livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/silvamartinswal... ·...
TRANSCRIPT
![Page 1: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/1.jpg)
Evolutionary Genetics of Insecticide Resistance in Culex
quinquefasciatus
Thesis submitted in accordance with the requirements of the University of
Liverpool for the degree of Doctor in Philosophy
By
Walter Fabricio Silva Martins
October 2015
![Page 2: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/2.jpg)
Acknowledgements
I would like to thank my supervisors Professor Martin Donnelly and Dr Craig Wilding. I am
deeply grateful for their support, insight, patience and gentle guidance over developing this
project. I also want to thank Tiago Antão who acted as my interim supervisor over the last year
of this project and for his bioinformatics advice.
I am particularly grateful to Krishanthi Subramaniam, for all her help and advice in the
experimental work as well as for her friendship and kindness with non-related work issues.
I also must thank Emily Rippon and Keith Steen. I very much appreciate all their contribution,
enthusiasm and support to develop all the lab work related to this project. I am also grateful for
their friendship. I will miss all our morning scouse conversations and newspapers reading.
I am thankful to Lakis Liloglou for all his assistance with the copy number variation assay design
and data analysis as well as for the opportunity for conducting this work in his lab.
I would like to express my gratitude to Chris Clarkson and Henry Mawejje for help with the
bioassays. Especially, thankful to Henry for his crucial assistance with the Uganda field work.
I also wish to thank Ana Lopes, Florence Crombé, David Weetman, Lori Flood and Alison
Isaacs for their contribution and support during my stay in the vector biology group.
My very sincere thanks to Constância Ayres for her support with the CAPES foundation
fellowship.
I am grateful for the funding sources, the CAPES foundation and the department of biology,
Universidade Estadual da Paraíba.
Finally, I would like to express my profound gratitude to my parents Maria and João as well as
my brothers and “sisters” Paulo, Hamilton, Thayse and Karolyne for all their encouragement
and motivation. I am also thankful to Ione for all your kind assistance and a special friend Paul
for the encouraging chats as well as my liverpudlian family; De Morgan` s family, Roberta
Holmes, Lorena Zapana, Marika Curika, Rodrigo Fernandez and Ticiana Criddle. All of you
make my time in Liverpool much easier and enjoyable.
![Page 3: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/3.jpg)
i
Abstract
Culex quinquefasciatus mosquitoes play an important role in the transmission of
vector-borne diseases of public health importance including lymphatic filariasis (LF) as well
as many arboviruses. Insecticide-based approaches are one of the most important
interventions to mitigate disease burden; nevertheless increased resistance of vectors to
insecticides imposes a challenge for the sustainability and effectiveness of both current and
future vector control interventions. Hence, understanding the dynamics and likely
mechanisms underlying the evolution of resistance will be critical to effective decision-
making in insecticide resistance management strategies. The present study was set out to
investigate the genetic basis of insecticide resistance in C. quinquefasciatus from Uganda.
Two objectives were developed, 1) to investigate patterns of insecticide resistance across the
south of the country and how this might reflect local selection and genetic structure and 2) to
investigate the basis of the molecular mechanisms underlying resistance to all four classes of
insecticides recommended for vector control.
The population genetic study compared and contrasted microsatellite markers and
two resistance-associated loci (Vgsc-1014F and Ace1-119S). While no significant difference
in genetic diversity across populations were detected by microsatellites, higher frequency of
Vgsc-1014F compared to the Ace1-119S mutations was observed in all populations
suggesting that the Ugandan Eastern – Southwest populations are under a heterogeneous
selection pressure, which created a pattern of local adaptation in these populations.
Additionally, the copy number (CN) assay developed in this study indicated the presence of
CN variation in the voltage gated sodium channel (Vgsc) gene in about 10% of the individuals
assayed from these populations. Genotypic/phenotypic association tests conducted on
bendiocarb resistant-individuals suggested that this resistant phenotype was not underlying
solely by the 119S target-site mutation in the Ace-1 gene. Indeed, synergist bioassays show
an increase of mortality of around 25% in mosquitoes pre-exposed to either TTP or PBO,
indicating a possible resistance mediated by detoxification enzymes. Using a novel whole-
transcriptome microarray we profiled the bendiocarb-resistant phenotype and implicated two
P450s (Cyp-Cx1 and Cyp6n23) with the highest up-regulation expression compared to a
susceptible strain. Remarkably, the predicted Cyp-Cx1 is closely related to two P450s from
the family Cyp6, which were already validated in vitro as insecticide metabolizers in A.
gambiae and A. aegypti, which corroborates a likely association of metabolic resistance in
the investigated bendiocarb-resistant phenotype.
Taken together the results yielded by genomic and transcriptomic experiments
provide evidence that Ugandan C. quinquefasciatus mosquitoes are under heterogeneous
selection pressure imposed by insecticides from distinct classes, and that the evolution of
insecticide resistance is mediated by at least two main genetic mechanisms; target-site
mutations (Vgsc-1014F and Ace1-119S) as well as over-expression of detoxification
enzymes.
![Page 4: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/4.jpg)
ii
Table of Contents
Abstract ............................................................................................................................................. i
List of Tables ..................................................................................................................................... vi
List of Figures .................................................................................................................................. vii
List of Abbreviations ......................................................................................................................... xi
Chapter I – Background and Study design ..................................................................................... 1
1.1. Ecology and medical importance of Culex complex mosquitoes .............................................. 1
1.1.1 Ecology of Culex mosquitoes ............................................................................................... 1
1.1.2 Epidemiology of vector-borne diseases transmitted by Culex mosquitoes ........................ 3
1.1.3 Public health intervention toward diseases transmitted by Culex mosquitoes.................. 5
1.2. Insecticide-based tools applied for vector control.................................................................... 8
1.3. Molecular basis of insecticide resistance in mosquitoes .......................................................... 9
1.3.1 Target-site mutations in mosquito’s resistant phenotypes .............................................. 11
1.3.2 Molecular mechanisms of metabolic resistance ............................................................... 16
1.3.2.1 Cytochrome P450s (P450s) ............................................................................................ 16
1.3.2.2 Glutathione S-transferases (GSTs) ................................................................................. 18
1.3.2.3 Esterases......................................................................................................................... 20
1.3.2.4 Mechanisms underlying insecticide metabolic resistance ............................................. 21
1.4. Evolution of insecticide resistance in Culex mosquitoes and impact on vector control ......... 22
1. 5. Aims and study design ............................................................................................................ 29
Chapter II – Development of Microsatellite Multiplex Panels for Population Genetic Analysis of the
Lymphatic Filariasis Vector Culex quinquefasciatus ..................................................................... 31
2.1Abstract ..................................................................................................................................... 31
2.2 Introduction .............................................................................................................................. 31
2.3 Materials and methods ............................................................................................................ 32
2.3.1 Samples and species identification ................................................................................... 32
2.3.2 Microsatellite isolation and primer design ....................................................................... 33
2.3.3 Microsatellite reactions ..................................................................................................... 34
2.3.4 Mutiplex development and amplification ......................................................................... 34
2.3.5 Data analysis ...................................................................................................................... 35
2.4 Results and discussion .............................................................................................................. 36
![Page 5: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/5.jpg)
iii
Chapter III - Local selection in the presence of high levels of gene flow: Evidence of heterogeneous
insecticide selection pressure across Ugandan Culex quinquefasciatus populations ..................... 43
3.1 Abstract .................................................................................................................................... 43
3.2 Introduction .............................................................................................................................. 44
3.3 Materials and methods ............................................................................................................ 47
3.3.1 Area of study and mosquito collection ............................................................................. 47
3.3.2 DNA isolation and Species identification .......................................................................... 48
3.3.3 Allelic discrimination assays of insecticide target-site mutations .................................... 49
3.3.4 Detection of Ace-1 gene duplication by haplotype diversity ............................................ 52
3.3.5 Microsatellite genotyping ................................................................................................. 52
3.4 Results ...................................................................................................................................... 54
3.4.1 Frequency of target-site resistant alleles .......................................................................... 54
3.4.2 Ace-1 haplotype diversity and identification of allelic copy variation .............................. 59
3.4.3 Microsatellite genotyping ................................................................................................. 62
3.4.3.1Genetic diversity ............................................................................................................. 62
3.4.3.2 Population structure ...................................................................................................... 65
3.5 Discussion ................................................................................................................................. 67
3.5.1 Pattern of insecticide target-site mutations ..................................................................... 67
3.5.2 Population structure and heterogeneous evolution of insecticide resistance ................. 71
3.6 Conclusion ................................................................................................................................ 75
Chapter IV - Comparative analysis of PCR-based methods for inference of copy number
polymorphism in the sodium channel gene of Culex quinquefasciatus mosquitoes ...................... 77
4.1 Abstract .................................................................................................................................... 77
4.2 Introduction .............................................................................................................................. 78
4.3 Material and methods .............................................................................................................. 80
4.3.1 Sample collection and DNA isolation ................................................................................ 80
4.3.2 Characterization of Vgsc haplotype diversity .................................................................... 80
4.3.2.1 Kdr mutation (L1014F) allelic discrimination assays ...................................................... 80
4.3.2.2 Haplotype diversity characterization ............................................................................. 81
4.4.3 Vgsc gene CN assignment by PCR-based assay ................................................................. 82
4.4.3.1 Vgsc -CN primer design and validation .......................................................................... 83
4.4.3.2 Copy number assignment using qPCR ............................................................................ 84
![Page 6: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/6.jpg)
iv
4.4.3.3 Copy number assignment by ddPCR .............................................................................. 85
4.4.3.4 Copy number assignment using Pyrosequencing .......................................................... 86
4.4. Results ..................................................................................................................................... 87
4.4.1 Vgsc gene haplotype diversity and genotype constitution ............................................... 87
4.4.2 Copy number assignment of the Vgsc gene based on PCR-methods ............................... 92
4.4.2.1 Primer design ................................................................................................................. 92
4.4.2.2 qPCR ............................................................................................................................... 93
4.4.2.3 ddPCR ............................................................................................................................. 97
4.4.2.4 Vgsc-RQPS ...................................................................................................................... 98
4.4.3 Comparison between the calculated CN across the different methods ........................... 99
4.5 Discussion ............................................................................................................................... 102
Chapter V - Molecular mechanisms driven resistance to carbamates insecticides in Ugandan Culex
quinquefasciatus mosquitoes ......................................................................................................... 108
5.1 Abstract .................................................................................................................................. 108
5.2 Introduction ............................................................................................................................ 109
5.3 Materials and methods .......................................................................................................... 112
5.3.1 Sample collection ............................................................................................................ 112
5.3.2 Insecticide susceptibility test .......................................................................................... 112
5.3.3 Synergist assays ............................................................................................................... 113
5.3.4 Ace- 1 genotyping of bendiocarb phenotyped mosquitoes ............................................ 114
5.3.5 Microarray ....................................................................................................................... 114
5.3.5.1 Construction of the 8 X 60K array and study design .................................................... 114
5.3.5.2 RNA extraction, labelling and hybridization ................................................................. 117
5.3.5.3 Data analysis ................................................................................................................. 118
5.3.6 RT-qPCR validation .......................................................................................................... 119
5.3.7 Manual annotation of the CYP6D3 gene ......................................................................... 120
5.4 Results .................................................................................................................................... 122
5.4.1 Insecticide susceptibility status ....................................................................................... 122
5.4.2 Frequency of Ace-1 resistant allele on bendiocarb selected mosquitoes ...................... 124
5.4.3 Gene expression profiling of bendiocarb selected mosquitoes ...................................... 124
5.4.4 Candidate gene validation by qPCR ................................................................................ 131
5.4.5 CYP6D3 gene annotation ................................................................................................ 133
![Page 7: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/7.jpg)
v
5.5 Discussion ............................................................................................................................... 136
5.6 Conclusion .............................................................................................................................. 140
Chapter VI – Conclusion ........................................................................................................... 141
Appendices ................................................................................................................................... 147
Appendix3-A ................................................................................................................................. 148
Appendix 3-B ................................................................................................................................ 150
Appendix3-C ................................................................................................................................. 152
Appendix 3-D ................................................................................................................................ 153
Appendix 4-A ................................................................................................................................ 154
Appendix 4-B ................................................................................................................................ 156
Appendix 4-C ................................................................................................................................ 157
Appendix 4-D ................................................................................................................................ 160
Appendix 4-E ................................................................................................................................ 161
Appendix 5-A ................................................................................................................................ 162
Appendix 5-B ................................................................................................................................ 163
References .................................................................................................................................... 164
![Page 8: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/8.jpg)
vi
List of Tables
Table 2.1: Characteristics of polymorphic microsatellites from Culex quinquefasciatus collected in two
field populations from Uganda. .............................................................................................................. 37
Table 3.1: Primers and probes for screening the Ace-1 and Kdr mutations in the Ace-1 and Vgsc genes,
respectively in Culex quinquefasciatus mosquitoes. .............................................................................. 51
Table 3.2: Ugandan Culex quinquefasciatus populations and genotypes of the target-site mutations
G119S and L1014F ................................................................................................................................ 57
Table 3.3: Sample sizes and indices of genetic diversity at 26 microsatellite loci for four Ugandan C.
quinquefasciatus populations. ................................................................................................................ 65
Table 5.1: PCR primers used for qPCR gene expression analysis ...................................................... 120
Table 5.2: Primer sequences for amplification and sequencing of the Cyp6d3 genomic region ......... 121
Table 5.3: Most differentially expressed genes from microarray analysis comparing Uganda resistant,
sympatric controls and TPRI susceptible mosquitoes. ......................................................................... 127
![Page 9: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/9.jpg)
vii
List of Figures
Figure 1.1: Global distribution of C. pipiens complex mosquitoes. C. p. pipiens composition may
include both forms (pipiens and molestus). .............................................................................................. 3
Figure 1.2: Impact of molecular mechanisms in insecticide cross-resistance. GSH, glutathione; AchE,
acetylcholinesterase; circle size reflects relative impact of mechanism of resistance. .......................... 11
Figure 2.1: Electropherograms of the five multiplex panels depicting amplification profile and loci
size distribution. Horizontal axis shows the size in base pairs (bp). Numbers above the peaks are the
allele size. ............................................................................................................................................... 39
Figure 2.2: Proportion of amplification and expected heterozygosity in each six-plex panel. %
amplification: proportion of samples per reaction that amplified for all loci. Box plot includes expected
heterozygosity from the 25th to the 75th percentile; the horizontal line within the box represents the
median value. Lines outside the box represent the lowest and highest value. ....................................... 40
Figure 3.1: Geographic distribution of field-collected Ugandan C. quinquefasciatus mosquitoes. ...... 48
Figure 3.2: Genetic variability for the L1014F and G119S target-site mutations in C. quinquefasciatus
mosquitoes from Uganda. A) Geographic distribution of target-site mutations. Pie charts depict the
relative frequencies of L1014F and G119S mutation in the Vgsc and Ace-1 gene, respectively. B)
Target-site mutations genotypic frequency. ........................................................................................... 56
Figure 3.3: Genotyping by pyrosequencing of the Vgsc-L1014F mutation in C. quinquefasciatus. A
and B) Allelic Vgsc-L1014F pyrogram showing two heterozygous genotypes: wild-type/resistant and
resistant/resistant C) Vgsc-L1014F allelic genotyping with a pattern of tri-allelic pyrogram indicating
likely gene duplication due to simultaneous presence of A, C and T alleles, instead of two alleles
expected for a diploid genome. D) Frequency of tri-allelic genotype across Ugandan population. ...... 58
Figure 3.4: Ace-1 gene haplotype diversity based on sequences obtained from C. quinquefasciatus
mosquitoes sampled in Uganda. A) polymorphic sites identified in a 535 bp partial fragment (intron 2
and exon 3) of Ace-1. Bold number indicates the position of the G119S mutation in exon 3. B)
Minimum spanning Network built using sequences of a partial fragment of the Ace-1 gene. Each
haplotype is represented by a circle, whose size is proportional to the number of individuals showing
that haplotype. Haplotypes are coloured to differentiate haplotypes containing the susceptible allele
(Orange) and resistant allele (green). Hatch marks represent mutational steps separating observed
haplotypes. ............................................................................................................................................. 60
Figure 3.5: Dendrogram constructed using partial sequence of the Ace-1 gene from C.
quinquefasciatus individuals with a likely duplicated haplotype. Red and green dots correspond to
susceptible and resistant G119S haplotypes, respectively. Haplotypes are labelled Cx followed by a
number corresponding to an individual identifier and a letter from A to I to identify an individual
sequenced colony from that individual. Haplotype labels highlighted in blue, green or orange are
individuals with more than two haplotypes. ........................................................................................... 61
Figure 3.6: Characterization of microsatellite markers. A) Genetic diversity estimates across Ugandan
C. quinquefasciatus populations determined from data of 26 microsatellite markers. Allelic richness
was calculated based on sample size of N=33. B) Test of microsatellite markers deviation from neutral-
![Page 10: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/10.jpg)
viii
equilibrium model using FST outlier approach. Each dot represents a microsatellite locus and red dots
identify candidate loci under positive selection. .................................................................................... 64
Figure 3.7: Genetic differentiation estimates among the four C. quinquefasciatus populations based on
allele frequencies of 26 microsatellite markers. A) Pair wise Fst matrix among the four populations B)
Regression of population pairwise linearized Fst values with geographic distances. C) First and second
PCs of the DAPC. Inferred populations clusters are indicated by ellipses, which model 95% of the
corresponding variability. D) Bayesian cluster analysis. Diagrammatic representation of population
clusters for the most likely K (K = 3), where each vertical bar represents an individual and each colour
represents the probability of belonging to one of the three clusters. ...................................................... 67
Figure 4.1: Schematic depicting the different approaches applied for genotyping and validation of the
Vgsc gene copy number in C. quinquefasciatus mosquitoes. qPCR-Std-curve and ddPCR-CN method
applied an absolute quantification measurement, while qPCR-ΔΔCt and pyrosequencing- RQPS use a
relative CN quantification. RQPS; Reference Query pyrosequencing and ddPCR Droplet Digital PCR.
Ct, intersection between an amplification curve and a threshold line. ................................................... 83
Figure 4.2: Haplotype diversity based on partial sequence of the Vgsc gene from Ugandan C.
quinquefasciatus A) Scatter plot of TaqMan-based allelic discrimination of the TTA/TTC codons for
1014F mutation B) Haplotype network of the Vgsc gene. Circles denote the relative number of samples
represented in each haplotype. The branches between black dots represent mutational steps separating
observed haplotypes. C) Dendrogram of individuals with a likely duplication of the Vgsc gene. (Cx
number) corresponds to an individual and the following letter from A to I means the number of distinct
colony sequenced per sample. Individuals highlighted in blue indicate mosquito with more than two
haplotypes. Green, red and orange dots correspond distinct alleles for the mutation 1014F. ................ 89
Figure 4.3: Multiple sequence alignment of the partial fragment of the Vgsc gene. Alignment was
performed using the ClustalW multiple sequence alignment program. Underlined regions in blue and
black correspond to primer and probe biding sites of the QRPS and qPCR and ddPCR assays,
respectively ............................................................................................................................................ 91
Figure 4.4: Copy number variation assay validation. A) Efficiency of primers and probes on duplex
PCR reactions assessed by standard curve with 2-fold DNA dilution. B) Vgsc-CN assay intra-
experiment reproducibility comparing triplicates of gDNA with unknown CN in three independent
experiments.1/2 and 1/3 correspond to correlation between experiments 1 and 2 and 1 and 3. ............ 93
Figure 4.5: qPCR amplification of the Vgsc-Pka plasmid serial dilution for absolute quantification
using the qPCR-Std method. A and B panels, shows the standard curve amplification for the Vgsc and
Pka gene, respectively. Red square on the standard curve correspond to the five points of the serial
dilution ranging from 3 x 105 to 101 copies/µl, whereas blue square correspond to quantification of
samples with unknown copy number. .................................................................................................... 95
Figure 4.6: CN prediction across different methods. A) Scatterplot of predicted CN per individual and
genotyping method. Each dot represents the CN predicted for each individual, predicted CN
correspond to calculated number without correction to expected CN. The black lines shows the mean
of predicted CN. B) Direct comparison of the predicted CN frequency across different methods
applied. C) Merged CN frequency from different platforms applying the criteria of overlapping
prediction of CN by > 2 distinct methods. Error bars shows the 95% confidence intervals. ................. 96
![Page 11: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/11.jpg)
ix
Figure 4.7: ddPCR CN prediction in Uganda Culex quinquefasciatus mosquitpes A) Merged of
replicate calculated CN. The error bars represent Poisson 95% confidence interval. B) 2-D amplitude
plot of the Vgsc and Pka showing satisfactory PCR condition to identify four well defined droplets
populations. ............................................................................................................................................ 98
Figure 4.8: Bland-Altman plot showing the difference between the predicted CN of qPCR methods
and RQPS against the ddPCR CN prediction. Each blue dot represents individuals CN difference. Dash
green line correspond to mean difference, while the dash red lines shows the 95% limits of agreement.
.............................................................................................................................................................. 101
Figure 5.1: Overview of Culex quinquefasciatus whole-transcriptome analysis. A) Design of the 8 x
60K Agilent microarray. CpipJ1; consensus gene set of the automated gene prediction from the C.
quinquefasciatus Johannesburg strain genome sequence. EST; expressed sequence tags. GSTD1,
Glutathione S transferase D1. CV probe; coefficient of variation. B) Interwoven hybridization loop
design for comparison between bendiocarb-exposed, non-exposed Ugandan field-collected mosquitoes
and the TPRI susceptible strain. Circles represents pools of 10 females: C; Uganda non-exposed
mosquitoes (sympatric control), R; Uganda Resistant mosquitoes and TPRI (Tropical Pesticides
Research Institute); C. quinquefasciatus susceptible strain from Tanzania. ........................................ 116
Figure 5.2: Insecticide susceptibility status of C. quinquefasciatus from Tororo, Uganda. Bioassay
results following exposure to WHO insecticide treated papers at standard conditions and effect of
insecticide synergists on the susceptibility status. Error bars represent 95% CI. PBO; piperonyl
butoxide, DEM; diethyl maleate, TPP; triphenyl phosphate. ............................................................... 123
Figure 5.3: Ace1-G119S allele genotyping and bendiocarb-selected (4h) mosquitoes association test.
