1336154 file000001 19549953
TRANSCRIPT
S1
Supporting Information
An Efficient System for Heterologous Expression of Secondary Metabolite Genes in Aspergillus
nidulans
Yi-Ming Chiang1,2
, C. Elizabeth Oakley3, Manmeet Ahuja
3, Ruth Entwistle
3, Aric Schultz
3,4,
Shu-Lin Chang1,5
, Calvin T. Sung1, Clay C. C. Wang
1,6,*, Berl R. Oakley
3,*
1Department of Pharmacology and Pharmaceutical Sciences, School of Pharmacy, University of
Southern California, 1985 Zonal Avenue, Los Angeles, California 90089, United States
2Graduate Institute of Pharmaceutical Science, Chia Nan University of Pharmacy and Science,
Tainan 71710, Taiwan, Republic of China
3Department of Molecular Biosciences, University of Kansas, 1200 Sunnyside Avenue,
Lawrence, Kansas 66045, United States
4Current address: Department of Microbiology and Immunology, University of Michigan
Medical School, Ann Arbor, MI 48109, United States
5Department of Biotechnology, Chia Nan University of Pharmacy and Science, Tainan 71710,
Taiwan, Republic of China
6Department of Chemistry, College of Letters, Arts, and Sciences, University of Southern
California, Los Angeles, California 90089, United States
*email: [email protected], [email protected]
Corresponding authors: Berl R. Oakley and Clay C. C. Wang.
S2
Table of Contents
Detailed Structural Characterization S3
Supplemental Methods S4
Compound Spectral Data S9
Supplemental References S12
Figure S1. Diagnostic PCR strategies. S14
Figure S2. An alternative secondary metabolite gene cluster deletion scheme. S18
Figure S3. Phylogenetic analysis of PKSs from the genome of A. terreus. S19
Figure S4. New start codons tested. S21
Figure S5. UV-Vis and ESIMS spectra in negative mode of compound 1 – 11 and 15 – 18. S23
Figure S6. HMBC correlations of compounds 6, 7, and 17 – 19. S26
Table S1. A. nidulans strains used for heterologous expression of NR-PKSs from A.
terreus. S27
Table S2. A. nidulans strains constructed in reconstituting the A. terreus asperfuranone
biosynthesis pathway. S28
Table S3. NMR data for compounds 6 and 7. S29
Table S4. NMR data for compounds 16 and 17. S30
Table S5. NMR data for compounds 18 and 19. S31
1H and
13C NMR spectra of new compounds 6, 7, 17, 18, and 19 S33
S3
Detailed Structural Characterizations
Two new compounds (6 and 7) isolated from alcA_ATEG_03432.1 strain
HRESIMS and 13
C NMR data (Table S3) of compound 7 indicated that 7 had a molecular
formula of C13H12O5, representing eight indices of hydrogen deficiency (IHD). 1H,
13C, and
gHMQC NMR spectra showed signals for two methyl groups [δH 1.46 (3H, d, J = 6.8 Hz), δC
24.3; and δH 1.98 (3H, s), δC 8.7], one oxygen-bearing methine [δH 5.23 (1H, q, J = 6.8 Hz), δC
66.7] and two aromatic protons [δH 7.43 and 8.08 (each 1H, s)] (Table S3). The 13
C NMR
spectrum revealed that compound 7 contains four olefins (δC 112.9, 120.4, 126.0, 126.1, 131.3,
140.0, 155.1, and 159.6) and two carbonyl groups (δC 181.8 and 185.2). This together with the
fact that compound 7 has eight IHD suggested that 7 contains a naphthaquinone chromophore.
We recently isolated a fatty-polyketide hybrid 22 (Table S3) from an afo (asperfuranone
biosynthetic pathway) engineered strain.1 Compounds 7 and 22 had almost identical UV-Vis
spectra (Fgiure S5). This suggested that 7 and 22 have the same naphthaquinone chromophore.
HMBC correlations allowed us to fully construct the structure of 7 (Figure S6). The 1H and
13C
NMR spectroscopic data of compound 6 were similar to those of 7 (Table S3). Comparison of
the NMR spectra between 6 and 7 indicated a ketone group at C-11 in 6 was reduced to a
hydroxyl group in 7. The C-11 ketone group caused H3-12 in 6 to shift downfield to δH 2.83
(3H, s). Thus, compound 6 was established as shown in Table 3. HMBC correlations (Figure
S6) also confirmed the assigned structure of 6.
Three new compounds (17 – 19) isolated from reconstitution of the afo biosynthetic
pathway
Compound 17 was isolated as yellow oil. The molecular formula was found to be C19H26O4 by
means of HRESIMS and 13
C NMR. The 1H NMR of 17 exhibited signals for the typical
aliphatic side chain found in azaphilons2, such as compound 16, including three olefinic proton
signals at δH 5.53, 6.04, and 6.90 (each 1H), three aliphatic sp3 proton signals at δH 1.3, 1.4,
and 2.47 (each 1H), and three methyl group signals at δH 0.85, 0.99, and 1.80 (each 3H) (Table
S4). Furthermore, its 1H NMR exhibited AB pattern signals at δH 4.80 and 4.86 (each 1H) and
ABX pattern signals at δH 2.40, 2.69, and 3.91 (each 1H). The ABX pattern of 17 is similar to
the same pattern in the 1H NMR spectrum of asperfuranone
3, suggesting that 17 and
S4
asperfuranone might have the same partial structure. Comparison of the 1H and
13C NMR
spectra between 16 and 17 (Table S4) revealed that 17 has one less keto group and one less
olefinic moiety than 16. The AB and ABX pattern signals in the 1H NMR spectrum of 17
suggested that the isochromene-3,5-dione moiety in 16 was reduced to 5-hydroxy-1H-
isochromen-3-one in 17. HMBC correlations (Figure S6) confirmed the assigned structure of 17.
Since compound 17 is structurally related to asperfuranone (12) from a biosynthetic point of
view, we named compound 17 asperpyranone and 16 preasperpyranone.
Compounds 18 and 19 have the molecular formula C14H18O3 and C17H22O4, respectively, on the
basis of their HRESIMS and 13
C NMR data. Both compounds exhibited typical azaphilone side
chains in their 1H NMR spectra including three olefinic protons, three aliphatic sp3 protons, and
three methyl group signals (Table S5). This suggested that compounds 18 and 19 are shunt
products of the afo biosynthetic pathway. The molecular formulae of 18 (C14H18O3) and 19
(C17H22O4) suggested that 18 utilizes two mal-CoAs and 19 utilizes three mal-CoAs and one
SAM for the process of extension. The fact that both compounds do not contain an aldehyde
functional group indicated that these two shunt products are not released by the R domain of
afoE but released through lactone cyclization. Indeed, both compounds contain an α,β,γ,δ-
unsaturated δ-lactone moiety identified from their 1H and
13C NMR spectral data (Table S5). It
is interesting to note that H-2 in 18 and H2-6 in 19 are exchangeable protons due the keto-enol
tautomerization (Table S5). Both structures were further supported by the long-range HMBC
correlations (Figure S6). We named compounds 18 and 19 proasperfuranone A and B,
respectively.
