1 1 2 vidjaya letchoumy premkumara, stacey cranerta, benjamin r
TRANSCRIPT
1
THE 3’ OVERHANGS AT TETRAHYMENA TELOMERES ARE PACKAGED BY FOUR PROTEINS: POT1a, TPT1, PAT1 AND PAT2 1
2
Vidjaya Letchoumy Premkumara, Stacey Cranert
a, Benjamin R. Linger
a,*, Gregg B. Morin
b, Sasha Minium
a, 3
Carolyn Pricea,#
4
5
aDepartment of Cancer Biology, University of Cincinnati, OH 45267, USA.
bMichael Smith Genome 6
Sciences Centre, British Columbia Cancer Agency, Vancouver, British Columbia V5Z 1L3, Canada, and 7
Department of Medical Genetics, University of British Columbia, Vancouver, British Columbia V6T 1Z3, 8
Canada. 9
10
Running Head: Pat2 is a component of the Pot1a telomere complex 11
12
#Address correspondence to Carolyn Price, [email protected] 13
14
*Present address, Department of Chemistry, Indiana Wesleyan University, Marion, IN 46953, USA, 15
16
EC Accepts, published online ahead of print on 2 December 2013Eukaryotic Cell doi:10.1128/EC.00275-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
2
ABSTRACT 17
Although studies with the ciliate Tetrahymena thermophila have played a central role in advancing our 18
understanding of telomere biology and telomerase mechanism and composition, the full complement of 19
Tetrahymena telomere proteins has not yet been identified. Previously we demonstrated that in 20
Tetrahymena, the telomeric 3’ overhang is protected by a three protein complex composed of Pot1a, 21
Tpt1 and Pat1. Here we show that that Tpt1 and Pat1 associate with a fourth protein, Pat2 (Pot1 22
associated in Tetrahymena 2). Mass spectrometry of proteins co-purifying with Pat1 or Tpt1 identified 23
peptides from Pat2, Pot1a, Tpt1 and Pat1. The lack of other proteins co-purifying with Pat1 or Tpt1 24
implies that the overhang is protected by a four protein Pot1a-Tpt1-Pat1-Pat2 complex. We verified that 25
Pat2 localizes to telomeres but we were unable to detect direct binding to telomeric DNA. Cells depleted 26
of Pat2 continue to divide but the telomeres exhibit gradual shortening. The lack of growth arrest 27
indicates that, in contrast to Pot1a and Tpt1, Pat2 is not required to sequester the telomere from the 28
DNA repair machinery. Instead, Pat2 is needed to regulate telomere length most likely by acting in 29
conjunction with Pat1 to allow telomerase access to the telomere. 30
31
INTRODUCTION 32
Telomere proteins are essential for genome stability because they sequester the DNA terminus 33
from unwanted DNA repair reactions that lead to end-to-end fusion of chromosomes (1, 2). They also 34
function in telomere replication by aiding passage of the replication fork through the telomeric duplex 35
DNA and by regulating access of enzymes such as telomerase, that are needed to replicate the extreme 36
DNA terminus (3). Telomeric DNA generally consists of tandem repeats of a simple G-C rich sequence 37
that extends to form an overhang on the 3’ G-rich strand. In mammals and fission yeast, the telomeric 38
DNA is protected by a multi-subunit protein complex (shelterin) that contains both telomere duplex and 39
3’ overhang binding proteins in addition to various linker subunits (4, 5). In other organisms such as S. 40
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
3
cerevisiae, the telomere duplex and 3’ overhang are protected by separate, but closely cooperating, 41
complexes (6, 7). 42
The telomere proteins that bind the 3’ overhang (e.g. POT1-TPP1 in vertebrates and Cdc13-Stn1-43
Ten1 in budding yeast) have several important roles (3, 4). First, they exclude replication protein A (RPA) 44
from the overhang thus preventing recruitment of ATR and activation of a DNA damage response (8-10). 45
Second, they engage with telomerase and DNA polymerase ɲ (pol ɲ) to regulate replication of the DNA 46
terminus (11-13). During telomere replication, telomerase compensates for the inability of DNA 47
polymerase to fully replicate the chromosome 5’ end by adding additional DNA to the 3’ overhang. The 48
extended overhang is then partially filled in through the action of pol ɲ (3, 14, 15). In mammalian cells, 49
the overhang binding protein POT1 and its partner subunit TPP1 have opposing effects on telomerase: 50
