1 session 6: a modeling approach to biochemistry tom hsu, phd. manos chaniotakis, phd. marina dang,...
TRANSCRIPT
1
Session 6:
A Modeling Approach to Biochemistry
Tom Hsu, PhD.
Manos Chaniotakis, PhD.
Marina Dang, PhD.
Copyright © 2012 Chaniotakas and Hsu
Essential Questions
How are amino acids connected to form a protein?
Does stoichiometry apply to macromolecules?
hemoglobin, an oxygen-transporter in red blood cells
Objectives
• Explain how a peptide bond is formed.
• Use the genetic code to translate an mRNA sequence into an amino acid sequence.
• Describe some of the factors involved in protein folding.
• Use stoichiometry to analyze protein samples.
Assessment
• Write the amino acid sequence from this mRNA sequence:AUGUUGCUGUUUUGCCAUUUUCCAACAGAC
The active form of insulin is a 5.8 kDa protein.
• What is the mass of insulin (in g) of 0.81 mmol of insulin?
The body stores insulin as a hexamer (6 molecules of insulin) that contains two Zn2+ ions.
• What is the mass of zinc in 0.27 mmol of the hexamer form of insulin?
TEKS correlations
112.35 (c)(8)(A) Define and use the concept of the mole.
112.35 (c)(8)(B) Use the mole concept to calculate the number of atoms, ions, or molecules in a sample of material.
Review
Polymerization reaction
• Small building blocks (monomers) come together to form a polymer.
• Proteins are polymers.• The monomers are called amino acids.
Proteins in and around us
Why are proteins important?
Where do we find proteins and what to do they do?
20 amino acids, millions of proteins
Movement Muscles are primarily made of proteins
Structure Tendons, skin, bones, claws, and fibers such as wool and hair
Catalysis Enzymes that catalyze chemical reactions
Transport Hemoglobin, for example, transports oxygen to our tissues
Storage Proteins store minerals needed by the body
Protection Blood-clotting proteins which keep us from bleeding too much; antibodies from our immune system protect us from infections
Energy Cytochromes transfer electrons through a series of redox transfer reactions
Assembling amino acids
Asparagine (Asn)
Valine
Leucine
Asparagine
Aspartic acid
Glycine
Alanine
Serine
Methionine
Threonine
Cysteine
Each group builds one of the following amino acids:
Twenty amino acids
Use the amino acids chart.
Structure of an amino acid
• Central carbon
• Amino group
• Carboxylic acid group
• R group (the side chain)
On your model, find the following:
Structure of an amino acid
• Central carbon
• Amino group
• Carboxylic acid group
• R group (the side chain)
What part makes each amino acid different?
Structure of an amino acid
• Central carbon
• Amino group
• Carboxylic acid group
• R group (the side chain)
What part makes each amino acid different?
Naming amino acids
Write the 3-letter code for each amino acid.
What characteristic does the side chain give to the amino acid?
From DNA to mRNA to proteins
DNA molecule
Ex: ATG – GCC
Transcription
• The genetic information contains “instructions” for protein synthesis.
• DNA transfers the information to mRNA.
mRNA molecule
AUG – GCC
From DNA to mRNA to proteins
DNA molecule mRNA molecule
AUG – GCCEx: ATG – GCC
Transcription
Amino acid chain
Met – Ala
Functional protein
Translation
• We use the genetic code to translate from mRNA to amino acids.
Understanding and using the genetic code
Read the wheel starting from the center.
AAU codes for Asparagine (Asn)
Understanding and using the genetic code
• Each codon (group of 3 nucleotides) codes for one amino acid.
Understanding and using the genetic code
Here is an mRNA sequence:
AUG/UCU/UGC/GAC/GGC/GCA/ACC/GUC/AAC/CUA/UAG/
Build the protein chain that this sequence codes for.
Building a protein chain
together form H2O
one amino acid another amino acid
Building a protein chain
a peptide bond forms between C and N
Building a protein chain
Building a protein chain from mRNA
AUG / UCU / UGC / GAC / GGC / GCA / ACC / GUC / AAC / CUA / UAG
together form H2Oone amino acid another amino acid
Building a protein chain from mRNA
1. Why is this polymerization reaction also called a dehydration reaction?
2. How many water molecules did you produce by connecting these ten amino acids?
Building a protein chain from mRNA
1. Why is this polymerization reaction also called a dehydration reaction?
2. How many water molecules did you produce by connecting these ten amino acids?
A water molecule is produced or “lost” every time a peptide bond is made. “Dehydration” refers to this loss of water.
There were 9 peptide bonds, and 9 water molecules were formed.
Building a protein chain from mRNA
This polypeptide chain has 10 amino acids.
Consider that real proteins can have hundreds of amino acids:
• The active form in insulin has 51 amino acids, but it is stored as a hexamer (6 insulin molecules): 306 amino acids.
• Cytochrome P450 3A4 in the human liver has 485 amino acids.• The a and b chains of hemoglobin have 287 amino acids; hemoglobin
functions as a tetramer (4 hemoglobin molecules): 1148 amino acids.