A) Ace-1 allelic and genotypic frequencies B) Association of the Ace-1 genotype and bendiocarb
resistant phenotype. GG, GS and SS correspond to homozygous and heterozygous genotypes for the
ace1-G119S locus. ............................................................................................................................... 124
Figure 5.4: Candidate genes differentially transcribed in C. quinquefasciatus bendiocarb selected
mosquitoes. A) Changes of gene expression between the three groups (Uganda exposed, Uganda un-
exposed and TPRI) presented as a volcano plot. B, C and D Scatter plots showing representative GO
term clusters (cellular component, biological process and molecular function, respectively) of
differentially expressed transcripts with FDR>2.0. labeled circles are GO terms with frequency higher
than 5%, while circles size indicates the frequency of the GO term compared to Drosophila
melanogaster Go term enrichment. ...................................................................................................... 129
Figure 5.5: Go term enrichment analysis based on significantly differentially expressed probes with a -
log false-discovery rate (FDR) > 2 obtained from the ANOVA among three groups (Uganda exposed
and non-exposed (sympatric control) and TPRI susceptible strain. ..................................................... 130
Figure 5.6: Transcriptomic profile of differentially expressed genes with fold-change >2 in Uganda
exposed and sympatric mosquitoes compared to TPRI. A) Venn diagram showing the overlap of up-
and down-regulated transcripts between the three groups. B) Comparison of the number of GO terms
identified by each pair-wise comparison. C) GO term enrichment of up-regulated transcripts between
the groups with frequency higher than 2%. .......................................................................................... 131
![Page 12: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/12.jpg)
x
Figure 5.7: Standard curve from primers used on real-time PCR for microarray candidate genes
validation. Squares correspond to 1x10 serial dilution of cDNA. qPCR efficiency (Eff) and coefficient
of determination (Rsq) were calculated for each prime based on two replicates. ................................ 132
Figure 5.8: Pair wise comparison of microarray and qPCR data based on gene expression profile for
three genes found to be significantly different expressed between Uganda exposed, non-exposed
mosquitoes (sympatric control) and TPRI susceptible strain ............................................................... 132
Figure 5.9: Cyp6d3 predicted gene structure and annotation. A) Output of the VectorBase genome
browse suggested a gene architecture with four exons and three introns. B) Schematic representation of
the Cyp6d3 after re-annotation using Augustus software, which indicates two distinct genes here
named Cyp-Cx1 (g1.t1) and Cyp-Cx2 (g2.t1). C) Unrooted distance neighbour joining tree showing
phylogenetic relationship of the predicted gene CYPCx1 from C. quinquefasciatus to A. aegypt and A.
gambiae cytochrome P450s from the CYP6 gene family. The percentage of bootstrap confidence
values from 1000 replicates is shown at the nodes. ............................................................................. 134
Figure 5.10: Nucleotide and amino acid sequences of Cyp-Cx1 (g1.t1) and Cyp-Cx2 (g2.t1) genes after
re-annotation of the Cyp6d3 gene using Augustus software. ............................................................... 135
![Page 13: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/13.jpg)
xi
List of Abbreviations
Ace Acetylcholinesterase
AWDI Alternative Wet and Dry Irrigation
BIC Bayesian Information Criterion
CNP Copy Number Polymorphism
CNV Copy Number Variation
DAPC Discriminant Analysis of Principal Components
ddPCR Digital Droplet PCR
DEC Diethylcarbamazine
DEM Diethyl Maleate
FIS Inbreeding Coefficient
GABA Gamma-Aminobutyric Acid
GO Gene Ontology
GPELF Global Program to Eliminate Lymphatic Filariasis
GSTs Glutathione S-transferases
HE Expected Heterozygosity
HO Observed Heterozygosity
HWE Hardy-Weinberg Equilibrium
IBD Isolation-By-Distance
IRS Indoor Residual Spraying
ITNs Insecticide-Treated Bed Nets
JEV Japanese Encephalitis Virus
kdr Knockdown resistance
LLITNs Long Lasting Insecticide-Treated Bednets
LF Lymphatic Filariasis
MDA Mass Drug Administration
MF Microfilaria
Ne Effective Population size
NTDs Neglected Tropical Diseases
P450 Cytochrome P450
PBO Piperonyl Butoxide
PIC Polymorphism Information Content
qPCR Quantitative PCR
Rdl Resistance to Dieldrin
RQPS Reference Query Pyrosequencing
Rs Allelic Richness
RT-qPCR Reverse transcription Quantitative PCR
RVF Rift Valley Fever
![Page 14: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/14.jpg)
xii
SLEV Saint Louis Encephalitis Virus
SNPs Single Nucleotide Polymorphisms
TFBS Transcription Factor Binding Sites
TPP Triphenyl Phosphate
TPRI Tropical Pesticides Research Institute
ULV Ultra Low Volume
Vgsc Voltage-Gated Sodium Channel
WNV West Nile virus
![Page 15: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/15.jpg)
1
CHAPTER I Chapter I – Background and Study design
Background and Study Design
1.1. Ecology and medical importance of Culex complex mosquitoes
1.1.1 Ecology of Culex mosquitoes
With more than 700 species, the genus Culex is the largest within the family Culicidae,
containing a vast number of species which have the capacity to transmit lymphatic
filariasis (LF), as well as arboviruses such as West Nile virus (WNV), Japanese
Encephalitis Virus (JEV), Rift Valley Fever (RVF) and Saint Louis Encephalitis Virus
(SLEV) (Farajollahi et al. 2011, Harbach 2011). The subgenus Culex includes most of the
species of public health importance with around 16 of the 198 species recognized as
vectors of pathogens to humans, with seven of the species belonging to the Culex pipiens
complex: Culex pipiens, Culex quinquefasciatus, Culex australicus, Culex globocoxitus,
Culex molestus, Culex pallens and Culex torrentium being the most relevant for the
burden transmission of these diseases (Knight 1978, Becker et al. 2010, Harbach 2012).
Although the term pipiens complex will apply here as well as is used in most of the recent
publications, recent works have also suggested the use of the term Culex pipiens
assemblage to avoid taxonomic connotation as the degree of relationship among these
species is not yet clearly defined (Harbach 2012).
![Page 16: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/16.jpg)
2
Notwithstanding their global distribution, the species within the Culex pipiens
complex have different preferential habitats across tropical, temperate and sub-temperate
regions (Figure 1.1) (Hesson et al. 2011, Russell 2012). Indeed, the geographic
distribution and ecological features of these species impacts on their primary medical
importance. Among species of the Culex pipiens complex, differences in aspects of
behavior, such as distinct feeding preference (ornithophily / mammophily); and ability to
complete a gonotrophic cycle without blood feeding (anautogenous / autogenous), are
reflected in the vectorial capacity of each species (Vinogradova 2000, Fonseca et al. 2004,
Gomes et al. 2009, Farajollahi et al. 2011).
Additionally, the apparent high adaptability of mosquitoes of the complex to a wide
variety of breeding sites such as sewerage systems, polluted and fresh water, and artificial
containers, as well as the ability to feed on a variety of vertebrate blood types, enables
successful adaptation to both rural and urban locations (Reusken et al. 2010, Farajollahi
et al. 2011). This habitat flexibility, which allows a closer connection between Culex
mosquitoes and human populations, makes these species a highly efficient system for
bridging pathogen transmission from animal reservoirs to humans (Bowman 2014).
![Page 17: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/17.jpg)
3
Taken from (Farajollahi et al. 2011)
Figure 1.1: Global distribution of C. pipiens complex mosquitoes. C. p. pipiens
composition may include both forms (pipiens and molestus).
1.1.2 Epidemiology of vector-borne diseases transmitted by Culex
mosquitoes
Although highly adapted to a wide diversity of habitat conditions, Culex spp.
composition and their public health relevance contrasts greatly among ecozones (Hesson
et al. 2011). Among the vector-borne diseases with worldwide medical relevance, Culex
species play an important role in the transmission of arboviruses and filarial worms,
mainly in tropical and sub-tropical regions (Alatoom and Payne 2009, WHO 2012a,
Schmidt et al. 2013).
At present, arboviruses transmitted by Culex mosquitoes belong almost exclusively to
two genera: Flavivirus; which are viruses with single, positive-strand RNA (eg JEV and
WNV) and Phlebovirus, viruses with single, negative-strand RNA (eg RVFV)
(Mukhopadhyay et al. 2005, Pepin et al. 2010, Lequime and Lambrechts 2014). Among
these arboviruses, only WNV has a worldwide distribution, while SLEV is endemic in the
American continent and JEV and RVF are geographically spread throughout South-east
![Page 18: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/18.jpg)
4
Asia, sub-Saharan Africa and Arabia (Kramer et al. 2008, Weissenböck et al. 2010,
Ikegami and Makino 2011). The majority of WNV infections in the Western hemisphere
have been reported in the United States. Since the virus was first detected in New York
City in 1999, more than 37,000 cases have been reported, with around 7,000 classified as
neuroinvasive disease, 9,000 as West Nile fever like (WNF) and 770 deaths (Hayes et al.
2005, Kilpatrick et al. 2006, Roehrig 2013).
Furthermore, C. quinquefasciatus is responsible for most of the urban transmission
burden of lymphatic filariasis (LF), recognized as the second largest cause of disability
globally and with a heavy social and economic impact in endemic regions (Chandy et al.
2011, van den Berg et al. 2013). LF, caused by three species of filarial worms Brugia
malayi, Brugia timori and Wuchereria bancrofti, is a parasitic infection broadly spread
throughout 83 endemic countries of the tropical and sub-tropical regions, resulting in one
fifth of the world`s population being at risk of infection and more than 100 million people
infected in Asia, Africa and the Americas (Ottesen 2006, Ichimori et al. 2014). The socio-
economic and public health impact of LF in endemic regions results from a wide range of
clinical symptoms including chyluria, tropical pulmonary eosinophilia and adenopathy
(Huppatz et al. 2009).The large disability rate of LF as reported in Africa and Southeast
Asia, ranging from 2.3 to 3.5 million DALYs (disability-adjusted life-years), reflects
mostly the long term disability related to lymphoedema, elephantiasis and hydrocele,
which is caused by the blocking of the lymphatic system due to deposition of adult worms,
especially in the lower limbs (Chandy et al. 2011, van den Berg et al. 2013).
![Page 19: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/19.jpg)
5
1.1.3 Public health intervention toward diseases transmitted by Culex
mosquitoes
Due to the socio-economic and human health impact of vector-borne diseases
transmitted by Culex species, development of control interventions is imperative in order
to block transmission and prevent outbreaks in endemic regions. Despite the similar
patterns of transmission of the arboviruses and parasite-caused diseases through bites of
infected Culex species, distinct epidemiological control strategies have been applied for
different diseases and geographic locations (Spinsanti et al. 2003, Batallán et al. 2015).
Public health risk management for arboviral diseases such as JEV and WNV have
typically applied vaccination as the main strategy to prevent outbreaks in endemic regions
(Schmidt et al. 2013). For these arboviruses, vaccines are available to immunize either the
animal or human host, but are not suitable for vaccination of both. For example, there are
four vaccines licensed for WNV; however, they are exclusively used for the epizootic host
(Kramer et al. 2008). Likewise, the pillar for JEV vaccination campaigns is human
immunization using one of two vaccines available (Erlanger et al. 2009), while
vaccination of animal hosts (e.g. pigs) is an alternative strategy of control; although two
drawbacks for swine vaccinations exist; 1) requirement of annual vaccination and 2) low
effectiveness of attenuated vaccines for young animals (Wada 1988). Despite the
availability of specific vaccines to prevent outbreaks of arboviruses transmitted by Culex
spp, vector control intervention is still an imperative approach to mitigate burden
transmission of arboviruses in endemic regions. Control programs against Culex mosquito
populations include a wide range of approaches based on different methods (e.g
biolarvicides, insect-growth regulators and insecticides) and strategies (e.g. indoor
![Page 20: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/20.jpg)
6
residual spraying (IRS), long lasting insecticide-treated bednets (LLITNs and aerial fog)
(Keiser et al. 2005, Takken and Knols 2009).
Successful campaigns of Culex spp control for preventing and reducing arboviruses
outbreak have been broadly reported across endemic regions. For example, vector control
through aerial and ground use of Ultra-Low Volume (ULV) applications with Naled (1,2-
dibromo-2,2-dichloroethyl dimethyl phosphate) in Louisiana, US resulted in up to 10-fold
reduction of C. quinquefasciatus population density over the intervention term, together
with a dramatic drop in the number of WNV human cases (Palmisano et al. 2005). Also
in the USA, during the 2005 WNV epidemic in Sacramento County, California, aerial
spraying with pyrethrins had a strong impact on the control of a WNV epidemic, which
resulted in a decrease of both vector population density (C. pipiens and C. tarsalis) and
WNV infection rates by 50% between sprayed and unsprayed areas within the county
(Macedo et al. 2010). Furthermore, in the same epidemic outbreak in Sacramento in 2005,
a different intervention using sprays of pyrethrins combined with piperonyl butoxide
(PBO), an insecticide synergist, was effective at reducing both mosquito populations and
the number of human WNV positive infections (Carney et al. 2008).
Moreover, although vaccination campaigns for human and swine populations have
almost eliminated the incidence of JEV in countries such as Japan, Korea and Taiwan (van
den Hurk et al. 2009), vector control interventions have also played an important role to
minimize the JEV transmission cycle, especially in endemic rural settlements, where
immunization campaigns is a challenge to reducing human vaccination rate (Hills and
Phillips 2009). Additionally, in Asian rural endemic regions, mosquito control
interventions have also been a key element to prevent and reduce the density of Culex
mosquitoes populations across regions with large rice fields; distinct control approaches
![Page 21: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/21.jpg)
7
using biological larvicides and invertebrate predators to reduce vector-population density
by limiting breeding sites, including changes in agricultural practices, such as wet and dry
irrigation (AWDI), have reduced JEV transmission (Keiser et al. 2005, Kumari et al.
2014).
In contrast to the vaccination approach used to control the arboviruses transmitted by
Culex mosquitoes due to the absence of vaccines for preventing filarial worm infections,
anti-filarial chemotherapy was chosen as the primary intervention to reduce infective
microfilaria prevalence in endemic regions (WHO 2005). This strategy is a worldwide
programme recommended by the World Health Organisation (WHO), and applied through
the Global Program to Eliminate Lymphatic Filariasis (GPELF) launched in 2000 (WHO
2012a, 2013b). The mainstay of the GPELF is annual mass drug administration (MDA)
in endemic regions using three anti-filarial drugs: albendazole, diethylcarbamazine (DEC)
and ivermectin, which kill the microfilaria in infected patients’ blood and interrupt the
transmission cycle (Bhullar and Maikere 2010).
Nevertheless, despite the initial recommendation of MDA as the primary intervention
to eliminate LF, vector control interventions have been recognised as an important
complementary strategy to achieve the target of LF elimination by 2020, with vector
control measures providing a valuable contribution in both MDA and post-MDA
intervention phases (Bockarie et al. 2009). Vector control interventions have played an
important role in LF eradication especially in Central Africa, where due to co-infection
with LF and Loa Loa, MDA could not be applied, as patients treated with Ivermectin may
develop severe adverse reactions including neurologic decline and encephalopathy (Babu
et al. 2006, Addiss and Global Alliance Eliminate 2010). Furthermore, combinations of
MDA and vector control have also been recommended for regions with a high prevalence
![Page 22: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/22.jpg)
8
of microfilaria, where use of both interventions can reduce the number of MDA rounds
and the time required to achieve the microfilaria eradication threshold (Kyelem et al. 2008,
Rivero et al. 2010).
1.2. Insecticide-based tools applied for vector control
Insecticide-based approaches targeting both larval and adult stages are the most widely
applied vector control interventions (WHO 2012b). Despite the utility of insecticides for
minimizing the burden of vector borne diseases, to date, a restricted number of insecticides
belonging to four classes: pyrethroids, organochlorines, organophosphates and
carbamates, have been approved for public health programmes (Malaria Vectors 2012).
Furthermore, there are also limitations to their application due to their toxicity towards
either humans or the environment. For example, while all four classes of insecticide are
approved for indoor residual spraying (IRS), solely pyrethroids are recommended by
WHO for use on bed nets (WHO 2003). By contrast, due to the toxic effect of pyrethroid
insecticides on aquatic species, such as fish, their use is restricted for vector control
targeting larval stages (Sanchez-Bayo 2012).
Consequently, for control interventions targeting different parts of the mosquito
life cycle, specific insecticides and delivery methods are recommended by WHO to ensure
both security and maximum efficacy of control actions. At present, 12 adulticide
formulations; DDT, malathion, dichlorvos (DDVP), temephos, fenitrothion, bendiocarb,
propoxur, cypermethrin, alpha-cypermethrin, deltamethrin, lambda-cyhalothrin and
permethrin are authorised for use in either indoor or outdoor sprays or for both (Becker et
al. 2010, WHO 2011). For instance, exclusively deltamethrin and cyphenothrin are
![Page 23: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/23.jpg)
9
approved for both indoor and outdoor sprays, while the others have application restrictions
for indoor (e.g. permethrin) or outdoor use (e.g. lambda-cyhalothrin and malathion)
(Matthews 2008). Additionally, adult control interventions especially in Africa where
Culex is co-endemic with Anopheles species, have also applied long-lasting insecticidal
nets (LLINs), which have either deltamethrin, alpha-cypermethrin or permethrin
incorporated into polyethylene or coated on to polyester during manufacturing (Bellini et
al. 2014).
As an outbreak prevention strategy, mosquito larval control using synthetic
insecticides relies exclusively on four organophosphate insecticides; chlorpyrifos,
fenthion, pirimiphos-methyl and temephos, with the latter two recommended for
application in natural and artificial breeding sites, whereas the former two are to be used
only in open water bodies (Becker et al. 2010). Alternatively to syntactic insecticides,
bacterial larvicides such as Bacillus thuringiensis israelensis (Bti) and B. sphaericus have
also been applied to mosquitoes larvae control, with significant reduction of larvae density
already reported in Culex, and Anopheles mosquito and A. aegypti after bioassays (Cyrino
Zequi et al. 2014, Dylo et al. 2014, Soares-da-Silva et al. 2015). Nevertheless, a recent
study also show that ingestion of Bti in sugar meals by adults of the A. gambiae complex
have no effect in the survivorship rate (Terbot et al. 2015), which indicated a stage specific
activity.
1.3. Molecular basis of insecticide resistance in mosquitoes
The historic and continuing use of insecticide in agricultural practices and for
public health has driven the evolution of resistance, with resistance to at least one
insecticide having now been reported in around 600 arthropod species (Mota-Sanchez et
![Page 24: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/24.jpg)
10
al. 2002, Whalon et al. 2008, Sparks 2013). Therefore, due to the limited number of
insecticides and the timeframe of around 12 years needed to develop new insecticides,
characterization and understanding of the mechanisms involved in the resistance are
crucial to preserve and increase the life span of existing compounds (Sparks 2013).
Insecticides belonging to all four classes recommended for vector control target
the insect’s peripheral and central nervous system, leading to continuous nerve excitation,
paralysis and death (Coats 2012). For instance, pyrethroid insecticides induce neuronal
over-excitation by delaying the inactivation of voltage-gated sodium channels (Soderlund
2012). Similarly, neonicotinoid insecticides also induce neuronal over-excitation;
however, by contrast they target nicotinic acetylcholine receptors (Matsuda et al. 2009).
Although structurally and biochemically distinct, these insecticides share similar modes
of action. For example, organophosphates and carbamates act by inhibition of
acetylcholinesterase (Ace), preventing breakdown of the neurotransmitter acetylcholine,
resulting in neuromuscular overstimulation. On the other hand, both pyrethroids and
organochlorines act on the sodium channel located in the neuronal membrane, keeping the
channel open and thus, causing loss of nervous impulse (the knockdown phenotype) or
can result in an over-stimulation causing repetitive neuron firing, with both phenotypes
leading to paralysis of the animal (Ranson et al. 2011, Sanchez-Bayo 2012).
So far, most of the resistant-phenotypes reported in resistant mosquitoes rely on
four main types of mechanisms of resistance; target-site insensitivity, metabolic,
behavioural and cuticular, with their presence alone or in combination within individuals
or populations conferring resistance to all insecticides applied in vector control
interventions (Marcombe et al. 2013). Additionally, due to similar modes of action
between insecticides from different classes, a single mechanism can also confer cross-
![Page 25: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/25.jpg)
11
resistance to one or more classes of compound, although distinct mechanisms may impact
differently in the resistance to insecticides from different classes (Figure 1.2) (Nauen
2007). Due to the scope of this work further details for the mechanisms of resistance
mediated by target-site and detoxification enzymes are provided herein, while additional
information toward behavioral and cuticular resistance are available elsewhere (Liu et al.
2006, Wood et al. 2010, Chareonviriyaphap et al. 2013).
Taken from (Malaria Vectors 2012)
Figure 1.2: Impact of molecular mechanisms in insecticide cross-resistance. GSH,
glutathione; AchE, acetylcholinesterase; circle size reflects relative impact of mechanism
of resistance.
1.3.1 Target-site mutations in mosquito’s resistant phenotypes
The mechanism of resistance by target insensitivity relies on structural changes in
the insecticide target site, which blocks insecticides from binding to its target. Most
structural changes result from replacement of single amino acids (Yang and Liu 2013). At
present, the insecticides available are designed to bind one out of three targets; the synaptic
acetylcholinesterase Ace-1 gene, the gamma-aminobutyric acid (GABA) receptor gene
and the voltage-dependent sodium channel encoded by the sodium channel gene (Casida
and Durkin 2013, Yang and Liu 2013).
![Page 26: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/26.jpg)
12
The voltage-gated sodium channel (Vgsc) is the primary target for both pyrethroids
and DDT. Insecticide target-site mutations in the Vgsc, are referred to as knock-down
resistance (kdr), due to reduction of the knock-down effect (insect paralysis after short
time contact with insecticide) (Ffrench-Constant et al. 2004). The Vgsc gene is composed
of four domains (I-IV), with each containing six transmembrane helices (S1-S6).
Mutations associated with resistant phenotypes are mostly found in domain II and helices
S4 to S6, where changes in five different residues; Met918 in the IIS4-IIS5 linker, Leu925,
Thr929 and Leu932 in IIS5 and Leu1014 in IIS6 have previously been associated with
resistance to class I and II pyrethroids as well as cross-resistance to DDT (O'Reilly et al.
2006). Although all these mutations are linked to insecticide binding sites, occurrence of
resistant phenotypes can result from either single mutations or in combination. Resistant
mosquitoes encompassing the combination of any of these variants - M918T L925I,
T929I, T929V with L1014F - are termed super-kdr mutations, which result in a higher
level of resistance (Williamson et al. 1996, Ranson et al. 2000, Bass et al. 2004).
Among the kdr mutations, a substitution of leucine to phenylalanine [L to F] at the
position 1014 in the 6th segment of domain II (IIS6) is the most common kdr mutation
associated with resistance to pyrethroids and DDT in many insect species, as well as
vector species (Soderlund 2008, Rinkevich et al. 2012, Liu 2015). Nevertheless, across
vector species other mutations have also been linked to pyrethroid resistance such as the
N1575Y in A. gambiae, I1011M/V, V1016G/I and F1269C in A. aegypti, F1534C in A.
albopictus and L1014F/S in Culex pipiens (Jones et al. 2012a, Zhao et al. 2014a, Kushwah
et al. 2015, Li et al. 2015).
Target-site mutations in the acetylcholinsterase gene is a common resistance
mechanism to organophosphate and carbamate insecticides (Bourguet et al. 2013). These
![Page 27: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/27.jpg)
13
insecticides are irreversibly competitive inhibitors of acetylcholinesterase, which is
responsible for hydrolyzing the neurotransmitter acetylcholine at the postsynaptic
membrane, terminating nerve impulses (Cousin et al. 2005, Alout et al. 2007a). Among
arthropod genomes the number of Ace genes differs between species. In Drosophila only
a single copy has been identified (called Ace-2) whereas most insects possess two copies
known as Ace-1 and Ace-2. Although both copies of this gene are functional encoding two
Ace (Ace-1 and Ace-2), only one of them is involved in resistance, with the Ace-1
proposed as the major catalytic enzyme based on higher expression and the association of
insecticide resistance point mutations in this gene with the resistant phenotype, while the
function of Ace-2 is unknown (Ren et al. 2002, Mori et al. 2007).
