1

THE 3’ OVERHANGS AT TETRAHYMENA TELOMERES ARE PACKAGED BY FOUR PROTEINS: POT1a, TPT1, PAT1 AND PAT2 1

2

Vidjaya Letchoumy Premkumara, Stacey Cranert

a, Benjamin R. Linger

a,*, Gregg B. Morin

b, Sasha Minium

a, 3

Carolyn Pricea,#

4

5

aDepartment of Cancer Biology, University of Cincinnati, OH 45267, USA.

bMichael Smith Genome 6

Sciences Centre, British Columbia Cancer Agency, Vancouver, British Columbia V5Z 1L3, Canada, and 7

Department of Medical Genetics, University of British Columbia, Vancouver, British Columbia V6T 1Z3, 8

Canada. 9

10

Running Head: Pat2 is a component of the Pot1a telomere complex 11

12

#Address correspondence to Carolyn Price, Carolyn.price@uc.edu 13

14

*Present address, Department of Chemistry, Indiana Wesleyan University, Marion, IN 46953, USA, 15

16

EC Accepts, published online ahead of print on 2 December 2013Eukaryotic Cell doi:10.1128/EC.00275-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

2

ABSTRACT 17

Although studies with the ciliate Tetrahymena thermophila have played a central role in advancing our 18

understanding of telomere biology and telomerase mechanism and composition, the full complement of 19

Tetrahymena telomere proteins has not yet been identified. Previously we demonstrated that in 20

Tetrahymena, the telomeric 3’ overhang is protected by a three protein complex composed of Pot1a, 21

Tpt1 and Pat1. Here we show that that Tpt1 and Pat1 associate with a fourth protein, Pat2 (Pot1 22

associated in Tetrahymena 2). Mass spectrometry of proteins co-purifying with Pat1 or Tpt1 identified 23

peptides from Pat2, Pot1a, Tpt1 and Pat1. The lack of other proteins co-purifying with Pat1 or Tpt1 24

implies that the overhang is protected by a four protein Pot1a-Tpt1-Pat1-Pat2 complex. We verified that 25

Pat2 localizes to telomeres but we were unable to detect direct binding to telomeric DNA. Cells depleted 26

of Pat2 continue to divide but the telomeres exhibit gradual shortening. The lack of growth arrest 27

indicates that, in contrast to Pot1a and Tpt1, Pat2 is not required to sequester the telomere from the 28

DNA repair machinery. Instead, Pat2 is needed to regulate telomere length most likely by acting in 29

conjunction with Pat1 to allow telomerase access to the telomere. 30

31

INTRODUCTION 32

Telomere proteins are essential for genome stability because they sequester the DNA terminus 33

from unwanted DNA repair reactions that lead to end-to-end fusion of chromosomes (1, 2). They also 34

function in telomere replication by aiding passage of the replication fork through the telomeric duplex 35

DNA and by regulating access of enzymes such as telomerase, that are needed to replicate the extreme 36

DNA terminus (3). Telomeric DNA generally consists of tandem repeats of a simple G-C rich sequence 37

that extends to form an overhang on the 3’ G-rich strand. In mammals and fission yeast, the telomeric 38

DNA is protected by a multi-subunit protein complex (shelterin) that contains both telomere duplex and 39

3’ overhang binding proteins in addition to various linker subunits (4, 5). In other organisms such as S. 40

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

3

cerevisiae, the telomere duplex and 3’ overhang are protected by separate, but closely cooperating, 41

complexes (6, 7). 42

The telomere proteins that bind the 3’ overhang (e.g. POT1-TPP1 in vertebrates and Cdc13-Stn1-43

Ten1 in budding yeast) have several important roles (3, 4). First, they exclude replication protein A (RPA) 44

from the overhang thus preventing recruitment of ATR and activation of a DNA damage response (8-10). 45

Second, they engage with telomerase and DNA polymerase ɲ (pol ɲ) to regulate replication of the DNA 46

terminus (11-13). During telomere replication, telomerase compensates for the inability of DNA 47

polymerase to fully replicate the chromosome 5’ end by adding additional DNA to the 3’ overhang. The 48

extended overhang is then partially filled in through the action of pol ɲ (3, 14, 15). In mammalian cells, 49

the overhang binding protein POT1 and its partner subunit TPP1 have opposing effects on telomerase: 50

POT1 excludes telomerase from the overhang while TPP1 recruits telomerase and enhances telomerase 51

processivity (16-18). In budding yeast, Cdc13 anchors and activates telomerase at the overhang while 52