Supplemental Methods
Isolation of secondary metabolites
For scaling up, all A. nidulans strains were grown in 30 ml of liquid LMM in 125 ml flask and
induced by 10 mM of cyclopentanone as described in Materials and Methods. The culture
medium was then combined and extracted with EtOAc as described below. After flash column
chromatography, all fractions were analyzed by HPLC-DAD-MS and 1H NMR. Fractions
containing secondary metabolites of interest were further purified by semi-preparative reverse
phase HPLC [Phenomenex Luna 5 µm C18 (2), 250 × 10 mm] and monitored by a PDA
S5
detector at 254 nm. The gradient system was MeCN (solvent B) in 5 % MeCN/H2O (solvent A)
with or without 0.05 % TFA as specified below. Due to the instability of the intermediates
produced from the afo biosynthesis pathway in acidic conditions, the eluent from semi-
preparative HPLC containing purified intermediate and TFA was quenched with 0.1M KH2PO4
buffer (pH = 7) immediately. After evaporating the solvent, the intermediate was recovered by
adding 20 ml of ddH2O and partitioned with 20 ml of ethyl acetate twice. The spectra data of
these intermediates were taken as rapidly as possible after evaporating the ethyl acetate. The
known compounds were identified by comparing the spectral data with the literature and are
specified below.
alcA(p)_ATEG_00145.1
30 flasks of LO4522 culture medium were collected and the combined medium after filtration
was extracted with EtOAc. After evaporating EtOAc, the crude extract (33 mg) was subjected
to semi-preparative reverse phase HPLC with the following gradient condition without TFA: 10
to 37 % B from 0 to 27 min, 37 to 100 % B from 27 to 28 min, maintained at 100 % B from 28
to 30 min, 100 to 10 % B from 30 to 31 min, and re-equilibration with 10 % B from 31 to 35
min. 6,8-dihydroxy-3-methylisocoumarin (2, 1.3 mg) was eluted at 26.0 min. The
aforementioned medium was then acidified with HCl to pH 2 and extracted with EtOAc twice.
The two EtOAc extracts were combined and the combined EtOAc layer was evaporated in
vacuo. The crude extract in EtOAc layer (408 mg) was applied to a flash reverse phase C18 gel
column (COSMOSIL 75C18-OPN, 20 × 55 mm) and eluted with MeOH-H2O mixtures of
decreasing polarity (fraction A, 1:9, 100 ml; fraction B, 3:7, 100 ml; fraction C, 7:3, 100 ml;
fraction D, 1:0, 100 ml). Fraction B (146.7 mg) containing the major metabolites found in
HPLC profile was subjected to semi-preparative reverse phase HPLC with the following
gradient condition with 0.05 % of TFA: 5 % B from 0 to 5 min, 5 to 24 % B from 5 to 24 min,
24 to 100 % B from 24 to 26 min, maintained at 100 % B from 26 to 27 min, 100 to 5 % B from
27 to 28 min, and re-equilibration with 5 % B from 28 to 32 min. 4-hydroxy-6-methyl-2H-
pyran-2-one (3, 42.3 mg), 2-carboxy-3,5-dihydroxybenzylmethyl ketone (1, 21.0 mg), and
orsellinic acid (4, 7.8 mg) were eluted at 10.5, 20.3 and 22.6 min, respectively.
alcA(p)_ATEG_03629.1
S6
10 flasks of LO4527 culture medium were filtrated and collected. The combined medium was
extracted with EtOAc. The water layer was then acidified with HCl to pH 2 and extracted with
EtOAc a second time. The two EtOAc extracts were combined and the combined EtOAc layer
was evaporated in vacuo. Without further purification, the 1H and
13C NMR spectra of crude
extract (136.4 mg) in the EtOAc layer showed that it contained 5-methylorsellinic acid (5) as a
major compound.
alcA(p)_ATEG_03432.1
30 flasks of LO5093 culture medium were filtrated and collected. The combined medium was
extracted with EtOAc. The water layer was then acidified with HCl to pH 2 and extracted with
EtOAc a second time. The two EtOAc extracts were combined and the combined EtOAc layer
was evaporated in vacuo. The crude extract in the EtOAc layer (136 mg) was applied to a flash
reverse phase C18 gel column (COSMOSIL 75C18-OPN, 20 × 30 mm) and eluted with MeOH-
H2O mixtures of decreasing polarity (fraction A, 1:9, 100 ml; fraction B, 3:7, 100 ml; fraction C,
7:3, 100 ml; fraction D, 1:0, 100 ml). Fraction C (72.2 mg) containing the major metabolites
found in HPLC profile was subjected to semi-preparative reverse phase HPLC with the
following gradient condition with 0.05 % of TFA: 20 to 43 % B from 0 to 23 min, 43 to 100 %
B from 23 to 25 min, maintained at 100 % B from 25 to 26 min, 100 to 20 % B from 26 to 27
min, and re-equilibration with 20 % B from 27 to 31 min. 2,7-dihydroxy-6-(1-hydroxyethyl)-3-
methylnaphthalene-1,4-dione (7, 22.9 mg) and 6-acetyl-2,7-dihydroxy-3-methylnaphthalene-
1,4-dione (6, 14.1 mg) were eluted at 10.8 and 22.6 min, respectively.
alcA(p)_ATEG_10080.1*
10 flasks of LO5408 culture medium were filtrated and collected. The medium was extracted
with EtOAc twice and the combined EtOAc layer was then evaporated in vacuo to obtain 113
mg of crude extract. The purification procedure for isolating 3,5-dimethylorsellinic acid (8) was
as described previously4. 72.3 mg of 8 was obtained from 10 flask culture.
alcA(p)_AteafoG, alcA(p)_AteafoE
10 flasks of LO5283 culture medium were filtrated and collected. The combined medium
containing compound 11 was extracted with EtOAc twice. However, compound 11 was found
S7
to be insoluble in water based medium and the majority of 11 remained in the pellet. Thus, the
pellet was soaked in acetone (100 ml) followed by removing the mycelia through filtration.
Both EtOAc and acetone layer were combined, and the organic solvents were evaporated in
vacuo. The purification procedure for isolating compound 11 was as described previously.3
28.5 mg of 11 was purified from 10 flask culture.
alcA(p)_AteafoG, alcA(p)_AteafoC
30 flask of LO7156 culture medium were filtrated and collected. The medium was extracted
with EtOAc twice and the combined EtOAc layer was then evaporated in vacuo to obtain 17 mg
of the crude extract. This crude extract was subjected to semi-preparative reverse phase HPLC
with the following gradient condition with 0.05 % of TFA: 40 to 60 % B from 0 to 20 min, 60 to
100 % B from 20 to 22 min, maintained at 100 % B from 22 to 27 min, 100 to 40 % B from 27
to 28 min, and re-equilibration with 40 % B from 28 to 32 min. (2Z,4Z)-4,6-dimethylocta-2,4-
dienoic acid (15, 0.5 mg) was eluted at 14.3 min.
alcA(p)_AteafoG, alcA(p)_AteafoE, alcA(p)_AteafoD
30 flask of LO6759 culture medium were filtrated and collected. The combined medium was
extracted with EtOAc. The water layer was then acidified with HCl to pH 2 and extracted with
EtOAc a second time. The two EtOAc extracts were combined and the combined EtOAc layer
was evaporated in vacuo. The crude extract in the EtOAc layer (147 mg) was applied to a flash
reverse phase C18 gel column (COSMOSIL 75C18-OPN, 10 × 100 mm) and eluted with
MeOH-H2O mixtures of decreasing polarity (fraction A, 1:9, 50 ml; fraction B, 3:7, 50 ml;
fraction C, 7:3, 50 ml; fraction D, 1:0, 50 ml). Fraction D (39.6 mg) containing compound 16
was further purified by gel filtration chromatography (Sephadex LH-20, 10 × 220 mm) eluted
with MeOH. Due to the instability of compound 16, NMR experiments were undertaken
immediately after gel filtration chromatography. Compound 17 was found to be mainly in the
mycelia of LO6759. Thus, the mycelia were soaked in methanol (200 ml) overnight followed
by removing the mycelia through filtration. Methanol was evaporated to obtain a crude mycelia
extract (79 mg) which was then applied to a flash reverse phase C18 gel column (COSMOSIL
75C18-OPN, 10 × 100 mm) and eluted with MeOH-H2O mixtures of decreasing polarity
(fraction A, 1:9, 50 ml; fraction B, 3:7, 50 ml; fraction C, 7:3, 50 ml; fraction D, 1:0, 50 ml).