In mosquitoes, evolution of insecticide resistance due to insensitive Ace-1 has
been globally reported in diverse species such as C. pipiens, C. vishnui, C.
tritaeniorhynchus, C. quinquefasciatus, A. gambiae and A. albimanus, A. nigerimus, A.
atroparvus and A. sacharovi (Bourguet et al. 2013, Weetman and Donnelly 2015,
Weetman et al. 2015). In these species, insensitive Ace-1 results from non-synonymous
mutations in residues close to the organophosphate and carbamate binding site. So far,
only three single point mutations have been described in resistant phenotypes; G119S,
F290V and F331W (numbered according to Torpedo californica AChE nomenclature)
(Alout and Weill 2008). While two amino acid substations F290V and F331W have been
exclusively described in C. pipiens and C. tritaeniorhynchus, respectively, the G119S
variant has been selected in several species including C. pipiens, C. vishnui, A. gambiae
and A. albimanus (Weill et al. 2003). Ace-1 protein insensitivity due to the G119S
variation, results from changes in protein structure, since the glycine is located in the
![Page 28: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/28.jpg)
14
oxyanion hole of the enzyme, at the base of the active site gorge reducing the access of
the insecticide to the catalytic triad (Alout et al. 2007a).
Despite these point mutations in the Ace-1 gene, these mutations are important to
mosquitos` survival under insecticide selection. Many studies have shown that such
resistance-associated mutations can result in deleterious effects and fitness disadvantages
due to reduction of the Ace-1 catalytic activity efficiency (Kwon et al. 2012, Lee et al.
2015). Among the Ace-1 point mutations, the highest fitness costs have been associated
with the resistant allele 119S, which accounts for a reduction between 60 and 70% of the
Ace-1 enzymatic activity (Bourguet et al. 1997, Djogbenou et al. 2008). Additionally,
other point mutations in the Ace-1 gene such as G228S and F439W in Tetranychus urticae
has also been linked to a reduction of Ace-1 catalytic efficiency (Kwon et al. 2012), while
the fitness cost associated with other mutations like F290V described in C. pipens is not
elucidated (Alout et al. 2009).
The impact of Ace-1 insecticide resistant alleles in Culex mosquitoes fitness costs
has been described in many instances such as; survival cost of resistant mosquitoes
(Gazave et al. 2001), increase in development time and changing in morphology e.g.
shorter wing length (Bourguet et al. 2004) as well as life-history trails including: larval
mortality, adult female size and mating disadvantage compared to susceptible genotypes
(Berticat et al. 2002, Duron et al. 2006). To compensate the deleterious effects in the
reduction of Ace-1 catalytic activity driven point mutation, duplication of the Ace-1 gene
have been proposed as a compensatory adaptation mechanism by restoring the normal
level of the Ace-1 activity (Alout et al. 2009, Lee et al. 2015). Indeed, Ace-1 gene
duplication has been reported in diverse arthropod species such as Tetranychus evansi,
Tetranychus urticae, Plutella xylostella, Aphis gossypii (Kwon et al. 2010, Carvalho et al.
![Page 29: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/29.jpg)
15
2012, Shang et al. 2014, Sonoda et al. 2014) as well as vector species as A. gambiae and
Culex mosquitoes (Bourguet et al. 1996a, Djogbenou et al. 2008).
In mosquitoes of the Culex pipiens complex, many studies have indicated that
enhancing of Ace-1 copy number results from several independent duplications
encompassing both resistant and susceptible copies of the Ace-1 gene creating a
‘permanent heterozygote’ (Labbe et al. 2007a, Alout et al. 2011, Osta et al. 2012b). These
not exhibit deleterious pleiotropic effects since the presence of the susceptible Ace-1 allele
in the duplicated genotype compensate the effects of the resistant-associated mutation
(Labbe et al. 2007b). Consequently, the duplicated Ace-1 genotypes have more advantages
compared to non-duplicated resistant genotypes when there are changes from insecticide
selection to a free insecticide environment, as resistant mosquitoes harboring the
duplicated Ace-1 susceptible copy compensate the cost associated with the resistant copy
(Bourguet et al. 1996a, Labbe et al. 2007a, Labbe et al. 2007b).
In addition to the proposed compensatory adaptation mechanism of the Ace-1
duplication, enhanced copy number of the Ace-1 gene have also been associated with the
level of insecticide resistance. For example, quantitative PCR analysis in the two-spotted
spider mite, T. urticae revealed the presence of Ace-1 gene copy number and level of
mRNA expression ranging from 2 to 6, resulting in different levels of monocrotophos-
resistant phenotype (Kwon et al. 2010). On the same way, in Aphis gossypii the Ace-2
copy number and transcription level was also significantly associated with
organophosphate-resistance (Shang et al. 2014). Hence, the association of Ace-1 gene
copy number and insecticide resistance need to be investigated not only as a compensatory
mechanism of the fitness cost associated with resistant alleles but also as a likely
alternative mechanism driving evolution of resistance.
![Page 30: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/30.jpg)
16
Insecticide resistance to cyclodiene, phenylpyrazoles, pyrethroids and ivermectins
have also been linked to single point mutations in the (GABA) receptor. This
neurotransmitter receptor encoded by the Rdl (resistance to dieldrin) gene is formed by
five subunits around a central transmitter-gated ion channel (Remnant et al. 2014). The
resistant phenotype is associated with a single non-synonymous change from an alanine
residue to a serine, or rarely to a glycine at position 302 within the second transmembrane
region of the Rdl subunit (Ffrench-Constant et al. 2004, Ffrench-Constant 2007).
Insensitivity to insecticides due to the alanine to serine or alanine to glycine
substitution in the GABA receptor results from two aspects; reducing insecticide binding
and destabilization of the insecticide’s preferred (desensitized) receptor conformation
(Zhang et al. 1994). In mosquitoes, resistance to dieldrin has been mostly reported in
Anopheles spp. and Ae. aegypti (Du et al. 2005, Wondji et al. 2011, Casida and Durkin
2013).
1.3.2 Molecular mechanisms of metabolic resistance
Metabolic resistant-phenotypes in insects are mostly mediated by three major
metabolic detoxification gene families: cytochrome P450s (P450s), esterases, and
glutathione S-transferases (GSTs) (Hemingway and Ranson 2000, Li et al. 2007).
1.3.2.1 Cytochrome P450s (P450s)
Among the three major detoxification gene families, cytochrome P450 is the
largest gene family, with a substantial number of genes already described in the three most
studied vector species; with 105 identified in A. gambiae, 160 in A. aegypti and 196 in C.
![Page 31: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/31.jpg)
17
quinquefasciatus. In C. quinquefasciatus the number of predicted P450 genes is more than
twice and three times compared to the number of carboxyl/cholinesterases and GSTs
respectively (Komagata et al. 2010, Yan et al. 2012).
Cytochrome P450-dependent monooxygenases are hydrophobic, heme-containing
enzymes, with many of them specialized for metabolism of endogenous substrates
including steroids, hormones and lipids, although these enzymes also play an important
role in metabolism and detoxification of xenobiotic compounds such as environmental
toxins and insecticides (David et al. 2013). In insects, the large diversity of P450 genes
are distributed within four clans; CYP2, CYP3, CYP4 and the mitochondrial CYP clan
(Feyereisen 2012). Most of the P450 genes identified with high expression levels in
insecticide resistant phenotypes belong to the Cyp6 family, which have been suggested to
present characteristics of environmental response such as tissue, or temporal specific
expression (Hemingway et al. 2004, Ingham et al. 2014). Indeed, P450 genes have been
associated with resistance to all classes of insecticides, which reflects their genetic
diversity, broad substrate specificity and catalytic spectrum (Feyereisen 2005). However,
it is important to bear in mind that overproduction of enzymes like P450 is not always
correlated with insecticide resistance as a unique regulatory transcriptional factor and can
be regulated by several genes (Schuler and Berenbaum 2013).
In mosquitoes, a large number of P450 candidate genes from distinct Cyp families
have been identified in pyrethroid resistant mosquitoes from Culex, Anopheles and Aedes
as broadly reviewed by many authors (Ranson et al. 2002, Schuler and Berenbaum 2013).
Although many P450 candidate genes have already been identified, only a limited number
of genes have their metabolizing capability validated by heterologous expression, as
described for CYP6P3 (Li et al. 2007, Djouaka et al. 2008, Müller et al. 2008), CYP6M2
![Page 32: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/32.jpg)
18
(Mitchell et al. 2012), CYP6Z1 (David et al. 2005) and CYP6P9 (Riveron et al. 2013)
from Anopheles, CYP9J32 (Bingham et al. 2011), CYP9J24 and CYP9J28 (Strode et al.
2008) from Aedes and CYP9M10 (Liu et al. 2011a, Wilding et al. 2012) and CYP4H34
from Culex (Hardstone et al. 2010, Komagata et al. 2010).
1.3.2.2 Glutathione S-transferases (GSTs)
GSTs are another gene family commonly associated with detoxification and
cellular antioxidant defense, in which elevated levels of activity have been found to be
associated with organophosphate, organochlorine, and pyrethroid insecticides (see for
review (Li et al. 2007)). These enzymes act by three primary functions; conjugation of
reduced glutathione (GSH), dehydrochlorination, or sequestration of natural and synthetic
exogenous xenobiotics; the two former mechanisms having been mostly associated with
insecticide resistance (Syvanen et al. 1996, Ranson et al. 2001, Vontas et al. 2001). GSTs
are classified in two groups based on their cellular location; microsomal or cytosolic, with
distinct GSTs divided within six classes; sigma, zeta, theta, omega, delta and epsilon. The
last two are the largest classes and found exclusively in insects (Enayati et al. 2005, Li et
al. 2007).
Due to broad substrate specificities of individual enzymes, elevated GST
expression has been associated with resistance to insecticides from all the main classes of
insecticides, e.g. organophosphate resistance in Musca domestica and Plutella xylostella
and DDT resistance in Drosophila melanogaster (Ku et al. 1994, Syvanen et al. 1994,
Tang and Tu 1994). In mosquitoes, DDT and pyrethroid resistance mediated by GSTs
have already been reported in distinct vector species such as Aedes and Culex (Grant et al.
![Page 33: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/33.jpg)
19
1991, Penilla et al. 2006), as well as in a vast number of Anopheles species including: A.
albimanus, A. annularis, A. culicifacies, A. gambiae, A. stephensi and A. arabiensis
(Gunasekaran et al. 2011, Mitchell et al. 2014, Sanil et al. 2014, Wilding et al. 2014). For
instance, in A. aegypti DDT-resistant strains from three geographic locations (New
Orleans, Thailand and Mexico), three Epsilon GSTs; GSTe2, GSTe5 and GSTe7 were
detected with over-expression in resistant mosquitoes, while the independent partial
silencing of the last two Epsilons also increased the susceptibility to pyrethroids in these
strains (Lumjuan et al. 2011).
Similarly, in DDT-resistant A. albopictus mosquitoes from Florida and New Jersey,
USA a higher over expression of GSTs was also reported as the mechanism driving the
resistant in both larval and adult stages (Marcombe et al. 2014). In A. gambiae, in silico
analysis of 24 GSTs, shows that the GST Delta D6 has the highest interaction affinity with
DDT (Aravindan et al. 2014). Nevertheless, transcriptomic microarray-based studies have
also identified high levels of expression of AgGSTE2 and GSTS1-2 in A. gambiae strains
resistant to pyrethroids and permethrin (David et al. 2005), while GSTS1-1, GSTS1-2 and
microsomal GSTs (GSTMIC2) were detected with high expression level in A. stephensi
pyrethroid-resistant strain (Vontas et al. 2007).
In Culex mosquitoes, genomic sequences analyses indicated a total of 40 putative
GSTs, with 35 corresponding to cytosolic and 5 microsomal (Reddy et al. 2011, Reddy et
al. 2012). As also reported in other insects, GSTs-resistant phenotypes are mostly driven
by GSTs gene amplification and over expression (for a review see (Li et al. 2007). Higher
expression of GSTs has already been associated with Culex mosquito resistance to DDT
and pyrethroids insecticides. For example, in C. quinquefasciatus a theta GST was
identified up-regulated by 19-fold in parathion resistant mosquitoes (Wang et al. 2015)
![Page 34: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/34.jpg)
20
whereas GST over-expression was also observed in pyrethroid-resistant strains from
Mobile and Huntsville, Alabama, USA (Xu et al. 2005). Furthermore, over expression of
CpGSTD1 (a DDT metaboziler) was also linked to C. pipiens Marin DDT-resistant
phenotype (Samra et al. 2012).
1.3.2.3 Esterases
Metabolic resistance through elevated esterase expression is also an important
mechanism associated with resistance to organophosphates, carbamates and pyrethroids
(for a review see (Hotelier et al. 2010)). As described for the other two detoxification gene
families, esterases are also ubiquitous enzymes involved in the metabolism of exogenous
and endogenous compounds, playing a critical function in insect development and
behaviour such as reproduction and hydrolysis of pheromones and many semiochemicals
(Claudianos et al. 2006). Esterases belong to the carboxylesterase multigene family, which
based on sequence similarity and substrate specificity is sub-divided into eight
subfamilies: α-esterases, β-esterases, juvenile hormone esterases, gliotactins,
acetylcholinesterases, neurotactins, neuroligins, and glutactins, with α-esterases, β-
esterases, acetylcholinesterases and juvenile hormones involved in most of the catalytic
activities (Ranson et al. 2002, Yu et al. 2009). Insecticide resistance mediated by esterases
is typically associated with insecticides containing ester compounds such as pyrethroids,
carbamates and organophosphates making them good substrates for the esterase
hydrolysis mechanism, which is capable of hydrolysing ester bonds to generate an acid
and an alcohol as metabolites (Montella et al. 2012). Resistance mediated by enhancing
of esterase activities have already been reported in A. gambiae permethrin resistant
![Page 35: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/35.jpg)
21
phenotypes as well as organophosphate resistance in A. aegypti and Culex mosquitoes
(Mourya et al. 1993, Vulule et al. 1999, Paton et al. 2000).
1.3.2.4 Mechanisms underlying insecticide metabolic resistance
Despite the small number of gene families thus far implicated in metabolic
resistance, a vast number of molecular mechanisms trigger changes in detoxification
enzyme function, expression or both (Li et al. 2007). Resistance mediated by
detoxification enzymes are mostly associated with up regulation, allelic variant or gene
amplification, although some of these mechanisms are not observed in all three families
of detoxification genes (Bass and Field 2011). As described for target-site mutations,
changes in amino acid residues within detoxification enzymes also drive insecticide
resistance; however, by increasing metabolic capacity due to an increase of affinity to
insecticide. Most metabolic resistance mediated through coding sequence mutations has
been reported in esterase, GTSs and P450s genes (Li et al. 2007). For example, in
Drosophila, divergence of protein sequence among copies of the Cyp6g1 gene resulted in
resistance to multiple classes of insecticide, with variants of this enzyme conferring
resistance to either DDT or nitenpyram but not for both insecticides (Harrop et al. 2014).
Similarly, changes in coding sequences in carboxylesterase genes resulted in an increase
of organophosphate hydrolysis in many species including Chrysomyia putoria, M.
domestica, L. cuprina, Anisopteromalus, calandrae, Plodia interpunctella and Culex
tarsalis (Whyard et al. 1995, Campbell et al. 1998, Claudianos et al. 1999).
Nevertheless, insecticide detoxification mediated by transcriptional up-regulation
is apparently a more common cause of resistance across insect species (Bass and Field
![Page 36: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/36.jpg)
22
2011). Among the mechanisms linked to higher constitutive production of transcripts,
most detoxification gene up-regulation is mediated by changes in cis and/or trans gene
regulatory elements through mutation or insertion/deletion in promoter regions or in
regulatory loci (Komagata et al. 2010, Liu 2015). Increase of detoxification enzymes
mediated by trans-acting regulatory elements was associated with overexpression of GST-
2 allele in A. Aegypti (Ortelli et al. 2003), while in A. gambiae the presence of Nrf2/Keap
1 and AhR/ARNT as putative transcription factor binding sites (TFBS) within the CYP6M2
promoter is potentially associated with its up-regulation (Mohammed et al. 2014).
Metabolic resistance driven by over-expression of detoxification genes through
gene amplification has also been a common mechanism associated with GSTs and esterase
genes. Association of esterase gene amplification with insecticide resistance was reported
in Myzus persicae, where resistance to organophosphates, carbamates and pyrethroid
insecticides resulted from amplification of the E4 and FE4 genes (Field and Devonshire
1998). Similarly, in mosquitoes of the Culex complex (C. quinquefasciatus and C. pipiens)
independent co-amplification of two esterases, estα21 and estβ21, as well as estα3 and
estβ2, also trigger organophosphate resistance (DeSilva et al. 1997). Additionally, GST
gene amplification contributed to organophosphate resistant phenotypes in M. domestica
mediated by duplication of GSTd3 and GSTd4 (Wang et al. 1991), whereas amplification
of GSTd1 in Nilaparvata lugens conferred resistance to pyrethroids (Vontas et al. 2001).
1.4. Evolution of insecticide resistance in Culex mosquitoes and impact on
vector control
In mosquitoes of the Culex pipiens complex, most reports of resistance are to
pyrethroid insecticides, which might reflect the extensive use of this insecticide both for
![Page 37: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/37.jpg)
23
crop-pest control and public health interventions (Van den Berg et al. 2012). Although
there are heterogeneous levels of resistance among populations, resistance to diverse
pyrethroid compounds including permethrin, deltamethrin, β-cypermethrin, Es-
bioallethrin, λ-cyhalothrin, etofenprox, bifenthrin, β-cyfluthrin, phenothrin and
resmethrin have already been reported in Culex populations across the Western and
Eastern Hemisphere (For a review see (Scott et al. 2015).
So far, most identified pyrethroid resistant phenotypes are associated with two
main mechanisms; target-site mutation in the Vgsc and detoxification mediated by P450s.
Among the target-site mutations already associated with the Culex pyrethroid resistant
phenotype: L1014S, L1014C, V1016G and L1014F, only the last is widely distributed
across the American, African and Asian continents (Scott et al. 2015). Despite this wide
geographic distribution, previous studies suggest that the L1014F has arisen at least twice
as two mutant alleles - either an A-to-T or an A-to-C substitution at the same codon
position resulting in the 1014F resistant allele - with the A to C variant initially identified
in Sri Lanka and having only recently been detected at low frequency on the African
continent on Pemba island, Zanzibar (Martinez‐Torres et al. 1999, Wondji et al. 2008,
Jones et al. 2012b).
To date, the other three mutations associated with pyrethroid resistance are
restricted to a few Culex species as well as being locally geographically distributed e.g.
L1014S was identified in C. pallens from Japan and C. pallens and C. pipiens from China,
L1014C has been detected in C. pipens molestus from China and V1016G identified in
C. quinquefasciatus from Saudi Arabia (Komagata et al. 2008, Chen et al. 2010, Wang
et al. 2012, Liu et al. 2013). However, additional mutations like V1016G are typically
linked to the L1014F mutation, as described in C. pipiens molestus from China, which
![Page 38: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/38.jpg)
24
make it difficult to pinpoint the contribution of each mutation to the resistant genotype
(Wang et al. 2012). Additionally, distinct mutations can also have different impact in
resistance. For instance, in C. pipiens pallens from China, the L1014F mutation was
reported to be associated with deltamethrin resistance, but no association was detected
for the alternative mutation L1014S (Chen et al. 2010).
In addition to target-site mutations in the Vgsc gene, many studies have reported
that resistance to pyrethroids in Culex is mediated by P450- dependent oxidases (Yang
and Liu 2013, 2014). Indeed, a vast list of P450 genes have been identified in permethrin
resistant C. quinquefasciatus mosquitoes, with most of them classified in the families 4,
6 and 9 (CYP4H34, CYP4C52v1, CYP4D42v2, CYP4C38, CYP4H40, CYP6Z10,
CYP6F1 ,CYP6AA7, CYP6AA7, CYP6Z15, CYP9M10, CYP9J40, CYP9J34,
CYP9M10, CYP9J45, CYP9M10, CYP9J33, CYP9J43, CYP9J34, CYP9J45, CYP9J39)
or other P450 gene family (CYP325K3v1, (CYP) CPIJ000926, CYP325G4, CYP306A1,
CYPPAL1) (Kasai et al. 2000, Komagata et al. 2010, Gong et al. 2013).
However, so far only CYP9M10 has been associated with pyrethroid resistance in
C. quinquefasciatus strains and natural populations from distinct geographic background
including Saudi Arabia, Asia, North America and Sub-Saharan Africa (Liu et al. 2004,
Wilding et al. 2012, Itokawa et al. 2013). By contrast, no difference of expression of
CYP4H34 was observed in larvae and adults of two permethrin selected strains (ISOP450
and ISOJPAL), while in the same colonies permethrin resistance was associated with
CYP9M10, which was over expressed 1800-fold in ISOP450 and 870-fold in ISOJPAL
compared to a susceptible strain (Hardstone et al. 2010).
Although CYP9M10 permethrin-resistant phenotypes have been demonstrated in
various populations, many studies have indicated the distinct molecular mechanism
![Page 39: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/39.jpg)
25
underlying its over-transcription among resistant phenotypes. Two main mechanisms
have already been linked to over-expression of CYP9M10. One involving a genomic
tandem duplication including the CYP9M10 and other genes was reported in C.
quinquefasciatus strains from Asia and Africa (Itokawa et al. 2010, Itokawa et al. 2013).
The second mechanism involves two independent cis-acting mutations resulting from
insertion of a transposable element upstream of the putative transcriptional start site of
CYP9M10, which modulates the high level of gene expression (Itokawa et al. 2010,
Wilding et al. 2012).
Before replacement of organophosphates with pyrethroid insecticides due to an
increase in insecticide resistance, many organophosphate compounds including
dichlorvos, malathion, diazinion, chlorpyriphos were the most widely applied insecticides
for Culex control on the African, European, American and Asian continents (Chandre et
al. 1997, Raymond et al. 2001, Jones et al. 2012b, Osta et al. 2012b). Evolution of
organophosphate resistance in Culex mosquitoes, has been described in other vector
species driven mostly by two main mechanisms involving target-site mutation and
detoxification enzymes mediated by over-expression of esterase or both mechanisms
(Toma et al. 2011, Karunamoorthi and Sabesan 2013, Liu 2015).
Organophosphate resistance in C. pipiens from France is one of the most well
documented examples of evolution of insecticide resistance in Culex mosquitoes after four
decades of control intervention (Labbe et al. 2007b). In this study, the authors clearly
demonstrated that in these populations the evolution of resistance involved a dynamic
process of mosquito’s adaptation to organophosphate selection pressure, which included
an increase in frequency of the Ace-1 resistant allele (119S), but also successive gene
duplication events including resistant and susceptible alleles, while the duplication of the
![Page 40: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/40.jpg)
26
susceptible allele was associated with reducing of the deleterious effect of the Ace-1
resistant allele.
The target-site mutation G119S in the Ace-1 gene, which is associated with
reduced susceptibility to organophosphates and carbamates, has been the most widely
detected in the resistant phenotype (Weill et al. 2004, Casida and Durkin 2013, Zhao et
al. 2014a). Although the G119S mutation has been more frequent and broadly detected,
additional non-synonymous mutations in the Ace-1 gene such as V185M, G247S, A328S,
A391T, and T682A have also been detected in C. quinquefasciatus from China but not
demonstrated to be involved with resistance to dichlorvos, while two of them G247S and
A328S were associated with resistance to the carbamate insecticide propoxur (Zhao et al.