Cdc13 and Stn1 appear to mediate subsequent fill-in synthesis of the C-strand by pol ɲ (12, 13, 19-21). 53

Ciliated protozoa have played an important role in our understanding of telomere biology 54

because these organisms have an unusual genomic organization that results in each cell containing 55

thousands of telomeres and an abundance of telomerase (22). The ciliate Tetrahymena thermophila has 56

been a particularly valuable player because it is amenable to both genetic manipulation and biochemical 57

analysis (23, 24). As a result, the composition and function of Tetrahymena telomerase subunits are well 58

characterized and studies with the Tetrahymena enzyme continue to establish paradigms for the 59

enzymatic mechanism (25-29). 60

Tetrahymena cells contain two types of nuclei, the germline micronucleus and the 61

transcriptionally active macronucleus (30). The micronucleus is diploid and contains five chromosomes 62

with telomeres >2.5 kb in length (31). The macronucleus is polyploid and is formed from a copy of the 63

micronucleus during sexual reproduction. As part of this process, the micronuclear chromosomes are 64

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

4

subdivided into smaller pieces, telomeres are added to the new DNA termini and the resulting 65

macronuclear chromosomes are subject to endoreduplication (22). The outcome is ∼20,000 66

macronuclear chromosomes of which ∼9,000 comprise an rDNA minichromosome of 21 Kb (32). The 67

telomeres on macronuclear chromosomes consist of 250-350 bp T2G4.C4A2 repeats that terminate in a 3’ 68

G-strand overhang of ∼14 or 20 nt (33). The telomere is packaged into a non-nucleosomal DNA protein 69

complex however the protein components of the complex are only partially characterized (34). 70

We previously identified the 3’-overhang binding protein Pot1a based on sequence identity to 71

Oxytricha nova TEBPɲ and human POT1 (35). We then identified two proteins, Tpt1 and Pat1, that 72

associate with Pot1a (36). Neither Tpt1 nor Pat1 bind DNA directly. Tpt1 interacts with Pot1a and 73

appears to be the Tetrahymena ortholog of human TPP1, S. pombe Tpz1 or Oxytricha TEBPɴ. The Pot1a-74

Tpt1 dimer is important for telomere protection and negative regulation of telomerase action as even 75

partial depletion of either Pot1a or Tpt1 results in cell cycle arrest and rapid telomere elongation. Pat1 76

interacts with Tpt1 to form a Pot1a-Tpt1-Pat1 complex. Pat1 is a unique protein that appears to be 77

required for telomerase to gain access to the DNA terminus since depletion of Pat1 causes gradual 78

telomere shortening without affecting telomerase levels (36). Here we report the identification of a 79

fourth component of the G-overhang binding complex, Pat2 (Pot-associated Tetrahymena 2) which also 80

appears to facilitate telomerase action at the chromosome terminus. 81

82

MATERIALS AND METHODS 83

Tetrahymena growth and transformation ̘ 84

Tetrahymena thermophila cells were grown in 1.5× PPYS medium at 30°C as previously described (33). 85

The TAP-Tpt1 and TAP-Pat1 cells were described previously (36). In each cell line, the endogenous TPT1 86

or PAT1 promoter and 5’ coding sequence is replaced by the cadmium inducible MTT1 promoter and 87

sequence encoding a 6-His motif followed by two protein A motifs, a TEV cleavage site and the start of 88

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

5

the Tpt1 or Pat1 coding sequence. Cells expressing Pat2-FLAG-His and TAP-tagged Pat2 were generated 89

using biolistic transformation to introduce a gene replacement construct into the native PAT2 gene locus 90

(Figure 1). The FLAG-His tag encodes a FLAG peptide followed by six histidines. The TAP tag encodes six 91

histidines followed by two protein A motifs and a TEV cleavage site. To allow selection for clones with 92

gene replacement, the gene replacement construct contained the Neo3 cassette which encodes the 93

NEO1 gene driven by the MTT1 promoter (37). Cells were selected with paromomycin in the presence of 94

2 ʅg/ml CdCl2 to obtain full gene replacement. Clones were checked at regular intervals to ensure they 95

retained the full gene replacement and had not reverted to wild type (Supplemental Fig. 2A). In each 96

case, the residual WT band remained at <5% of that seen in control cells indicating that it corresponded 97

to signal from the micronuclear gene. To obtain growth curves, the culture was adjusted regularly to 98

keep the cells in log phase (<2x105 cells/ml). 99

100

Mass Spectrometry 101

Nuclear extracts were prepared from TAP-Pat1, TAP-Tpt1 and WT cells as previously described (36). 102