POT1 excludes telomerase from the overhang while TPP1 recruits telomerase and enhances telomerase 51
processivity (16-18). In budding yeast, Cdc13 anchors and activates telomerase at the overhang while 52
Cdc13 and Stn1 appear to mediate subsequent fill-in synthesis of the C-strand by pol ɲ (12, 13, 19-21). 53
Ciliated protozoa have played an important role in our understanding of telomere biology 54
because these organisms have an unusual genomic organization that results in each cell containing 55
thousands of telomeres and an abundance of telomerase (22). The ciliate Tetrahymena thermophila has 56
been a particularly valuable player because it is amenable to both genetic manipulation and biochemical 57
analysis (23, 24). As a result, the composition and function of Tetrahymena telomerase subunits are well 58
characterized and studies with the Tetrahymena enzyme continue to establish paradigms for the 59
enzymatic mechanism (25-29). 60
Tetrahymena cells contain two types of nuclei, the germline micronucleus and the 61
transcriptionally active macronucleus (30). The micronucleus is diploid and contains five chromosomes 62
with telomeres >2.5 kb in length (31). The macronucleus is polyploid and is formed from a copy of the 63
micronucleus during sexual reproduction. As part of this process, the micronuclear chromosomes are 64
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
4
subdivided into smaller pieces, telomeres are added to the new DNA termini and the resulting 65
macronuclear chromosomes are subject to endoreduplication (22). The outcome is ∼20,000 66
macronuclear chromosomes of which ∼9,000 comprise an rDNA minichromosome of 21 Kb (32). The 67
telomeres on macronuclear chromosomes consist of 250-350 bp T2G4.C4A2 repeats that terminate in a 3’ 68
G-strand overhang of ∼14 or 20 nt (33). The telomere is packaged into a non-nucleosomal DNA protein 69
complex however the protein components of the complex are only partially characterized (34). 70
We previously identified the 3’-overhang binding protein Pot1a based on sequence identity to 71
Oxytricha nova TEBPɲ and human POT1 (35). We then identified two proteins, Tpt1 and Pat1, that 72
associate with Pot1a (36). Neither Tpt1 nor Pat1 bind DNA directly. Tpt1 interacts with Pot1a and 73
appears to be the Tetrahymena ortholog of human TPP1, S. pombe Tpz1 or Oxytricha TEBPɴ. The Pot1a-74
Tpt1 dimer is important for telomere protection and negative regulation of telomerase action as even 75
partial depletion of either Pot1a or Tpt1 results in cell cycle arrest and rapid telomere elongation. Pat1 76
interacts with Tpt1 to form a Pot1a-Tpt1-Pat1 complex. Pat1 is a unique protein that appears to be 77
required for telomerase to gain access to the DNA terminus since depletion of Pat1 causes gradual 78
telomere shortening without affecting telomerase levels (36). Here we report the identification of a 79
fourth component of the G-overhang binding complex, Pat2 (Pot-associated Tetrahymena 2) which also 80
appears to facilitate telomerase action at the chromosome terminus. 81
82
MATERIALS AND METHODS 83
Tetrahymena growth and transformation ̘ 84
Tetrahymena thermophila cells were grown in 1.5× PPYS medium at 30°C as previously described (33). 85
The TAP-Tpt1 and TAP-Pat1 cells were described previously (36). In each cell line, the endogenous TPT1 86
or PAT1 promoter and 5’ coding sequence is replaced by the cadmium inducible MTT1 promoter and 87
sequence encoding a 6-His motif followed by two protein A motifs, a TEV cleavage site and the start of 88
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
5
the Tpt1 or Pat1 coding sequence. Cells expressing Pat2-FLAG-His and TAP-tagged Pat2 were generated 89
using biolistic transformation to introduce a gene replacement construct into the native PAT2 gene locus 90
(Figure 1). The FLAG-His tag encodes a FLAG peptide followed by six histidines. The TAP tag encodes six 91
histidines followed by two protein A motifs and a TEV cleavage site. To allow selection for clones with 92
gene replacement, the gene replacement construct contained the Neo3 cassette which encodes the 93
