1 session 6: a modeling approach to biochemistry tom hsu, phd. manos chaniotakis, phd. marina dang,...

1

Session 6:

A Modeling Approach to Biochemistry

Tom Hsu, PhD.

Manos Chaniotakis, PhD.

Marina Dang, PhD.

Copyright © 2012 Chaniotakas and Hsu

Essential Questions

How are amino acids connected to form a protein?

Does stoichiometry apply to macromolecules?

hemoglobin, an oxygen-transporter in red blood cells

Objectives

• Explain how a peptide bond is formed.

• Use the genetic code to translate an mRNA sequence into an amino acid sequence.

• Describe some of the factors involved in protein folding.

• Use stoichiometry to analyze protein samples.

Assessment

• Write the amino acid sequence from this mRNA sequence:AUGUUGCUGUUUUGCCAUUUUCCAACAGAC

The active form of insulin is a 5.8 kDa protein.

• What is the mass of insulin (in g) of 0.81 mmol of insulin?

The body stores insulin as a hexamer (6 molecules of insulin) that contains two Zn2+ ions.

• What is the mass of zinc in 0.27 mmol of the hexamer form of insulin?

TEKS correlations

112.35 (c)(8)(A) Define and use the concept of the mole.

112.35 (c)(8)(B) Use the mole concept to calculate the number of atoms, ions, or molecules in a sample of material.

Review

Polymerization reaction

• Small building blocks (monomers) come together to form a polymer.

• Proteins are polymers.• The monomers are called amino acids.

Proteins in and around us

Why are proteins important?

Where do we find proteins and what to do they do?

20 amino acids, millions of proteins

Movement Muscles are primarily made of proteins

Structure Tendons, skin, bones, claws, and fibers such as wool and hair

Catalysis Enzymes that catalyze chemical reactions

Transport Hemoglobin, for example, transports oxygen to our tissues

Storage Proteins store minerals needed by the body

Protection Blood-clotting proteins which keep us from bleeding too much; antibodies from our immune system protect us from infections

Energy Cytochromes transfer electrons through a series of redox transfer reactions

Assembling amino acids

Asparagine (Asn)

Valine

Leucine

Asparagine

Aspartic acid

Glycine

Alanine

Serine

Methionine

Threonine

Cysteine

Each group builds one of the following amino acids:

Twenty amino acids

Use the amino acids chart.

Structure of an amino acid

• Central carbon

• Amino group

• Carboxylic acid group

• R group (the side chain)

On your model, find the following:

Structure of an amino acid

• Central carbon

• Amino group

• Carboxylic acid group

• R group (the side chain)

What part makes each amino acid different?

Naming amino acids

Write the 3-letter code for each amino acid.

What characteristic does the side chain give to the amino acid?

From DNA to mRNA to proteins

DNA molecule

Ex: ATG – GCC

Transcription

• The genetic information contains “instructions” for protein synthesis.

• DNA transfers the information to mRNA.

mRNA molecule

AUG – GCC

From DNA to mRNA to proteins

DNA molecule mRNA molecule

AUG – GCCEx: ATG – GCC

Transcription

Amino acid chain

Met – Ala

Functional protein

Translation

• We use the genetic code to translate from mRNA to amino acids.

Understanding and using the genetic code

Read the wheel starting from the center.

AAU codes for Asparagine (Asn)


• Each codon (group of 3 nucleotides) codes for one amino acid.


Here is an mRNA sequence:

AUG/UCU/UGC/GAC/GGC/GCA/ACC/GUC/AAC/CUA/UAG/

Build the protein chain that this sequence codes for.

Building a protein chain

together form H2O

one amino acid another amino acid


a peptide bond forms between C and N

Building a protein chain from mRNA

AUG / UCU / UGC / GAC / GGC / GCA / ACC / GUC / AAC / CUA / UAG

together form H2Oone amino acid another amino acid


1. Why is this polymerization reaction also called a dehydration reaction?

2. How many water molecules did you produce by connecting these ten amino acids?


1. Why is this polymerization reaction also called a dehydration reaction?

2. How many water molecules did you produce by connecting these ten amino acids?

A water molecule is produced or “lost” every time a peptide bond is made. “Dehydration” refers to this loss of water.