Briefly, nuclei (chromatin) were isolated from cells expressing the TAP-tagged protein and extracted 103

with 20 mM Tris pH 7.5, 200 mM NaCl, 1.5 mM MgCl2 plus protease inhibitors for 1 hr at 4°C. The 104

clarified supernatant was incubated with IgG Sepharose for 1 hr at 4°C, the beads were washed and 105

protein complexes released from the beads by digestion with TEV protease. Samples were precipitated 106

with TCA, separated by SDS-PAGE and visualized by colloidal Coomassie staining. The entire lane was 107

excised and divided into 16 pieces, and prepared for MS by in-gel reduction, alkylation and trypsin 108

digestion. The eluted samples were analyzed by reverse-phase nano-electrospray tandem MS as 109

described (38). Spectra from the gel slices were searched against tryptic peptides predicted from the 110

Tetrahymena genome as described (36). 111

112

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

6

Immunoprecipitation and Chromatin immunoprecipitation (ChIP) 113

Co-immunoprecipitation studies were performed as described (36). Nuclear extracts from Pat2-FLAG-His 114

cells were prepared as described above except salt was added to 300 mM NaCl. The clarified extracts 115

were incubated with Ni-Sepharose beads (GE-Healthcare), washed with 20 mM Tris ph7.5, 300 mM 116

NaCl, 1.5 mM MgCl2 plus 8 or 40 mM imidazole. Proteins were released by boiling in SDS PAGE sample 117

buffer. MNase digestion was performed on clarified extracts prior to addition of the Ni-Sepharose 118

beads. Samples were incubated at 30°C for 30 min with 180 units MNase per ml extract. Co-purifying 119

Tpt1 and Pat1 were identified by western blots using previously generated antibodies (36). For ChIP 120

analysis, cells were fixed with formaldehyde, the DNA sheared, and the soluble chromatin fraction was 121

prepared as previously described (35). Precipitation was performed for 1 h at 4°C with IgG Sepharose for 122

TAP-Pat2, M2 anti-FLAG resin for Pat2-FLAG-His or with antibody and protein A Sepharose for 123

endogenous proteins. Precipitates were washed sequentially with RIPA buffer, high salt solution and LiCl 124

solution (35). DNA was isolated from the precipitate using Chelex resin (Chelex® 100 from BioRad) (39). 125

50 ʅl of 10% Chelex slurry in ddH20 was added to the washed beads and boiled for 10 min, the 126

suspension was allowed to cool, Proteinase K (100ug/ml) was added and the sample incubated for 30 127

min at 55°C with shaking. Samples were boiled again for 10 min, centrifuged and the supernatant 128

collected. The residual Chelex/IgG Sepharose/Protein A bead fraction was then re-extracted with 50 ʅl 129

water, centrifuged and the first and second supernatants were combined. The supernatant was used 130

directly as a template in real-time qPCR using the Int and Tel primers. Real time was performed using 131

SYBR® Advantage® qPCR Premix from Clontech. Conditions for PCR were as follows; 95°C for 2 min, 132

followed by 40 cycles of 95°C for 15sec, 55°C for 20 sec, 72°C for 30 sec. Primers were against the 26S 133

rRNA subtelomeric sequence (GAACTTCAATCTTTGACTAGC and 134

AATTTCTTTGACATTGAGTAAAAGTTATTTATT) or internal, non-subtelomeric sequence 135

(TGAAATTGCAAGGTAGGTTTC and CATAGTTACTCCCGCCGTT). 136

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

7

137

Telomere length analysis 138

Telomere length was determined by Southern hybridization to HindIII-digested genomic DNA using a 139

subtelomeric probe to the rDNA telomere (40). 140

141

RESULTS AND DISCUSSION 142

Identification of Pat2 143

In the original experiments designed to identify Pot1a interaction partners, we used mass 144

spectrometry (MS) to identify proteins that co-purified with TAP-tagged Pot1a. Based on peptide 145

abundance and percent of gene coverage, Tpt1 and Pat1 were the most obvious candidates. To 146

determine whether the Pot1a-Tpt1-Pat1 complex contains additional proteins, we repeated the analysis 147

with tagged Tpt1 and Pat1. Nuclear extracts were prepared from wild type cells, cells expressing TAP-148