S8
Fraction C (7.9 mg) containing compound 17 was subjected to semi-preparative reverse phase
HPLC with the following gradient condition with 0.05 % of TFA: 40 to 60 % B from 0 to 20
min, 60 to 100 % B from 20 to 22 min, maintained at 100 % B from 22 to 25 min, 100 to 40 %
B from 25 to 26 min, and re-equilibration with 40 % B from 26 to 30 min. Asperpyranone (17,
0.8 mg) was eluted at 19.7 min.
alcA(p)_AteafoG, alcA(p)_AteafoE, alcA(p)_AteafoC, alcA(p)_AteafoD, alcA(p)_AteafoC
30 flask of LO6853 culture medium were filtrated and collected. The combined medium was
extracted with EtOAc. The medium was extracted with EtOAc twice and the combined EtOAc
layer was then evaporated in vacuo to obtain 78 mg of crude extract. This crude extract was
subjected to semi-preparative reverse phase HPLC with the following gradient condition with
0.05 % of TFA: 40 to 60 % B from 0 to 20 min, 60 to 100 % B from 20 to 22 min, maintained at
100 % B from 22 to 27 min, 100 to 40 % B from 27 to 28 min, and re-equilibration with 40 % B
from 28 to 32 min. Compounds 15 and 18 (6.2 mg) were coeluted at 14.3 min.
Proasperfuranone B (19, 1.1 mg) was eluted at 16.8 min. Compounds 16 and 17 (5.3 mg) were
coeluted at 19.4 min. Compounds 15 and 18 were further separated with the following gradient
condition with 0.05% of TFA: 40 to 46 % B from 0 to 30 min, 46 to 100 % B from 30 to 31 min,
maintained at 100 % B from 31 to 32 min, 100 to 40 % B from 32 to 33 min, and re-
equilibration with 40 % B from 33 to 37 min. Compounds 15 (1.5 mg) and 18 (2.6 mg) were
eluted at 26.0 and 27.3 min, respectively.
alcA(p)_AteafoG, alcA(p)_AteafoE, alcA(p)_AteafoC, alcA(p)_AteafoD, alcA(p)_AteafoF
30 flask of LO6864 culture medium were filtrated and collected. The combined medium was
extracted with EtOAc. The medium was extracted with EtOAc twice and the combined EtOAc
layer was then evaporated in vacuo to get 27 mg of crude extract. This crude extract was
subjected to semi-preparative reverse phase HPLC with the following gradient condition with
0.05 % of TFA: 40 to 60 % B from 0 to 20 min, 60 to 100 % B from 20 to 22 min, maintained at
100 % B from 22 to 27 min, 100 to 40 % B from 27 to 28 min, and re-equilibration with 40 % B
from 28 to 32 min. Asperfuranone (12, 3.8 mg) was eluted at 13.0 min.
S9
Compound Spectral Data
Melting points were determined with a Yanagimoto micromelting point apparatus and are
uncorrected. NMR spectra were collected on a Varian Mercury Plus 400 spectrometer. High
resolution electrospray ionization mass spectrum was obtained on Agilent 6210 time of flight
LC-MS. The spectral data of compounds 45, 8
4, 11 – 14
3 and 16
2 were identical to those from
our previous studies. Compound 9 had same UV-Vis and MS data (Figure S3) with
atrochrysone reported.6 Atrochrysone is a known major product produced by ACAS and ACTE
in vitro.7 Compound 10 had identical UV-Vis, MS, and retention time with emodin purified
from our previous studies.8
2-carboxy-3,5-dihydroxybenzylmethyl ketone (1)
Amorphous solid; For UV-Vis and ESIMS spectra, see Figure S5; 1H NMR (acetone-d6, 400
MHz) δ 1.69 (3H, s), 3.19 (2H, s), 6.26 (1H, d, J = 2.0 Hz), 6.31 (1H, d, J = 2.0 Hz), 11.37 (1H,
br s). 1H NMR data were in good agreement with the published data.
9
6,8-dihydroxy-3-methylisocoumarin (2)
Amorphous solid; For UV-Vis and ESIMS spectra, see Figure S5; 1H NMR (acetone-d6, 400
MHz) δ 2.20 (3H, d, J = 1.2 Hz), 6.30 (3H, m); 1H NMR (CD3OD, 400 MHz) δ 2.20 (3H, d, J =
1.2 Hz), 6.18 (1H, d, J = 2.4 Hz), 6.21 (1H, d, J = 2.4 Hz), 6.25 (1H, br s). 1H NMR data were
in good agreement with the published data.10
4-hydroxy-6-methyl-2H-pyran-2-one (3)
Colorless needles, mp 181 – 183 °C; For UV-Vis and ESIMS spectra, see Figure S5; 1H NMR
(acetone-d6, 400 MHz) δ 2.18 (3H, s), 5.29 (1H, br s), 5.96 (1H, br s); 13
C NMR (acetone-d6,
100 MHz) δ 19.9 (q), 89.6 (d), 100.8 (d), 164.4 (s), 165.0 (s), 171.2 (s). 1H NMR data were in
good agreement with the published data.11
5-methylorsellinic acid (5)
Amorphous solid; For UV-Vis and ESIMS spectra, see Figure S5; 1H NMR (acetone-d6, 400
MHz) δ 2.08 (3H, s), 2.49 (3H, s), 6.31 (1H, s); 13
C NMR (acetone-d6, 100 MHz) δ 11.7 (q),
S10
19.0 (q), 101.1 (d), 105.8 (s), 117.1 (s), 142.3 (s), 161.4 (s), 163.8 (s), 174.4 (s). 1H NMR data
were in good agreement with the published data.12
6-acetyl-2,7-dihydroxy-3-methylnaphthalene-1,4-dione (6)
Brown plates, mp > 300 °C; For UV-Vis and ESIMS spectra, see Figure S5; For 1H and
13C
NMR (acetone-d6), see Table S3; HRESIMS, [M – H]– m/z found 245.0456, calc. for C13H9O5:
245.0455.
2,7-dihydroxy-6-(1-hydroxyethyl)-3-methylnaphthalene-1,4-dione (7)
Orange needles, mp 252 – 254 °C (decomposition); For UV-Vis and ESIMS spectra, see Figure
S5; For 1H and
13C NMR (acetone-d6), see Table S3; HRESIMS, [M – H]
– m/z found 247.0612,
calc. for C13H11O5: 247.0612.