2014a). Two other mutations in the Ace-1 gene have also been identified; F290V in C.
pipiens from Cyprus and F331W C. tritaeniorhynchus (according to Torpedo californica
AChE nomenclature), which show insensitivity to insecticide using in vitro experiments
(Alout et al. 2007b, Alout et al. 2007a, Alout and Weill 2008).
Despite the fitness benefit of the Ace-1 target-site mutations for populations under
insecticide selection, in an insecticide free environment many studies have shown that
resistant target-site alleles have strong deleterious effects (Berticat et al. 2002, Berticat et
al. 2008). Interestingly, many studies have reported that over the course of selection and
evolution of the 119S resistant allele in the Ace-1 gene, duplication of the Ace-1 gene acts
like an alternative compensatory mechanism to normalise the level of the wild type
enzyme avoiding the deleterious effects of the G119S mutation (Lenormand et al. 1998,
Labbe et al. 2007a, Alout et al. 2009, Alout et al. 2011, Labbé et al. 2014).
Organophosphate resistance phenotypes associated with Ace-1 gene duplication have been
broadly reported in Culex populations, with many studies showing that the duplications
![Page 41: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/41.jpg)
27
resulting from independent events within and between Culex species and geographic
localities, as identified in C. pipiens from Southern France and Lebanon as well as C.
quinquefasciatus from Martinique, Caribbean and Philippines (Bourguet et al. 1996a,
Bourguet et al. 1996b, Osta et al. 2012a).
Another important mechanism associated with resistance to organophosphate
insecticide involves the esterase gene duplication, which results in higher esterase
expression and consequently increases its capability to bind or metabolize the insecticide
(Raymond et al. 1998). Although there are many esterase allozymes, six from the esterase
B locus (B1, B2, B4, B5, B6 and B7) and four (A1, A2, A4 and A5) at the esterase A locus
are the alleles frequently associated with resistance, while co-amplification of two esterase
genes (estα21 and estβ21) is the most common resistant genotype in C. quinquefasciatus
mosquitoes (Guillemaud et al. 1996, Liu et al. 2011b, Gordon and Ottea 2012, Johnson
and Fonseca 2015). Particularly, the est2 alleles associated with organophosphate
resistance have the broadest distribution, already detected in resistant Culex populations
across Europe, Asia, Africa, America and Oceania (Labbé et al. 2005). Despite most
esterase-resistant phenotypes resulting from gene amplification of two or more linked
esterase genes, resistance associated with single amplification or due to change in gene
expression regulatory elements have also been described (for a review see (Raymond et
al. 1998)).
More recently, carbamate insecticides became an alternative to the threat of the
high level of pyrethroid and organophosphate resistance detected in vector mosquitoes.
Indeed, although most reports of susceptibility to carbamates are from Anopheles especies
(Yewhalaw et al. 2011, Kigozi et al. 2012, Mulamba et al. 2014), a few studies have also
indicated higher susceptibility to bendiocarb than to other insecticides in C.
![Page 42: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/42.jpg)
28
quinquefasciatus from Africa as reported in populations from Ghana and Tanzania (Jones
et al. 2012b, Kudom et al. 2015). Nevertheless, since both target-site mutations and
metabolic resistance (e.g. esterases and P450s) associated with organophosphate
resistance also confer cross-resistance to carbamates (Li et al. 2007, Casida and Durkin
2013, Pocquet et al. 2013), it is important to bear in mind that these mechanisms of
resistance might already have been present in low frequency in that population, which can
jeopardise future control interventions with carbamate insecticides.
In Uganda, inferences of the impact of vector control programmes in the evolution
of insecticide resistance targeted chiefly at Anopheles species; A. gambiae and A. funestus
due to the primary importance of insecticide-based methods to control these mosquitoes
population and consequently to mitigate the high prevalence of malaria throughout the
country (Kigozi et al. 2012, Yeka et al. 2012).
Despite the non-primary medical role of C. quinquefasciatus in vector-borne
diseases transmission in Uganda, the present research was conducted in this country as
non-official control interventions toward C. quinquefasciatus mosquitoes have been
applied, although insecticide-based methods are applied nationwide for the control of
other vector species as well as in agricultural settlements (Kigozi et al. 2012). Hence,
studying C. quinquefasciatus populations from this region provide a suitable fieldsite to
investigate the impact of insecticide selection pressure in the evolution of insecticide
resistance in non-target insect populations. Additionally, the accessibility to the
infrastructure of the Ugandan Anopheles insecticide resistance management programme
(e.g. insectary as well as the possibility of synchronise the Culex to the Anopheles
collection) also facilitates the development of the present study in the selected region.
![Page 43: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/43.jpg)
29
1. 5. Aims and study design
The primary objective of this work was to develop and apply DNA-based markers
as well as transcriptomic profiling to enhance the understanding of the evolutionary
genetics of insecticide resistance in C. quinquefasciatus mosquitoes. Firstly, to investigate
the likely impact of insecticidal selection pressure in the mosquito population structure
and genetic diversity, neutral and insecticide-associated genomic markers were applied to
genotype C. quinquefasciatus population from Uganda collected between July and August
2012. Secondly, to infer if Ugandan resistant-phenotypes are involved in the mechanism
of metabolic resistance, gene expression profiles of bendiocarb resistant C.
quinquefasciatus were used to identify candidate genes associated with metabolic
resistance. For this, the following studies were conducted:
Chapter II. Application of a bioinformatics approach to design 29 new
microsatellite markers for genetic diversity, and population genetic analysis of C.
quinquefasciatus. The characterized markers were used to develop five six-plex
reactions, which were used to experimentally validate samples from two Ugandan
field populations (Jjnja and Kamapala).
Chapter III. C. quinquefasciatus mosquitoes collected across a transect from
Eastern to South Western Uganda were utilized to infer the likely patterns of the
evolution of insecticide resistance among populations through combinations of
putatively selected loci (the target-site mutations 1014L in the Vgsc gene and 119S
in the Ace-1 gene) and 29 neutral microsatellite markers.
Chapter IV. Development and validation of a new Vgsc-CNV PCR-based assay
to evaluate the copy number of the Vgsc gene in natural populations of Culex
mosquitoes. The Vgsc-CNV assay was designed to perform on three distinct
genotyping platforms: standard real-time PCR (qPCR), pyrosequencing and
![Page 44: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/44.jpg)
30
droplet digital PCR (ddPCR). Additionally, diagnostic sensitivity and accuracy of
the newly designed Vgsc-CNV assay was compared across the three platforms by
genotyping mosquitoes collected in Uganda.
Chapter V. A novel 8 x 60K whole-transcriptomic microarray was designed and
applied to identify candidate genes associated with bendiocarb insecticide
resistance in mosquitoes collected and phenotyped in Tororo, Uganda.
![Page 45: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/45.jpg)
31
Chapter II Chapter II – Development of Microsatellite Multiplex Panels for Population Genetic Analysis
of the Lymphatic Filariasis Vector Culex quinquefasciatus
Development of Microsatellite Multiplex Panels for Population
Genetic Analysis of the Lymphatic Filariasis Vector Culex
quinquefasciatus
2.1Abstract
The lymphatic filariasis vector Culex quinquefasciatus has previously been subject to studies to
characterize genetic diversity and structure and also the genetic basis of differences in behavior
and vector competence. Although a number of microsatellite markers are available for Culex
species, these have not been optimized for multiplexed reactions, which would reduce the time
and cost of large-scale screening. We identified 29 novel microsatellites from C.
quinquefasciatus whole genome sequence data and developed a panel of five multiplex
reactions. Reproducibility and polymorphism of the markers in multiplex reactions were
investigated in mosquitoes collected from two field populations from Uganda. All loci were
polymorphic with 2-12 alleles per locus with the mean polymorphic information content (PIC)
and expected heterozygosity (HE) of 0.533 and 0.585, respectively. These panels of marker
multiplexes will enhance efficiency of population and quantitative genetic studies of C.
quinquefasciatus.
2.2 Introduction
Species within the Culex pipiens complex occur widely throughout tropical and
temperate environments worldwide and are vectors of several arboviruses and pathogens such
as West Nile virus (WNV) and St. Louis virus (Hamer et al. 2008, Cornel et al. 2012, Molaei et
al. 2012). One member of the complex, C. quinquefasciatus, is the primary vector of lymphatic
filariasis (LF) in India, Brazil, Asia, Africa and the Western Pacific (Bockarie et al. 2009,
Behura et al. 2011, Kumar et al. 2011). Recently, the frequency of LF has increased in urban
![Page 46: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/46.jpg)
32
and semi-urban areas of the developing world due to the ability of C. quinquefasciatus to thrive
in dense urban environments (Simonsen and Mwakitalu 2013).
To date few microsatellite markers have been described for C. quinquefasciatus
(Fonseca et al. 1998, Smith et al. 2005, Edillo et al. 2009, Hickner et al. 2010), limiting the
scope of medically-important quantitative and population genetic studies of ecology, vector
competence and insecticide resistance. Vector competence varies markedly, with C.
quinquefasciatus populations in West Africa almost fully refractory to infection (Zielke and
Kuhlow 1977), and evidence for vector-parasite co-adaptation in other parts of the range; yet
the role of genetic factors underpinning this variation remains to be determined (Kothera et al.
2012). Moreover, population genetic analyses provide an opportunity to investigate recent
invasions (Fonseca and Bahnck 2006, Bataille et al. 2009), hybridization events (Fonseca et al.
2004, Gomes et al. 2009) and to evaluate the efficiency of vector control strategies in endemic
areas (Cartaxo et al. 2011).
Here, we apply a bioinformatics approach to identify 29 new microsatellite loci for
population genetic analysis of C. quinquefasciatus. In addition, we develop in silico five six-
plex reactions, and validate these experimentally in samples from two Ugandan field
populations.
2.3 Materials and methods
2.3.1 Samples and species identification
Characterization of all putative microsatellite markers was carried out by genotyping C.
quinquefasciatus samples from two laboratory colonies (CqSF from Recife Brazil (Wilding et
![Page 47: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/47.jpg)
33
al. 2012) and ISOP450 (Hardstone et al. 2007) maintained at the Liverpool School of Tropical
Medicine (LSTM) and field mosquitoes from two regions of Uganda (Jinja; 00° 25' N, 33°12' E
and Kampala; 00°20' N, 32°30' E) collected in July 2012. Genomic DNA of individual
mosquitoes was isolated using a DNeasy kit (Qiagen). The field samples were confirmed as C.
quinquefasciatus through a diagnostic PCR assay prior to microsatellite genotyping (Smith and
Fonseca 2004).
2.3.2 Microsatellite isolation and primer design
A total of 180 randomly selected C. quinquefasciatus genome supercontigs were
downloaded from VectorBase (www.vectorbase.org) and analyzed using SciRoKo 3.4 (Kofler
et al. 2007) to identify perfect di- or tri- nucleotide motifs with the number of repeats ranging
from 5 to 20. For each candidate microsatellite, approximately 200 bp of pre- and post-motif
flanking sequence was isolated and target loci with flanking sequences containing
microsatellites sequences were excluded. To reduce the likelihood of physical linkage, only one
microsatellite per supercontig was chosen for primer design using primer 3.0 (Rozen and
Skaletsky 2000), targeting primer GC content between 50% and 70% and melting temperature
between 60 and 65 °C. All primers were checked for unique binding using BLAST against the
C. quinquefasciatus genome in VectorBase. Only primer pairs from which at least one of the
primers was unique in the whole genome were selected for PCR. Furthermore, the primer
sequences were BLASTed against the GenBank nucleotide database to ensure that they had not
been described previously.
![Page 48: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/48.jpg)
34
2.3.3 Microsatellite reactions
Initially, thirty-six primer sets were designed and tested individually using eight samples
from the two laboratory colonies CqSF (n = 4) and ISOP450 (n = 4). PCR reactions were
performed in 25 µl volumes containing 1X buffer, 2mM MgCl2, 0.2mM of each dNTP, 1.25
units of Taq polymerase (Fermentas), 0.5 µM of each primer and 2 µl of genomic DNA. The
PCR conditions consisted of denaturation for 3 min at 95°C, followed by 30 cycles of 30 s at 95
°C, 30 s at 55 °C, and 30 s at 72 °C, and a final extension at 72 °C for 10 min. PCR products
were separated on 2% agarose gel in 1X TAE buffer, stained with ethidium bromide and
visualized using UV light. PCR reactions that showed non-specific fragments at the initial
conditions were optimized by iteratively increasing the annealing temperature in steps of 2 °C
up to a maximum of 65 °C.
2.3.4 Mutiplex development and amplification
Following initial PCR optimization, 30 microsatellite primer pairs that consistently
amplified single fragments of expected fragment size (within the resolution of agarose gel) in
all samples of both laboratory colonies were tested for compatibility in PCR multiplex reactions
using Multiplex Manager 1.0 (Holleley and Geerts 2009). Multiplex panels were selected to
have 6 loci per reaction, three fluorescent dyes, at least 30 bp between loci labeled with the same
dye and a complementary threshold of 15 (maximum number of AT or CG matches between
two primers) to prevent potential hairpins, or dimers between any primers within each reaction.
Forward primers of each set were labeled with Beckman-Coulter D2, D3 or D4 fluorescent
dyes; however, D3 and D4 were preferentially selected due to their higher signal intensity.
![Page 49: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/49.jpg)
35
Initially, the primer sets for each multiplex reaction were divided in two pairs of primers labeled
with different dyes and then used to amplify 2 pools containing equivalent amounts of eight
DNAs from each laboratory and field sample to characterize the allelic range of each locus to
ensure that multiplexed loci labeled with the same marker had non-overlapping allelic ranges.
Additionally, four samples from each population and laboratory colony were used to
amplify the complete multiplex panel to detect the possible presence of false peaks arising from
dye spectral overlap and stutter peaks. Finally, five multiplex panels were used to genotype 35
individuals from each field sample to characterize polymorphism and screen for the presence of
possible null alleles.
Multiplexes were amplified in 25 µl reaction volumes that included 1X Type-it multiplex
PCR Master Mix (Qiagen), 0.2 µM of each primer and 2 µl of genomic DNA. Amplifications
were carried out under the following conditions: initial heat activation for 5 min at 95 °C
followed by 24 cycles of 30 s at 95°C, 90 s at 60°C, 30 s at 72°C and a final extension step of
30 min at 60°C. For fragment analysis, 2 µl of PCR multiplex reaction were added to a mix of
37.5 µl of Sample Loading Solution and 0.5 µl of 400-bp size Standard (Beckman-Coulter)
followed by a denaturation step of 5 min 95°C before fragment analysis on Beckman-Coulter
CEQ8000. Genotypes were scored by allelic size using Beckman-Coulter CEQ 2000 DNA
analysis system software and manually verified.
2.3.5 Data analysis
Observed and expected heterozygosities were calculated using GenAlEx (Peakall and
Smouse 2012). Linkage disequilibrium among marker pairs and deviation from Hardy-
Weinberg equilibrium for each locus were assessed using the exact tests in GENEPOP (Rousset
![Page 50: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/50.jpg)
36
2008). Polymorphism information content (PIC) was calculated using CERVUS v3.0.3
(Kalinowski et al. 2007). The influence of stuttering and large allele dropout on genotypes was
analyzed using Micro-Checker (Van Oosterhout et al. 2004).
2.4 Results and discussion
Scanning of 180 C. quinquefasciatus supercontigs identified 214 putative microsatellite
sequences with di- and tri- nucleotides repeats. Thirty six perfect di- or tri- nucleotide, single-
locus repeats were selected for primer design and characterization. Initial screening of the
designed primers by fragment analysis on agarose gel electrophoresis showed 30 of the primer
pairs with consistent amplification, while the remaining six primer sets were discarded due to
either no amplification (MCQ 30, MCQ 40 and MCQ 43) or amplification of non-target regions
(MCQ 7, MCQ 17 and MCQ 44) under different reaction and amplification conditions. BLAST
analysis against the GenBank nucleotide database of all markers revealed that one locus (MCQ
16) despite differing in primer sequences matched a microsatellite region previously described
(GenBank Accession number DQ388495.1).
Thirty loci were selected for multiplexing in five six-plex reactions (Table 2.1), which all
amplified under the same PCR conditions. All multiplex panels were free from spectral overlap,
allele overlap, and excess peaks (Figure 2.1). For three of the loci (MCQ 4, MCQ 5 and MCQ
21), Micro-Checker suggested mis-scoring of stutter peaks in samples from Jinja. However,
close examination of the electropherograms did not support this suggestion.
![Page 51: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/51.jpg)
37
Table 2.1: Characteristics of polymorphic microsatellites from Culex quinquefasciatus collected in two field populations from Uganda.
Population
Jinja Kampala
Multiplex Locus Primer sequences (5`-3`) Dye Repeat
motif
size
range (bp)
No of
alleles PIC HE FIS FIS
GenBank
accession no.
Reaction 1 MCQ24 F: CTTCTAGGGTTGGCGTTGAG
R: TCGTGATCTGCATCGGTAAT
[D4] (AC)8 127-139 6 0.673 0.717 0.108 NS -0.069 GF112168
MCQ16 F: ACGCCGTCAGAAACACATTA
R: GAGCTGTGTGACAAGCATGG
[D4] (AC)13 197-209 7 0.658 0.688 0.094 0.127 GF112169
MCQ19 F: GTCCCAGGATCGTAGCTCAG
R: CGTTCCCCTAGAGTTGGTTG
[D4] (GT)8 250-261 6 0.464 0.492 -0.052 0.119 NS GF112166
MCQ45 F: GCGCTAGGGACCATACACAA
R: TGGTTTCTAACTGGGGCATC
[D3] (AG)14 100-115 6 0.351 0.374 -0.062 NS 0.056 GF112160
MCQ3 F: GGGCCAGAGGAAAGTGAGAT
R: CCCGAAACCTTAAGCACATC
[D3] (GT)8 206-214 6 0.383 0.412 0.240 NS 0.334 NS GF112143
MCQ25 F: CTAGAGGAAAAGCGGTGCAT
R: CTGGCTGTCCACACATCAAT
[D3] (GT)10 254-266 5 0.478 0.554 0.386 NS 0.272 GF112150
Reaction 2
MCQ28 F: TTTGGCAAATAGCCTTCTGG
R: GGTGTCGATGTGAGGGGTTA
[D4] (TG)8 116-126 4 0.604 0.659 0.658* 0.488* GF112170
MCQ39 F: TCTTTAGCAGCGCCTGTATG
R: ACAACACGTAACCTCGCTGA
[D4] (GT)9 186-200 5 0.467 0.502 0.090 -0.067 GF112157
MCQ10 F: AGCGAGTGCGACGAATAAAG
R: CAGCGTGGAAGACAAGTTCA
[D4] (CGA)8 306-320 5 0.583 0.636 0.398* 0.221 GF112145
MCQ2 F: TGATTGAGTCATGGTGCAGAG
R: ACCCTTAAGCCTTCCGTGTA
[D3] (AG)20 135-155 2 0.340 0.434 0.060 0.328 NS GF112142
MCQ4 F: TTCATCTCTATCCGGTTGTGG
R: CTAGCCTGGCAAGAACCAAC
[D3] (TG)8 258-262 3 0.580 0.654 0.083 0.020 GF112162
MCQ29 F: CCCTTGTGGGAAGTAGTTGG
R:TGACACTTCCTCGAGACACG
[D2] (AC)8 119-127 4 0.602 0.662 -0.127 0.158 GF112171
Reaction 3
MCQ1 F: TACCGAGAGGTTTGCAGGAC
R: GCGTACCAGGATCGTCTCAT
[D4] (AG)12 133-145 4 0.445 0.521 0.504* 0.415 NS GF112161
MCQ22 F: TCAAATCTGGGTCACAATGC
R: TGACAACTTCCCCAGAGAGG
[D4] (GT)17 179-215 12 0.612 0.666 0.359 NS 0.060 GF112148
![Page 52: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/52.jpg)
38
Polymorphic Information content (PIC), expected heterozygosity (HE) and Weir and Cockerham's (1984) inbreeding coefficient (FIS).
NS: not significant; *Significant departure from Hardy-Weinberg after Bonferroni correction (adjusted significance [5%] threshold =
0.001666) of the probability values using Fisher`s method.
MCQ37 F: AATCCAAACGACGCAAGAAC
R: GGCGCTAGAAGTAGCCTTCA
[D4] (AC)8 245-251 4 0.378 0.420 0.102 -0.097 GF112156
MCQ36 F: GGATGGACTCCACGAAATGT
R: GGGTTTCATGGTGTCTACGG
[D3] (CA)8 148-152 3 0.339 0.406 -0.087 -0.019 GF112155
MCQ23 F: TCTTTAGCTTGCAGGGCCTA
R: TTCTGACAGCTGCACTCACC
[D3] (CT)8 244-251 4 0.474 0.539 0.598* 0.367* GF112149
MCQ11 F: CATGAGCACGTGTCTTCTCC
R: CATCATAATCGGCGCCTAAC
[D2] (TG)8 251-265 5 0.462 0.558 -0.022 -0.017 GF112146
Reaction 4
MCQ8 F: CCCCAACATTAAACCCTCTTT
R: TTTCTGTACACCTCGCACCA
[D4] (CA)13 213-221 4 0.618 0.683 0.221 0.066 GF112163
MCQ9 F: TTAGCGGAGCAGCTGTGTAG
R: GTGCCTCAAGAGTCCATCGT
[D4] (GA)10 271-281 8 0.659 0.706 0.058 0.190 NS GF112164
MCQ31 F: AATGAAGGAACCTCGCGTAA
R: ATTTAGATGCGACCGCAGAA
[D4] (TG)8 158-170 5 0.675 0.714 -0.107 -0.015 GF112152
MCQ42 F: AAGGGTCACAACCCACTTCA
R: TGGTGGGGACACATGTTAAA
[D3] (CT)13 122-136 8 0.501 0.528 -0.036 -0.053 NS GF112159
MCQ13 F: ACAGAGCTGCCTTTTGCAGT
R: CCAGCTGCCAATTTCATTCT
[D3] (AC)9 248-256 5 0.552 0.622 0.175 0.123 GF112165
MCQ41 F: GAAGGCACTTCCTGTCTCGT
R:TGGTCGTAACAATCCCCTT
[D3] (AG)8 194-202 5 0.600 0.666 -0.068 0.024 GF112158
Reaction 5
MCQ33 F: ATCCGCTCGACAAATAATGG
R: ACATGGAACGACGTCGAAAT
[D4] (CA)9 110-114 3 0.337 0.369 0.795* 0.465* GF112153
MCQ20 F: TGTATGATGCTGTGCGATGA
R: CAAACCTTGCCAAAGAGTGC
[D4] (AG)9 198-202 3 0.539 0.611 0.129 0.355 NS GF112147
MCQ21 F: CAGCTCGGCAATAGAAAACC
R: TCTGTCTCTGTCTGCCTTGC
[D4] (CT)10 241-271 8 0.589 0.617 0.414* 0.208 GF112167
MCQ26 F: ACCTGTCACTCGAGCCATTC
R: GTGCGACATCCGATACTGAA
[D4] (CT)9 145-167 9 0.826 0.844 -0.033 0.103 GF112151
MCQ34 F: CAGTGGGGAAAGAAACCAGA
R: TTAAGCCAATCTGCGTTGTG
[D3] (CA)9 172-190 7 0.581 0.621 0.409* 0.271* GF112154
MCQ5 F: GGAAATCCATTGGACAGGAA
R: ACATCGTCGGAGGAACAGAG
[D2] (AC)9 198-206 5 0.630 0.679 0.230 NS 0.370* GF112144
![Page 53: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/53.jpg)
39
Figure 2.1: Electropherograms of the five multiplex panels depicting amplification profile
and loci size distribution. Horizontal axis shows the size in base pairs (bp). Numbers above
the peaks are the allele size.