Tpt1 or TAP-Pat1 and the tagged Tpt1 or Pat1 were purified on IgG Sepharose. Bound proteins were 149

released by digestion with TEV protease and analyzed by MS (36). Peptides were compared to the 150

predicted Tetrahymena thermophila proteome. MS was performed on two independent samples from 151

TAP-Tpt1, TAP-Pat1 and WT cells. Proteins identified in the WT control sample were subtracted from the 152

TAP-Tpt1 and TAP-Pat1 samples. 153

The MS analysis of each TAP-Tpt1 or TAP-Pat1 sample consistently identified peptides from 154

Tpt1, Pat1, Pot1a and a new protein since named Pat2 (Pot1a-associated Tetrahymena 2) (Supplemental 155

Tables 1 and 2). Multiple unique peptides were identified for each protein with 9-28 Pat2 peptides 156

identified in the four samples analyzed. RT-PCR was then used to identify the full cDNA sequence of Pat2 157

(Supplemental Fig. 1). The predicted protein has a molecular weight of 69 kDa. It was striking that no 158

other Tetrahymena proteins consistently co-purified with both TAP-Tpt1 and TAP-Pat1 and the peptide 159

coverage of the remaining proteins identified by MS was substantially lower than that observed for Pat2 160

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

8

(Supplemental Table. 2). This finding suggests that the proteins present at the 3’ overhangs of 161

Tetrahymena telomeres exist in a four-protein complex consisting of Pot1a, Tpt1, Pat1 and Pat2. 162

163

Verification that Pat2 is a telomere protein 164

To confirm that Pat2 is a telomere protein, we sought to verify the interaction with Tpt1 and 165

Pat1 and to demonstrate localization to telomeres. To achieve this, we generated cell lines that 166

expressed FLAG-His or TAP-tagged versions of Pat2 (Fig. 1). Cells expressing Pat2-FLAG-His were 167

generated by gene targeting using a construct that placed sequence encoding the tag in frame with the 168

3’ coding sequence (Fig. 1A panel I). These cells retained the endogenous promoter. Cells expressing 169

TAP-Pat2 had the endogenous promoter replaced by the cadmium-inducible MTT1 promoter and a 6-170

His, two Protein A tag was added to the 5’ coding sequence (Fig. 1A panel III). Following selection in 171

paromomycin, cells with full replacement of the endogenous gene were obtained for both the 5’ and 3’ 172

tagged alleles (Fig. 1B) indicating that the tags did not interfere with protein function. Moreover, the 173

gene replacements were stable during growth in the absence of drug with the residual WT band 174

remaining at <5% of that seen in control cells, indicating that it corresponded to signal from the 175

micronuclear gene (Supplemental Fig. 2A and data not shown). 176

We verified that Pat2 is present in complexes with Tpt1 and Pat1 through pull-down 177

experiments using nuclear extracts from Pat2-FLAG-His expressing cells. The Pat2 was bound to Ni-178

Sepharose beads and co-purifying proteins identified by Western blot (Fig. 2A). Tpt1 and Pat1 both co-179

purified with Pat2. To ensure that the interaction with Tpt1 and Pat1 was not mediated through DNA or 180

RNA, control samples were treated with micrococcal nuclease before application to the Ni-Sepharose. 181

This treatment did not disrupt the interaction indicating that Tpt1 and Pat1 are present in a complex 182

with Pat2. 183

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

9

To test for telomere localization, we performed ChIP with Pat2-FLAG-His and TAP-Pat2 cells. The 184

cells were cross-linked with formaldehyde, sonicated and Pat2-associated chromatin was isolated with 185

agarose-linked anti-FLAG antibody or IgG sepharose. Telomere association was monitored by real time 186

PCR using primers corresponding either to a region immediately adjacent to the rDNA telomere or to an 187

internal region of the rDNA (Fig. 2B). A preferential enrichment of telomeric over non-telomeric DNA 188

was observed with both the anti-FLAG resin and the IgG Sepharose (Fig. 2B panels II and III). The 189

enrichment was particularly apparent with the TAP-Pat2 cells grown with cadmium and it was lost if the 190

cells were grown without cadmium to repress TAP-Pat2 expression (see below). We therefore conclude 191

that Pat2 is a telomere protein. 192

While sequence analysis of Pat2 failed to reveal orthologous proteins in other organisms, 193

analysis using secondary structure prediction and structure threading programs suggested a high alpha 194

helical content with a possible myb motif in the N-terminus. Since myb-repeats are characteristic of 195

proteins that bind the telomere duplex, we expressed Pat2 in E. coli and tested whether the purified 196

protein bound telomeric DNA. However, we were unable to detect significant binding to either single-197

stranded or double-stranded DNA (data not shown). This finding indicates that Pat2 resembles Pat1 and 198

