positioning of TFIIB contributes to repression of

open complex activity.

Since TFIIF repressed transcription from many of the bubble templates and has a

dramatic effect on the location of the TFIIB core domain, we tested if TFIIF-

dependent positioning of the core domain contributes to repression. To test this

hypothesis, the positioning of the TFIIB core needed to be unlinked from the

presence of TFIIF. Given the results presented above, we reasoned that the Zn

ribbon and possibly the reader/linker would be necessary for full activity of the

open complexes, but the TFIIB core domain would be dispensable. To generate a

construct lacking the TFIIB core domain, the N-terminus of TFIIB containing the

ribbon and reader/linker regions was fused to the N-terminus of TBP (Fig 9A).

The first 60 residues of yeast TBP is not conserved, and likely serves as a flexible

linker between the TFIIB N-terminus and the TBP conserved domain.

This recombinant factor was purified and, as expected, had no activity in the

reconstituted transcription system with double stranded DNA (not shown). In

striking contrast, the TFIIBN-TBP fusion worked nearly as well to promote

transcription from Bubble 3 as did TBP and TFIIB (Fig 9B, compare lanes 2,4).

If TFIIF-dependent positioning of the TFIIB core domain on Pol II contributes to


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

repression, then transcription using the fusion construct lacking the core domain

should be resistant to TFIIF. As predicted by this model, addition of TFIIF had

no repressive effect, in contrast to the system with TBP and TFIIB that was

repressed by TFIIF (Fig 9B, lanes 4,5). High resolution analysis showed that the

TFIIB-TBP fusion allowed initiation at the same position in the single stranded

DNA bubble as wild type factors, but the fusion was defective in promoting

initiation from downstream double stranded DNA (Fig 9C). Together, our

results suggest that positioning of the TFIIB core domain on the Pol II wall at

Bubble 3 is inhibitory to initiation.

Discussion

Although Pol II and the general transcription factors are highly conserved, there

is a clear difference in the position and mechanism of transcription start site

selection between S. cerevisiae and mammals. Here we have examined the

ability of the yeast system to initiate transcription at variable distances from

TATA using a series of pre-melted HIS4 promoters, forming minimal open

complexes with Pol II, TFIIB and TBP. We found that yeast Pol II has

remarkable flexibility in the ability to initiate transcription from these bubbles

spaced over >50 bp of promoter DNA. Within this window, we found that the

sequence of the bubble was the most important determinant of promoter activity,

but that the position of the bubble and the sequence immediately upstream of the

bubble also contributed to initiation efficiency. Activity of these templates

required only Pol II, TBP and TFIIB, the same components required for the

human system to transcribe pre-melted promoters (13, 21, 26). The most active

HIS4 promoter derivatives were those with bubbles overlapping either the

mammalian start site (~30 bp downstream of TATA) or promoters with bubbles

overlapping the normal HIS4 start sites (~70 bp downstream). However, bubbles

of appropriate sequence positioned between these two optimal locations did

support initiation, although less efficiently.

An unexpected finding was that TFIIF could modulate the activity of the minimal

open complexes. At most bubble derivatives, TFIIF repressed initiation within


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

the single stranded region, while permitting initiation 2-4 bp downstream of the

bubble when an appropriate sequence was present. In contrast, bubbles

surrounding the normal HIS4 start sites were either slightly stimulated by TFIIF

or were insensitive to its presence. Surprisingly, we found that the response to

TFIIF was mediated by the sequence of the bubble. For example, replacing

Bubble 3 (repressed by TFIIF and overlapping the mammalian start site) with the

Bubble 15 sequence (stimulated by TFIIF and located at the yeast start site)

created a promoter that was stimulated by TFIIF, but initiated transcription close

to the mammalian start site. Conversely, replacing Bubble 15 with the Bubble 3

sequence gave a promoter that initiated far from TATA and was repressed by

TFIIF. Additional experiments showed that the sequence of the single stranded

template strand, within a few bases upstream of the single-double strand

junction, can determine whether an open complex is repressed or stimulated by

TFIIF (Fig 6A). What sequence feature of the heteroduplex region dictates the

response to TFIIF? Heteroduplex templates that are not repressed by TFIIF tend

to have some A/T character at the 5’ end of the bubble and G/C at the 3’ end,

while bubbles repressed by TFIIF tend to have G/C spread throughout the bubble

sequence. Heteroduplex regions that do not work as efficient promoters are very

A/T-rich (Bubbles 9, 10, 12).