![Page 54: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/54.jpg)
40
Polymorphism and reproducibility of the microsatellite markers was surveyed in 70
C. quinquefasciatus individuals collected in Uganda. Amplification success was 100% for
21 of the 30 markers, while for the remaining nine loci amplification was between 77.14%
and 98.6%. The lowest success rate (77.14%) was observed in multiplex 5 primarily as a
result of amplification failure of loci MCQ33 and MCQ34 (Figure 2.2).
All 30 loci were polymorphic (0.95 criterion), with 2-12 alleles observed per locus
(average 5.367 SD 0.388), while the observed and expected mean heterozygosities were
0.484 (SD 0.029) and 0.585 (SD 0.022) respectively. Four out of 5 panels exhibited the same
proportion of alleles (mean = 5.74), while the mean of expected heterozygosity in reaction
2, reaction 4 and reaction 5 was higher than 0.6 (Figure 2.2). Furthermore, polymorphic
information content (PIC) also showed a high level of genetic variability ranging from 0.337
(MCQ 33) to 0.826 (MCQ 26).
Figure 2.2: Proportion of amplification and expected heterozygosity in each six-plex panel.
% amplification: proportion of samples per reaction that amplified for all loci. Box plot
includes expected heterozygosity from the 25th to the 75th percentile; the horizontal line
within the box represents the median value. Lines outside the box represent the lowest and
highest value.
0
10
20
30
40
50
60
70
80
90
100
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
Reaction 1 Reaction 2 Reaction 3 Reaction 4 Reaction 5
% a
mp
lific
atio
n
exp
ecte
dh
eter
ozy
gosi
ty p
er
locu
s
% amplification
![Page 55: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/55.jpg)
41
Samples from Jinja and Kampala exhibited seven and five significant deviations from
Hardy-Weinberg equilibrium (HWE) respectively after Bonferroni correction (Table 1),
with four markers (MCQ 28, MCQ 23, MCQ 33 and MCQ 34) showing significant HWE
deviation in both populations. For these loci the HWE deviation was associated with positive
FIS values (between 0.271 and 0.795) reflecting heterozygote deficiency, probably due to the
presence of null alleles. Owing to very large diversity in mosquitoes and insects, it is
common for some loci to exhibit null alleles. Results from the linkage disequilibrium test
(Fisher`s exact test) detected significant linkage disequilibrium between only loci MCQ 26
and MCQ 31 (Jinja) and MCQ 26 and MCQ 41 (Kampala), suggesting broad-scale
independence of markers.
In this study we describe 29 new microsatellite markers, which have been combined
into five multiplex reactions, thereby significantly enhancing the genotyping efficiency for
genetic diversity studies of C. quinquefasciatus. Though in silico methods for isolation of
microsatellite loci have significantly increased the number of markers developed in different
species (Lovin et al. 2009, Abreu et al. 2012, Dobes and Scheffknecht 2012), the high
frequency of primer site and flanking region mutations still impedes the development of
markers which amplify consistently in wild populations (Carlsson 2008, Hickner et al. 2010).
It remains to be investigated as to whether these markers will be useful in other members of
the complex as large variation in flanking regions between other species within the C. pipiens
has been described (Smith et al. 2005).
The development of these six-plex suites is especially important since most of the
previously published microsatellite markers applied for C. quinquefasciatus genotyping
have been amplified in simplex reactions (single locus) and analyzed by pooling PCR
products from several loci (Fonseca et al. 1998, Huang et al. 2008), which is a limitation for
high throughput screening. Previous studies (Masi et al. 2003, Porta et al. 2006, Eusemann
![Page 56: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/56.jpg)
42
et al. 2009) have shown that the optimization of parameters such as optimal annealing
temperature and primer concentration are critical but time-consuming steps for multiplex
development. However, here we demonstrated that by combining in silico characterization
of primer compatibility and a commercial multiplex amplification kit the optimization
process proved straightforward, without apparently compromising amplification quality or
specificity. Although these multiplex have been designed for a specific dye system, it can be
readily converted to other systems using the design software described.
![Page 57: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/57.jpg)
43
Chapter III
Chapter III - Local selection in the presence of high levels of gene flow: Evidence of
heterogeneous insecticide selection pressure across Ugandan Culex quinquefasciatus
populations
Local selection in the presence of high levels of gene flow:
Evidence of heterogeneous insecticide selection pressure across
Ugandan Culex quinquefasciatus populations
3.1 Abstract
Despite the role of insecticide based-approaches to control Culex quinquefasciatus populations,
few studies so far have been conducted to understand the impact of insecticide selection pressure
in the process of local evolution of resistance in natural populations. Herein, C. quinquefasciatus
mosquitoes collected in Uganda, where no direct vector control interventions for this species
have been conducted recently, was used as a model to determine if is possible to detect
heterogeneities in selection pressure driven by the use of insecticides targeting other insect
species with medical or agricultural interest. Genetic diversity and structure of the local
populations were assessed through microsatellite markers, and the impact of insecticide pressure
from distinct classes was investigated by applying two parallel genotyping assays to type the
target-site mutations;Vgsc-1014L and Ace1-119S. Among the populations, no significant
differences in genetic diversity indices were observed by the microsatellite markers with HE
ranging from 0.597 to 0.612, with the highest and lowest allele frequency detected in samples
from Kanungu (4.96) and Kampala (5.42), respectively. The microsatellite data also indicated
low genetic differentiation among populations (FST = 0.019, P = 0.001), although a pattern of
genetic structure was detected, which grouped the four populations within three clusters. In
contrast to microsatellite markers, the genotyping of insecticide-resistance markers indicated a
heterogeneous distribution of resistance alleles between Uganda Central to Eastern and
Southwest populations. In populations from the central region, a frequency of 62% and 32% for
the Kdr and Ace-1 resistant allele were observed, respectively. Conversely, in the populations
from Eastern and Southwest a higher frequency of Kdr alleles (100% and 97%) was detected,
while the frequency of Ace-1 resistant alleles corresponded to 12% on both regions. Taken
together, the pattern of microsatellite genetic diversity and insecticide selected markers suggest
that despite the absence of official vector control against Ugandan C. quinquefasciatus,
populations are under heterogeneous selection pressure imposed by insecticides from distinct
classes with variation in level of exposure.
![Page 58: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/58.jpg)
44
3.2 Introduction
Culex quinquefasciatus, also known as the southern house mosquito, is widely distributed
throughout many regions of Africa, the Americas, Asia and Australia (Farajollahi et al. 2011).
C. quinquefasciatus is a primary vector of arboviruses such as West Nile virus (WNV) and St.
Louis encephalitis virus (SLEV) in temperate regions (Diaz-Badillo et al. 2011, Molaei et al.
2012) and in many tropical/sub-tropical regions it is implicated in the transmission of lymphatic
filariasis (LF) (Bockarie et al. 2009, Simonsen and Mwakitalu 2013). On the African continent,
LF is predominantly transmitted by Anopheles mosquitoes in rural areas, while in urban and
coastal areas of East Africa, Culex species are the main vector (Bockarie et al. 2009).
Since LF is the second largest cause of long term disability among the Neglected Tropical
Diseases (NTDs), efforts to eliminate LF in endemic regions by 2020 have been intensified
through the Global Program to Eliminate LF (GPELF) (Katiyar and Singh 2011, Rebollo and
Bockarie 2013). Although Mass Drug Administration (MDA) has been the primary intervention
of the GPELF to block LF transmission, vector control measures have also been advocated for
endemic areas where MDA faces challenges such as adverse reactions due to co-infection with
LF and Loa-loa. In regions with high LF prevalence, vector control is expected to reduce the
number of MDA rounds required to achieve the elimination threshold (Sunish et al. 2007,
Bockarie et al. 2009, Kelly-Hope et al. 2013).
Vector control relies chiefly upon the use of insecticides, either through insecticide treated
nets or indoor residual spraying of insecticides onto the interior surfaces of dwellings.
Development of resistance to these insecticides has been the major impediment to effective
control. In contrast to other vector species, few studies have addressed mechanisms and
distribution of resistance in C. quinquefasciatus (Jones et al. 2012b, Scott et al. 2015), likely
![Page 59: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/59.jpg)
45
due to the reliance upon MDA, rather than vector control, as the primary anti-LF intervention
(Kolaczinski et al. 2007). In Uganda, a country with high rates of malaria transmission and with
LF prevalence concentrated in the North and West ranging from 0.4-30.7%, Anopheles is
incriminated as the primary vector (Onapa et al. 2001, Kolaczinski et al. 2007) and vector
control is targeted chiefly at Anopheles. Whilst there is no official vector control programme
targeting Culex populations, insecticide resistance may be indirectly selected through the use of
insecticides for the control of vector species such as Anopheles or agricultural pests or directly
through control of nuisance biters, principally in urban areas (Norris and Norris 2011, Nkya et
al. 2013).
Indeed, due to the high prevalence of malaria across the country, two vector control
interventions have been used (Kigozi et al. 2012, Yeka et al. 2012); distribution of long-lasting
pyrethroid insecticide treated nets (ITNs) and focal indoor residual spraying (IRS) in regions of
high malaria prevalence especially in the Mid-North region (Yeka et al. 2012, Uganda Bureau
of Statistics 2015) but also in the extreme South-West (Bukirwa et al. 2009). Targeting
Anopheles mosquitoes, during malaria control interventions is also likely to impose selection
pressure on sympatric Culex mosquitoes as demonstrated by other studies (N'Guessan et al.
2009, Norris and Norris 2011).
In addition, heterogeneity in selection pressure and geographical spatial structure could
result in a heterogeneous pattern of insecticide resistance at both a micro- and macro-geographic
scale (Lenormand 2002, Barbosa and Hastings 2012). Consequently, distinguishing the effect
of local selection from population genetic background is not easily achieved (Kawecki and Ebert
2004). For example, frequencies of adaptive selected markers for insecticide resistance, such as
kdr or Ace-1 alleles, if approximately without deleterious fitness effects, may occur at similar
frequencies in insecticide-treated and non-treated areas through extensive gene flow as well as
![Page 60: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/60.jpg)
46
through direct selection pressure (Endersby et al. 2008). Conversely differential resistance allele
frequencies could result from differences in either/or selection pressures or genetic drift.
Population genetic inferences combining neutral and adaptive loci might allow us to infer
differential selective pressure across an area. Since allele frequencies at neutral loci are
influenced mostly by effective population size and migration, these markers have become a
powerful tool for detecting the influence of demographic and colonization effects on population
diversity and structure (Selkoe and Toonen 2006, Hoffmann and Willi 2008). By contrast,
changes in the frequency of insecticide resistant alleles such as 1014L and 119S have been
studied extensively and are associated with insecticide selection pressure in vector populations
worldwide (Weill et al. 2004, Donnelly et al. 2009, Tantely et al. 2010, Mawejje et al. 2013).
Studying both resistance marker frequencies and neutral markers from the same samples
promises to yield important insights about heterogeneities in selection pressure.
Hence, since C. quinquefasciatus has not been linked to LF transmission in Uganda and
MDA is applied as the main strategy to mitigate the burden of LF transmission, no direct vector
control intervention for C. quinquefasciatus has been conducted recently throughout the country
(although malaria control interventions may indirectly target Culex). In this study, we utilized
Ugandan C. quinquefasciatus collections as a model to determine through combinations of
putatively selected and neutral markers, if it is possible infer heterogeneities in insecticide
selection. Population genetic diversity and structure were assessed using microsatellite markers,
whilst the impact of insecticide pressure from distinct classes in the evolution of resistance was
investigated by applying two parallel genotyping assays to type the target-site mutations 1014L
in the VGSC gene and 119S in the Ace-1 gene.
![Page 61: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/61.jpg)
47
3.3 Materials and methods
3.3.1 Area of study and mosquito collection
C. quinquefasciatus were collected from four districts of Uganda (Figure 3.1) with similar
levels of insecticide-treated bed nets (ITNs) coverage (Uganda Bureau of Statistics 2015). Three
of these districts are the main study sites of the Ugandan ICEMR (International Centers of
Excellence for Malaria Research) (ICEMR 2015). A total of 162 resting adult mosquitoes of
both sex were collected by aspiration from inside houses between July and August 2012.
Collection points were located in Tororo and Kanungu districts with populations of 526 and 252
thousand people, respectively and more than 80% of the population dwelling in rural places. In
Jinja and Kampala, with populations of 468 thousand and 1.5 million people, respectively
samples were obtained from peri-urban places in Jinja (63% of rural houses) and in urban centres
from Kampala (Uganda Bureau of Statistics 2014).
![Page 62: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/62.jpg)
48
Figure 3.1: Geographic distribution of field-collected Ugandan C.
quinquefasciatus mosquitoes.
3.3.2 DNA isolation and Species identification
Genomic DNA from individual mosquitoes was isolated using a DNeasy kit (Qiagen)
following the manufacturer’s recommendations and then re-suspended in 200 µl of distilled
water. All samples were confirmed as C. quinquefasciatus by a diagnostic PCR assay (Smith
and Fonseca 2004).
Tororo
Kanungu
![Page 63: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/63.jpg)
49
3.3.3 Allelic discrimination assays of insecticide target-site mutations
For the initial design of target-site mutation genotyping assays, partial genomic
fragments spanning the location of the G119S mutation in the Ace-1 gene and the L1014F
mutation (kdr) in the Vgsc gene were amplified from genomic DNA isolated from mosquitoes
collected from four different regions (Figure 3.1). PCR reactions were performed in a final
volume of 20 µl including 1µl of genomic DNA, 1X Phusion HF buffer, 200 µM of each dNTP,
0.02 U/µl of Phusion Hot start II DNA polymerase and 0.4 µM of each specific primer for the
Ace-1 and Vgsc gene (Table 3.1). Amplification was performed with cycling conditions of 98
ºC for 30 sec, followed by 30 cycles of 98 ºC for 10 sec, 56 ºC for 15 sec and 72 ºC for 15 sec
with a final extension of 72 ºC for 10 min.
PCR products were purified using the GeneJET PCR purification kit (Thermo Scientific)
and then cloned into the pJet 1.2 vector using the CloneJet PCR cloning kit (Thermo Scientific).
Clones were screened using PCR and DNA extracted for sequencing from positive colonies
using the GeneJET Plasmid Miniprep kit. After sequencing, sequences were aligned and
manually edited in CodonCode Aligner (CodonCode Corporation). Sequence regions conserved
across haplotypes were used to design custom primers and TaqMan probes using the Custom
TaqMan® Assay Design Tool (Life Technologies, UK) and pyrosequencing assay using the
PyroMark assay design software 2.0 (Qiagen).
The Ace-1 TaqMan assay was designed to genotype the SNP (GGC/AGC) in the first
base of the codon at the position 119 in the Ace-1 gene. TaqMan allelic discrimination reactions
were performed in a final volume of 10 µl using 1 µl of genomic DNA, 1X SensiMix II probe
(Bioline), 900 mM of each primer and 200 nM of probes (Table 3.1). A Stratagene MX3005P,
![Page 64: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/64.jpg)
50
with cycling parameters of 95 °C for 10 min and 40 cycles of 92 °C for 15 sec and 60 °C for 1
min was used.
The Kdr-pyrosequencing assay to type the L1014F mutation in the exon 20 of the Vgsc
gene was developed to detect two synonymous resistant alleles (TTC and TTT) and the wild-
type allele (TTA). PCR reactions to amplify a 105 bp fragment was performed in a total of 25
µl containing 10ng of gDNA, 200 µM of each dNTP, 1X of the 10X PCR buffer, 2.0 mM of
MgCl2, 0.6 units of HotStarTaq DNA polymerase (Qiagen) and 0.4 µM of each specific primer
(Table 2). After initial denaturation at 95 °C for 15 min, PCR amplification was performed for
40 cycles of 94 °C for 30 sec, 58 °C for 30 sec, and 72 °C for 30 sec, followed by a final
extension step at 72 °C for10 min. For genotyping by pyrosequencing, single-stranded PCR
products were obtained using the PyroMark Q24 Vacuum Prep Workstation and then used in
pyrosequencing reactions performed using the PyroMark Gold Q96 reagent kit (Qiagen).
Sequencing primer and dispensation order are described in Table 3.1.
![Page 65: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/65.jpg)
51
Table 3.1: Primers and probes for screening the Ace-1 and Kdr mutations in the Ace-1 and Vgsc genes, respectively in Culex
quinquefasciatus mosquitoes.
Locus
PCR primers Target-site SNP assay
TaqMan allelic discrimination
Ace-1 Cx_Ace-1-F: 5`- CGACTCGGACCCACTCGT - 3` Primer F: 5` - TCCAGCGTGGCAGTCC - 3`
Cx_Ace-1-R: 5` - CCTACCTCAGTGCCAGGTTC - 3` Primer R: 5` -GCCGTCATGCTGTGGATCTT - 3`
Wild-type/probe: 5` - VIC-AGTAGAAGCCACCCCC - 3`
SNP/probe: 5` - FAM-AGTAGAAGCTACCCCC - 3`
Kdr Pyrosequencing
Cx-Kdr-F: 5` - CCTCCCGGACAAGGACCTG - 3` Primer F: 5` - CTTGGCCACCGTAGTGATAGG - 3`
Cx-Kdr-R: 5` - GGACGCAATCTGGCTTGTTA -3` Primer R: 5`Biotin - GCTGTTGGCGATGTTTTGACA - 3`
Seq. primer: 5` - CCGTAGTGATAGGAAATTT - 3`
Dispensation: 5`HGTCGTGAGT ATTCCAGCGT GAAGTC - 3`
![Page 66: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/66.jpg)
52
3.3.4 Detection of Ace-1 gene duplication by haplotype diversity
The absence of Ace-1 homozygous resistant genotypes observed from the TaqMan
results indicated a likely gene duplication of Ace-1 in all four populations studied (Djogbénou
et al. 2009, Alout et al. 2011). To investigate the possible presence of multiple gene copies, a
partial fragment of Ace-1 was PCR amplified from 12 individuals from Kampala. After cloning,
between six and eight colonies from each individual were sequenced in order to detect the
presence of >2 alleles, which is indicative of gene duplication (Labbe et al. 2007a).
Sequences from each individual were aligned in CodonCode Aligner software version
4.2.2 with ClustalW (Larkin et al. 2007) and visualized using Jalview (Waterhouse et al. 2009).
MEGA 5.1 (Tamura et al. 2011) was used to analyse haplotype variability by calculating the
number of polymorphic sites and nucleotide diversity (π nucleotide diversity index). Frequency
and relationships between haplotype were visualised by a minimum spanning network tree
generated using the program PopArt available at http://popart.otago.ac.nz.
3.3.5 Microsatellite genotyping
Microsatellite genotyping was conducted using a novel panel of 30 microsatellite loci
developed for this study (see Chapter II). Microsatellite loci were isolated by scanning 180 C.
quinquefasciatus supercontigs downloaded from VectorBase (Megy et al. 2012) with SciRoKo
(Kofler et al. 2007) to identify perfect di- or tri- nucleotide motifs with repeat number ranging
from 5 to 20. Genotyping was performed using five six-plex assays with PCR reactions
conducted in 25 µl volumes containing: 1X Type-it multiplex PCR Master Mix (Qiagen), 0.2
µM of each primer and 2 µl of genomic DNA. PCR cycling conditions followed the QIAGEN
Type-it Microsatellite procedure and amplified fragments were genotyped using a Beckman-
Coulter CEQ8000 capillary electrophoresis system with a 400 size standard kit. Genotypes were
![Page 67: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/67.jpg)
53
sized using the Beckman-Coulter CEQ 2000 DNA analysis system software and manually
verified.
The microsatellite genotype data was analyzed with the program Micro-Checker (Van
Oosterhout et al. 2004) to detect possible scoring errors (stutter peaks and allele drop-out) and
null alleles. Then, allelic frequencies, observed (HO) and expected (HE) heterozygosities were
calculated using the GenAIEX 6.5 (Peakall and Smouse 2012) . Allele richness, adjusted to the
smallest sample size, was estimated in FSTAT (Goudet 2001), and Polymorphic Information
Content (PIC) calculated using Cervus 3.0 (Kalinowski et al. 2010). Genotypic frequencies were
tested for deviation from Hardy-Weinberg equilibrium (HWE) for each locus by the exact
probability test available in GENEPOP 4.3 (Rousset 2008), followed by a sequential Bonferroni
correction. Detection of loci under selection were conducted using coalescent simulations for
each loci comparing levels of genetic differentiation (FST) and genetic diversity
(heterozygosities) within and between population as described by Excoffier et al. (2009)
implemented in Arlequin 3.5.1 (Excoffier et al. 2005).
Genetic differentiation among populations was estimated by pairwise FST using Arlequin
3.5.1 (Excoffier et al. 2005). In addition, an AMOVA analysis was also carried out in Arlequin
to estimate the level of differentiation among populations from different clusters based on FST
values. The pattern of migration under an isolation-by-distance model was tested with a
Mantel’s test using Rousset’s genetic distance (FST/(1-FST)) and geographic distance in the
isolation-by-distance program (Jensen et al. 2005). A Bayesian analysis to infer the population
structure without prior information of the geographic distribution of samples was carried out
using STRUCTURE 2.3 (Pritchard et al. 2000). To identify the optimal number of clusters (K)
in these populations, twenty independent runs were conducted for each K value (ranging from
K = 1 to K = 7) with 10,000 interactions and 100,000 replications. The most likely K value was
![Page 68: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/68.jpg)
54
calculated for each run by the log likelihood (LnP(D)) method and results compiled using
CLUMPP (Jakobsson and Rosenberg 2007). Population structure was also evaluated by
Discriminant Analysis of Principal Components (DAPC) using the adegenet R package
(Jombart 2008). To identify optimal number of cluster for the DAPC clustering, k-means values
were sequentially tested and then compared using Bayesian Information Criterion (BIC), with
the lowest value of BIC used as likely number of population clusters.
3.4 Results
3.4.1 Frequency of target-site resistant alleles
Genotyping of two target-site mutations G119S and L1014F in the Ace-1 and Vgsc genes
respectively was conducted utilizing TaqMan allelic discrimination and pyrosequencing assays,
respectively. The Ace-1 resistant allele (AGC) was observed in all populations with a frequency
ranging from 12-33% (Figure 3.2A). Despite the high frequency of the 119S allele we observed
complete absence of homozygous resistant mosquitoes. The frequency of heterozygotes was
almost three times higher in Kampala and Jinja compared to the other two populations (Table
3.2, Figure 3.2B). Among the four populations, a moderate He (0.323 + 0.065) was observed
with a marked excess of heterozygotes (Fis = -0.362), whilst within populations, genotype
frequencies were not significantly different from Hardy-Weinberg expectation for both the
Kanungu and Tororo populations (Table 3.2). Additionally, no significant difference in allele
frequencies was detected between Jinja and Kampala (P = 1.0) and Kanungu and Tororo (P =
1.0).