NEO1 gene driven by the MTT1 promoter (37). Cells were selected with paromomycin in the presence of 94
2 ʅg/ml CdCl2 to obtain full gene replacement. Clones were checked at regular intervals to ensure they 95
retained the full gene replacement and had not reverted to wild type (Supplemental Fig. 2A). In each 96
case, the residual WT band remained at <5% of that seen in control cells indicating that it corresponded 97
to signal from the micronuclear gene. To obtain growth curves, the culture was adjusted regularly to 98
keep the cells in log phase (<2x105 cells/ml). 99
100
Mass Spectrometry 101
Nuclear extracts were prepared from TAP-Pat1, TAP-Tpt1 and WT cells as previously described (36). 102
Briefly, nuclei (chromatin) were isolated from cells expressing the TAP-tagged protein and extracted 103
with 20 mM Tris pH 7.5, 200 mM NaCl, 1.5 mM MgCl2 plus protease inhibitors for 1 hr at 4°C. The 104
clarified supernatant was incubated with IgG Sepharose for 1 hr at 4°C, the beads were washed and 105
protein complexes released from the beads by digestion with TEV protease. Samples were precipitated 106
with TCA, separated by SDS-PAGE and visualized by colloidal Coomassie staining. The entire lane was 107
excised and divided into 16 pieces, and prepared for MS by in-gel reduction, alkylation and trypsin 108
digestion. The eluted samples were analyzed by reverse-phase nano-electrospray tandem MS as 109
described (38). Spectra from the gel slices were searched against tryptic peptides predicted from the 110
Tetrahymena genome as described (36). 111
112
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
6
Immunoprecipitation and Chromatin immunoprecipitation (ChIP) 113
Co-immunoprecipitation studies were performed as described (36). Nuclear extracts from Pat2-FLAG-His 114
cells were prepared as described above except salt was added to 300 mM NaCl. The clarified extracts 115
were incubated with Ni-Sepharose beads (GE-Healthcare), washed with 20 mM Tris ph7.5, 300 mM 116
NaCl, 1.5 mM MgCl2 plus 8 or 40 mM imidazole. Proteins were released by boiling in SDS PAGE sample 117
buffer. MNase digestion was performed on clarified extracts prior to addition of the Ni-Sepharose 118
beads. Samples were incubated at 30°C for 30 min with 180 units MNase per ml extract. Co-purifying 119
Tpt1 and Pat1 were identified by western blots using previously generated antibodies (36). For ChIP 120
analysis, cells were fixed with formaldehyde, the DNA sheared, and the soluble chromatin fraction was 121
prepared as previously described (35). Precipitation was performed for 1 h at 4°C with IgG Sepharose for 122
TAP-Pat2, M2 anti-FLAG resin for Pat2-FLAG-His or with antibody and protein A Sepharose for 123
endogenous proteins. Precipitates were washed sequentially with RIPA buffer, high salt solution and LiCl 124
solution (35). DNA was isolated from the precipitate using Chelex resin (Chelex® 100 from BioRad) (39). 125
50 ʅl of 10% Chelex slurry in ddH20 was added to the washed beads and boiled for 10 min, the 126
suspension was allowed to cool, Proteinase K (100ug/ml) was added and the sample incubated for 30 127
min at 55°C with shaking. Samples were boiled again for 10 min, centrifuged and the supernatant 128
collected. The residual Chelex/IgG Sepharose/Protein A bead fraction was then re-extracted with 50 ʅl 129
water, centrifuged and the first and second supernatants were combined. The supernatant was used 130
directly as a template in real-time qPCR using the Int and Tel primers. Real time was performed using 131
SYBR® Advantage® qPCR Premix from Clontech. Conditions for PCR were as follows; 95°C for 2 min, 132
followed by 40 cycles of 95°C for 15sec, 55°C for 20 sec, 72°C for 30 sec. Primers were against the 26S 133
rRNA subtelomeric sequence (GAACTTCAATCTTTGACTAGC and 134
AATTTCTTTGACATTGAGTAAAAGTTATTTATT) or internal, non-subtelomeric sequence 135
(TGAAATTGCAAGGTAGGTTTC and CATAGTTACTCCCGCCGTT). 136
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
7
137
Telomere length analysis 138
Telomere length was determined by Southern hybridization to HindIII-digested genomic DNA using a 139
subtelomeric probe to the rDNA telomere (40). 140
141
RESULTS AND DISCUSSION 142
Identification of Pat2 143