There were 9 peptide bonds, and 9 water molecules were formed.


This polypeptide chain has 10 amino acids.

Consider that real proteins can have hundreds of amino acids:

• The active form in insulin has 51 amino acids, but it is stored as a hexamer (6 insulin molecules): 306 amino acids.

• Cytochrome P450 3A4 in the human liver has 485 amino acids.• The a and b chains of hemoglobin have 287 amino acids; hemoglobin

functions as a tetramer (4 hemoglobin molecules): 1148 amino acids.


Translate these two sequences:

Sequence 1:

AUG/UCU/UGC/GAC/GGC/GCA/ACC/GUC/AAC/CUA/UAG

Sequence 2:

AUG/AGU/UGC/GAU/GGG/GCU/ACG/GUC/AAC/UUA/UAA


Translate these two sequences:

Sequence 1:

AUG/UCU/UGC/GAC/GGC/GCA/ACC/GUC/AAC/CUA/UAG

Sequence 2:

AUG/AGU/UGC/GAU/GGG/GCU/ACG/GUC/AAC/UUA/UAA

Amino acid sequence: Start – Met – Ser – Cys – Asp – Gly – Ala – Thr – Val – Asn – Leu – Stop


Suppose there is a mistake in the mRNA sequence, and GAC is replaced with GAU. Is the protein chain affected?

Suppose there is a mistake in the mRNA sequence, and UGC is replaced with UGA. Is the protein chain affected?


Suppose there is a mistake in the mRNA sequence, and GAC is replaced with GAU. Is the protein going to be affected?

Suppose there is a mistake in the mRNA sequence, and UGC is replaced with UGA. Is the protein going to be affected?

No: Both codons code for aspartic acid.

Yes: A cysteine amino acid is replaced with a stop codon. This terminates the protein synthesis.

Protein folding

1. Look carefully at the amino acids in the polypeptide chain. Determine which amino acids are polar and nonpolar.

2. How would you predict the polar amino acids to orient themselves in an aqueous environment, such as the environment in our bodies?

Protein folding

1. Look carefully at the amino acids in the polypeptide chain. Determine which amino acids are polar and nonpolar.

2. How would you predict the polar amino acids to orient themselves in an aqueous environment, such as the environment in our bodies?

Polar: Ser, Cys, Thr, Asn,

Nonpolar: Met, Gly, Ala, Val, Leu

Polar amino acids would be on the outside and in contact with the surrounding water; nonpolar amino acids would be protected in the center.

Demonstrate this with your model.

Protein folding

Factors in protein folding:• H bonding• Electrostatic forces• van der Waals• Disulfide bonds• Chaperone proteins…

Protein folding

1. Crack an egg into a cup or beaker.

2. Use a 3-mL plastic pipette to transfer some egg white into 3 test tubes.

#1 #2 #3

3 mL of vinegar 3 mL of water

3 mL of water + a pinch of salt

Protein folding

#1 #2 #3

3 mL of vinegar 3 mL of water


Precipitate Precipitate No precipitate

Protein folding

Some amino acids have side chains that are acidic or basic. Do you think that adding vinegar to protein will disrupt its 3D structure? Explain.

#1

3 mL of vinegar

Precipitate

Protein folding

Some amino acids have side chains that are acidic or basic. Do you think that adding vinegar to protein will disrupt its 3D structure? Explain.

#1

3 mL of vinegar

Adding vinegar means that some of the basic side chains

may interact with the acid in the mixture. This can disrupt

the 3D structure of the protein.

Precipitate

Protein folding

#2 #3

3 mL of water


If you are a protein biochemist, would you stabilize proteins in water or in water containing some salt?

Precipitate No precipitate

Protein folding

#2

3 mL of water

+

–

++

+

–

–

–

protein

+

–

++

+

–

–

–

protein

Precipitate: protein aggregate

Electrostatic forces are involved in protein folding. Some parts of the protein are positive; others are negative.

If “unprotected” surface charges can cause proteins to aggregate (“clump” together).

Protein folding

#2

3 mL of water

#3


No precipitate: stabilized protein

+

–

++

+

–

–

–

Na+

Na+

Na+

Cl– Cl–

Cl–

protein

+

–

++

+

–

–

–

protein

+

–

++

+

–

–

–

protein

Precipitate: protein aggregate

The salt ions help to stabilize the protein.