For the kdr mutations (L1014F) we detected a high frequency of resistant alleles ranging
from 62 - 100% (Figure 3.2A). The kdr mutation in C. quinquefasciatus has two alternative non-
![Page 69: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/69.jpg)
55
synonymous substitutions (TTT and TTC) at the third position of the codon. The
pyrosequencing genotyping identified 11 individuals harbouring all three kdr alleles instead of
the two expected from diploid organisms. With the exception of Kanungu, mosquitoes with tri-
allelic genotypes were observed in all populations with a frequency of 4.0 - 10.8% (Figure 3.3),
which was not used for the calculation of resistant allele frequency. Excluding individuals with
a tri-allelic pattern to allow the use of standard methods to infer departures from Hardy-
Weinberg, our analysis detected significant deviation only in mosquitoes from Tororo with FIS
< 0, indicating an excess of heterozygotes (Table 3.2).
Nevertheless, between populations significant differences in allele’s frequencies was
detected with the exception of Jinja and Kampala (P = 0.63). The TTC allele was observed at a
high frequency (41-69%) in all populations with the exception of Kanungu, where a higher
frequency of the TTT resistant allele (55%) was detected, coupled with an absence of the wild-
type allele (Figure 3.2A). In all populations, we observed a low frequency of susceptible
homozygotes (ranging from 0 to 14%), while the majority of resistant alleles were observed in
heterozygotes (Figure 3.2B).
![Page 70: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/70.jpg)
56
Figure 3.2: Genetic variability for the L1014F and G119S target-site mutations in C. quinquefasciatus mosquitoes from Uganda. A)
Geographic distribution of target-site mutations. Pie charts depict the relative frequencies of L1014F and G119S mutation in the Vgsc
and Ace-1 gene, respectively. B) Target-site mutations genotypic frequency.
![Page 71: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/71.jpg)
57
Table 3.2: Ugandan Culex quinquefasciatus populations and genotypes of the target-site mutations G119S and L1014F
ace1-G119S locus Vgsc-L1014Flocus
Genotype Genotype
Population N GG GS SS HE F HWa N LL FC L FC FC FTL FCFT FT FT HE F HWa
Jinja 40 14 26 0 0.439 -0.481 0.002** 34 5 13 7 3 5 1 0.611 -0.011 0.945NS
Kampala 46 17 29 0 0.432 -0.460 0.002** 46 6 16 7 7 8 2 0.649 -0.050 0.954NS
Kanungu 45 34 11 0 0.215 -0.139 0.350NS 42 0 0 6 0 26 10 0.495 -0.249 0.106NS
Tororo 43 33 10 0 0.206 -0.132 0.388NS 43 1 1 19 0 20 2 0.450 -0.085 0.000***
N is the number of mosquitoes analysed; HE is the expected heterozygosity and F is the fixation index. HWa, P-value of χ² tests for
Hardy-Weinberg equilibrium.
GG, GS and SS correspond to homozygous and heterozygous genotypes for ace1-G119S locus.
FC; codon TTC, FT; codon TTT, L; codon TTA are distinct codons at the Vgsc-L1014 locus.
NS, not significant; **P < 0.01; ***P < 0.001
![Page 72: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/72.jpg)
58
Figure 3.3: Genotyping by pyrosequencing of the Vgsc-L1014F mutation in C.
quinquefasciatus. A and B) Allelic Vgsc-L1014F pyrogram showing two heterozygous
genotypes: wild-type/resistant and resistant/resistant C) Vgsc-L1014F allelic
genotyping with a pattern of tri-allelic pyrogram indicating likely gene duplication due
to simultaneous presence of A, C and T alleles, instead of two alleles expected for a
diploid genome. D) Frequency of tri-allelic genotype across Ugandan population.
![Page 73: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/73.jpg)
59
3.4.2 Ace-1 haplotype diversity and identification of allelic copy
variation
A 535 bp fragment of the Ace-1 gene was sequenced from 12 individuals (N =
57 sequences; GenBank accession numbers: KT591708-KT591765) with nine
haplotypes detected displaying a total of ten polymorphic sites (Figure 3.4A) with
frequencies ranging from 0.017-0.397, with the resistant allele detected in four
haplotypes: A, E, H and I accounting for 40% of total haplotypes identified. The
minimum spanning network tree (Figure 3.4B) shows that three resistance bearing
haplotypes (A, H, I) differ from each other by a single mutational step with Hap A the
most common. The remaining 119S (E) is three mutational steps away and is likely to
have an independent origin. For 119G wildtype haplotypes there was no predominant
haplotype. In three out of 12 individuals studied, we identified mosquitoes with three
to five haplotypes belonging to different cluster from the neighbour-joining
dendrogram (Figure 3.5), which indicates the presence of copy number variation for
the Ace-1 gene in the populations studied.
![Page 74: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/74.jpg)
60
Position
12
33
69
75
87
11
4
18
9
27
7
35
5
46
2
Total of
Variation
Haplotype
freq
Consensus A Y R G A T G G G T
Haplotype
A A C A 3 0.397
B G T A 3 0.190
C A C 2 0.121
D G T A C 4 0.0172
E G T A A 4 0.0172
F G T A C C 5 0.0517
G G T C G 4 0.172
H G A C A 4 0.0172
I A C T A 4 0.0172
Figure 3.4: Ace-1 gene haplotype diversity based on sequences obtained from C.
quinquefasciatus mosquitoes sampled in Uganda. A) polymorphic sites identified in a
535 bp partial fragment (intron 2 and exon 3) of Ace-1. Bold number indicates the
position of the G119S mutation in exon 3. B) Minimum spanning Network built using
sequences of a partial fragment of the Ace-1 gene. Each haplotype is represented by a
circle, whose size is proportional to the number of individuals showing that haplotype.
Haplotypes are coloured to differentiate haplotypes containing the susceptible allele
(Orange) and resistant allele (green). Hatch marks represent mutational steps
separating observed haplotypes.
A
B
![Page 75: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/75.jpg)
61
Figure 3.5: Dendrogram constructed using partial sequence of the Ace-1 gene from C.
quinquefasciatus individuals with a likely duplicated haplotype. Red and green dots
correspond to susceptible and resistant G119S haplotypes, respectively. Haplotypes
are labelled Cx followed by a number corresponding to an individual identifier and a
letter from A to I to identify an individual sequenced colony from that individual.
Haplotype labels highlighted in blue, green or orange are individuals with more than
two haplotypes.
![Page 76: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/76.jpg)
62
3.4.3 Microsatellite genotyping
3.4.3.1 Genetic diversity
A total of 186 alleles were detected across the 30 microsatellite loci analysed
(Appendix3-A) with 19 private alleles detected in 17 of the 30 loci. The number of
unique alleles in the samples from Kampala was twice that detected in any other
population (Figure 3.6A); however, the presence of these eight private alleles are
unlikely to significantly influence the genetic structure analysis since only two alleles
have a frequency higher than 1%. The allelic richness and Polymorphic Information
Content (PIC) across markers varied from 2.88 (MCQ 2) to 11.14 (MCQ 21) and from
0.332 (MCQ 2) to 0.825 (MCQ 26), respectively (Appendix3-A).
The Hardy-Weinberg exact test performed in individual locus/population
indicated that 26 out of 120 instances did not conform to HW equilibrium after
multiple corrections. However, only two loci (MCQ 28 and MCQ 33) showed
departure from HW equilibrium across all populations (Appendix3-B). The number of
loci that were not in HW equilibrium in each population ranged from five to eight
(Table 3.3). For all loci with departure from HW equilibrium, significant deviation
was associated with a positive inbreeding coefficient (FIS), revealing deviation in the
direction of heterozygote deficiency.
Analyses performed with Micro-Checker indicated a high frequency of null
alleles at loci MCQ 28 (0.12) and MCQ 33 (0.22), which could likely be responsible
for the heterozygote deficiency at these loci. Although the MCQ 1 and MCQ 34 loci
were within HW expectation in at least one population, these loci failed to amplify in
more than 10% of the samples also suggesting the presence of null alleles and them
not used on the genetic diversity analysis.
![Page 77: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/77.jpg)
63
Allelic diversity, expected heterozygosity (HE) and allelic richness within
populations were calculated using those 26 loci conforming to HW equilibrium and
exhibiting an absence or low frequency of possible null alleles. Levels of genetic
diversity were similar across populations (Figure 3.6A, Appendix 3B). The mean
number of alleles across all loci varied from 4.96 in samples from Kanungu to 5.42 in
samples from Kampala, whilst the highest allelic richness (Rs = 5.17) was detected in
Kampala; nevertheless, no significant difference in index of genetic diversity was
observed among the populations (Figure 3.6A). Average HE across all samples ranged
from 0.597 in Kampala to 0.612 in Kanungu with a median of 0.604 (Appendix 3B).
From the 26 microsatellite loci tested for deviation from a neutral-equilibrium model
based on the FST outlier approach, only the marker MCQ24 showed signs of possible
divergent selection (Figure 3.6B).
The analysis of the genomic region (supercont 3.264) containing this
microsatellite locus with sign of non-neutrality shows that it is close to 16 genes, most
of which are described as hypothetical proteins of unknown function; however, one
gene (CPIJ010175) belongs to the P450 family (CYP9J48) suggesting that the
departure from neutrality of MCQ24 might reflect genetic hitchhiking from insecticide
selection nearby the marker genomic region. Although further investigation is needed
to confirm the possible link of Cyp9j48 with insecticide resistance, the identification
of this gene is especially important as in A. aegypti, few candidate genes from the
family Cyp9 have been associated with permethrin and deltamethrin insecticide
resistance, with two genes Cyp9J24 and Cyp9J28 have their permethrin metabolizer
confirmed by heterologous expression (Strode et al. 2008).
![Page 78: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/78.jpg)
64
A
B
Figure 3.6: Characterization of microsatellite markers. A) Genetic diversity estimates
across Ugandan C. quinquefasciatus populations determined from data of 26
microsatellite markers. Allelic richness was calculated based on sample size of N=33.
B) Test of microsatellite markers deviation from neutral-equilibrium model using FST
outlier approach. Each dot represents a microsatellite locus and red dots identify
candidate loci under positive selection.
0.560
0.580
0.600
0.620
0.640
0.660
0.000
2.000
4.000
6.000
8.000
Jinja Kampala Kanungu Tororo
He
tero
zygo
sity
Me
an
Populations
No. of different alleles No. of alleles (Freq>=5%) Allelic RichnessNo. Private Alleles Expected heterozygosity
![Page 79: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/79.jpg)
65
Table 3.3: Sample sizes and indices of genetic diversity at 26 microsatellite loci for
four Ugandan C. quinquefasciatus populations.
N, Sample size; Ne, Estimate of effective population size; HE, mean expected
heterozygosity; HO, mean observed heterozygosity; FIS, inbreeding coefficient;
HW, Hardy-Weinberg equilibrium. a Linkage disequilibrium method bNumber of loci showing departure from Hardy-Weinberg equilibrium after multiple
test correction
*P > 0.05
3.4.3.2 Population structure
Pairwise FST estimates were used to measure the genetic differentiation among
the four Ugandan populations. The overall FST value was relatively low but statistically
significant (FST = 0.019, P = 0.001), while the pair wise FST values between
populations ranged from 0.007 to 0.029 (Figure 3.7A), with all figures significant at P
< 0.05. Additionally, a pattern of migration positively correlated with the geographic
distance between populations was detected (R2 = 0.963, P = 0.047, Figure 3.7B).
The DAPC and Structure analysis (Appendix 3C) also indicated population
structure, which grouped the four populations within three clusters, with individuals
from Jinja and Kampala belonging to the same cluster, which was distinct from the
other two samples (Figure 3.7C-D). AMOVA analysis carried out using the three
geographic clusters indicated by the Bayesian and DAPC results showed that the
majority of variation exists within individuals of (97.60%), while the variation among
Location N HE HO FIS HW
Jinja 41 0.603 (0.108) 0.541 (0.162) 0.116 * 8b
Kampala 44 0.597 (0.107) 0.531 (0.128) 0.123 * 5b
Kanungu 39 0.612 (0.159) 0.549 (0.199) 0.115 * 8b
Tororo 38 0.606 (0.134) 0.511 (0.172) 0.170 * 5b
![Page 80: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/80.jpg)
66
geographic clusters and populations of the same cluster are 1.62% and 0.78%
respectively.
Continued
![Page 81: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/81.jpg)
67
C
D
Figure 3.7: Genetic differentiation estimates among the four C. quinquefasciatus
populations based on allele frequencies of 26 microsatellite markers. A) Pair wise Fst
matrix among the four populations B) Regression of population pairwise linearized
Fst values with geographic distances. C) First and second PCs of the DAPC. Inferred
populations clusters are indicated by ellipses, which model 95% of the corresponding
variability. D) Bayesian cluster analysis. Diagrammatic representation of population
clusters for the most likely K (K = 3), where each vertical bar represents an individual
and each colour represents the probability of belonging to one of the three clusters.
3.5 Discussion
3.5.1 Pattern of insecticide target-site mutations
Based on the assessment of the two target-site mutations, L1014F (kdr) and
G119S (Ace-1), our data provides evidence of intense insecticide selection pressure on
![Page 82: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/82.jpg)
68
C. quinquefasciatus populations across Uganda’s Eastern-Southwest regions.
Genotyping results indicated a very high frequency of both kdr and Ace-1 resistant
alleles (Figure 3.2), with the frequency of kdr significantly higher than Ace-1 mutation
in all populations. A higher frequency of kdr compared to the Ace-1 resistance
mutation has been also reported in Culex and other vector mosquitoes in the African
continent (Corbel et al. 2007, Yewhalaw et al. 2011, Namountougou et al. 2012),
which might reflect the historical application of DDT and pyrethroid insecticides for
both vector and pest insect control or the deleterious effects of the 119S resistant allele
in the absence of insecticidal pressure (Djogbénou et al. 2009, Sparks 2013,
Hemingway 2014).
In Uganda, vector control interventions with pyrethroids, DDT and carbamate
insecticides have been regularly applied through the Uganda National Malaria Control
Program (UNMCP), which includes national scale distribution of ITNs and IRS in
regions with a high malaria prevalence (Yeka et al. 2012). Additionally, these
insecticides have been also applied for the tsetse and tick control to reduce sleeping
sickness and tick-borne diseases transmission (Bardosh et al. 2013). Remarkably, a
higher frequency of pyrethroid/DDT resistant markers (kdr) in our study has also been
described for Anopheles populations from the same geographical regions (Ramphul et
al. 2009, Verhaeghen et al. 2010).
Nevertheless, although previous studies have indicated a possible influence of
control intervention (ITN and IRS) targeted at Anopheles on insecticide resistance in
C. quinquefasciatus (Norris and Norris 2011, Jones et al. 2012b), with our study design
it is not possible to directly associate the UNMCP intervention with the evolution of
resistance in Culex populations. Furthermore, since insecticide is applied to control
other NTDs as well as in agriculture practises and domestic use (Kotlyar 2010,
![Page 83: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/83.jpg)
69
Wielgosz et al. 2014) in Uganda, pinpointing the likely insecticide exposure source
and the impact on the evolution of resistance in the studied populations is difficult.
Interestingly, the kdr genotyping also indicated a high frequency of both
variants (TTT and TTC) of the 1014F mutation in all populations, contrasting with
previous reports on the geographic distribution of 1014F in Culex mosquitoes
worldwide, which exclusively detect the TTT allele (Martinez‐Torres et al. 1999,
Sarkar et al. 2009, Ponce et al. 2015). To date, the TTC variant has been detected at
high frequency only in C. quinquefasciatus from Sri Lanka, which was previously
argued as the most likely geographic origin (Wondji et al. 2008), while only recently
having been detected in African C. quinquefasciatus from Zanzibar yet at very low
frequency (Jones et al. 2012b). The present data also show a significant difference in
frequency of the kdr resistant alleles within populations, with the TTC variant being
predominant in all populations with the exception of Kanungu. I do not have a
conclusive explanation for the difference in frequency of TTT and TTC within
Ugandan populations and between Uganda and other African populations.
Even so, at least two possible scenarios with relevance to resistance
management and understating of evolution of resistance can be raised. First, the allelic
frequency might reflect differences in allelic effect. Although in C. quinquefasciatus
both 1014F alleles are synonymous, differences in frequency due to higher adaptability
of one haplotype over the others cannot be discounted as previous work in Musca
domestica shows difference in fitness advantage in distinct haplotypes bearing the
same kdr mutations (Rinkevich et al. 2013b).
Another explanation involves a colonization process with genetic drift. Since the
TTT allele has been detected worldwide (see reference (Martinez‐Torres et al. 1999,
Sarkar et al. 2009, Ponce et al. 2015) this may indicate an ancient origin/colonisation
![Page 84: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/84.jpg)
70
or dispersion, which suggests that the TTC allele was introduced in Uganda from
another geographical region with a large founder effect followed by genetic drift that
shifted the TTT and TTC allele frequency, although a de novo origin and dispersion
cannot be discarded. Additionally, it is also possible that the TTC allele arose on the
African continent but has not been detected in other populations due to the Culex
species kdr genotyping methodologies employed in previous studies.
Interestingly, kdr genotyping by pyrosequencing indicated that 6.25% of the 176
individuals genotyped displayed three alleles simultaneously at position 1014 (Figure
3.3) suggesting a duplication of the Vgsc gene in the studied populations. In C.
quinquefasciatus Vgsc gene duplication was first reported in mosquitoes from the USA
(Xu et al. 2011), while in this study analysis (see Chapter IV) using quantitative PCR
methods to screen the same individual indicated the presence of copy number variation
(CNV) for the Vgsc gene, with copy number ranging from two to four. Recently, Vgsc
gene duplication was also detected in A. aegypti from Brazil, indicating that gene
duplication in target-site genes might be a common event (Martins et al. 2013).
Although detection of gene duplication for genes such as Ace-1, esterase and the
resistance to dieldrin gene, Rdl (Labbe et al. 2007b, Djogbénou et al. 2009, Remnant
et al. 2013) have already been demonstrated to be involved in insecticide resistance, a
definitive association of Vgsc gene duplication with insecticide resistance is currently
unproven.
Genotyping of the Ace-1 mutation indicated a high frequency of resistant
alleles in all four populations, with heterozygosity in Jinja and Kampala almost twice as
high compared to the other populations. In no populations were homozygous resistant
genotypes detected, while significant departures from Hardy-Weinberg was detected in
all populations possibly due to the absence of one of the genotypic classes (Table 3.2,
![Page 85: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/85.jpg)
71
Appendix 3D). The absence of homozygous Ace-1 resistant genotypes was not surprising
as the same pattern has been previously reported in both Culex and Anopheles populations
(Djogbenou et al. 2008, Edi et al. 2014, Labbe et al. 2014). In both species, this pattern
has been linked to the deleterious effects of the resistant homozygous genotype due to
changes in acetylcholinesterase kinetic properties and mutation fitness cost in an
insecticide-free or reduced insecticide exposure environment. However, the departure
from Hardy-Weinberg in our surveyed Ugandan mosquitoes might not be linked
exclusively to intensity of selection pressure, but could also reflect Ace-1 gene duplication
involving the wild type allele, thus creating a permanent heterozygosis to normalise ace-
1 enzyme activity level (Kwon et al. 2010, Alout et al. 2011, Weetman et al. 2015).
Indeed, our haplotype analysis identified mosquitoes harbouring Ace-1 gene duplication
in three out of 12 individuals investigated, with these mosquitoes exhibiting either three
or five distinct haplotypes simultaneously.
3.5.2 Population structure and heterogeneous evolution of insecticide
resistance
To infer the impact of indirect insecticide selection on genetic diversity and
population structure in a non-target species such as C. quinquefasciatus mosquitoes
from Uganda, we performed a population genetic study combining neutral markers
(microsatellites) and genotype data from two markers (1014F and 119S) linked to
resistance to four classes of insecticide applied in public health programs (Ffrench-
Constant 2007, Rivero et al. 2010). The data described here indicated a contrasting
genetic pattern between the microsatellite and insecticide selected markers. For both
markers linked to resistance, it was not able to identify a clear spatial geographic
spread, but did detect heterogeneity in allelic frequencies when comparing Ugandan
![Page 86: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/86.jpg)
72
Central to Eastern and Southwest populations. By contrast, no significant difference
in genetic diversity indices was observed from neutral markers among the populations.
The asymmetric distribution of insecticide resistant alleles strongly indicates that
C. quinquefasciatus populations across this Eastern/South-West transect of Uganda
are under heterogeneous insecticide selection pressure. This evidence is supported by
the homogeneity of genetic diversity observed with neutral markers across the
populations, suggesting that demographic effects, genetic drift, effective population
size and migration are not the main factors driving the heterogeneous distribution of
resistance alleles. The homogeneous microsatellite genetic diversity observed in the
studied populations contrasts with an expected reduction in genetic diversity between
populations under different strength of selection pressure as reported in C.
quinquefasciatus from Recife, Brazil after vector control intervention with Bacillus
sphaericus, a bio-larvicide (Cartaxo et al. 2011). As indicated by these authors,
discrepancies between neutral and selected markers might be linked to differences in
the marker’s genetic properties that modulate changes in allele frequencies, including
aspects such as quick recolonization and drastic bottleneck effects, difference in
intensity of local selection with frequent gene flow or low impact of insecticide
treatment on effective population size (Ne) (Kawecki and Ebert 2004, Paris et al.
2010).
Markedly, our data indicate that both the Tororo and Kanungu populations from
outside the Central-Eastern region (based on four administrative regions in Uganda)
have experienced a higher or longer-term selection pressure with pyrethroid
insecticides and/or DDT than the other populations, as suggested by the fixed or close
to fixation kdr mutation. On the other hand, the highest frequency of the Ace-1
mutation was observed in a geographic distribution pattern opposite to that of kdr. Not
![Page 87: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/87.jpg)
73
surprisingly, similar processes of local adaptation reflecting a heterogeneous evolution
of insecticide resistance in sympatric populations have also been observed in all the
main vector species worldwide (Sunil et al. 2013, Ambrose et al. 2014).
Interestingly, most studies reporting heterogeneous patterns of insecticide
resistance at a micro-geographical scale have linked the local evolution of resistance
to challenges for implementation of efficient control intervention in highly fragmented
habitats including overlapping of urban and rural patches or due to heterogeneous
urbanization structure, which could result in a mosaic of landscapes with sharp shifts
of insecticide selection pressure in local and metapopulation levels (Pocquet et al.
2013, Yadouleton et al. 2015).
The different distribution of kdr alleles between the districts might reflect the
combination of approaches to reduce Anopheles populations, which include national
distribution of ITN and IRS only in highly endemic and epidemic-prone regions. For
example, across Uganda irregular spraying with insecticides such as lambda-
cyhalothrin, DDT and alpha cypermethrin has been reported since 2006 when IRS was
re-introduced for vector control (Yeka et al. 2012). Although equally distributed in
urban and rural regions, differences in usage of ITN might also be linked to the pattern
of Culex kdr distribution as indicated by the Uganda Bureau of Statistics (Kudom et
al. 2015), which shows householders that own at least one ITN differ for example by
44% between the East Central and West Nile regions. Additionally, it is also important
to consider that in non-urban districts, other sources of insecticide exposure due to
agriculture practices, domestic usage as reported in other studies (Nalwanga and
Sempebwa 2011, Uganda Bureau of Statistics 2012) or the concomitant tsetse fly
vector control intervention in rural Uganda (Bardosh et al. 2013) might also play an
important role in the evolution of C. quinquefasciatus resistance.
![Page 88: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/88.jpg)
74
Surprisingly, the data from the present study also identifies a widespread
distribution of the Ace-1 G119S mutation, with a higher frequency in mosquitoes from
the Uganda Central region. The high frequency of the Ace-1 allele strongly indicates
that the mosquitoes collected in our study have been exposed to organophosphates
and/or carbamates insecticides, possibly for purposes other than public health as no
official intervention with insecticides from these classes for vector control were
conducted in the studied districts. For example, in C. quinquefasciatus populations
from Ghana and Benin, the high frequency of Ace-1 was attributed to the use of these
insecticides by farmers for pest control or pollutants in mosquito breeding sites
(Pocquet et al. 2013, Yadouleton et al. 2015).