Understanding and using the genetic code
Translate these two sequences:
Sequence 1:
AUG/UCU/UGC/GAC/GGC/GCA/ACC/GUC/AAC/CUA/UAG
Sequence 2:
AUG/AGU/UGC/GAU/GGG/GCU/ACG/GUC/AAC/UUA/UAA
Understanding and using the genetic code
Translate these two sequences:
Sequence 1:
AUG/UCU/UGC/GAC/GGC/GCA/ACC/GUC/AAC/CUA/UAG
Sequence 2:
AUG/AGU/UGC/GAU/GGG/GCU/ACG/GUC/AAC/UUA/UAA
Amino acid sequence: Start – Met – Ser – Cys – Asp – Gly – Ala – Thr – Val – Asn – Leu – Stop
Understanding and using the genetic code
Suppose there is a mistake in the mRNA sequence, and GAC is replaced with GAU. Is the protein chain affected?
Suppose there is a mistake in the mRNA sequence, and UGC is replaced with UGA. Is the protein chain affected?
Understanding and using the genetic code
Suppose there is a mistake in the mRNA sequence, and GAC is replaced with GAU. Is the protein going to be affected?
Suppose there is a mistake in the mRNA sequence, and UGC is replaced with UGA. Is the protein going to be affected?
No: Both codons code for aspartic acid.
Yes: A cysteine amino acid is replaced with a stop codon. This terminates the protein synthesis.
Protein folding
1. Look carefully at the amino acids in the polypeptide chain. Determine which amino acids are polar and nonpolar.
2. How would you predict the polar amino acids to orient themselves in an aqueous environment, such as the environment in our bodies?
Protein folding
1. Look carefully at the amino acids in the polypeptide chain. Determine which amino acids are polar and nonpolar.
2. How would you predict the polar amino acids to orient themselves in an aqueous environment, such as the environment in our bodies?
Polar: Ser, Cys, Thr, Asn,
Nonpolar: Met, Gly, Ala, Val, Leu
Polar amino acids would be on the outside and in contact with the surrounding water; nonpolar amino acids would be protected in the center.
Demonstrate this with your model.
Protein folding
Factors in protein folding:• H bonding• Electrostatic forces• van der Waals• Disulfide bonds• Chaperone proteins…
Protein folding
1. Crack an egg into a cup or beaker.
2. Use a 3-mL plastic pipette to transfer some egg white into 3 test tubes.
#1 #2 #3
3 mL of vinegar 3 mL of water
3 mL of water + a pinch of salt
Protein folding
#1 #2 #3
3 mL of vinegar 3 mL of water
3 mL of water + a pinch of salt
Precipitate Precipitate No precipitate
Protein folding
Some amino acids have side chains that are acidic or basic. Do you think that adding vinegar to protein will disrupt its 3D structure? Explain.
#1
3 mL of vinegar
Precipitate
Protein folding
Some amino acids have side chains that are acidic or basic. Do you think that adding vinegar to protein will disrupt its 3D structure? Explain.
#1
3 mL of vinegar
Adding vinegar means that some of the basic side chains
may interact with the acid in the mixture. This can disrupt
the 3D structure of the protein.
Precipitate
Protein folding
#2 #3
3 mL of water
3 mL of water + a pinch of salt
If you are a protein biochemist, would you stabilize proteins in water or in water containing some salt?
Precipitate No precipitate
Protein folding
#2
3 mL of water
+
–
++
+
–
–
–
protein
+
–
++
+
–
–
–
protein
Precipitate: protein aggregate
Electrostatic forces are involved in protein folding. Some parts of the protein are positive; others are negative.
If “unprotected” surface charges can cause proteins to aggregate (“clump” together).
Protein folding
#2
3 mL of water
#3
3 mL of water + a pinch of salt
No precipitate: stabilized protein
+
–
++
+
–
–
–
Na+
Na+
Na+
Cl– Cl–
Cl–
protein
+
–
++
+
–
–
–
protein
+
–
++
+
–
–
–
protein
Precipitate: protein aggregate
The salt ions help to stabilize the protein.
Stoichiometry in biochemistry
• Molar mass of large molecules are expressed in daltons (Da).
• 1 Da = 1 g/mol
• 1 kDa = 1,000 g/mol Hemoglobin(64 kDa)
What is the mass of 1 mol of hemoglobin?
Stoichiometry in biochemistry
64 kDa = 64,000 g/mol 1 mol 64 kg
Note: The average North American adult has a mass of ~80 kg.
• Molar mass of large molecules are expressed in daltons (Da).
• 1 Da = 1 g/mol
• 1 kDa = 1,000 g/mol Hemoglobin(64 kDa)
What is the mass of 1 mol of hemoglobin?
Stoichiometry in biochemistry
Lysozyme
Lysozyme C has a molar mass of 16.5 kDa.
• What is the mass in grams of 1 mol of lysozyme?
Stoichiometry in biochemistry
Lysozyme
Lysozyme C has a molar mass of 16.5 kDa.