Stoichiometry in biochemistry

• Molar mass of large molecules are expressed in daltons (Da).

• 1 Da = 1 g/mol

• 1 kDa = 1,000 g/mol Hemoglobin(64 kDa)

What is the mass of 1 mol of hemoglobin?


64 kDa = 64,000 g/mol 1 mol 64 kg

Note: The average North American adult has a mass of ~80 kg.

• Molar mass of large molecules are expressed in daltons (Da).

• 1 Da = 1 g/mol

• 1 kDa = 1,000 g/mol Hemoglobin(64 kDa)

What is the mass of 1 mol of hemoglobin?


Lysozyme

Lysozyme C has a molar mass of 16.5 kDa.

• What is the mass in grams of 1 mol of lysozyme?


Lysozyme


• What is the mass in grams of 1 mol of lysozyme?

3 3 g16.5 kDa 16.5 10 Da 16.5 10

mol

The mass of 1 mol of lysozyme is 16,500 g or 16.5 kg.



• A typical laboratory sample is most likely to contain which amount of lysozyme:

• 1 mol?

• 0.1 mol?

• 0.0001 mol (0.1 mmol)?



• A typical laboratory sample is most likely to contain which amount of lysozyme:

• 1 mol?

• 0.1 mol?

• 0.0001 mol (0.1 mmol)?

16,500 g

1,650 g

1.65 g

Most likely amount

165 apples

17 apples


Lysozyme

Lysozyme C has a molar mass of 16.5 kDa. A sample of lysozyme has a protein concentration of 1.8 mM.

• How many moles of lysozyme are in a volume of 1.5 mL?


Lysozyme


• How many moles of lysozyme are in a volume of 1.5 mL?

3 3 mol1.8 mM 1.8 10 M 1.8 10

L

361.8 10 mol

0.0015 L 2.7 10 mol lysozymeL

Convert from mM to mol/L:

Convert to moles:


Lysozyme


• How many grams of lysozyme are in this sample?


Lysozyme



3 3 g16.5 kDa 16.5 10 Da 16.5 10

mol Convert from kDa to g/mol:


Lysozyme



36 16.5 10 g

2.7 10 mol 0.045 g 45 mgmol

3 3 g16.5 kDa 16.5 10 Da 16.5 10

mol Convert from kDa to g/mol:

Convert from moles to grams:

Assessment


Assessment


AUG – UUG – CUG – UUU – UGC – CAU – UUU – CCA – ACA – GAC

Met – Leu – Leu – Phe – Cys – His – Phe – Pro – Thr – Asp

Assessment



Assessment



3 3 g5.8 kDa 5.8 10 Da 5.8 10

mol

33 5.8 10 g

0.81 10 mol 4.7 gmol

Convert from kDa to g/mol:

Convert from mol to g:

Assessment



Assessment



23

3 2

2 mol Zn0.27 10 mol hexamer

1mol hexamer

0.54 10 mol Zn

Mole to mole conversion:

Assessment



23

3 2

2 mol Zn0.27 10 mol hexamer

1mol hexamer

0.54 10 mol Zn

23 2

2

65.38 g Zn0.54 10 mol Zn 0.035 g 35 mg

1mol Zn

Mole to mole conversion:

Mole to gram conversion:

Extracting DNA from strawberries

1. Place one strawberry in a resealable bag and puree.

2. In a cup, mix 2 tsp of dish detergent, 1 tsp of salt, and ½ cup of water.

3. Pour the mixture into the bag of strawberry puree.

4. Mix gently (avoid bubbles).

5. Filter the mixture into a new cup.

6. Add an equal amount of cold rubbing alcohol.

7. Observe what happens.

8. Stir with a wooden stick, and remove it from the mixture.

How big are macromolecules?Note: One human DNA molecule contains 204 billion atoms.

1 session 6: a modeling approach to biochemistry tom hsu, phd. manos chaniotakis, phd. marina dang,...

Documents

proteins structuretendons

role of proteins

diversity of proteins

proteins important

context of proteins

molecules of insulin

amino acid sequence

mmol of insulin