Alternatively, the high frequency of Ace-1 mutation might be linked to the
replacement of pyrethroids and DDT for carbamate IRS throughout Ugandan Northern
regions in 2010, which reduced malaria transmission and indicated that Anopheles
populations were susceptible to bendiocarb (Yeka et al. 2012). Although it is not
possible make a direct link to the start of bendicoarb IRS action with the high
frequency of Ace-1 mutation in C. quinquefasciatus from Kampala and Jinja, an
increase of Ace-1 resistant allele in these districts, driven by migration of bendiocarb-
resistant mosquitoes from North to Central Uganda, is also a feasible possibility.
In spite of probable intense gene flow between populations supported by the low
pairwise FST observed, our data indicated the populations are structured in three demes.
Certainly, the population structure observed might reflect our study design with
asymmetric geographic distance between collections points, which could result in the
very strong pattern of isolation-by-distance (IBD) detected. Nevertheless, it is
important to notice that factors other than geographic distance, such as environmental
heterogeneity and associated selection as well as serial sequential founder effects, may
![Page 89: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/89.jpg)
75
also cause similar patterns of spatial autocorrelation (Orsini et al. 2013). For example,
in Aedes rusticus, comparisons among areas treated and not-treated with Bacillus
thuringiensis israelensis (Bti) showed more intense IBD among treated than among
non-treated sites (Nabyonga et al. 2013). These authors argue that the difference in
observed IBD instead of spatial distribution could result from differences in population
size after insecticide application or lower migration capability of selected mosquitoes
imposed by a fitness cost of the resistance mechanism. Consequently, it is also possible
that the structured distribution observed in Ugandan populations might reflect the
impact of heterogeneous insecticide selection pressure and not necessarily the
geographic distribution as the closest populations (Jinja and Kampala) show higher
frequencies of the Ace-1 mutation whereas the most distant (Kanungu and Tororo)
have the higher frequency of kdr resistant alleles.
3.6 Conclusion
Taken together the genetic diversity of neutral markers and two insecticide
resistance target-site markers shown in this study provide evidence that despite the
absence of a direct vector control intervention targeting C. quinquefasciatus
populations in Uganda, those populations have been submitted to an intense or long
term insecticide selection evidenced by a high frequency of 1014F and 119S resistant
alleles. These results are a warning of the importance of monitoring the evolution of
resistance in non-target mosquito populations in areas with frequent usage of
insecticide, as increase of resistance in vector species with secondary importance
might also contribute to increased transmission burden of vector-borne disease and
nuisance biting. In light of the unstructured distribution of insecticide resistance alleles
despite the likely high gene flow and low mosquito population differentiation, the
![Page 90: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/90.jpg)
76
population genetics study also suggests that C. quinquefasciatus populations from
different Ugandan districts are under heterogeneous selection pressure imposed by
insecticides from distinct classes with variation in the level of exposure creating a
pattern of local adaptation. Consequently, the results shown here indicate that public
health or agriculture insecticide usage could be driving the evolution of resistance in
non-target species such as C. quinquefasciatus in Uganda, thus representing a threat to
the local burden of transmission of vector-borne disease. Lastly, the results also
demonstrate that combining both newly resistant marker assays and the developed
microsatellite multiplex-panel is an applicable tool for detecting and monitoring the
pattern of local evolution of resistance in C. quinquefasciatus under control
interventions, which could provide new insight for developing more specific and
effective control programs.
![Page 91: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/91.jpg)
77
Chapter IV Chapter IV - Comparative analysis of PCR-based methods for inference of copy number
polymorphism in the sodium channel gene of Culex quinquefasciatus mosquitoes
Comparative Analysis of PCR-based Methods for Inference of
Copy Number Polymorphism in the Voltage-gated Sodium
Channel Gene of Culex quinquefasciatus Mosquitoes
4.1 Abstract
Although, the evolution of insecticide resistance in insects has mostly been associated with
variation in the gene(s) encoding the insecticide target-site or alterations in detoxification gene
expression, in mosquitoes of the Culex pipiens complex in many instances the genetic basis of
resistant phenotypes have also been related to an increase in copy number of insecticide-
resistance associated genes. Recently, in Culex quinquefasciatus mosquitoes it was reported
that there is a variation in copy number of the para-type sodium channel genes (Vgsc), which is
the target-site for the pyrethroids and organochlorines insecticides. For further investigation of
the Vgsc gene copy number in C. quinquefasciatus, in the present study a novel Vgsc-copy
number (CN) assay was designed and applied to infer the Vgsc gene CN in Ugandan field-
collected mosquitoes. Additionally, the applicability of distinct genotyping platforms and
efficiency of the Vgsc-CN assay were assessed by comparing the predicted CN of mosquitoes
genotyped through three platforms and four different methods: standard quantitative PCR
(qPCR) using absolute quantification (qPCR-Std) and ΔCt method, pyrosequencing by RQPS
method and droplet digital PCR (ddPCR) through absolute quantification. Quantification of the
Vgsc copy across all platforms and methods indicated the presence of CN variation in around
10% of the mosquitoes assayed, with variation in CN corresponding to three or four copies per
diploid genome. Under the experimental conditions applied herein, the ddPCR and Real-time
PCRs methods performed more precisely and yielded similar prediction of the Vgsc CN, while
the lowest concordance among all methods was observed for the RQPS methods. Hence, due
to evident variation in copy number of the C. quinquefasciatus Vgsc gene, the developed and
validated Vgsc-CN assay described here will facilitate the monitoring of the Vgsc gene CN in
wild populations as well as can provide a greater opportunity for future studies to elucidate
associations between the Vgsc CN and level of insecticide resistance.
![Page 92: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/92.jpg)
78
4.2 Introduction
The evolution of insecticide resistance involves a complex interaction of many types of
genetic variation; although known resistance mechanisms in mosquitoes are associated mainly
with variation in the gene(s) encoding the insecticide target-site, or alterations in detoxification
gene expression (Corbel et al. 2007, Berticat et al. 2008). Nevertheless, multiple studies have
now shown that gene duplication can also play a very important role in the evolution of
insecticide resistance (Kwon et al. 2012, Harrop et al. 2014, Shang et al. 2014).
Evolution of insecticide resistance through changes in gene copy number in contrast to
others sources of genetic variation such as single nucleotide polymorphisms (SNPs), can
drastically increase gene divergence and function by modifying gene structure, gene dose and
expression level of genes linked to resistance (Kondrashov et al. 2002, Zhong et al. 2013, Zhao
et al. 2014c). Gene duplication or deletion are also important sources of intraspecific diversity.
One such example is through copy number variation (CNV), also known as copy number
polymorphism (CNP) as detected in frequency >1% at population level, which encompasses
insertion/deletion of genomic regions >1Kb (Schrider and Hahn 2010, Severson and Behura
2012).
Previous studies in organisms including humans, insects and plants have revealed links
between CNV and phenotypic variation; ranging from localised plant adaptation; to a wide
array of human conditions and diseases such as schizophrenia and intellectual disability (Langer
et al. 2014, Mikhail 2014, Mukherjee et al. 2015). In the silkworm Bombyx mori in silico
analysis indicated that 1.4 % of the duplicated genome, included genes associated with
immunity, detoxification and reproduction (Zhao et al. 2013). In mosquitoes, species of the
Culex pipiens complex provide well-characterized examples of how CNVs can be associated
with adaptations to insecticide pressure. For example, amplification of the carboxylesterase
alleles A2, B2, A5 and B5 has been associated with resistance to organophosphates through
![Page 93: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/93.jpg)
79
elevated expression and insecticide detoxification (Coleman and Hemingway 1997, Buss and
Callaghan 2004). Additionally, duplication of the Ace-1 locus has been linked to
organophosphate and carbamate insecticide resistance in both Culex pipiens (Labbe et al.
2007a) and Anopheles gambiae (Weetman et al. 2015). The duplication brings a wild-type and
resistant allele onto the same chromatid and is thought to partially compensate for the
deleterious effects of resistant alleles in the absence of insecticide (Kondrashov and
Kondrashov 2006, Kondrashov 2012, Long et al. 2013).
C. quinquefasciatus, a mosquito with a broad distribution in tropical and subtropical
regions is the main vector of lymphatic filariasis as well as West Nile virus (WNV) and St.
Louis encephalitis virus (SLEV) (Kramer et al. 2008, Ichimori et al. 2014). Recently, variation
in the copy number of the para-type sodium channel genes (Vgsc) has been described in field-
collected mosquitoes from the United States of America, using Southern blot and PCR methods
(Xu et al. 2011). The results of this study indicated that the C. quinquefasciatus genome
contains at least two copies of the sodium channel gene. Although CNV has been described for
both target-site and metabolic genes and is associated with resistance to insecticides, readily
applicable molecular diagnostic tests to investigate the occurrence and evolution of CNV in
natural populations is lacking (Santolamazza et al. 2008).
Discovery methods for identifying CNVs such as microarrays and next-generation
sequencing are laborious (Alkan et al. 2011), which limits the identification and development
of diagnostic methods. Nevertheless, developing high-throughput and cost effective PCR-based
approaches for large scale population genotyping will become imperative for monitoring and
elucidating the role of CNV in the evolution of resistance and on vector control.
In the present study, we developed and validated a new Vgsc-CNV PCR-based assay to
score the number of copies of the Vgsc gene in natural populations of Culex mosquitoes. Four
Vgsc-CNV assays were designed for three distinct genotyping platforms: standard quantitative
![Page 94: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/94.jpg)
80
PCR (qPCR) and pyrosequencing, both commonly applied for genotyping SNPs, as well as the
newly developed droplet digital PCR (ddPCR) platform (Pinheiro et al. 2012). Additionally,
the Vgsc-CNV assay sensitivity and accuracy was compared across the three platforms by
genotyping field-collected mosquitoes from Uganda.
4.3 Material and methods
4.3.1 Sample collection and DNA isolation
Indoor resting adult C. quinquefasciatus mosquitoes were collected from four Ugandan
towns/cities: Jinja, Kampala, Kanungu and Tororo (see Chapter III, Figure 3.1) between June
and July 2012. Adults were sexed using antenna morphology with only males selected to
characterize the Vgsc gene dose since gravidity in females can affect CN estimation. Samples
were stored on silica gel prior to DNA isolation using a DNeasy kit (Qiagen) following the
manufacturer’s recommendations. DNA concentration from each mosquito was quantified by
PicoGreen (Life Technologies) and then normalized to approximately 10 ng/µl. Before CN
analysis all adult mosquitoes were confirmed as C. quinquefasciatus by a diagnostic PCR
method (Smith and Fonseca 2004).
4.3.2 Characterization of Vgsc haplotype diversity
4.3.2.1 Kdr mutation (L1014F) allelic discrimination assays
Two assays to genotype the L1014F kdr mutations in exon 20 of the Vgsc gene (see
below), which has been implicated in resistance to pyrethroids and organochlorine insecticides
were designed and applied in parallel to detect two non-synonymous variants; one to genotype
TTA/TTT alleles and the other to detect TTA/TTC variants. Primer sets and TaqMan probes
were designed using the Custom TaqMan® Assay Design Tool (Life Technologies).
![Page 95: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/95.jpg)
81
TaqMan allelic discrimination reactions were carried out using approximately 20 ng of
gDNA, 1X SensiMix II probe (Bioline), 0.4 µM of each primer (Kdr-F: 5`-
CTTGGCCACCGTAGTGATAGG-3`and Kdr-R: 5`-GCTGTTGGCGATGTTTTGACA-3`)
and 0.1 µM of each probe (Probe-TTC-allele: 5`- FAM-CACGACGAAATTT-3` or Probe-
TTT-allele: 5`-FAM-TCACGACAAAATTT-3` and Probe-TTA-allele/wildtype: 5`-VIC-
ACTCACGACTAAATTT-3`), in a final volume of 10 µl. The PCR was performed on a
Stratagene MX3005P with cycling parameters of 95 °C for 10 min followed by 40 cycles of 95
ºC for 10 sec and 60 ºC for 45 sec.
4.3.2.2 Haplotype diversity characterization
To investigate the haplotype diversity and the number of distinct haplotypes present in
each individual, a partial fragment of approximately 676 base pairs (bp) of the Vgsc gene
spanning intron 19 and exon 20 including the position of the kdr mutations (L1014F) originally
described in houseflies (Williamson et al. 1996) and then other insects (O'Reilly et al. 2006)
was used. Identification of CN using haplotype diversity assumed that each individual mosquito
carrying >2 distinct haplotypes exhibited copy number variation, as described by Labbé (Labbe
et al. 2007a). The number of distinct haplotypes per individual was characterized by cloning
and sequencing eight clones of the PCR per individual.
The partial fragment of the Vgsc gene was amplified by PCR in a reaction volume of 25
µl including approximately 25 ng of gDNA, 1X Phusion HF buffer, 200 µM of each dNTP,
0.02 U/µl of Phusion Hot start II DNA polymerase and 0.4 µM of each specific primer Vgsc-F:
5`-CCTCCCGGACAAGGACCTG-3` and Vgsc-R: 5`-GGACGCAATCTGGCTTGTTA-3`.
Amplification was performed with cycling conditions of 98 ºC for 30 sec, followed by 30 cycles
of 98 ºC for 10 sec, 56 ºC for 15 sec and 72 ºC for 15 sec. with a final extension of 72 ºC for 10
min. PCR products were purified using the GeneJet PCR purification kit (Thermo Scientific)
![Page 96: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/96.jpg)
82
and cloned into the pJet 1.2 vector using the CloneJet PCR cloning kit (Thermo Scientific).
Individual plasmids were isolated using the GeneJet Plasmid Mini Kit and sequenced (Source
Biosciences).
Sequence traces were edited in CodonCode Aligner software version 4.2.2. Multiple
sequence alignments were performed with ClustalW and then visualized using Jalview software
(Waterhouse et al. 2009). Haplotype diversity was visualized using a Neighbour-Joining tree
build using the software MEGA 5.1 (Tamura et al. 2011) with frequency and relationships
between haplotypes were visualized by a haplotype network generated using the program TCS
version 1.21 (Clement et al. 2000).
4.4.3 Vgsc gene CN assignment by PCR-based assay
The Vgsc-CN PCR-based methods described here were designed to perform on three
platforms using four distinct CN calculation methods as described in Figure 4.1. The CN
assessment is based on a partial fragment of exon 20 of the Vgsc gene (CPIJ007595-RA)
normalized to a fragment of exon 1 of the cAMP-dependent protein kinase A (Pka) gene
(CPIJ018257-RA), a single copy housekeeping gene in the Culex genome (endogenous
control).
The assays based on real-time and ddPCR platforms employed a TaqMan-CNV method,
which consists of a duplex PCR reaction using a pair of unlabeled primers for each gene and a
FAM-MGB probe for the Vgsc gene and a VIC-MGB probe for the reference gene (Pka). The
CN quantification by pyrosequencing was conducted using the Reference Query
Pyrosequencing (RQPS) method described by Liu et. al (Liu et al. 2010) with minor
modifications. Briefly, the Vgsc-RQPS method utilizes an engineered plasmid (probe)
encompassing a 100 bp fragment from both the Vgsc and PKA genes linked to any gene
fragment (stuffer DNA) with no homology to the reference or query gene. On each fragment a
![Page 97: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/97.jpg)
83
SNP was introduced that differs between the RQ-probe allele and the gDNA allele. gDNA of
each mosquito with unknown CN was mixed with the RQ-probe and then co-amplified in a
simplex PCR reaction for each Vgsc and Pka gene followed by pyrosequencing analysis.
Figure 4.1: Schematic depicting the different approaches applied for genotyping and validation
of the Vgsc gene copy number in C. quinquefasciatus mosquitoes. qPCR-Std-curve and ddPCR-
CN method applied an absolute quantification measurement, while qPCR-ΔΔCt and
pyrosequencing- RQPS use a relative CN quantification. RQPS; Reference Query
pyrosequencing and ddPCR Droplet Digital PCR. Ct, intersection between an amplification
curve and a threshold line.
4.4.3.1 Vgsc -CN primer design and validation
All primer and probe binding sites of the exon 20 of the Vgsc gene were selected using
the sequence alignment from the haplotype diversity analysis to identify conserved regions
(Figure 4.3). Vgsc-CN assay primers and probes used on the qPCR and ddPCR assay were
![Page 98: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/98.jpg)
84
designed using the primer express version 2.0 Software (Applied Biosystems). Primers and
probes for the Vgsc gene were: Vgsc/CN-F: 5`-TGCCACGGTGGAACTTCA-3`; Vgsc/CN-R:
5`-CACCCGGAACACGATCATG-3`; Vgsc/CN-Probe:5`-FAM-GACTTCATGCACTCAT-
MGB-3`, while for the PKA reference were: PKA/CN-F: 5`-GACTGGTGGGCATTAGGTG
TTC-3`; PKA/CN-R: 5`- TCAGCAAAAAAAGGTGGATATCC-3`; Probe: 5`-VIC-
GTGTACGAGATGGCAGC-MGB-3`.
For the pyrosequencing assay, PCR primer sets and sequencing primers that co-
amplify the genomic and RQ-probe sequences for either Vgsc and reference gene were also
designed using the PyroMark assay design software 2.0 (Qiagen). For the Vgsc gene, PCR
reactions were performed using the primers: Vgsc/Py-F: 5`-CGAATCCATGTGGGACTGC–
3` and Vgsc/Py-R: 5`Biotin- CTATCACTACGGTGGCCAAGAAGA-3`, whereas for the PKA
gene the primers used were: PKA/Py-F: 5`-GGAAACAACGCAACTTCAACA-3` and
PKA/Py-R: 5`Biotin- TCTTCTTTAGCTTGATCCAGGAAT-3`.
The efficiency of primers and probes designed for qPCR and ddPCR were
determined by using a standard curve for three replicates across five doubling dilutions from an
initial concentration of approximately 20 ng/µl of gDNA. Primer specificity was tested by melt
curve and electrophoresis on a 2% agarose gel. Duplex-PCR reaction conditions were
experimentally determined by primer-limiting analysis to identify the optimal primer and probe
concentrations that provide a constant Ct value (threshold cycle) among primer/probes titration
with primer efficiency on duplex-PCR reaction not differing by more than 5%.
4.4.3.2 Copy number assignment using qPCR
Absolute and relative quantification methods were used in parallel to quantify the Vgsc
CN. For both quantification methods qPCR reactions were performed in triplicate in a final
volume of 20 µl including around 10 ng of genomic DNA, 1X TaqMan gene expression master
![Page 99: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/99.jpg)
85
mix (Applied Biosystems), 0.4µM and 0.2 µM of each primer and probe as described
previously. Two samples assayed earlier were used as positive controls of PCR reproducibility.
Amplification was conducted using the Applied Biosystems 7500 Fast PCR-Real time systems
with the following condition: 50 °C for 2 min, 95 °C for 10 min, and then 40 cycles of 94 °C
for 15 s and 60 °C for 1 min.
For absolute quantification, a plasmid containing the sequences spanning primer and
probe binding sites for both genes used in the qPCR assay was created (see appendix 4-A). The
purified plasmid concentration was measured using picogreen and then a 10-fold serial dilution
ranging from 3 x 105 to 101 copies/µl of the Vgsc-Pka plasmid DNA was used to generate
standard curves by plotting Ct values versus log copies for both Vgsc and Pka gene. Absolute
copy number was calculated by determining the number of Vgsc and Pka copies per haploid
genome interpolated from the standard curve for each sample and then the ratio (Vgsc /Pka) of
copies/µl was multiplied by two to obtain the diploid genome CN. To increase the precision of
the quantification, plates were used where the standard curve had R2 > 0.98. The relative
quantification between the Vgsc and Pka gene was assessed based on Ct values collected using
a 0.2 threshold and automatic baseline. The CN analysis was carried out using the CopyCaller
software v2.0 (Applied Bisystems), which applies a comparative (Ct) method.
4.4.3.3 Copy number assignment by ddPCR
For the ddPCR assay, roughly 10 ng of gDNA was digested with 0.2 units of AluI (NEB)
for 15 min at 25 ºC. AluI was selected since its restriction sites were identified nearby the
upstream and downstream position of the PCR primers for both the Vgsc and reference gene.
Digested gDNA was assayed in a duplex ddPCR reaction in a final volume of 20 µl including:
1X ddPCR supermix and 0.4 µM of each primer and 0.2 µM of each probe described in the
primer design section. The total volume of each ddPCR PCR mix was transferred to the sample
![Page 100: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/100.jpg)
86
wells on the eight-channel droplet generator cartridge (Bio-Rad) while 70 µl of droplet
generation oil (Bio-Rad) were loaded on each oil well channel. Lastly, 40 µl of the partitioned
droplet PCR mix were transferred to a 96-well plate and then amplified to end point using a
thermal cycler. The amplification condition was determined by serial dilution of the Vgsc -Pka
plasmid DNA to identify the required input gDNA concentration while a temperature gradient
ranging from 55 ºC to 65 ºC was conducted to detect assay amplitude with a well-defined
separation between positive and negative droplet populations (Appendix 4-B).Thermal cycling
conditions were: 95 ºC for 5 min, 95 ºC for 30 sec and 57 ºC for 1 min (40 cycles) and 98 ºC
for 10 min.
After PCR amplification, the PCR product was loaded on the QX100 droplet reader
(Bio-Rad), for simultaneous two-colour detection of the droplets. Data analysis of the ddPCR
reads was carried out using QuantaSoft analysis software version 1.6.6 (Bio-Rad). Absolute
quantification of the Vgsc gene CN for each sample was then calculated in reference to the Pka
gene event number.
4.4.3.4 Copy number assignment using Pyrosequencing
Relative quantification analysis by the Vgsc-RQPS method required the construction of
a plasmid, here denominated as RQ-probe, which contained partial sequences of the Vgsc and
Pka gene with an introduced SNP for differentiating RQ-probe alleles from gDNA alleles. The
RQ-probe design, cloning and purification details are described in the appendix 4-C.
For each sample tested, two mixtures of RQ-probe/gDNA were prepared using molar
ratios of 1:1 and 2:1 in a final volume of 10 µl. Simplex PCR reactions for the Vgsc and Pka
gene were performed in a total of 25 µl using 3 µl of each RQ- probe/gDNA molar ratio mix in
parallel, 200 µM of each dNTP, 1X of the 10X PCR buffer, 2.0 mM of MgCl2, 0.6 units of
HotStarTaq DNA polymerase (Qiagen) and 0.4 µM of each primer described previously. After
![Page 101: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/101.jpg)
87
initial denaturation at 95 °C for 15 min, PCR was performed for 40 cycles of 94 °C for 30 sec,
58 °C for 30 sec, and 72 °C for 30 sec, followed by a final extension step at 72 °C for 10 min.
Single-stranded PCR products for analysis by pyrosequencing were obtained using the
PyroMark Q24 Vacuum Prep Workstation. Pyrosequencing reactions of the Vgsc PCR products
were performed using the sequencing primer: 5`-TGCTGGTGGGCGACG-3` and dispensation
order: 5`-GTGATCTG-3`, whereas for the Pka PCR amplification used the sequencing primer:
5`-CCGCAGAAAGTGTAAAA-3` and the following dispensation order: 5`- TCGATCTG-3`.