In the original experiments designed to identify Pot1a interaction partners, we used mass 144
spectrometry (MS) to identify proteins that co-purified with TAP-tagged Pot1a. Based on peptide 145
abundance and percent of gene coverage, Tpt1 and Pat1 were the most obvious candidates. To 146
determine whether the Pot1a-Tpt1-Pat1 complex contains additional proteins, we repeated the analysis 147
with tagged Tpt1 and Pat1. Nuclear extracts were prepared from wild type cells, cells expressing TAP-148
Tpt1 or TAP-Pat1 and the tagged Tpt1 or Pat1 were purified on IgG Sepharose. Bound proteins were 149
released by digestion with TEV protease and analyzed by MS (36). Peptides were compared to the 150
predicted Tetrahymena thermophila proteome. MS was performed on two independent samples from 151
TAP-Tpt1, TAP-Pat1 and WT cells. Proteins identified in the WT control sample were subtracted from the 152
TAP-Tpt1 and TAP-Pat1 samples. 153
The MS analysis of each TAP-Tpt1 or TAP-Pat1 sample consistently identified peptides from 154
Tpt1, Pat1, Pot1a and a new protein since named Pat2 (Pot1a-associated Tetrahymena 2) (Supplemental 155
Tables 1 and 2). Multiple unique peptides were identified for each protein with 9-28 Pat2 peptides 156
identified in the four samples analyzed. RT-PCR was then used to identify the full cDNA sequence of Pat2 157
(Supplemental Fig. 1). The predicted protein has a molecular weight of 69 kDa. It was striking that no 158
other Tetrahymena proteins consistently co-purified with both TAP-Tpt1 and TAP-Pat1 and the peptide 159
coverage of the remaining proteins identified by MS was substantially lower than that observed for Pat2 160
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
8
(Supplemental Table. 2). This finding suggests that the proteins present at the 3’ overhangs of 161
Tetrahymena telomeres exist in a four-protein complex consisting of Pot1a, Tpt1, Pat1 and Pat2. 162
163
Verification that Pat2 is a telomere protein 164
To confirm that Pat2 is a telomere protein, we sought to verify the interaction with Tpt1 and 165
Pat1 and to demonstrate localization to telomeres. To achieve this, we generated cell lines that 166
expressed FLAG-His or TAP-tagged versions of Pat2 (Fig. 1). Cells expressing Pat2-FLAG-His were 167
generated by gene targeting using a construct that placed sequence encoding the tag in frame with the 168
3’ coding sequence (Fig. 1A panel I). These cells retained the endogenous promoter. Cells expressing 169
TAP-Pat2 had the endogenous promoter replaced by the cadmium-inducible MTT1 promoter and a 6-170
His, two Protein A tag was added to the 5’ coding sequence (Fig. 1A panel III). Following selection in 171
paromomycin, cells with full replacement of the endogenous gene were obtained for both the 5’ and 3’ 172
tagged alleles (Fig. 1B) indicating that the tags did not interfere with protein function. Moreover, the 173
gene replacements were stable during growth in the absence of drug with the residual WT band 174
remaining at <5% of that seen in control cells, indicating that it corresponded to signal from the 175
micronuclear gene (Supplemental Fig. 2A and data not shown). 176
We verified that Pat2 is present in complexes with Tpt1 and Pat1 through pull-down 177
experiments using nuclear extracts from Pat2-FLAG-His expressing cells. The Pat2 was bound to Ni-178
Sepharose beads and co-purifying proteins identified by Western blot (Fig. 2A). Tpt1 and Pat1 both co-179
purified with Pat2. To ensure that the interaction with Tpt1 and Pat1 was not mediated through DNA or 180
RNA, control samples were treated with micrococcal nuclease before application to the Ni-Sepharose. 181
This treatment did not disrupt the interaction indicating that Tpt1 and Pat1 are present in a complex 182
with Pat2. 183
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
9
To test for telomere localization, we performed ChIP with Pat2-FLAG-His and TAP-Pat2 cells. The 184
cells were cross-linked with formaldehyde, sonicated and Pat2-associated chromatin was isolated with 185
agarose-linked anti-FLAG antibody or IgG sepharose. Telomere association was monitored by real time 186