Combined, our results show that the HIS4 promoter sequence is optimized to

direct initiation from the in vivo initiation region located ~60-80 bp from TATA.

Pol II, attempting to initiate at the mammalian position, would presumably be

inhibited by TFIIF. Further, the sequence of HIS4 ~40-60 bp downstream from

TATA does not support initiation when single stranded. However, there must be

additional control over transcription start site selection. Positioning an active

initiator (the Bubble 15 sequence) 30 bp downstream from TATA in double

stranded DNA does not allow initiation (JF, not shown). Consistent with this,

insertion of the strong SNR14 initiator at variable distances from the HIS4 TATA,

shows that transcription cannot initiate closer than ~50 bp from TATA (SH, not

shown). Thus, there are at least two levels of control that dictate the


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

transcription start site in the yeast system, (i) the promoter sequence, and (ii) an

inherent property of Pol II and/or the general factors.

The complete purified transcription system also allowed us to test the function of

the TFIIB reader and linker regions. B-Linker mutations were found to block

transcription from double stranded DNA in the yeast and archaeal systems and

archaeal TFB linker mutants were rescued by pre-melting promoter DNA (15).

Here, we found that mutations in the TFIIB linker could also be rescued by pre-

melting the DNA, as transcription from both Bubbles 3 and 15 occurred at near

normal levels using the TFIIB L110P reader mutant. Similarly, three B-reader

mutants were nearly inactive on double stranded DNA but were rescued by pre-

melted promoter DNA. The B-reader was previously known to be critical for

TFIIB function and to assist in transcription start site selection (1, 15, 22, 26, 27).

Together, our new results show that both the B-reader and linker regions play a

major role in melting and/or stabilization of the melted DNA in the open

complex; detrimental effects of the TFIIB mutations on transcription of double

stranded DNA are almost completely reversed at heteroduplex promoters.

Finally, the minimal open complex system allowed us to probe the architecture of

these complexes compared to PICs. Although the TFIIB ribbon, reader and

linker regions were positioned similarly in PICs and open complexes, there was a

striking difference in the position of the TFIIB core domain in the two complexes.

In PICs, the TFIIB core domain binds the Pol II wall, while this TFIIB domain is

positioned away from the wall in the minimal open complex containing TBP,

TFIIB, Pol II and the heteroduplex bubble. Addition of TFIIF caused a shift in

positioning of the TFIIB core domain to the location on the Pol II wall observed

in PICs, and this occurred at both Bubbles 3 and 15. We found that eliminating

the TFIIB core domain also eliminated the ability of TFIIF to repress

transcription at Bubble 3, showing that repositioning TFIIB contributes to

repression of transcription by TFIIF. These results give a different model for the

architecture of the open complex state compared to previous proposals based on

merging models for the PIC and the Pol II elongation complex (Fig 10) (15, 19).


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

In the previous models, positioning of the TFIIB core domain on Pol II results in

a sharp bend in the template strand, 14 bp upstream from the transcription start

site, at the junction of single and double stranded DNA. In contrast,

repositioning the TFIIB core domain away from Pol II would eliminate this bend

and the presumed resulting strain on the stability of the complex.

To develop a working model for the architecture of the TFIIF-containing open

complexes, we need to account for the findings that TFIIF does not repress all

minimal open complexes. Recall that open complexes formed on Bubble 15 were

slightly stimulated by TFIIF, while at the same time, TFIIF caused repositioning

of the TFIIB core on Bubble 15 (Fig 8B). One model consistent with our data is

that TFIIF, either directly or indirectly, can “read” the sequence of the single

stranded template strand and help position this DNA within Pol II in an active

and/or stable state. By this model, stable positioning of the Bubble 15 template

strand would be assisted by TFIIF. In contrast, when TFIIF is added to open

complexes that are repressed by TFIIF (e.g., Bubble 3) the resulting bend in the

template strand, caused by binding of TFIIB to the Pol II wall, may pull the DNA

into a non functional position leading to repression of initiation. From modeling

of the PIC and the structure of the TFIIB-Pol II complex, we know that the TFIIB

B-reader and linker as well as the unstructured linker in the TIIF small subunit

are close to or within the Pol II active site cleft (9, 15, 19). In future work to test

this model, it will be informative to probe protein-DNA contacts between the

single stranded bubble, TFIIB, TFIIF and Pol II to more precisely determine the

path of single stranded DNA in both active and inactive minimal complexes and

to probe for direct interactions between TFIIB, TFIIF and promoter DNA.