Tpt1 in that it associates with the telomeric 3’ overhang via Pot1a. It further suggests that the 3’ 199

overhang-binding complex may be physically separate from any complex that binds to the telomere 200

duplex DNA. 201

202

Depletion of Pat2 leads to gradual telomere shortening 203

To assess the effects of Pat2 removal from the telomere, we initially attempted to generate cells 204

with a disruption of the PAT2 gene. We were only able to obtain 80-90% gene replacement suggesting 205

that Pat2 is essential (Supplemental Fig. 2B). Nonetheless, analysis of telomere length in the knockdown 206

cells revealed slight telomere shortening (Supplemental Fig. 2C). We next examined the effect of Pat2 207

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

10

depletion using the conditional TAP-Pat2 cell line. Cells were kept in continuous culture +/- cadmium for 208

up to 15 days and monitored for changes in growth rate or telomere length. Pat2 depletion did not 209

cause a noticeable change in growth rate (Fig. 3A). However Southern blot analysis of telomeric 210

restriction fragments revealed a gradual telomere shortening during the first ∼10 days in culture (Fig. 211

3B). The length shortened from 350-400 bp to about 150 bp and then stabilized. The rate and extent of 212

telomere shortening was similar to that previously observed after conditional depletion of either Pat1 or 213

TERT (36). When Pat1 and TERT conditional cells are grown without cadmium, telomere length gradually 214

declines and then stabilizes due to partial re-activation of the MTT1 promoter in cells with short 215

telomeres and the resulting re-expression of Pat1 or TERT. When we examined PAT2 mRNA levels by RT-216

PCR, we did not see significant reactivation of the MTT1 promoter in TAP-Pat2 cells grown without 217

cadmium. However, repression of TAP-Pat2 expression was incomplete and a low level of PAT2 mRNA 218

remained throughout the experiment (Supplemental Fig. 2D). This residual Pat2 expression likely 219

explains why TAP-Pat2 cells grown without cadmium fail to show a growth defect despite the essential 220

nature of the PAT2 gene. 221

The lack of rapid growth arrest and the gradual nature of the telomere shortening seen after 222

Pat2 depletion indicates that Pat2 is probably not required to protect the telomere from degradation or 223

DNA repair activities (35, 36). Thus, this function seems to be reserved for Pot1a-Tpt1. The similarity in 224

the rate and extent of telomere shortening seen after Pat2 (Fig. 3) and TERT (36) depletion instead 225

suggests that Pat2 is needed for telomerase to add repeats to the chromosome terminus. Since Pat1 loss 226

also causes gradual telomere shortening, it remained possible that Pat2 depletion has an indirect effect 227

on telomere length by causing Pat1 to dissociate from the telomere. To test for this scenario, we 228

performed ChIP with Tap-Pat2 cells grown +/- cadmium using antibodies to Pat1 and Tpt1. As shown in 229

Fig 2C, association of Pat1 and Tpt1 with telomeres was unaffected by Pat2 depletion. Thus, it appears 230

that Pat2 regulates telomerase action on the chromosome end. Pat1 may also regulate telomerase but 231

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

11

an alternative possibility is that the telomere shortening seen after Pat1 depletion occurs because the 232

loss of Pat1 causes Pat2 to dissociate from the telomere. 233

Overall our results indicate that the 3’ overhangs of Tetrahymena telomeres are packaged by a 234

four protein complex containing Pot1a, Tpt1, Pat1 and Pat2. Previous studies indicate that the complex 235

is anchored to the overhang via Pot1a, the Pot1a-Tpt1 dimer serves to prevent the overhang from 236

activating a DNA damage response and it limits extension of the overhang by telomerase. In contrast, 237

Pat1 and Pat2 are needed for telomerase to maintain telomere length. Currently it is unclear how Pat1 238

and Pat2 facilitate telomerase action. However, one possibility is that they coordinate removal of Pot1a 239

with telomerase binding to ensure that the overhang is always protected by one or other complex. The 240

Tetrahymena telomerase holoenzyme binds to the overhang through an OB fold-containing subunit 241