PCR using primers corresponding either to a region immediately adjacent to the rDNA telomere or to an 187
internal region of the rDNA (Fig. 2B). A preferential enrichment of telomeric over non-telomeric DNA 188
was observed with both the anti-FLAG resin and the IgG Sepharose (Fig. 2B panels II and III). The 189
enrichment was particularly apparent with the TAP-Pat2 cells grown with cadmium and it was lost if the 190
cells were grown without cadmium to repress TAP-Pat2 expression (see below). We therefore conclude 191
that Pat2 is a telomere protein. 192
While sequence analysis of Pat2 failed to reveal orthologous proteins in other organisms, 193
analysis using secondary structure prediction and structure threading programs suggested a high alpha 194
helical content with a possible myb motif in the N-terminus. Since myb-repeats are characteristic of 195
proteins that bind the telomere duplex, we expressed Pat2 in E. coli and tested whether the purified 196
protein bound telomeric DNA. However, we were unable to detect significant binding to either single-197
stranded or double-stranded DNA (data not shown). This finding indicates that Pat2 resembles Pat1 and 198
Tpt1 in that it associates with the telomeric 3’ overhang via Pot1a. It further suggests that the 3’ 199
overhang-binding complex may be physically separate from any complex that binds to the telomere 200
duplex DNA. 201
202
Depletion of Pat2 leads to gradual telomere shortening 203
To assess the effects of Pat2 removal from the telomere, we initially attempted to generate cells 204
with a disruption of the PAT2 gene. We were only able to obtain 80-90% gene replacement suggesting 205
that Pat2 is essential (Supplemental Fig. 2B). Nonetheless, analysis of telomere length in the knockdown 206
cells revealed slight telomere shortening (Supplemental Fig. 2C). We next examined the effect of Pat2 207
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
10
depletion using the conditional TAP-Pat2 cell line. Cells were kept in continuous culture +/- cadmium for 208
up to 15 days and monitored for changes in growth rate or telomere length. Pat2 depletion did not 209
cause a noticeable change in growth rate (Fig. 3A). However Southern blot analysis of telomeric 210
restriction fragments revealed a gradual telomere shortening during the first ∼10 days in culture (Fig. 211
3B). The length shortened from 350-400 bp to about 150 bp and then stabilized. The rate and extent of 212
telomere shortening was similar to that previously observed after conditional depletion of either Pat1 or 213
TERT (36). When Pat1 and TERT conditional cells are grown without cadmium, telomere length gradually 214
declines and then stabilizes due to partial re-activation of the MTT1 promoter in cells with short 215
telomeres and the resulting re-expression of Pat1 or TERT. When we examined PAT2 mRNA levels by RT-216
PCR, we did not see significant reactivation of the MTT1 promoter in TAP-Pat2 cells grown without 217
cadmium. However, repression of TAP-Pat2 expression was incomplete and a low level of PAT2 mRNA 218
remained throughout the experiment (Supplemental Fig. 2D). This residual Pat2 expression likely 219
explains why TAP-Pat2 cells grown without cadmium fail to show a growth defect despite the essential 220
nature of the PAT2 gene. 221
The lack of rapid growth arrest and the gradual nature of the telomere shortening seen after 222
Pat2 depletion indicates that Pat2 is probably not required to protect the telomere from degradation or 223
DNA repair activities (35, 36). Thus, this function seems to be reserved for Pot1a-Tpt1. The similarity in 224
the rate and extent of telomere shortening seen after Pat2 (Fig. 3) and TERT (36) depletion instead 225
suggests that Pat2 is needed for telomerase to add repeats to the chromosome terminus. Since Pat1 loss 226
also causes gradual telomere shortening, it remained possible that Pat2 depletion has an indirect effect 227
on telomere length by causing Pat1 to dissociate from the telomere. To test for this scenario, we 228
performed ChIP with Tap-Pat2 cells grown +/- cadmium using antibodies to Pat1 and Tpt1. As shown in 229