Acknowledgements

We thank Hung-Ta Chen for initial design of the heteroduplex bubble strategy,

Bruce Knutson for sequence analysis, Patrick Cramer for communication of an

RNA Pol II purification method, and members of the Hahn lab for advice and


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

comments on the manuscript. This work was supported by grant GM053451

from the National Institutes of Health.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

References

1. Bangur, C. S., T. S. Pardee, and A. S. Ponticelli. 1997. Mutational analysis of the D1/E1 core helices and the conserved N-terminal region of yeast transcription factor IIB (TFIIB): identification of an N-terminal mutant that stabilizes TBP-TFIIB-DNA complexes. Mol. Cell. Biol. 17:6784-6793.

2. Chen, H.-T., and S. Hahn. 2004. Mapping the location of TFIIB within the RNA Polymerase II transcription preinitiation complex: A model for the structure of the PIC. Cell 119:169-180.

3. Chen, H. T., and S. Hahn. 2003. Binding of TFIIB to RNA polymerase II: Mapping the binding site for the TFIIB zinc ribbon domain within the preinitiation complex. Mol Cell 12:437-447.

4. Chen, H. T., L. Warfield, and S. Hahn. 2007. The positions of TFIIF and TFIIE in the RNA polymerase II transcription preinitiation complex. Nat Struct Mol Biol 14:696-703.

5. Chen, Z. A., A. Jawhari, L. Fischer, C. Buchen, S. Tahir, T. Kamenski, M. Rasmussen, L. Lariviere, J. C. Bukowski-Wills, M. Nilges, P. Cramer, and J. Rappsilber. 2010. Architecture of the RNA polymerase II-TFIIF complex revealed by cross-linking and mass spectrometry. EMBO J 29:717-726.

6. Cramer, P., K. J. Armache, S. Baumli, S. Benkert, F. Brueckner, C. Buchen, G. E. Damsma, S. Dengl, S. R. Geiger, A. J. Jasiak, A. Jawhari, S. Jennebach, T. Kamenski, H. Kettenberger, C. D. Kuhn, E. Lehmann, K. Leike, J. F. Sydow, and A. Vannini. 2008. Structure of eukaryotic RNA polymerases. Annu Rev Biophys 37:337-352.

7. Datwyler, S. A., and C. F. Meares. 2000. Protein-protein interactions mapped by artificial proteases: where sigma factors bind to RNA polymerase. Trends Biochem Sci 25:408-414.

8. Dvir, A., K. P. Garrett, C. chault, J.-M. Egly, J. W. Conaway, and R. C. Conaway. 1996. A role for ATP and TFIIH in activation of the RNA polymerase II preinitiation complex prior to transcription initiation. J. Biol. Chem. 271:7245-7248.

9. Eichner, J., H. T. Chen, L. Warfield, and S. Hahn. 2010. Position of the general transcription factor TFIIF within the RNA polymerase II transcription preinitiation complex. EMBO J 29:706-716.

10. Giardina, C., and J. T. Lis. 1993. DNA melting on yeast RNA polymerase II promoters. Science 261:759-762.

11. Hahn, S. 2004. Structure and mechanism of the RNA polymerase II transcription machinery. Nat Struct Mol Biol 11:394-403.

12. Hahn, S., and E. T. Young. 2011. Transcriptional regulation in S. cerevisiae: transcription factor regulation and function, mechanisms of initiation, and roles of activators and coactivators. submitted.

13. Holstege, F. C., P. C. van der Vliet, and H. T. Timmers. 1996. Opening of an RNA polymerase II promoter occurs in two distinct steps and requires the basal transcription factors IIE and IIH. Embo J 15:1666-1677.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

14. Holstege, F. C. P., U. Fiedler, and H. T. M. Timmers. 1997. Three transitions in the RNA polymerase II transcription complex during initiation. EMBO J. 16:7468-7480.

15. Kostrewa, D., M. E. Zeller, K.-J. Armache, M. Seizl, K. Leike, M. Thomm, and P. Cramer. 2009. Structure of the RNA polymerase II-TFIIB complex and the mechanism of transcription initiation. Nature 462:323-330.