Teb1 that also serves as a processivity factor (25, 41). Since most Tetrahymena 3’ overhangs are 14 or 20 242

nt in length and both Pot1a and Teb1 require at least two T2G4 repeats for high affinity binding (42) 243

(Linger and Price unpublished results), it is unlikely that Pot1a and Teb1/telomerase can bind the 244

overhang concurrently. 245

246

ACKNOWLEDGMENTS 247

We thank Wanda Manieri for antibody production and Rebecca Lindhorst for purification of 248

recombinant Pat2. This work was supported by National Institutes of Health (NIH) grant GM088728 (to 249

CMP) and by the BC Cancer Foundation (to GBM). BRL was supported by NIH grant T32 CA117846 and 250

SC by NIH grant T32 ES007250. 251

252

REFERENCES 253

1. Murnane JP. 2012. Telomere dysfunction and chromosome instability. Mutat Res 730:28-36. 254

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

12

2. O'Sullivan RJ, Karlseder J. 2010. Telomeres: protecting chromosomes against genome 255

instability. Nat Rev Mol Cell Biol 11:171-181. 256

3. Stewart JA, Chaiken MF, Wang F, Price CM. 2012. Maintaining the end: roles of telomere 257

proteins in end-protection, telomere replication and length regulation. Mutat Res 730:12-19. 258

4. Palm W, de Lange T. 2008. How shelterin protects mammalian telomeres. Annu Rev Genet 259

42:301-334. 260

5. Dehe PM, Cooper JP. 2010. Fission yeast telomeres forecast the end of the crisis. FEBS Lett 261

584:3725-3733. 262

6. Wellinger RJ, Zakian VA. 2012. Everything you ever wanted to know about Saccharomyces 263

cerevisiae telomeres: beginning to end. Genetics 191:1073-1105. 264

7. Giraud-Panis MJ, Teixeira MT, Geli V, Gilson E. 2010. CST meets shelterin to keep telomeres in 265

check. Mol Cell 39:665-676. 266

8. Denchi EL, de Lange T. 2007. Protection of telomeres through independent control of ATM and 267

ATR by TRF2 and POT1. Nature 448:1068-1071. 268

9. Churikov D, Price CM. 2008. Pot1 and cell cycle progression cooperate in telomere length 269

regulation. Nature structural & molecular biology 15:79-84. 270

10. Ribeyre C, Shore D. 2012. Anticheckpoint pathways at telomeres in yeast. Nature structural & 271

molecular biology 19:307-313. 272

11. Zaug AJ, Podell ER, Nandakumar J, Cech TR. 2010. Functional interaction between telomere 273

protein TPP1 and telomerase. Genes & development 24:613-622. 274

12. Churikov D, Corda Y, Luciano P, Geli V. 2013. Cdc13 at a crossroads of telomerase action. Front 275

Oncol 3:39. 276

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

13

13. Qi H, Zakian VA. 2000. The Saccharomyces telomere-binding protein Cdc13p interacts with both 277

the catalytic subunit of DNA polymerase alpha and the telomerase-associated est1 protein. 278

Genes & development 14:1777-1788. 279

14. Zhao Y, Sfeir AJ, Zou Y, Buseman CM, Chow TT, Shay JW, Wright WE. 2009. Telomere extension 280

occurs at most chromosome ends and is uncoupled from fill-in in human cancer cells. Cell 281

138:463-475. 282

15. Wang F, Stewart JA, Kasbek C, Zhao Y, Wright WE, Price CM. 2012. Human CST has 283

independent functions during telomere duplex replication and C-strand fill-in. Cell reports 284

2:1096-1103. 285

16. Nandakumar J, Bell CF, Weidenfeld I, Zaug AJ, Leinwand LA, Cech TR. 2012. The TEL patch of 286

telomere protein TPP1 mediates telomerase recruitment and processivity. Nature 492:285-289. 287