(2Z,4Z)-4,6-dimethylocta-2,4-dienoic acid (15)
Colorless amorphous solid; For UV-Vis and ESIMS spectra, see Figure S5; 1H NMR (CDCl3,
400 MHz) δ 0.85 (3H, t, J = 7.6 Hz), 0.99 (3H, d, J = 6.8 Hz), 1.3 and 1.4 (each 1H, m), 1.80
(3H, br s), 2.46 (1H, m), 5.72 (1H, br d, J = 10.0 Hz), 5.79 (1H, d, 15.6 Hz), 7.40 (1H, d, 15.6
Hz); 1H NMR (CD3OD, 400 MHz) δ 0.87 (3H, t, J = 7.2 Hz), 1.00 (3H, d, J = 6.4 Hz), 1.3 and
1.4 (each 1H, m), 1.80 (3H, br s), 2.49 (1H, m), 5.67 (1H, br d, J = 9.6 Hz), 5.78 (1H, d, 15.6
Hz), 7.28 (1H, d, 15.6 Hz); 13
C NMR (CDCl3, 100 MHz) δ 11.9 (q), 12.4 (q), 20.1 (q), 29.9 (t),
35.0 (d), 114.6 (d), 131.6 (s), 149.7 (d), 152.2 (d), 172.4 (s); 13
C NMR (CD3OD, 100 MHz) δ
12.5 (q), 12.7 (q), 20.7 (q), 31.3 (t), 36.2 (d), 117.2 (d), 133.2 (s), 149.4 (d), 151.5 (d), 171.4 (s).
1H and
13C NMR data were in good agreement with the published data.
13
preasperpyranone (16)
Yellow oil; For UV-Vis and ESIMS spectra, see Figure S5; For 1H and
13C NMR (CD3OD), see
Table S4; HRESIMS, [M + H]+ m/z found 315.1589, calc. for C19H22O4: 315.1591.
1H and
13C
NMR data in CDCl3 were identical with our previous published data.2
asperpyranone (17)
S11
Yellow oil; For UV-Vis and ESIMS spectra, see Figure S5; For 1H and
13C NMR (CD3OD), see
Table S4; HRESIMS, [M + H]+ m/z found 319.1912, calc. for C19H26O4: 319.1904.
proasperfuranone A (18)
Yellow-orange oil; For UV-Vis and ESIMS spectra, see Figure S5; For 1H and
13C NMR
(CDCl3 and CD3OD), see Table S5; HRESIMS, [M + H]+ m/z found 235.1328, calc. for
C14H18O3: 235.1329.
proasperfuranone B (19)
Light yellow oil; For UV-Vis and ESIMS spectra, see Figure S5; For 1H and
13C NMR (CDCl3
and CD3OD), see Table S5; HRESIMS, [M + H]+ m/z found 291.1591, calc. for C17H22O4:
291.1591.
S12
Supplemental References
(1) Liu, T.; Chiang, Y. M.; Somoza, A. D.; Oakley, B. R.; Wang, C. C. J Am Chem Soc 2011,
133, 13314-6.
(2) Somoza, A. D.; Lee, K. H.; Chiang, Y. M.; Oakley, B. R.; Wang, C. C. Org Lett 2012, 14,
972-5.
(3) Chiang, Y. M.; Szewczyk, E.; Davidson, A. D.; Keller, N.; Oakley, B. R.; Wang, C. C. J
Am Chem Soc 2009, 131, 2965-70.
(4) Ahuja, M.; Chiang, Y. M.; Chang, S. L.; Praseuth, M. B.; Entwistle, R.; Sanchez, J. F.; Lo,
H. C.; Yeh, H. H.; Oakley, B. R.; Wang, C. C. J Am Chem Soc 2012, 134, 8212-21.
(5) Sanchez, J. F.; Chiang, Y. M.; Szewczyk, E.; Davidson, A. D.; Ahuja, M.; Elizabeth
Oakley, C.; Woo Bok, J.; Keller, N.; Oakley, B. R.; Wang, C. C. Mol Biosyst 2010, 6,
587-93.
(6) Muller, M.; Lamottke, K.; Low, E.; Magor-Veenstra, E.; Steglich, W. Journal of the
Chemical Society, Perkin Transactions 1 2000, 2483-2489.
(7) Awakawa, T.; Yokota, K.; Funa, N.; Doi, F.; Mori, N.; Watanabe, H.; Horinouchi, S.
Chem Biol 2009, 16, 613-23.
(8) Bok, J. W.; Chiang, Y. M.; Szewczyk, E.; Reyes-Domingez, Y.; Davidson, A. D.; Sanchez,
J. F.; Lo, H. C.; Watanabe, K.; Strauss, J.; Oakley, B. R.; Wang, C. C.; Keller, N. P. Nat
Chem Biol 2009, 5, 462-464.
(9) Iwasaki, S.; Muro, H.; Sasaki, K.; Nozoe, S.; Okuda, S.; Sato, Z. Tetrahedron Letters
1973, 14, 3537-3542.
(10) Kendall, J. K.; Fisher, T. H.; Schultz, H. P.; Schultz, T. P. The Journal of Organic
Chemistry 1989, 54, 4218-4220.
(11) Evans, G. E.; Staunton, J. Journal of the Chemical Society, Perkin Transactions 1 1988,
755-761.
(12) Harris, T. M.; Murphy, G. P.; Poje, A. J. Journal of the American Chemical Society 1976,
98, 7733-7741.
(13) Yoshida, E.; Fujimoto, H.; Baba, M.; Yamazaki, M. Chemical & Pharmaceutical Bulletin
1995, 43, 1307-1310.
(14) Takahashi, T.; Jin, F. J.; Sunagawa, M.; Machida, M.; Koyama, Y. Appl Environ
Microbiol 2008, 74, 7684-93.
(15) Bergmann, S.; Schumann, J.; Scherlach, K.; Lange, C.; Brakhage, A. A.; Hertweck, C. Nat
Chem Biol 2007, 3, 213-7.
(16) Chiang, Y. M.; Szewczyk, E.; Nayak, T.; Davidson, A. D.; Sanchez, J. F.; Lo, H. C.; Ho,
W. Y.; Simityan, H.; Kuo, E.; Praseuth, A.; Watanabe, K.; Oakley, B. R.; Wang, C. C.
Chem Biol 2008, 15, 527-32.
(17) Fujii, I.; Ono, Y.; Tada, H.; Gomi, K.; Ebizuka, Y.; Sankawa, U. Mol Gen Genet 1996,
253, 1-10.
(18) Kennedy, J.; Auclair, K.; Kendrew, S. G.; Park, C.; Vederas, J. C.; Hutchinson, C. R.
Science 1999, 284, 1368-72.
(19) Gressler, M.; Zaehle, C.; Scherlach, K.; Hertweck, C.; Brock, M. Chem Biol 2011, 18,
198-209.
(20) Rzhetsky, A.; Nei, M. Molecular Biology and Evolution 1992, 9, 945-67.
(21) Felsenstein, J. Evolution 1985, 39, 783-91.
S13
(22) Zuckerkandl, E.; Pauling, L. Evolutionary divergence and convergence in proteins. Edited
in Evolving Genes and Proteins by V. Bryson and H.J. Vogel 1965, pp. 97-166. Academic
Press, New York.
(23) Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics. 2000, Oxford University
Press, New York.
(24) Saitou, N.; Nei, M. Molecular Biology and Evolution 1987, 4, 406-25.