16. Kuehner, J. N., and D. A. Brow. 2006. Quantitative analysis of in vivo initiator selection by yeast RNA polymerase II supports a scanning model. J Biol Chem 281:14119-14128.

17. Lane, W. J., and S. A. Darst. 2010. Molecular evolution of multisubunit RNA polymerases: structural analysis. J Mol Biol 395:686-704.

18. Li, Y., P. M. Flanagan, H. Tschochner, and R. D. Kornberg. 1994. RNA polymerase II initiation factor interactions and transcription start site selection. Science 263:805-807.

19. Liu, X., D. A. Bushnell, D. Wang, G. Calero, and R. D. Kornberg. 2010. Structure of an RNA polymerase II-TFIIB complex and the transcription initiation mechanism. Science 327:206-209.

20. Miller, G., and S. Hahn. 2006. A DNA-tethered cleavage probe reveals the path for promoter DNA in the yeast preinitiation complex. Nat Struct Mol Biol 13:603-610.

21. Pan, G., and J. Greenblatt. 1994. Initiation of transcription by RNA Polymerase II is limited by melting of the promoter DNA in the region immediately upstream of the initiation site. J. Biol. Chem. 269:30101-30104.

22. Pinto, I., W.-H. Wu, J. G. Na, and M. Hampsey. 1994. Characterization of sua7 mutations defines a domain of TFIIB involved in transcription start site selection in yeast. J. Biol. Chem. 269:30569-30573.

23. Ranish, J. A., N. Yudkovsky, and S. Hahn. 1999. Intermediates in formation and activity of the RNA polymerase II preinitiation complex: holoenzyme recruitment and a postrecruitment role for the TATA box and TFIIB. Genes Dev 13:49-63.

24. Saecker, R. M., M. T. Record, Jr., and P. L. Dehaseth. 2011. Mechanism of Bacterial Transcription Initiation: RNA Polymerase - Promoter Binding, Isomerization to Initiation-Competent Open Complexes, and Initiation of RNA Synthesis. J Mol Biol.

25. Thomas, M. C., and C. M. Chiang. 2006. The general transcription machinery and general cofactors. Crit Rev Biochem Mol Biol 41:105-178.

26. Thompson, N. E., B. T. Glaser, K. M. Foley, Z. F. Burton, and R. R. Burgess. 2009. Minimal promoter systems reveal the importance of conserved residues in the B-finger of human transcription factor IIB. J Biol Chem 284:24754-24766.

27. Tran, K., and J. D. Gralla. 2008. Control of the timing of promoter escape and RNA catalysis by the transcription factor IIb fingertip. J Biol Chem 283:15665-15671.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

28. Wang, W., M. Carey, and J. D. Gralla. 1992. Polymerase II promoter activation: closed complex formation and ATP-driven start site opening. Science 255:450-453.

29. Werner, F., and D. Grohmann. 2010. Evolution of RNA polymerases in the three domains of life. Nat Rev Micro submitted.

30. Yan, M., and J. D. Gralla. 1997. Multiple ATP-dependent steps in RNA polymerase II promoter melting and intiiation. EMBO J. 16:Not available.

31. Zhang, Z., and F. S. Dietrich. 2005. Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33:2838-2851.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Figure legends

Figure 1. Great flexibility in the location of active minimal open complexes

using S. cerevisiae Pol II, TBP, and TFIIB. (A) The location of heteroduplex

bubbles generated at the HIS4 promoter. Bubbles 3 and 15, at the theoretical

human and measured yeast transcription start sites respectively, are highlighted

in green. The location of initiation typically found at human TATA-containing

promoters is indicated by a blue arrow, and corresponding blue base. The yeast

in vitro transcription start sites are indicated by red arrows and red bases in the

HIS4 sequence. (B) In vitro transcription from HIS4 comparing VP16-activated

nuclear extract (lane 1) and all basal purified factors including TFIIF, TFIIE and

TFIIH (lane 3). Transcription was visualized using primer extension. ATP or

ATPγS, along with all other nucleotides, was added where indicated. Unless

otherwise specified, NTPs were added for 3 min in all transcription reactions.