17. Latrick CM, Cech TR. 2010. POT1-TPP1 enhances telomerase processivity by slowing primer 288

dissociation and aiding translocation. The EMBO journal 29:924-933. 289

18. Wang F, Podell ER, Zaug AJ, Yang Y, Baciu P, Cech TR, Lei M. 2007. The POT1-TPP1 telomere 290

complex is a telomerase processivity factor. Nature 445:506-510. 291

19. Evans SK, Lundblad V. 1999. Est1 and Cdc13 as comediators of telomerase access. Science 292

286:117-120. 293

20. Taggart AK, Teng SC, Zakian VA. 2002. Est1p as a cell cycle-regulated activator of telomere-294

bound telomerase. Science 297:1023-1026. 295

21. Puglisi A, Bianchi A, Lemmens L, Damay P, Shore D. 2008. Distinct roles for yeast Stn1 in 296

telomere capping and telomerase inhibition. The EMBO journal 27:2328-2339. 297

22. Jahn CL, Klobutcher LA. 2002. Genome remodeling in ciliated protozoa. Annu Rev Microbiol 298

56:489-520. 299

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

14

23. Eisen JA, Coyne RS, Wu M, Wu D, Thiagarajan M, Wortman JR, Badger JH, Ren Q, Amedeo P, 300

Jones KM, Tallon LJ, Delcher AL, Salzberg SL, Silva JC, Haas BJ, Majoros WH, Farzad M, Carlton 301

JM, Smith RK, Jr., Garg J, Pearlman RE, Karrer KM, Sun L, Manning G, Elde NC, Turkewitz AP, 302

Asai DJ, Wilkes DE, Wang Y, Cai H, Collins K, Stewart BA, Lee SR, Wilamowska K, Weinberg Z, 303

Ruzzo WL, Wloga D, Gaertig J, Frankel J, Tsao CC, Gorovsky MA, Keeling PJ, Waller RF, Patron 304

NJ, Cherry JM, Stover NA, Krieger CJ, del Toro C, Ryder HF, Williamson SC, Barbeau RA, 305

Hamilton EP, Orias E. 2006. Macronuclear genome sequence of the ciliate Tetrahymena 306

thermophila, a model eukaryote. PLoS biology 4:e286. 307

24. Turkewitz AP, Orias E, Kapler G. 2002. Functional genomics: the coming of age for Tetrahymena 308

thermophila. Trends in genetics : TIG 18:35-40. 309

25. Zeng Z, Min B, Huang J, Hong K, Yang Y, Collins K, Lei M. 2011. Structural basis for Tetrahymena 310

telomerase processivity factor Teb1 binding to single-stranded telomeric-repeat DNA. 311

Proceedings of the National Academy of Sciences of the United States of America 108:20357-312

20361. 313

26. Hong K, Upton H, Miracco EJ, Jiang J, Zhou ZH, Feigon J, Collins K. 2013. Tetrahymena 314

Telomerase Holoenzyme Assembly, Activation, and Inhibition by Domains of the p50 Central 315

Hub. Molecular and cellular biology 33:3962-3971. 316

27. Jacobs SA, Podell ER, Cech TR. 2006. Crystal structure of the essential N-terminal domain of 317

telomerase reverse transcriptase. Nature structural & molecular biology 13:218-225. 318

28. Jiang J, Miracco EJ, Hong K, Eckert B, Chan H, Cash DD, Min B, Zhou ZH, Collins K, Feigon J. 319

2013. The architecture of Tetrahymena telomerase holoenzyme. Nature 496:187-192. 320

29. Berman AJ, Gooding AR, Cech TR. 2010. Tetrahymena telomerase protein p65 induces 321

conformational changes throughout telomerase RNA (TER) and rescues telomerase reverse 322

transcriptase and TER assembly mutants. Molecular and cellular biology 30:4965-4976. 323

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

15

30. Karrer KM. 2000. Tetrahymena genetics: two nuclei are better than one. Methods in cell biology 324

62:127-186. 325

31. Kirk KE, Blackburn EH. 1995. An unusual sequence arrangement in the telomeres of the germ-326

line micronucleus in Tetrahymena thermophila. Genes & development 9:59-71. 327

32. Kapler GM. 1993. Developmentally regulated processing and replication of the Tetrahymena 328

rDNA minichromosome. Current opinion in genetics & development 3:730-735. 329

33. Jacob NK, Skopp R, Price CM. 2001. G-overhang dynamics at Tetrahymena telomeres. The 330

EMBO journal 20:4299-4308. 331

34. Cohen P, Blackburn EH. 1998. Two types of telomeric chromatin in Tetrahymena thermophila. 332

Journal of molecular biology 280:327-344. 333

35. Jacob NK, Lescasse R, Linger BR, Price CM. 2007. Tetrahymena POT1a regulates telomere length 334

and prevents activation of a cell cycle checkpoint. Molecular and cellular biology 27:1592-1601. 335