Fig 2C, association of Pat1 and Tpt1 with telomeres was unaffected by Pat2 depletion. Thus, it appears 230
that Pat2 regulates telomerase action on the chromosome end. Pat1 may also regulate telomerase but 231
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
11
an alternative possibility is that the telomere shortening seen after Pat1 depletion occurs because the 232
loss of Pat1 causes Pat2 to dissociate from the telomere. 233
Overall our results indicate that the 3’ overhangs of Tetrahymena telomeres are packaged by a 234
four protein complex containing Pot1a, Tpt1, Pat1 and Pat2. Previous studies indicate that the complex 235
is anchored to the overhang via Pot1a, the Pot1a-Tpt1 dimer serves to prevent the overhang from 236
activating a DNA damage response and it limits extension of the overhang by telomerase. In contrast, 237
Pat1 and Pat2 are needed for telomerase to maintain telomere length. Currently it is unclear how Pat1 238
and Pat2 facilitate telomerase action. However, one possibility is that they coordinate removal of Pot1a 239
with telomerase binding to ensure that the overhang is always protected by one or other complex. The 240
Tetrahymena telomerase holoenzyme binds to the overhang through an OB fold-containing subunit 241
Teb1 that also serves as a processivity factor (25, 41). Since most Tetrahymena 3’ overhangs are 14 or 20 242
nt in length and both Pot1a and Teb1 require at least two T2G4 repeats for high affinity binding (42) 243
(Linger and Price unpublished results), it is unlikely that Pot1a and Teb1/telomerase can bind the 244
overhang concurrently. 245
246
ACKNOWLEDGMENTS 247
We thank Wanda Manieri for antibody production and Rebecca Lindhorst for purification of 248
recombinant Pat2. This work was supported by National Institutes of Health (NIH) grant GM088728 (to 249
CMP) and by the BC Cancer Foundation (to GBM). BRL was supported by NIH grant T32 CA117846 and 250
SC by NIH grant T32 ES007250. 251
252
REFERENCES 253
1. Murnane JP. 2012. Telomere dysfunction and chromosome instability. Mutat Res 730:28-36. 254
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
12
2. O'Sullivan RJ, Karlseder J. 2010. Telomeres: protecting chromosomes against genome 255
instability. Nat Rev Mol Cell Biol 11:171-181. 256
3. Stewart JA, Chaiken MF, Wang F, Price CM. 2012. Maintaining the end: roles of telomere 257
proteins in end-protection, telomere replication and length regulation. Mutat Res 730:12-19. 258
4. Palm W, de Lange T. 2008. How shelterin protects mammalian telomeres. Annu Rev Genet 259
42:301-334. 260
5. Dehe PM, Cooper JP. 2010. Fission yeast telomeres forecast the end of the crisis. FEBS Lett 261
584:3725-3733. 262
6. Wellinger RJ, Zakian VA. 2012. Everything you ever wanted to know about Saccharomyces 263
cerevisiae telomeres: beginning to end. Genetics 191:1073-1105. 264
7. Giraud-Panis MJ, Teixeira MT, Geli V, Gilson E. 2010. CST meets shelterin to keep telomeres in 265
check. Mol Cell 39:665-676. 266
8. Denchi EL, de Lange T. 2007. Protection of telomeres through independent control of ATM and 267
ATR by TRF2 and POT1. Nature 448:1068-1071. 268
9. Churikov D, Price CM. 2008. Pot1 and cell cycle progression cooperate in telomere length 269
regulation. Nature structural & molecular biology 15:79-84. 270
10. Ribeyre C, Shore D. 2012. Anticheckpoint pathways at telomeres in yeast. Nature structural & 271
molecular biology 19:307-313. 272
11. Zaug AJ, Podell ER, Nandakumar J, Cech TR. 2010. Functional interaction between telomere 273
protein TPP1 and telomerase. Genes & development 24:613-622. 274
12. Churikov D, Corda Y, Luciano P, Geli V. 2013. Cdc13 at a crossroads of telomerase action. Front 275
Oncol 3:39. 276
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
13
13. Qi H, Zakian VA. 2000. The Saccharomyces telomere-binding protein Cdc13p interacts with both 277
the catalytic subunit of DNA polymerase alpha and the telomerase-associated est1 protein. 278
Genes & development 14:1777-1788. 279
14. Zhao Y, Sfeir AJ, Zou Y, Buseman CM, Chow TT, Shay JW, Wright WE. 2009. Telomere extension 280
occurs at most chromosome ends and is uncoupled from fill-in in human cancer cells. Cell 281
138:463-475. 282
