1 drew endy stanford bioengineering the biobricks foundation the presidential commission for the...
TRANSCRIPT
![Page 1: 1 Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010 Overview](https://reader034.vdocuments.net/reader034/viewer/2022051621/56649e7b5503460f94b7c1c6/html5/thumbnails/1.jpg)
1
Drew EndyStanford BioengineeringThe BioBricks Foundation
The Presidential Commission for the Study of Bioethical IssuesWashington DC8 July 2010
Overview and Context of the Technology of Synthethic Biology
![Page 2: 1 Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010 Overview](https://reader034.vdocuments.net/reader034/viewer/2022051621/56649e7b5503460f94b7c1c6/html5/thumbnails/2.jpg)
2
Mice from dirty rags & wheat bran
Life has not now been created from inanimate matter.
![Page 3: 1 Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010 Overview](https://reader034.vdocuments.net/reader034/viewer/2022051621/56649e7b5503460f94b7c1c6/html5/thumbnails/3.jpg)
33
Synthetic genomes are a BTD (Big Technical Deal)
Natural living systems,Direct generational descent, Replication with error,Natural selection.
Synthetic living systems,“Decoupled” promulgation over time, Replication with representation,Fashioned selections.
![Page 4: 1 Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010 Overview](https://reader034.vdocuments.net/reader034/viewer/2022051621/56649e7b5503460f94b7c1c6/html5/thumbnails/4.jpg)
44
Big stresses can arise when material and information become interconvertible.- Changes in business and distribution models
(ongoing transitions from CDs & DVDs, to MP3s & Internet TV)- Challenges to safety & security frameworks (from control of material, to control of information)- Avoidance of nation state and cultural relations (border controls for DNA sequences on the internet, really?)- Increases in scale and pace (overloading of current practices)
![Page 5: 1 Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010 Overview](https://reader034.vdocuments.net/reader034/viewer/2022051621/56649e7b5503460f94b7c1c6/html5/thumbnails/5.jpg)
5
TAATACGACTCACTATAGGGAGA
DNA Construction = #1 Tech. of 21st Ctry.From
absract information to physical, living DNA designs.
2004: 10,000 bp2010: 1,000,000 bp2016: 100 million?
![Page 6: 1 Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010 Overview](https://reader034.vdocuments.net/reader034/viewer/2022051621/56649e7b5503460f94b7c1c6/html5/thumbnails/6.jpg)
6
~99% Genetic Engineering:<20 kb DNA, ~1 dozen DNA components
Genome Synthesis:>8 mb DNA, ~1000+ DNA components?!
~4 meter gap
400-fold “biointegration gap,” today.
(We are relatively bad at putting the molecules of biology back together in useful ways)
![Page 7: 1 Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010 Overview](https://reader034.vdocuments.net/reader034/viewer/2022051621/56649e7b5503460f94b7c1c6/html5/thumbnails/7.jpg)
7
if {growing} call wintergreen()else call bananas()
Beyond synthetic genomes: We’ll need languages & grammars for writing DNA
poetry
![Page 8: 1 Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010 Overview](https://reader034.vdocuments.net/reader034/viewer/2022051621/56649e7b5503460f94b7c1c6/html5/thumbnails/8.jpg)
8
To Have the Chance of Being Ethical,We Must Lead Future Biotech. Tool
RevolutionsDNA Sequencing
Read Out the Genetic Code
Recombinant DNA
Basic “Cut” & “Paste”
Polymerase Chain Reaction
Amplify & Make Simple Changes
First Gen.
Biotech=
...
Next Gen.
BiotechAddsNew Tools
=
![Page 9: 1 Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010 Overview](https://reader034.vdocuments.net/reader034/viewer/2022051621/56649e7b5503460f94b7c1c6/html5/thumbnails/9.jpg)
9
- We often learn best by tinkering. Today, most of biology remains unknown; we stand to learn more than ever before via a synthetic approach.
The Technical Ethics of Synthetic Biology
- Freedom of the (DNA) press. There are now no sustained public investments in getting better at building DNA; leverage over the presses can lead to control of content (i.e., what is written).
- Preparedness and reconciliation. More accidents will happen; more misuses will occur; nature is not a liberal representative democracy; how do we make such truths not intolerable?
- Institutions & individuals; hackers are community. The tools of synthetic biology make biotechnology, today’s *most* compelling technology, available to many. Do we enable or ostracize a future world of “Do-It-Together” biotechnology? Let’s not overlook many basics (e.g., property rights).