36. Linger BR, Morin GB, Price CM. 2011. The Pot1a-associated proteins Tpt1 and Pat1 coordinate 336

telomere protection and length regulation in Tetrahymena. Molecular biology of the cell 337

22:4161-4170. 338

37. Shang Y, Song X, Bowen J, Corstanje R, Gao Y, Gaertig J, Gorovsky MA. 2002. A robust 339

inducible-repressible promoter greatly facilitates gene knockouts, conditional expression, and 340

overexpression of homologous and heterologous genes in Tetrahymena thermophila. 341

Proceedings of the National Academy of Sciences of the United States of America 99:3734-3739. 342

38. Mead CL, Kuzyk MA, Moradian A, Wilson GM, Holt RA, Morin GB. 2010. Cytosolic protein 343

interactions of the schizophrenia susceptibility gene dysbindin. Journal of neurochemistry 344

113:1491-1503. 345

39. Nelson JD, Denisenko O, Sova P, Bomsztyk K. 2006. Fast chromatin immunoprecipitation assay. 346

Nucleic acids research 34:e2. 347

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

16

40. Jacob NK, Stout AR, Price CM. 2004. Modulation of telomere length dynamics by the 348

subtelomeric region of tetrahymena telomeres. Molecular biology of the cell 15:3719-3728. 349

41. Min B, Collins K. 2009. An RPA-related sequence-specific DNA-binding subunit of telomerase 350

holoenzyme is required for elongation processivity and telomere maintenance. Mol Cell 36:609-351

619. 352

42. Min B, Collins K. 2010. Multiple mechanisms for elongation processivity within the reconstituted 353

tetrahymena telomerase holoenzyme. The Journal of biological chemistry 285:16434-16443. 354

355

FIGURE LEGENDS 356

Figure 1. Generation of cell lines with PAT2 gene replacement. (A) Gene targeting strategy used to make 357

cells expressing FLAG-His (panel I) or TAP-tagged Pat2 (panel III). Gene targeting constructs were 358

recombined into the native gene locus (panel II). Dotted lines, recombination arms; black bars, Southern 359

blot probes; E, EcoRV restriction sites. (B) Southern blots of EcoRV-digested genomic DNA from clones 360

showing full replacement of the endogenous PAT2 gene with the PAT2-FLAG-HIS (panel I) or TAP-PAT2 361

(panel II) allele. Bands from endogenous gene (4.7 kb), PAT2-FLAG-HIS (7 kb) and TAP-PAT2 (8.2 kb) 362

alleles are marked. *, cross-reacting band. Lanes 3-5 in panel I and lanes 5-6 in panel II represent 363

different clones. 364

365

Figure 2. Pat2 interacts with Tpt1 and Pat1 and localizes to telomeres. (A) Western blots showing co-366

purification of Tpt1 and Pat1 with Pat2 on Ni-Sepharose beads. Nuclear extracts were made from WT or 367

Pat2-FLAG-His cells Lanes 2-3 and 5-6 are from duplicate immunoprecipitation reactions. Panel II; 368

nuclear extracts from Pat2-FLAG-His cells were treated with MNase prior to addition of the beads. (B) 369

ChIP analysis to showing Pat2 presence at telomeres. (I) Schematic showing positions of real time PCR 370

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

17

primers on the rDNA chromosome. (II-III) Results of real time PCR analysis with ChIP samples from Pat2-371

FLAG-His or TAP-Pat2 cells. (II) Chromatin from Pat2-FLAG-His cells precipitated with anti-FLAG agarose. 372

N = 2 experiments, error bars indicate min and max. (III) Chromatin from TAP-Pat2 cells grown +/- 373

cadmium for 3 days and precipitated with IgG Sepharose. N = 3 experiments, error bars indicate SEM. (C) 374

ChIP analysis showing that Pat1 and Tpt1 association with the telomere are unaffected by Pat2 removal. 375

Chromatin from TAP-Pat2 cells grown for 3 days +/- cadmium was precipitated with antibody to Pat1 (I) 376

or Tpt1 (II). N = 3 experiments, error bars indicate SEM. 377

378

Figure 3. Effect of Pat2 depletion on growth rate and telomere length. (A) Growth curves for TAP-Pat2 379

cells grown +/- cadmium. Results are the average of two experiments. (B) Southern blots showing the 380

length of rDNA telomeres from TAP-Pat2 cells grown +/- cadmium for 1-15 days 381

382

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

on March 31, 2018 by guest

http://ec.asm.org/

Dow

nloaded from