15. Wang F, Stewart JA, Kasbek C, Zhao Y, Wright WE, Price CM. 2012. Human CST has 283
independent functions during telomere duplex replication and C-strand fill-in. Cell reports 284
2:1096-1103. 285
16. Nandakumar J, Bell CF, Weidenfeld I, Zaug AJ, Leinwand LA, Cech TR. 2012. The TEL patch of 286
telomere protein TPP1 mediates telomerase recruitment and processivity. Nature 492:285-289. 287
17. Latrick CM, Cech TR. 2010. POT1-TPP1 enhances telomerase processivity by slowing primer 288
dissociation and aiding translocation. The EMBO journal 29:924-933. 289
18. Wang F, Podell ER, Zaug AJ, Yang Y, Baciu P, Cech TR, Lei M. 2007. The POT1-TPP1 telomere 290
complex is a telomerase processivity factor. Nature 445:506-510. 291
19. Evans SK, Lundblad V. 1999. Est1 and Cdc13 as comediators of telomerase access. Science 292
286:117-120. 293
20. Taggart AK, Teng SC, Zakian VA. 2002. Est1p as a cell cycle-regulated activator of telomere-294
bound telomerase. Science 297:1023-1026. 295
21. Puglisi A, Bianchi A, Lemmens L, Damay P, Shore D. 2008. Distinct roles for yeast Stn1 in 296
telomere capping and telomerase inhibition. The EMBO journal 27:2328-2339. 297
22. Jahn CL, Klobutcher LA. 2002. Genome remodeling in ciliated protozoa. Annu Rev Microbiol 298
56:489-520. 299
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
14
23. Eisen JA, Coyne RS, Wu M, Wu D, Thiagarajan M, Wortman JR, Badger JH, Ren Q, Amedeo P, 300
Jones KM, Tallon LJ, Delcher AL, Salzberg SL, Silva JC, Haas BJ, Majoros WH, Farzad M, Carlton 301
JM, Smith RK, Jr., Garg J, Pearlman RE, Karrer KM, Sun L, Manning G, Elde NC, Turkewitz AP, 302
Asai DJ, Wilkes DE, Wang Y, Cai H, Collins K, Stewart BA, Lee SR, Wilamowska K, Weinberg Z, 303
Ruzzo WL, Wloga D, Gaertig J, Frankel J, Tsao CC, Gorovsky MA, Keeling PJ, Waller RF, Patron 304
NJ, Cherry JM, Stover NA, Krieger CJ, del Toro C, Ryder HF, Williamson SC, Barbeau RA, 305
Hamilton EP, Orias E. 2006. Macronuclear genome sequence of the ciliate Tetrahymena 306
thermophila, a model eukaryote. PLoS biology 4:e286. 307
24. Turkewitz AP, Orias E, Kapler G. 2002. Functional genomics: the coming of age for Tetrahymena 308
thermophila. Trends in genetics : TIG 18:35-40. 309
25. Zeng Z, Min B, Huang J, Hong K, Yang Y, Collins K, Lei M. 2011. Structural basis for Tetrahymena 310
telomerase processivity factor Teb1 binding to single-stranded telomeric-repeat DNA. 311
Proceedings of the National Academy of Sciences of the United States of America 108:20357-312
20361. 313
26. Hong K, Upton H, Miracco EJ, Jiang J, Zhou ZH, Feigon J, Collins K. 2013. Tetrahymena 314
Telomerase Holoenzyme Assembly, Activation, and Inhibition by Domains of the p50 Central 315
Hub. Molecular and cellular biology 33:3962-3971. 316
27. Jacobs SA, Podell ER, Cech TR. 2006. Crystal structure of the essential N-terminal domain of 317
telomerase reverse transcriptase. Nature structural & molecular biology 13:218-225. 318
28. Jiang J, Miracco EJ, Hong K, Eckert B, Chan H, Cash DD, Min B, Zhou ZH, Collins K, Feigon J. 319
2013. The architecture of Tetrahymena telomerase holoenzyme. Nature 496:187-192. 320
29. Berman AJ, Gooding AR, Cech TR. 2010. Tetrahymena telomerase protein p65 induces 321
conformational changes throughout telomerase RNA (TER) and rescues telomerase reverse 322
transcriptase and TER assembly mutants. Molecular and cellular biology 30:4965-4976. 323
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
15
30. Karrer KM. 2000. Tetrahymena genetics: two nuclei are better than one. Methods in cell biology 324
62:127-186. 325
31. Kirk KE, Blackburn EH. 1995. An unusual sequence arrangement in the telomeres of the germ-326
line micronucleus in Tetrahymena thermophila. Genes & development 9:59-71. 327
32. Kapler GM. 1993. Developmentally regulated processing and replication of the Tetrahymena 328
rDNA minichromosome. Current opinion in genetics & development 3:730-735. 329
33. Jacob NK, Skopp R, Price CM. 2001. G-overhang dynamics at Tetrahymena telomeres. The 330
EMBO journal 20:4299-4308. 331
34. Cohen P, Blackburn EH. 1998. Two types of telomeric chromatin in Tetrahymena thermophila. 332
Journal of molecular biology 280:327-344. 333