Lanes 5-14 used the heteroduplex bubble templates with addition of factors as

indicated. (C) Transcription from Bubble 15 and 3 templates as above, but also

containing TFIIF, TFIIE, and TFIIH as indicated. All reactions contained ATP

unless otherwise specified. Differences in primer extension product length are

due to the distance of the initiation site to the downstream primer. For each

bubble template, relative RNA levels are indicated, where the level observed with

TBP/TFIIB/Pol II is set to 1.0.

Figure 2. Open complex activity and the response to TFIIF at heteroduplex

bubbles spanning the HIS4 promoter. (A) In vitro transcription, visualized using

primer extension, from 10 heteroduplex bubbles with Pol II alone, or

TBP/TFIIB/Pol II (minimal open complexes) with or without added TFIIF. For

each bubble template, relative RNA levels are indicated, where the level observed

with TBP/TFIIB/Pol II is set to 1.0. (B) High resolution analysis of initiation

from Bubbles 3 and 15. The complement of the template strand sequence of the

HIS4 promoter derivatives are shown (analogous to the RNA sequence) with the

region of heteroduplex DNA indicated by brackets and the major sites of

initiation highlighted in red. The non-template strand sequence within the


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

bubble is identical to the template strand to prevent annealing. Sequences are

numbered relative to the most upstream S. cerevisiae HIS4 start site (Fig 1). Size

standards GA and AC are modified Maxam-Gilbert sequencing reactions using a

DNA fragment from the HIS4 promoter that was amplified using the same

primer used in RNA primer extension analysis.

Figure 3. TFIIF represses transcription initiation activity of the open complex.

In vitro transcription from Bubbles 3 and 15 by minimal open complexes with or

without TFIIF, was initiated with limiting nucleotides for 30 min. An α32P

labeled nucleotide (UTP, Bubble 3; GTP, Bubble 15) was included in all reactions

and used to visualize the short mRNA products. The position of DNA standards

of 5, 10, and 15 nucleotide lengths are indicated.

Figure 4. The sequence of Bubble 3 determines the response to TFIIF. (A)

Sequence of the HIS4 promoter and Bubble 3 variants. Highlighted are the TATA

box in red, hypothetical human transcription start site position in green, S.

cerevisiae start sites in red, with locations of the bubbles boxed in black. [-55 to -

43] replaces DNA upstream of Bubble 3 with the underlined DNA upstream from

Bubble 15; Bubble 3::15 replaces Bubble 3 sequence with Bubble 15 and [G -29T]

changes an initiating nucleotide downstream of the bubble (indicated with an

arrow) to a non preferred base (B) In vitro transcription from Bubble 3 and

variants using Pol II, TBP and TFIIB. TFIIF was added as indicated.

Transcription visualized by primer extension. For each bubble template, relative

RNA levels are indicated, where the level observed with TBP/TFIIB/Pol II is set

to 1.0. (C) High resolution analysis of initiation from Bubble 3 and two variants.

The complement of the template strand sequence of Bubble 3 is shown on the

left, and annotated as in Fig. 2B. At right is the sequence for the Bubble 3::15

promoter. The bubble location (brackets) and major start sites (red) are

indicated. GA is a DNA sequencing reaction size standard as described in Fig 2.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Figure 5. Promoter sequence and spacing affect initiation efficiency and the

response to TFIIF. (A) Sequence of the HIS4 variants. Highlighted are the TATA

box in red, human transcription start site position in green, S. cerevisiae start

sites in red, and locations of the bubbles are boxed in black. (B) In vitro

transcription from Bubble 15 and variants using Pol II, TBP and TFIIB. TFIIF

was added as indicated. For each bubble template, relative RNA levels are

indicated, where the level observed with TBP/TFIIB/Pol II is set to 1.0; ND = not

determined. Differences in primer extension product length are due to the

distance of the initiation site from the downstream primer. (C) High resolution

analysis of initiation from Bubble 15 and two variants. The complement of the

template strand sequence of Bubble 15 is shown at right, and annotated as in Fig.

2B. On the left is the sequence for the Bubble15::3 template. The bubble location

and major start sites are highlighted in red. GA is a DNA sequencing reaction

size standard as described in Fig 2.