S14
Figure S1. Diagnostic PCR strategies and representative results
a. Diagnostic PCR for a gene cluster replaced with the AfpyrG gene, in this case the
sterigmatocystin (ST) cluster. Strategies are shown diagramatically above. Primers P1 and P4
are beyond the ends of the ST cluster and primers P2 and P3 are within the AfpyrG sequence
that was used to replace the cluster. The ethidium bromide stained agarose gel below the
diagram shows results for one transformant in which the ST cluster was deleted as well as for a
parental control. Lane 1 shows bacteriophage λ digested with HindIII. Sizes of the fragments
(in kb) are given at the left. Lane 2 shows the results of a P1/P4 amplification of DNA from an
ST cluster deletant. Because the cluster has been deleted, P1 and P4 should be approximately 6
kb apart in the genome and a band of the correct size is amplified. Lane 8 is a PCR
amplification of DNA from the parental strain with the same primers. In the parental strain the
ST cluster is intact and the two primers are more than 50 kb apart. There is weak amplification
of several bands but none of the size predicted for the deletant. In the absence of strong,
specific amplification we often see weak amplification of several bands. Lanes 3 and 4 are
amplifications of deletant DNA with two primer sets (not shown) specific for genes within the
ST cluster. If the genes are present, strong bands of predictable sizes should be amplified.
There is weak, nonspecific amplification with one primer pair (lane 3) and no amplification with
the other (lane 4) indicating that the genes are absent. Lanes 9 and 10 show amplification of
parental DNA with the same primer pairs. The genes are present and bands of the expected
S15
sizes are amplified. Lanes 5 and 6 are amplifications of transformant DNA with P1 and P3 (lane
5) and P2 and P4 (lane 6). Strong bands of the expected sizes are amplified, indicating that the
cluster has been correctly replaced with AfpyrG. There is an additional weaker, lower band in
lane 5 that is also present in parental controls (lane 11). Lanes 11 and 12 show results with the
same primer pairs used to amplify parental DNA. Bands of the sizes expected for the cluster
deletion are not seen although some weaker bands are present.
b. Diagnostic PCR of a completely replaced cluster as created by the approaches shown in
Figure 1b and Supplemental Figure S2. The primers (red arrowheads) are from beyond the ends
of the transforming fragment. Amplification will only occur if the cluster is deleted and the size
of the PCR product can be predicted accurately. The gel below shows results obtained with the
monodictyphenone cluster. The primers used for amplification are outside of the two ends of
the cluster and they are 25,324 bp apart in the genome when the cluster is intact. Deletion of the
cluster leaves them 4015 pb apart. HindIII digests of bacteriophage λ DNA serves as size
standards. A band of the correct size is amplified in DNA from each of five transformants. In
transformant 3 the amplification is weaker as is sometimes the case when one uses miniprep
DNA. Amplification of wild-type DNA with the same primer set does not yield a band of the
size expected if the cluster is deleted but yields weak bands of a variety of sizes.
S16
c. Diagnostic PCR of the first gene transferred from a cluster (in this case a PKS) (see Figure 2
in the main text). Homologous recombination results in the correct reconstruction of the PKS
under the control of the alcA promoter [alcA(p)]. PCR primers (orange arrowheads) are
designed such that they anneal to regions outside of the zone of overlap. Amplification only
occurs if the overlapping fragments recombine correctly and the size can be predicted from
sequence information. In addition, correct integration results in the transforming strain
becoming pyr+, ribo
+ and in conidia becoming white. There are, thus, multiple indicators as to
whether correct integration has occurred. The ethidium bromide stained agarose gel below
shows results with the A. terreus PKS ATEG_02434 transferred into A. nidulans. The PCR
primers are specific for the A. terreus gene and are approximately 1000 bp apart in the gene.
Lane 1 is a HindIII digest of bacteriophage lambda. Sizes of the fragments (in kb) are listed at
the left. The 0.56 kb fragment is very faint. Lanes 2-4 show PCR amplifications from
transformants. All show a band of the correct size although the band in lane 2 is faint. Lane 5 is
S17
an amplification with the same primers of wild-type control DNA. As expected, no band is
amplified. Additional primer pairs may be used for additional verification.
d. Diagnostic PCR of genes transferred subsequently (see Figure 3 in the main text). Primers
(red arrowheads) are designed such that amplification will only occur if the second gene has
integrated correctly and the size of the amplified fragment can be predicted from sequence
information. The second integration also makes the transformed strain ribo- and pyro
+. The
ethidium bromide agarose gel below shows PCR amplification results with DNA from a strain
in which the A. terreus genes ATEG_02434 and ATEG_02438 have been inserted. One primer
is within ATEG_02434 (the PKS) and the second is within ATEG_02438 (Gene B). If the two
genes have been inserted correctly, a band of approximately 4400 bp will be amplified. Lane 1
is bacteriophage lambda DNA digested with HindIII. Fragment sizes (in kb) are shown at the
left. Lanes 2-5 show the results of PCR amplifications with four transformants. Two have a
band of the predicted size and thus have the two genes inserted correctly. Lane 6 is a wild-type
control and shows no specific amplification (a faint smear was visible in the original).
Additional primer pairs may be used for additional verification.
S18
Figure S2. An alternative secondary metabolite gene cluster deletion scheme. This scheme
is derived from one that was developed for Aspergillus sojae and Aspergillus oryzae by
Takahashi et al.14
a. A transforming fragment is generated by fusion PCR that includes two
sequences of ≈ 1 kb each from upstream of the target cluster (U1 and U2) as well as a ≈ 2 kb
sequence from downstream of the cluster (D) and AfpyrG as a selectable marker. Upon
transformation this fragment integrates upstream of the target cluster and the correct integration
is confirmed by diagnostic PCR. b. At a low frequency the duplicated sequences D undergo
homologous recombination with each other excising the target cluster. The loss of AfpyrG, and
thus excisants, can be selected for on 5-FOA. The result is a cleanly removed SM cluster and
since AfpyrG is removed, it can be reused as a selectable marker.
S19
S20
Figure S3. Phylogenetic analysis of PKSs from the genome of A. terreus. The optimal tree
with the sum of branch length = 18.70013344 is shown. The tree is drawn to scale, with branch
lengths in the same units as those of the evolutionary distances used to infer the phylogenetic
tree. Experimentally confirmed NR-PKSs such as A. parasiticus NSAS (AAS66004), A.
fumigatus PksP (CAA76740), P. brevicompactum MpaC (ADY00130), M. purpureus PksCT
(BAD44749), A. strictum MOS (CAN87161), and all NR-PKSs from A. nidulans;4 PKS-NRPSs
such as A. nidulans ApdA,15
A. fumigatus PsoA (EAL85113), A. flavus CpaA (BAI53678), and
C. bassiana TENS (CAL69597); HR-PKSs such as A. nidulans EasB,16
AfoG3, and
ANID_02035.14 were included in this tree. The polyketides of A. terreus ACAS,
7 MSAS,
17
LovB, and LovF18
have been addressed. The product of ATEG_00325.1 has been described
recently.19
Methods for Phylogenetic Analysis.
Amino acid sequences of NR-PKSs were obtained from National Center for Biotechnology
Information (NCBI) or the Broad Institute Aspergillus Comparative Database
(http://www.broadinstitute.org/annotation/genome/aspergillus_group/MultiHome.html).