35. Jacob NK, Lescasse R, Linger BR, Price CM. 2007. Tetrahymena POT1a regulates telomere length 334
and prevents activation of a cell cycle checkpoint. Molecular and cellular biology 27:1592-1601. 335
36. Linger BR, Morin GB, Price CM. 2011. The Pot1a-associated proteins Tpt1 and Pat1 coordinate 336
telomere protection and length regulation in Tetrahymena. Molecular biology of the cell 337
22:4161-4170. 338
37. Shang Y, Song X, Bowen J, Corstanje R, Gao Y, Gaertig J, Gorovsky MA. 2002. A robust 339
inducible-repressible promoter greatly facilitates gene knockouts, conditional expression, and 340
overexpression of homologous and heterologous genes in Tetrahymena thermophila. 341
Proceedings of the National Academy of Sciences of the United States of America 99:3734-3739. 342
38. Mead CL, Kuzyk MA, Moradian A, Wilson GM, Holt RA, Morin GB. 2010. Cytosolic protein 343
interactions of the schizophrenia susceptibility gene dysbindin. Journal of neurochemistry 344
113:1491-1503. 345
39. Nelson JD, Denisenko O, Sova P, Bomsztyk K. 2006. Fast chromatin immunoprecipitation assay. 346
Nucleic acids research 34:e2. 347
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
16
40. Jacob NK, Stout AR, Price CM. 2004. Modulation of telomere length dynamics by the 348
subtelomeric region of tetrahymena telomeres. Molecular biology of the cell 15:3719-3728. 349
41. Min B, Collins K. 2009. An RPA-related sequence-specific DNA-binding subunit of telomerase 350
holoenzyme is required for elongation processivity and telomere maintenance. Mol Cell 36:609-351
619. 352
42. Min B, Collins K. 2010. Multiple mechanisms for elongation processivity within the reconstituted 353
tetrahymena telomerase holoenzyme. The Journal of biological chemistry 285:16434-16443. 354
355
FIGURE LEGENDS 356
Figure 1. Generation of cell lines with PAT2 gene replacement. (A) Gene targeting strategy used to make 357
cells expressing FLAG-His (panel I) or TAP-tagged Pat2 (panel III). Gene targeting constructs were 358
recombined into the native gene locus (panel II). Dotted lines, recombination arms; black bars, Southern 359
blot probes; E, EcoRV restriction sites. (B) Southern blots of EcoRV-digested genomic DNA from clones 360
showing full replacement of the endogenous PAT2 gene with the PAT2-FLAG-HIS (panel I) or TAP-PAT2 361
(panel II) allele. Bands from endogenous gene (4.7 kb), PAT2-FLAG-HIS (7 kb) and TAP-PAT2 (8.2 kb) 362
alleles are marked. *, cross-reacting band. Lanes 3-5 in panel I and lanes 5-6 in panel II represent 363
different clones. 364
365
Figure 2. Pat2 interacts with Tpt1 and Pat1 and localizes to telomeres. (A) Western blots showing co-366
purification of Tpt1 and Pat1 with Pat2 on Ni-Sepharose beads. Nuclear extracts were made from WT or 367
Pat2-FLAG-His cells Lanes 2-3 and 5-6 are from duplicate immunoprecipitation reactions. Panel II; 368
nuclear extracts from Pat2-FLAG-His cells were treated with MNase prior to addition of the beads. (B) 369
ChIP analysis to showing Pat2 presence at telomeres. (I) Schematic showing positions of real time PCR 370
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from
17
primers on the rDNA chromosome. (II-III) Results of real time PCR analysis with ChIP samples from Pat2-371
FLAG-His or TAP-Pat2 cells. (II) Chromatin from Pat2-FLAG-His cells precipitated with anti-FLAG agarose. 372
N = 2 experiments, error bars indicate min and max. (III) Chromatin from TAP-Pat2 cells grown +/- 373
cadmium for 3 days and precipitated with IgG Sepharose. N = 3 experiments, error bars indicate SEM. (C) 374
ChIP analysis showing that Pat1 and Tpt1 association with the telomere are unaffected by Pat2 removal. 375
Chromatin from TAP-Pat2 cells grown for 3 days +/- cadmium was precipitated with antibody to Pat1 (I) 376
or Tpt1 (II). N = 3 experiments, error bars indicate SEM. 377
378
Figure 3. Effect of Pat2 depletion on growth rate and telomere length. (A) Growth curves for TAP-Pat2 379
cells grown +/- cadmium. Results are the average of two experiments. (B) Southern blots showing the 380
length of rDNA telomeres from TAP-Pat2 cells grown +/- cadmium for 1-15 days 381
382
on March 31, 2018 by guest
http://ec.asm.org/
Dow
nloaded from