Figure 6. Sequence of the template strand dictates the TFIIF response and the

transcription start site. (A) High resolution analysis of initiation from Bubble 3

and a variant promoter. The variant promoter contains a single nucleotide

change at position -32. The complement of the template strand sequences are

shown. TFIIF was added as indicated. GA is a DNA sequencing reaction size

standard as described in Fig 2. (B) Diagram showing Bubble 15 and three variant

heteroduplex promoters. All four bubbles are located at the site of Bubble 15 (Fig

1), with the variants possessing the template (T) and/or non- template (NT)

strand sequence from the Bubble 6 heteroduplex as indicated. (C) Initiation

from Bubble 15 and variants by minimal open complexes with and without IIF.

The complement of the template strand from wild type HIS4 at Bubble 15 is

shown at left, and the analogous sequence of Bubble 6 at right

Figure 7. TFIIB B-reader and linker mutants are active in minimal open

complexes. (A) In vitro transcription comparing wild type TFIIB with B-

reader/linker mutants. Transcription utilizing a complete purified transcription

system on double stranded (DS) HIS4 (lanes 2-5), or minimal open complexes


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

(Pol II, TBP, TFIIB) transcribing Bubble 3 (lanes 6-10) or Bubble 15 (lanes 11-15).

For each promoter, relative RNA levels are indicated, where the level observed

with TBP/TFIIB/Pol II (bubble templates) or with the complete set of factors (DS

templates) is set to 1.0. (B) High resolution analysis of initiation by minimal

open complexes, with and without TFIIF, comparing wild type TFIIB (lanes 1 and

2) with B-reader/linker mutants (lanes 3-10) from the Bubble 3 promoter. The

promoter sequence, major start sites, bubble location, and size standards are

labeled as in Fig 2.

Figure 8. TFIIF positions the TFIIB core domain in the open complex. (A)

TFIIB derivatives were conjugated to FeBABE at the indicated cysteine residues,

and assembled in PICs on a duplex HIS4 promoter (lanes 1-6) or in minimal open

complexes on the Bubble 3 promoter (lanes 7-12). Hydroxyl radical cleavage was

monitored by Western blot probed with an antibody reactive to the N-terminus of

Rpb1. Reproducible cleavage products are indicated by red asterisks, and are

located in the active center and dock regions (A/D), and Rpb1 clamp. (B) TFIIB

with FeBABE linked to residue 135 was used to form PICs on duplex HIS4 DNA

(lanes 1 and 2), or minimal open complexes on Bubble 3 (lanes 3 and 4) or

Bubble 15 (lanes 5 and 6). TFIIF was added where indicated, and cleavage of

Rpb1 was monitored as in (A). (C) TFIIB-FeBABE derivatives were assembled in

PICs on a duplex HIS4 promoter with or without IIF as indicated. Hydroxyl

radical cleavage of C-terminally Flag-tagged Rpb2 was monitored by Western

blot, and was observed in the fork/protrusion (F/P) and wall domains. (D) A

model for the position of the TFIIB core on Pol II is shown (9, 15). Cleavage (3) is

shown in the Rpb2 protrusion (magenta) and Rpb1 clamp domain (blue) from

TFIIB 135-FeBABE (green spheres). Also shown is the area of cleavage in the

wall domain of Rpb2 (brown) from TFIIB 184-FeBABE (red spheres).

Figure 9. The TFIIB core domain is required for repression of open complexes

by TFIIF (A) Schematic diagram of full length TBP, TFIIB, and the IIBN-TBP

fusion protein. (B) In vitro transcription from the Bubble 3 promoter by Pol II

alone (lane 1), Pol II plus the IIBN-TBP fusion protein (lanes 2 and 3), or Pol II


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

plus TBP and TFIIB (lanes 4 and 5). TFIIF was added to the reactions as

indicated. Relative RNA levels are indicated, where the level observed with

TBP/TFIIB/Pol II is set to 1.0. (C) High resolution analysis of initiation from

reactions as in (B). The promoter sequence, major start sites, bubble location,

and size standards are annotated as in Figure 2.

Figure 10. Model for the active form of the minimal open complex at Bubble 3.

The top panel shows a model for the minimal open complex in which the TFIIB

core domain has been displaced from the Rpb2 wall domain, eliminating the

sharp bend in the template strand DNA (Blue) at the junction of double and

single stranded DNA. Non-template strand (pink), TBP (green) and TFIIB

(yellow) are shown. Bottom panel shows a model for the minimal open complex

proposed by Cramer and colleagues (15) with the addition of TFIIF (Tfg1, orange;

Tfg2 red) (9).


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

1 1 2 3 architecture of the yeast rna polymerase ii open complex

Documents