Identification of KS, AT, ACP, CMeT, TE, and R domains was performed using the NCBI
Conserved Domain Database. Multiple sequence alignments were constructed using ClustalX
(http://www.clustal.org) with default settings and phylogenetic analyses were conducted using
MEGA5 (http://www.megasoftware.net). The evolutionary history was inferred using the
Minimum Evolution method.20
The bootstrap consensus tree inferred from 1000 replicates is
taken to represent the evolutionary history.21
The evolutionary distances were computed using
the Poisson correction method22
and are in the units of the number of amino acid substitutions
per site. The ME tree was searched using the Close-Neighbor-Interchange (CNI) algorithm23
at
a search level of 0. The Neighbor-joining algorithm24
was used to generate the initial tree.
S21
ATEG_02434: >A. terreus supercont_1.3 of Aspergillus terreus [DNA] 1516992-1517305 +
GACAACATGGGCAGCTAGGCCTTCGCTTACGAAGGAACAGGGACTTTCGATCCAACCTGC
ATGCGTATATTCCCAAGGGGTATGCATGCCCGCATAAAGAATGGCGGTCACAGACACATC
CTCGTGCGATACGTACATCAAGAACACATATAAAACTGTCGTGCGGGCACCAAACAGGCA
CTCCATACATGGCAAGATCAACACCGCAAGCATGAATGACAAACCGGCATTCAAGCTCTT
CTACTTTACCAACGAGAAGCCATCGGGTAATCCGAAAGAAGTGTTTCGTCGACTTCGTTC
TCACAGCAAAACCA
Originally annotated start codon Revised start codon ________________________________________________________________ ATEG_07500: >A. terreus supercont_1.11 of Aspergillus terreus [DNA] 259772-261045 -
TGAAGCATGTGCGTAACCCATGTCCGCTAGAATCTAAATTGAGGATTTAAGCAAAAGGAC
TCAACTCCGAGCGTTCATCCAGGTTTGGGTAACGACAACGATGAACGGAGACCATCCCGA
AGAACCATGCCAGGTCATCCTGTTTGGGGACTTGAGCCTAGTTAACATCAAAGACACACT
GAAGAACCTTCTCCATGTCAAGTCAAACCCTCTGCTAACATCTTTCTTTGCCCGCACGAA
TTATTCTCTACGCAGGCTATTGGAGAATCTATCCGGAGATCAACAAGCCCTTTTCCCTCG
TTTCACCACATTGATAGATCTTCTCGCGCGGTTTGGAGAGACACCGGGAACACCAACCCT
TGCTTTCTTTCTTCTATGTGTCCAACAAGTGGCACAATGCATCGTGTACATTTCTAGGTT
CCGTTTGGCGAGTGACATATGCTGATGGACACAGGCATTTCTCGACTGAAAATGACCACT
CGAGCATCTTCCCTCCAAGGAACACATATCTTATCGGTCCTTGCACTGGTGGCTTCTGCG
CAGCTGCATTGAGCTGTTCAACAAGTGTTTCAGACCTCGTGTCAAATGGCGTGGAGGTAT
CAATTAGTGCATTCAAAACAGCACTCCGCTCGTTTCTCGAAGCCAGTGCTATCTCACTCC
ATGACCCGTCATCGAGGAACAGTTGGGCCGCAGTGGTAACCCCATCAGGGAACGTTAGCC
TGGAGCAACTATTAACGGAATATACAGCAAGTTTTCTCTGATCTTTGCGTGGATCGTATC
TGACGGTGGATAGACCTCGACAACGCTTCATCAGCCCATGCATTGGACAAGCGCTCTCAC
CACCACCTCAACATGCACACTGAGTGGACGGCCTTCTAGGTTACGAGATTTCCTGGAGAC
AAACCAAGGCACATTGAAATATCGGTATCTGGAAATTGAATCACCATACCACGCCAGCAG
CCTGTTTGGTGACGCCGATGTTGAAGGCATTATTAATCATGTCGCAGATACGGCCAGGGC
ACCTCAAAGATCCCGCATACCGATTCTCTCATCCACAAGTGGTAGGATCATCCCAGAAGT
CGACTTCATAGGTCTGCTGCGTACGATTGTTCGTGAGACATTATGTGAACCCATTCGATG
GGACCTCATATTGGAATCGTGCCGTAGCTTAATGGCCAAGGAACATGGGAAAAAATGGAC
TATTTTACCATTCTCCAGCAATGCAACCGCGATGGTTGCGGCTGCCCTCACAAAGCAGAA
AGACATCCAGGTAA
Originally annotated start codon Revised start codon ________________________________________________________________ ATEG_08668: >A. terreus supercont_1.13 of Aspergillus terreus [DNA] 494265-494743 +
CAGCCTATAAGCTCTTTGTCGAGTTACTTGCGTGAGTTATCTCCATCATCCCCCATTTCT
AGCACTGATTGGTAAGTTATCAACTAGCATCCCCGGTTAGATGGTAAGTGCTCGAGGGCA
TACGTCGTGGGTGGAACAACAAAAGTATAACCTGTCTAGGATCGAGACTCAAAACCAGCT
S22
ATTCCATCGGGATCCGCGTATTCGTCGATTCATCGAGATAGGACCAAGGACGACGCTCTC
TACCATAGCCAAAAAATCCGCTGCAAAATATCATGCCTCTCATGCTCCATCGCAGTGGTC
AGACCTGCAGTTCTTGTCCTATCAAGAACACAAGGACGAGATCATCTACCGGTATTCAGA
TCCTTCTCAGGATGAAATGCCCTTTAGCAACAAAAAGTCGGAATCCCCGGGACCAGCTCT
TCCTGACCCCAACGTGCTACTGCCCGTGACCAGAGCAGCGGAGAAAGACACCAACCGTG
Originally annotated start codon Revised start codon _______________________________________________________________ ATEG_10080: >A. terreus supercont_1.16 of Aspergillus terreus [DNA] 378550-378768 -
GTTCCTCTCCCCAATGCGTTCTCCCTGCAATTTCTACCCTCCATCCACTCCCTGTCAGGT
TATCCCAACCAAGCGCTGCTGCCCGTTGTCCCTTCCCGACATGGGTTCACTACAGGATGC
CCATCCGCACCGCGTTTCAGTTCTATTCGGACCTAAATGCCCCAAGACTGATCGATCAGT
TCTGCATATACGCCGCTATCTTTCATCTCATAGAAATAC
Originally annotated start codon Revised start codon
Figure S4. New start codons tested for ATEG_07500.1, ATEG_02434.1, ATEG_10080.1, and
ATEG_08668.1. All sequences are from the Broad Institute Aspergillus comparative database.
S23
S24
S25
Figure S5. UV-Vis and ESIMS spectra of compounds 1 – 11 (negative mode) and 15 – 19
(positive mode).
S26
Figure S6. HMBC correlations (C → H) of compounds 6 and 7 in acetone-d6, and 17 – 19 in
CD3OD.