• What is the mass in grams of 1 mol of lysozyme?
3 3 g16.5 kDa 16.5 10 Da 16.5 10
mol
The mass of 1 mol of lysozyme is 16,500 g or 16.5 kg.
Stoichiometry in biochemistry
Lysozyme C has a molar mass of 16.5 kDa.
• A typical laboratory sample is most likely to contain which amount of lysozyme:
• 1 mol?
• 0.1 mol?
• 0.0001 mol (0.1 mmol)?
Stoichiometry in biochemistry
Lysozyme C has a molar mass of 16.5 kDa.
• A typical laboratory sample is most likely to contain which amount of lysozyme:
• 1 mol?
• 0.1 mol?
• 0.0001 mol (0.1 mmol)?
16,500 g
1,650 g
1.65 g
Most likely amount
165 apples
17 apples
Stoichiometry in biochemistry
Lysozyme
Lysozyme C has a molar mass of 16.5 kDa. A sample of lysozyme has a protein concentration of 1.8 mM.
• How many moles of lysozyme are in a volume of 1.5 mL?
Stoichiometry in biochemistry
Lysozyme
Lysozyme C has a molar mass of 16.5 kDa. A sample of lysozyme has a protein concentration of 1.8 mM.
• How many moles of lysozyme are in a volume of 1.5 mL?
3 3 mol1.8 mM 1.8 10 M 1.8 10
L
361.8 10 mol
0.0015 L 2.7 10 mol lysozymeL
Convert from mM to mol/L:
Convert to moles:
Stoichiometry in biochemistry
Lysozyme
Lysozyme C has a molar mass of 16.5 kDa. A sample of lysozyme has a protein concentration of 1.8 mM.
• How many grams of lysozyme are in this sample?
Stoichiometry in biochemistry
Lysozyme
Lysozyme C has a molar mass of 16.5 kDa. A sample of lysozyme has a protein concentration of 1.8 mM.
• How many grams of lysozyme are in this sample?
3 3 g16.5 kDa 16.5 10 Da 16.5 10
mol Convert from kDa to g/mol:
Stoichiometry in biochemistry
Lysozyme
Lysozyme C has a molar mass of 16.5 kDa. A sample of lysozyme has a protein concentration of 1.8 mM.
• How many grams of lysozyme are in this sample?
36 16.5 10 g
2.7 10 mol 0.045 g 45 mgmol
3 3 g16.5 kDa 16.5 10 Da 16.5 10
mol Convert from kDa to g/mol:
Convert from moles to grams:
Assessment
• Write the amino acid sequence from this mRNA sequence:AUGUUGCUGUUUUGCCAUUUUCCAACAGAC
Assessment
• Write the amino acid sequence from this mRNA sequence:AUGUUGCUGUUUUGCCAUUUUCCAACAGAC
AUG – UUG – CUG – UUU – UGC – CAU – UUU – CCA – ACA – GAC
Met – Leu – Leu – Phe – Cys – His – Phe – Pro – Thr – Asp
Assessment
The active form of insulin is a 5.8 kDa protein.
• What is the mass of insulin (in g) of 0.81 mmol of insulin?
Assessment
The active form of insulin is a 5.8 kDa protein.
• What is the mass of insulin (in g) of 0.81 mmol of insulin?
3 3 g5.8 kDa 5.8 10 Da 5.8 10
mol
33 5.8 10 g
0.81 10 mol 4.7 gmol
Convert from kDa to g/mol:
Convert from mol to g:
Assessment
The body stores insulin as a hexamer (6 molecules of insulin) that contains two Zn2+ ions.
• What is the mass of zinc in 0.27 mmol of the hexamer form of insulin?
Assessment
The body stores insulin as a hexamer (6 molecules of insulin) that contains two Zn2+ ions.
• What is the mass of zinc in 0.27 mmol of the hexamer form of insulin?
23
3 2
2 mol Zn0.27 10 mol hexamer
1mol hexamer
0.54 10 mol Zn
Mole to mole conversion:
Assessment
The body stores insulin as a hexamer (6 molecules of insulin) that contains two Zn2+ ions.
• What is the mass of zinc in 0.27 mmol of the hexamer form of insulin?
23
3 2
2 mol Zn0.27 10 mol hexamer
1mol hexamer
0.54 10 mol Zn
23 2
2
65.38 g Zn0.54 10 mol Zn 0.035 g 35 mg
1mol Zn
Mole to mole conversion:
Mole to gram conversion:
Extracting DNA from strawberries
1. Place one strawberry in a resealable bag and puree.
2. In a cup, mix 2 tsp of dish detergent, 1 tsp of salt, and ½ cup of water.
3. Pour the mixture into the bag of strawberry puree.
4. Mix gently (avoid bubbles).
5. Filter the mixture into a new cup.
6. Add an equal amount of cold rubbing alcohol.
7. Observe what happens.
8. Stir with a wooden stick, and remove it from the mixture.
How big are macromolecules?Note: One human DNA molecule contains 204 billion atoms.
60