S27
Table S1. A. nidulans strains used for heterologous expression of NR-PKSs from A. terreus. Fungal strain or
transformant(s)
alcA promoter replaced
gene genotypes
LO4388, LO4389, LO4390 None pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆
LO4522, LO4524 ATEG_00145.1 pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_00145.1: AfriboB
LO4532, LO4533, LO4534 ATEG_07500.1 pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_07500.1: AfriboB
LO5977, LO5978, LO5979 ATEG_07500.1* pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_07500.1*: AfriboB
LO4537, LO4538, LO4539 ATEG_08451.1 pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_08451.1: AfriboB
LO4583, LO4587, LO4588,
LO4591, LO4593, LO4595,
LO4596, LO4597
ATEG_08451.1
ATEG_08450.1
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_08451.1: AlcA(p)-ATEG_08450.1-AfpyroA
LO5088, LO5089, LO5090 ATEG_02434.1 pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_02434.1: AfriboB
LO6243, LO6244, LO6249,
LO6250, LO6253, LO6254 ATEG_02434.1
ATEG_02438.1
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_02434.1: alcA(p)_ATEG_02438.1: AfpyroA
LO6169, LO6170, LO6171 ATEG_02434.1* pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_02434.1*: AfriboB
LO6214, LO6215, LO6223,
LO6229, LO6230
ATEG_02434.1*
ATEG_02438.1
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_02434.1*: alcA(p)-ATEG_02438.1: AfpyroA
LO4547, LO4548, LO4549 ATEG_10080.1 pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_10080.1: AfriboB
LO5408, LO5483, LO5485 ATEG_10080.1* pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_10080.1*: AfriboB
LO4527, LO4528, LO4529 ATEG_03629.1 pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_03629.1: AfriboB
LO5093, LO5094 ATEG_03432.1 pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_03432.1: AfriboB
LO5200, LO5201, LO5202 ATEG_07661.1 pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_07661.1: AfriboB
LO5283, LO5285 ATEG_07661.1
ATEG_07659.1
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_07659.1: alcA(p)-ATEG_07661.1: AfpyroA
LO5098, LO5099 ATEG_08662.1 pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_08662.1: AfriboB
LO5794, LO5795, LO5796,
LO5797, LO5798
ATEG_08662.1
ATEG_08667.1
ATEG_08668.1
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_08662.1: alcA(p)-ATEG_08668.1: alcA(p)-
ATEG_08667.1: AfriboB
LO6120, LO6121, LO6125,
LO6127, LO6130, LO6131,
LO6132, LO6135, LO6136,
LO6137
ATEG_08662.1
ATEG_08667.1
ATEG_08668.1*
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; wA::AfpyrG:
alcA(p)-ATEG_08662.1: alcA(p)-ATEG_08667.1: alcA(p)-
ATEG_08668.1*: AfriboB
* indicates that the start codon was reaannotated.
S28
Table S2. A. nidulans strains constructed in reconstituting the A. terreus asperfuranone biosynthesis pathway.
Fungal strain or
transformant(s)
A. terreus gene
transferred into A.
nidulans and placed
under control of
alcA(p)
genotypes
LO7020, LO7021, LO7022 none pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆
LO6751, LO6754 AteafoG, AteafoE pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;
wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoE: AfpyroA
LO6763, LO6764, LO6765,
LO6777, LO6778, LO6779
AteafoG, AteafoE,
AteafoF
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;
wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoE: alcA(p)-
AteafoF: AfriboB
LO6758, LO6759, LO6760,
LO6772, LO6773, LO6774
AteafoG, AteafoE,
AteafoD
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;
wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AfoafoE: alcA(p)-
AteafoD: AfriboB
LO6767, LO6768, LO6769,
LO6782, LO6783, LO6784
AteafoG, AteafoE,
AteafoC
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;
wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoE: alcA(p)-
AteafoC: AfriboB
LO7156, LO7157, LO7158,
LO7159 AteafoG, AteafoC
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;
wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoC: AfpyroA
LO6817, LO6838 AteafoG, AteafoE,
AteafoC, AteafoD
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;
wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoE: alcA(p)-
AteafoC: alcA(p)-AteafoD: AfpyroA
LO6853, LO6854
AteafoG, AteafoE,
AteafoC, AteafoD,
AteafoC
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;
wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoE: alcA(p)-
AteafoC: alcA(p)-AteafoD: alcA(p)-AteafoC: AfriboB
LO6864, LO6865
AteafoG, AteafoE,
AteafoC, AteafoD,
AteafoF
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;
wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoE: alcA(p)-
AteafoC: alcA(p)-AteafoD: alcA(p)-AteafoF: AfriboB
LO6843, LO6844, LO6848,
LO6849
AteafoG, AteafoE,
AteafoF, AteafoD,
AteafoC
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;
wA::AfpyrG: alcA(p)-AteafoG; alcA(p)-AteafoE; alcA(p)-
AteafoF: alcA(p)-AteafoD: alcA(p)-AteafoC: AfriboB
LO6855, LO6856, LO6859,
LO6860
AteafoG, AteafoE,
AteafoF, AteafoC,
AteafoD
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;
wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoE: alcA(p)-
AteafoF: alcA(p)-AteafoC: alcA(p)-AteafoD: AfriboB
LO 7160, LO7161, LO7162,
LO7163, LO7164
AteafoG, AteafoE,
AteafoF, AteafoC,
AteafoD, AteafoB
pyrG89; pyroA4; nkuA::argB; riboB2; stcA-W∆; afoA-G∆;
wA::AfpyrG: alcA(p)-AteafoG: alcA(p)-AteafoE: alcA(p)-
AteafoF: alcA(p)-AteafoC: alcA(p)-AteafoD: alcA(p)-
AteafoB: AfriboB
Multiple transformants were used in analyses of secondary metabolite production. AfriboB,
AfpyrG, and AfpyroA are A. fumigatus genes used for replacement of A. nidulans genes. All
strains were constructed in this study except for LO4389.4 There is no standard designation for
genes inserted in tandem so we have created the following designation: wA::AfpyrG: alcA(p)-
AteafoG: alcA(p)-AteafoE: AfpyroA means that the wA gene was replaced with (in order) AfpyrG,
AteafoG under control of alcA(p), AteafoE under control of alcA(p) and AfpyroA.
S29
Table S3. NMR data for compounds 6, 7, and 22 (400 and 100 MHz)
a
6 (acetone-d6) 7 (acetone-d6) 22 (CD3OD)b
position δC δH δC δH δC δH
1 131.2 (CH) 8.49 (1H, s) 126.0 (CH) 8.08 (1H, s) 125.4 (CH) 8.06 (1H, s)
2 124.9 (C) — 126.1 (C) — 125.0 (C) —
3 183.9 (C) — 185.2 (C) — 185.6 (C) —
4 122.3 (C) — 120.4 (C) — 119.6 (C) —
5 156.0 (C) — 155.1 (C) — 155.2 (C) —
6 180.8 (C) — 181.8 (C) — 181.0 (C) —
7 136.4 (C) — 131.3 (C) — 130.7 (C) —
8 115.8 (CH) 7.43 (1H, s) 112.9 (CH) 7.43 (1H, s) 111.4 (CH) 7.36 (1H, s)
9 166.0 (C) — 159.6 (C) — 158.7 (C) —
10 123.6 (C) — 140.0 (C) — 138.5 (C) —
11 206.5 (C) — 66.7 (CH) 5.23 (1H, q, 6.8) 68.3 (CH) 5.02 (1H, dd, 4.4, 3.2)
12 27.7 (CH3) 2.83 (3H, s) 24.3 (CH3) 1.46 (3H, d, 6.8) 37.2 (CH2) 1.66, 1.74 (each 1H, m)
13 8.9 (CH3) 2.01 (3H, s) 8.7 (CH3) 1.98 (3H, s) 25.3 (CH2) 1.27-1.32
14 31.7 (CH2) 1.27-1.32
15 22.5 (CH2) 1.27-1.32
16 13.2 (CH3) 0.89 (3H, t, 6.4)
17 7.3 (CH3) 1.99 (3H, s) aFigures in parentheses are multiplicities and coupling constants (J) in Hz.
bData obtained from our previous studies (Liu et al., J. Am. Chem. Soc. 2011, 133, 13314-13316).
S30
Table S4. NMR data for compounds 16, and 17 (400 and 100 MHz)a
16 (CD3OD) 17 (CD3OD)
position δC δH δC δH
1 154.6 (CH) 8.06 (1H, s) 65.1 (CH2) 4.80 and 4.86 (each 1H, d, 12.4)
2 116.8 (C) — 115.6 (C) —
3 198.6b (C) — 198.8 (C) —
4 84.5 (C) — 78.3 (C) —
5 198.8b (C) — 73.8 (CH) 3.91 (1H, dd, 10.0, 5.6)
6 107.1 (CH) 5.53 (1H, s) 35.6 (CH2) 2.40 (1H, m), 2.69 (1H, dd, 18.0, 5.6)
7 146.2 (C) — 151.6 (C) —
8 110.3 (CH) 6.47 (1H, s) 106.2 (CH) 5.55 (1H, s)
9 158.7 (C) — 162.7 (C) —
10 117.5 (CH) 6.19 (1H, d, 15.6) 119.8 (CH) 6.04 (1H, d, 15.6)
11 142.7 (CH) 7.06 (1H, d, 15.6) 141.7 (CH) 6.90 (1H, d, 15.6)
12 133.8 (C) — 134.0 (C) —
13 148.4 (CH) 5.66 (1H, br d, 9.6) 146.8 (CH) 5.53 (1H, br d, 7.2)
14 36.3 (CH) 2.50 (1H, m) 36.2 (CH) 2.47 (1H, m)
15 31.4 (CH2) 1.3 and 1.4 (each 1H, m) 31.4 (CH2) 1.3 and 1.4 (each 1H, m)
16 12.5 (CH3) 0.86 (3H, t, 7.6) 12.5 (CH3) 0.85 (3H, t, 7.2)
17 20.8 (CH3) 1.00 (3H, d, 6.8) 20.9 (CH3) 0.99 (3H, d, 6.4)
18 12.6 (CH3) 1.84 (3H, br s) 12.7 (CH3) 1.80 (3H, br s)
19 28.2 (CH3) 1.48 (3H, s) 18.4 (CH3) 1.23 (3H, s) aFigures in parentheses are multiplicities and coupling constants (J) in Hz.
bvalues assigned maybe interchanged.
S31
O
O
HO
OO
O
HO
1918
1
47
14
1516
171
4 12
1314
Table S5. NMR data for compounds 18, and 19 (400 and 100 MHz)a
18 (CD3OD) 19 (CD3OD)
position δC δH δC δH
1 168.2 (C) — 169.0 (C) —
2 n.o.b n.o.
b 99.8 (C) —
3 174.8 (C) — 168.1 (C) —
4 103.0 (CH) 6.04 (1H, s) 104.4 (CH) 6.12 (1H, s)
5 162.0 (C) — 158.4 (C) —
6 118.1 (CH) 6.14 (1H, d, 15.6) nob no
b
7 142.0 (CH) 7.09 (1H, d, 15.6) 196.5 (C) —
8 133.6 (C) — 124.4 (CH) 6.21 (1H, d, 15.6)
9 147.4 (CH) 5.63 (1H, br d, 9.6) 151.7 (CH) 7.37 (1H, d, 15.6)
10 36.3 (CH) 2.49 (1H, m) 133.7 (C) —
11 31.4 (CH2) 1.3 and 1.4 (each 1H, m) 152.4 (CH) 5.86 (1H, br d, 9.6)
12 12.5 (CH3) 0.87 (3H, t, 7.6) 36.5 (CH) 2.51 (1H, m)
13 20.8 (CH3) 1.01 (3H, d, 6.8) 31.2 (CH2) 1.3 and 1.4 (each 1H, m)
14 12.7 (CH3) 1.83 (3H, br s) 12.5 (CH3) 0.87 (3H, t, 7.2)
15 20.5 (CH3) 1.01 (3H, d, 6.4)
16 12.7 (CH3) 1.83 (3H, br s)
17 8.5 (CH3) 1.86 (3H, s) aFigures in parentheses are multiplicities and coupling constants (J) in Hz.
bn.o.: not observed due to deuterium exchangeable proton(s).
S32
O
O
HO
OO
O
HO
1918
1
47
14
1516
171
4 12
1314
Table S5 cont. NMR data for compounds 18, and 19 (400 and 100 MHz)a
18 (CDCl3) 19 (CDCl3)
position δC δH δC δH
1 166.9 (C) — 166.9 (C) —
2 90.2 (CH) 5.57 (1H, s) 99.7 (C) —
3 172.7 (C) — 165.3 (C) —
4 101.7 (CH) 5.98 (1H, s) 103.4 (CH) 6.15 (1H, s)
5 160.4 (C) — 155.5 (C) —
6 116.3 (CH) 5.95 (1H, d, 15.6) 44.6 (CH2) 3.73 (2H, s)
7 141.2 (CH) 7.13 (1H, d, 15.6) 194.9 (C) —
8 131.7 (C) — 122.7 (CH) 6.13 (1H, d, 15.6)
9 146.7 (CH) 5.60 (1H, br d, 9.2) 151.5 (CH) 7.29 (1H, d, 15.6)
10 34.8 (CH) 2.43 (1H, m) 131.9 (C) —
11 30.1 (CH2) 1.3 and 1.4 (each 1H, m) 152.5 (CH) 5.82 (1H, br d, 9.6)
12 11.9 (CH3) 0.83 (3H, t, 7.2) 35.3 (CH) 2.47 (1H, m)
13 20.2 (CH3) 0.98 (3H, d, 6.4) 29.8 (CH2) 1.3 and 1.4 (each 1H, m)
14 12.3 (CH3) 1.79 (3H, br s) 11.9 (CH3) 0.84 (3H, t, 7.2)
15 19.9 (CH3) 0.99 (3H, d, 6.4)
16 12.4 (CH3) 1.78 (3H, br s)
17 8.3 (CH3) 1.90 (3H, s) aFigures in parentheses are multiplicities and coupling constants (J) in Hz.
bData obtained form gHMBC correlations.
S33
1H NMR spectrum of compound 6 in acetone-d6.
S34
13
C NMR spectrum of compound 6 in acetone-d6.
S35
1H NMR spectrum of compound 7 in acetone-d6.
S36
13
C NMR spectrum of compound 7 in acetone-d6.
S37
1H NMR spectrum of compound 17 in CD3OD.
S38
13
C NMR spectrum of compound17 in CD3OD.
S39
1H NMR spectrum of compound 18 in CD3OD.
S40
13
C NMR spectrum of compound 18 in CD3OD.
S41
1H NMR spectrum of compound 18 in CDCl3.
S42
13
C NMR spectrum of compound 18 in CDCl3.
S43
1H NMR spectrum of compound 19 in CD3OD.
S44
13
C NMR spectrum of compound 19 in CD3OD.
S45
1H NMR spectrum of compound 19 in CDCl3.
S46
13
C NMR spectrum of compound 19 in CDCl3.