Pyrosequencing reactions were performed using the PyroMark Gold Q96 reagent kit (Qiagen)
following the manufacturer’s guidelines.
CN prediction was calculated comparing the amplification ratios of the Pka reference gene
(RQprobe-Pka/ gDNA-Pka, alleles) and Vgsc (RQprobe- Vgsc / gDNA- Vgsc, alleles) by linear
regression, with differences of the amplification ratios reflecting variation of gene copy number.
The linear regression for the slope of the curve was multiplied by two to acquire the predicted
CN in the diploid genome. Further details of the data analysis are described by Liu et al. (Liu
et al. 2010).
4.4. Results
4.4.1 Vgsc gene haplotype diversity and genotype constitution
The potential for a gene duplication event in the Vgsc gene in Ugandan C.
quinquefasciatus mosquitoes was suggested by abnormal TaqMan genotyping results for the
1014F mutation located in exon 20. Two parallel assays for detecting the 1014F mutations were
designed to genotype the wild type codon (TTA) and the two alternative resistant codons, (TTT
or TTC), which both result in a pyrethroid and DDT resistance associated change from Leucine
to Phenylalanine (Wondji et al. 2008, van den Berg 2011).
![Page 102: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/102.jpg)
88
The TaqMan applied two fluorogenic probes that produce a fluorescent signal
proportional to the number of allele specific SNPs amplified in the qPCR reaction. In diploid
individuals with single copy loci individuals may be assigned to one of three clusters of
fluorescence: one for each homozygous genotype and the other for heterozygotes. However, in
this study genotyping of approximately 190 mosquitoes showed the presence of four well
separated clusters instead of the normal three. We assumed that the additional cluster
represented two populations within the heterozygous cluster (Figure 4.2A). We hypothesized
that the asymmetry within the putative heterozygous cluster may be due to gene duplication,
which causes a shift in the fluorescence ratio between the FAM/ VIC probes since individuals
with CNV can possess >2 alleles.
To further investigate if the TaqMan results were linked to variation in primer/probe
sequence binding sites or due to variation in the number of alleles, we carried out a haplotype
diversity analysis using 68 sequences from 12 individuals (GenBank accession numbers:
KR061912-KR061979) of a partial (677bp) fragment of the Vgsc gene. Sequence analyses
indicated the occurrence of five distinct haplotypes over all samples with frequencies ranging
from 0.073 to 0.456 based on 18 segregating sites (Figure 4.2B). Haplotype C, which displays
the (TTC) 1014F mutation was observed at the highest frequency (46%). The haplotype
network also indicated a possible two origins for the TTT mutation due to the presence of five
mutation between the two TTT resistant haplotypes (Hap A and Hap B), which surprisingly
was observed in little variation in the wildtype alleles, suggesting a selective sweep in the
wildtype possibly driven by the independent L-F duplication events.
Haplotype analysis indicated no variation in the binding site of the primer/probes
sequence in the mosquitoes studied (Figure 4.3). Moreover, haplotype analysis indicated that
the individual Cx8 possesses three distinct haplotypes; one for the resistant allele TTT and one
for the TTC (Figure 4.2C), which supports the hypothesis that gene duplication can exist for
![Page 103: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/103.jpg)
89
the Vgsc gene in Ugandan Culex mosquitoes. Additionally, this analysis also shows that there
are many distinct possible genotype combinations for the five haplotypes identified, with one
individuals (Cx3) having two haplotypes for the TTA susceptible allele (Figure 4.2C).
Figure 4.2: Haplotype diversity based on partial sequence of the Vgsc gene from Ugandan C.
quinquefasciatus A) Scatter plot of TaqMan-based allelic discrimination of the TTA/TTC
codons for 1014F mutation B) Haplotype network of the Vgsc gene. Circles denote the relative
number of samples represented in each haplotype. The branches between black dots represent
mutational steps separating observed haplotypes. C) Dendrogram of individuals with a likely
duplication of the Vgsc gene. (Cx number) corresponds to an individual and the following letter
from A to I means the number of distinct colony sequenced per sample. Individuals highlighted
in blue indicate mosquito with more than two haplotypes. Green, red and orange dots
correspond distinct alleles for the mutation 1014F.
![Page 104: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/104.jpg)
90
Continued
![Page 105: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/105.jpg)
91
Figure 4.3: Multiple sequence alignment of the partial fragment of the Vgsc gene. Alignment
was performed using the ClustalW multiple sequence alignment program. Underlined regions
in blue and black correspond to primer and probe biding sites of the QRPS and qPCR and
ddPCR assays, respectively
![Page 106: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/106.jpg)
92
4.4.2 Copy number assignment of the Vgsc gene based on PCR-methods
4.4.2.1 Primer design
Titration experiments with varying primer concentrations found that 400 nM of primers
yielded the closest Ct value comparing reactions for the Vgsc and Pka gene based on SYBR-
GREEN detection. 200 nM of probe was selected as this concentration yielded early Ct values
that remained constant as compared to using higher concentrations of the probe (Appendix 4-
D). Primer efficiency for qPCR and digital droplet PCR (ddPCR) was evaluated using a
standard curve performed on duplex PCR reactions run in triplicate for both genes.
Amplification efficiency was similar for both Vgsc and PKA genes suggesting no evidence of
reagent competition or primer/probe interactions, as indicated by PCR efficiencies of 98.7%
and 101.9%, and correlation coefficients of approx. 0.98 (Figure 4.4A). The specificity of the
primer sets was verified on both agarose gel and melt curves, which showed single bands and
melting peaks. Reproducibility of the duplex Vgsc-CN assay was confirmed by running three
experiments on consecutive days indicating strong correlation between the first run and the
second and the first and third, R2 = 0.879 and 0.980, respectively (Figure 4.4B).
![Page 107: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/107.jpg)
93
Figure 4.4: Copy number variation assay validation. A) Efficiency of primers and probes on
duplex PCR reactions assessed by standard curve with 2-fold DNA dilution. B) Vgsc-CN assay
intra-experiment reproducibility comparing triplicates of gDNA with unknown CN in three
independent experiments.1/2 and 1/3 correspond to correlation between experiments 1 and 2
and 1 and 3.
4.4.2.2 qPCR
For absolute quantification analysis by the qPCR-standard method, 92 samples were
compared to a relative standard curve constructed with a plasmid encompassing a single copy
of the Pka and Vgsc gene. The resulting standard curve was linear in the range tested, with a
PCR efficiency close to 100% differing by only 2% between both genes (Figure 4.5). The
standard curve covers Ct values ranging from 24 to 34, which interpolate a genomic DNA
![Page 108: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/108.jpg)
94
concentration around 10 ng/µl. The concentration of the Vgsc and Pka gene was determined
from the relative standard curve in copies per microliter and was between 1115.65 and 939150.7
for the Vgsc gene and 31.25 and 669886.3 for the Pka gene. The ratio of Vgsc /Pka ranged from
0.8 to 1.70 with predicted CN between 2 and 4 (Figure 4.6A).
The predicted CN as determined with the qPCR-ΔΔCt method indicated that individuals
had 2-4 copies per diploid genome (Figure 4.6A), with confidence intervals for the calculated
CN higher than 0.99 in 78.9% of the individuals. The Ct values observed for the Vgsc and Pka
gene ranged from 26.45 to 29.45 and 28.11 to 30.33, respectively with very little variation on
the average Ct and a low standard deviation for the Vgsc (27.66, SD=0.26) and Pka gene (28.85,
SD=0.23) across independent experiments.
![Page 109: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/109.jpg)
95
Figure 4.5: qPCR amplification of the Vgsc-Pka plasmid serial dilution for absolute
quantification using the qPCR-Std method. A and B panels, shows the standard curve
amplification for the Vgsc and Pka gene, respectively. Red square on the standard curve
correspond to the five points of the serial dilution ranging from 3 x 105 to 101 copies/µl, whereas
blue square correspond to quantification of samples with unknown copy number.
![Page 110: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/110.jpg)
96
Figure 4.6: CN prediction across different methods. A) Scatterplot of predicted CN per
individual and genotyping method. Each dot represents the CN predicted for each individual,
predicted CN correspond to calculated number without correction to expected CN. The black
lines shows the mean of predicted CN. B) Direct comparison of the predicted CN frequency
across different methods applied. C) Merged CN frequency from different platforms applying
the criteria of overlapping prediction of CN by > 2 distinct methods. Error bars shows the 95%
confidence intervals.
![Page 111: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/111.jpg)
97
4.4.2.3 ddPCR
The genotyping of 92 individuals from four Uganda populations by ddPCR indicated
the presence of CN ranging from 2-4 copies for the Vgsc gene per diploid genome (Figure
4.6A). The mean number of droplets analysed for the replicate reactions varied between 13,860
and 24,821 droplets with the total number of FAM/VIC positive droplets no less than 10%.
Between replicates the 95% confidence interval of the calculated CN completely overlapped in
most of the samples genotyped indicating strong reproducibility of the assay (Figure 4.7A).
ddPCR results also indicated that the experimental conditions applied for the Vgsc-CN assay
were efficient for complete separation of fluorescence amplitudes between positive and
negative droplets as well as to identify four well distinct populations of droplets FAM+/+ , VIC
+/+, FAM/VIC +/- and FAM/VIC -/- (Figure 4.7B).
![Page 112: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/112.jpg)
98
A
B
Figure 4.7: ddPCR CN prediction in Uganda Culex quinquefasciatus mosquitpes A) Merged
of replicate calculated CN. The error bars represent Poisson 95% confidence interval. B) 2-D
amplitude plot of the Vgsc and Pka showing satisfactory PCR condition to identify four well
defined droplets populations.
4.4.2.4 Vgsc-RQPS
The assessment of the Vgsc CN using the Vgsc-RQPS method was carried out by
comparing the peak ratio of the RQ-probe allele A; Vgsc and C; Pka in relation to the
complementary gDNA alleles T and G using a linear regression where the intercept was set at
zero. The CN of the samples was inferred by multiplying by 2 the slope of the linear regression
(y = kx; where k is the slope) with assay quality verified using R2 value. In total, 92 samples
were genotyped with a CN (diploid) of 3 being the most frequent (in 47.3% of individuals)
![Page 113: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/113.jpg)
99
whereas CNs of 2 and 4 were observed in 33% and 20% of the samples (Figure 4.6A).
Application of a threshold of R2 > 0.8 to assess the assay accuracy in the experimental
conditions resulted in only 59.78% of the samples (N=55) fitting the criterion. The other
samples retained very low or negative R2 values, which indicated that the experimental
conditions or assay design has low precision and reproducibility.
4.4.3 Comparison between the calculated CN across the different methods
To compare the predicted CN of the Vgsc gene across the four different approaches:
qPCR (ΔΔCt and qPCR-Std-curve method), RQPS and ddPCR although 92 mosquitoes were
genotyped for each method for assay corporation the number of samples was normalised to 55,
which was the total of samples genotypes by Vgsc-RQPS assay that fit the accuracy criterion
described previously. On the combined data set including mosquitoes from all the study regions
(Jinja, Kampala, Kanungu and Tororo) the predicted CN across the four methods ranged from
2 to 4 (Figure 4.6B) with two copies being the most frequent CN observed by qPCR-ΔΔCt,
qPCR-Std-curve and ddPCR (85.9%, 79.3% and 91.7%, respectively), whereas three copies
was observed in higher frequency (47%) in mosquitoes genotyped using the QRPS method. At
a population level, CNP was observed at a frequency of 4.7% in Kampala and 10% in Kanungu
but this was not a consistent trend across the different methods. The qPCR methods and ddPCR
showed higher similarity of predicted CN distribution compared to RQPS (Figure 4.6B), which
in most of the cases increased the predicted CN by 1.
Since analytical variation associated with PCR based methods such as amplification
efficiencies between reactions can result in confounding results, validation of predicted CN is
required to avoid misidentifying CNVs. To address this issue and to increase the accuracy of
the assays described herein the predicted CN was assessed in two steps. First, direct
comparisons of the calculated CN between the ddPCR (assumed herein as standard due to the
![Page 114: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/114.jpg)
100
high precession described elsewhere (Hindson et al. 2013) and the other methods was conducted
to identify discrepancies for posterior CN validation by re-genotyping. Using this approach,
deviation was highest for Vgsc-RQPS and lowest for qPCR-Std-curve (Figure 4.8). For the
qPCR-ΔCt and qPCR-Std-curve method 28.3% and 6.5% of the samples respectively, were
re-genotyped where most of samples had a predicted CN which increased by 1 copy indicating
genotyping inaccuracy. In contrast, since there was a large variation for most of the samples
assayed in the RQPS method, 50% of the samples were randomly selected to be repeated with
no reduction in discrepancy compared to ddPCR prediction. Secondly, to minimize the number
of false positives; predicted CN from the different methods were merged into one final CN
calling for each sample. Using the criterion that the likely CN per individual must be identical
for > 2 CN methods, we identified that most individuals have single copies, while in only 5%
of genotyped mosquitoes CN was detected (Figure 4.6C).
![Page 115: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/115.jpg)
101
Figure 4.8: Bland-Altman plot showing the difference between the predicted CN of qPCR
methods and RQPS against the ddPCR CN prediction. Each blue dot represents individuals CN
difference. Dash green line correspond to mean difference, while the dash red lines shows the
95% limits of agreement.
![Page 116: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/116.jpg)
102
4.5 Discussion
Mutations in the sodium channel gene (Vgsc), a target-site for pyrethroids and DDT
insecticides, have been described as a major threat to the success of control strategies for vector-
borne diseases. Various independent SNP mutations, or the combination of several mutations
in the Vgsc gene, such as the knockdown resistance (kdr) or super-Kdr mutations, have been
the most extensively described variants associated with a reduction in sensitivity of the Vgsc
gene to insecticides (Li et al. 2012, Silva et al. 2014). The evolution of insecticide resistance to
pyrethroids is especially worrying for mosquito control programs since there is a limited
number of insecticides approved for public health campaigns. Moreover, pyrethroids are the
only insecticide authorized for use on impregnated bed nets.
Monitoring the frequency of markers associated with the resistance can be crucial for
increasing the lifespan of approved insecticides, which allows for more sustainable control
programmes. In general, most of the worldwide studies of pyrethroids and DDT resistance in
mosquitoes have focused on detecting the resistant allele(s) of the mutation 1014F, which is
often observed at high frequency in resistant populations (Scott et al. 2015). Herein, we
investigate two possible mechanisms that could be related to variation in the level of insecticide
resistance associated with the Vgsc gene in C. quinquefasciatus mosquitoes, haplotype diversity
and genomic variation by gene copy number.
To characterize the haplotype diversity of the Vgsc gene, we used the approach of
sequencing multiple clones from the same individual instead of sequencing PCR products from
single mosquitoes since this method allows one to infer not only the number of distinct
haplotypes in the population but also an individual’s haplotype diversity. Surprisingly, we
identified a high difference in the frequency of haplotypes encompassing the resistant alleles;
with the C haplotype being more frequent than the other resistant haplotypes (Figure 4.2B). The
difference in resistant haplotype frequency was not expected since both alleles TTT and TTC
![Page 117: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/117.jpg)
103
are synonymous mutations and the mosquitoes studied were collected in a region with similar
selection pressure. With our data it is not possible to infer directly the reason for the increased
prevalence of one resistant haplotype as compared to others. Nevertheless, these data do provide
an opportunity to investigate distinct mechanisms involved in the insensitivity of the Vgsc gene
in C. quinquefasciatus. For instance, in a very simple scenario the low frequency of the resistant
haplotypes A and B could result from recent migration events; however, it was not possible in
our analysis to confirm this hypothesis since our data lacked haplotype information from
surrounding mosquito populations. Although local haplotype variation is plausible, the idea is
in contrast to results of low haplotype diversity in An. gambiae that show a single haplotype for
the 1575Y mutation on the Vgsc gene in a mosquito population from West and Central Africa
(Jones et al. 2012a). Another hypothesis is based on the high level of haplotype diversity, since
more than 10 single nucleotide polymorphisms were identified between resistant haplotypes as
well as the absence of a complete separation in the resistant haplotypes (Figure 4.2C), which
likely indicate an independent origin for these haplotypes or that the haplotypes occurring in
low frequency correspond to additional variation of the ancestral Kdr resistant alleles, although
an increase of diversity due to hybridisation of C. quinquefasciatus and pipiens could also been
involved.
The analyses of haplotype diversity applied here also provides an opportunity to explore
additional features of the Vgsc gene diversity at the genotype level. In our analysis, we
identified two individuals out of 12, which have the same resistance allele but on distinct
haplotypes, while the same pattern was also observed in wildtype haplotypes. For instance, the
genotype of individual Cx3 (Figure 4.2C) had two completely independent resistant Kdr
haplotypes with the allele TTT. On the other hand, individual Cx3 shows different haplotype
composition but for the susceptible allele. Our results indicate a complex genotype architecture
for the Vgsc gene in the population studied since distinct haplotypes and individuals with
![Page 118: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/118.jpg)
104
different haplotype combination were identified, despite studying only a small number (N=12)
of mosquitoes and only a partial fragment of the Vgsc gene. In terms of insecticide resistance
management the complexity of the genomic architecture sets additional challenges for
monitoring and understanding the role of target-site mutations linked to pyrethroids and DDT
resistance since haplotype variation can be involved in many aspects of gene regulation and
expression. For example, analysis of alternative splicing in C. quinquefasciatus suggested the
presence of four variants in the sodium channel proteins (He et al. 2012). Additionally,
characterization of the Vgsc haplotype diversity in Musca domestica and their implications on
fitness cost demonstrate that different resistant alleles and distinct haplotypes of a specific allele
can have completely different fitness costs (Rinkevich et al. 2013b).
Another explanation for the high haplotype diversity detected in our study population
can be linked to gene duplication of the Vgsc gene. This hypothesis was raised through our
preliminary analysis, which showed the presence of three distinct kdr haplotypes in the
individual Cx8 (Figure 4.2C). Furthermore, the results of the kdr genotyping by TaqMan also
suggested the presence of gene duplication since distinct clusters for heterozygotes were
observed (Figure 4.2A), which may result from fluorescence asymmetry due to difference in
allele numbers (Kumasaka et al. 2011). The possible Vgsc gene duplication observed in our
data is also supported by findings of previous studies in C quinquefasciatus mosquitoes
collected in the US, which suggested the presence of multiple copies of the Vgsc gene (Xu et
al. 2011). Furthermore, high nucleotide diversity in genes under selection in contrast to the low
variability expected due to hitchhiking has been demonstrated for duplicated genes as described
for the Ace-1 gene in Anopheles and Culex mosquitoes (Djogbénou et al. 2009, Osta et al.
2012b).
To further investigate the hypothesis that gene duplication has occurred in the Vgsc
gene, we developed and validated a PCR-based method that can be applied through three
![Page 119: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/119.jpg)
105
commonly used genotyping platforms. The Vgsc-CN assay described here in indicated CNP in
the Vgsc gene in all of the four inference methods applied. We identified mosquitoes with a CN
of three or four in all methods, with the exception of the RQPS method that predicted this figure
in a much higher frequency (Figure 4.4A). The consistent CN prediction by both qPCR methods
and ddPCR using the Vgsc-CN assay can provide more flexibility in assay choice for future
studies since it is not restricted to a single genotyping platform. Additionally, the Vgsc-CN
assay validation also indicates that primer sets and probes designed for the qPCR and ddPCR
methods perform satisfactorily with different chemistries as well as with different reaction
conditions. The optimum performance of each method to accurately determine CN was
demonstrated through similar primer efficiencies in the duplexed reactions and separation
between positive/negative droplet populations (Bustin et al. 2009, Huggett et al. 2013). This
allows not only for the possibility of cross-validation of the results on different platforms
without redesigning the assays but also removes the need for different panels of probes.
Evaluation of the assay precision and efficiency to reliably measure CN in field
collected mosquitoes was assessed by genotyping C. quinquefasciatus mosquitoes from four
geographic regions of Uganda. The calculated CN assessed by three methods were compared
to the ddPCR calculated CN as this method has been described as the most precise of the real-
time methods (Hindson et al. 2013). In our hands the ddPCR and qPCR-Std-curve methods
yielded similar results for CN calculation with the lowest standard deviation. This result was
expected as both methods rely on absolute quantification, although calculated by different
methods. Since the ddPCR platform is not broadly accessible due to high cost, our results
indicate that the application of both qPCR methods can provide a good alternative to identify
and validate CNV inferences. In contrast, the RQPS methods shows the lowest concordance
compared to the other three methods, with three instead of two as the mean predicted CN.
Additionally, the RQPS calculated CN was less precise with values widely distributed across a
![Page 120: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/120.jpg)
106
CN range between 2 and 4 compared to ddPCR. The discrepancy observed in the RQPS results
as compared to the other method indeed can be a reflection of the sample preparation. The
RQPS method requires mixing of gDNA and RQPS-probe at 1:1 and 1:2 molar ratios, which
can increase sample manipulation and consequently can introduce more experimental errors. It
is possible that the overestimation of the CN by the RQPS method may be linked to inaccuracy
of gDNA and the RQPS-probe ratio mixing since in about 50% of the samples the expected
peak ratio of the gDNA and RQPS-probe alleles were not observed.
Comparison of the calculated CN in relation to ddPCR results was also used to infer the
assay efficiency and sensitivity. For this, a specific criterion was established. The criterion was
that there should be a discordance of calculated CN differing by >1 to indicate a potential false
positive CN calling. The lowest efficiency was observed for the RQPS and qPCR-ΔCt method
with about 50 and 28.3% of the predicted CN corresponding to probable outliers, respectively.
For each sample that fit this criterion the entire workflow was replicated in triplicate to confirm
the calculated CN. The re-genotyping of the RQPS outliers does not change significantly the
previously predicted CN, indicating low accuracy. On the other hand, the re-genotyping of all
outliers observed on the qPCR-ΔCt method results in changes of predicted CN (Appendix 4-
E). The significant changes observed in the qPCR results could be linked to assay set-up issues
such as heterogeneous distribution of master mix or inaccuracy of gDNA normalization. The
first issue was not detected in our reaction conditions because the Ct standard deviation across
the parallel replicates was lower than 5%. On the other hand, variation in the concentration of
gDNA is the most probable reason since other publications have demonstrated that DNA
concentration, purity and integrity can be limitations for CNV accuracy prediction owing to
their influence on the ΔCt (Fernandez-Jimenez et al. 2011); nevertheless, this issue is more
difficult to resolve.
![Page 121: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/121.jpg)
107
The workflow applied in this study can minimize the number of false positive CN
predictions that occur in natural populations, since the comparison of predicted CN among
distinct methods can be used to validate the data as well as to reduce overestimation of CN
introduced by experimental variations. In our present data we identified between 8.3 and 9.8%
of samples across Uganda with CN=3 or 4 using the qPCR and ddPCR method. However, it is
possible that in some populations this figure could be higher, since due to the lack of historical
data on insecticide application in this region is not possible to conclude if the populations were
collected in the absence of selection, which could reduce the frequency of mosquitoes with gene
duplication due to the detrimental fitness cost of CN in insecticide-free environments
(Bergthorsson et al. 2007, Djogbénou et al. 2009).
The Vgsc-CN assay described here provide a simple and robust workflow for precise
measurement of CN in field collected mosquitoes overcoming the limited number of CNV
assays available so far for mosquito gene duplication studies. Additionally, by replacing the
primer/probe of the gene of interest the approach used here can be easily transferable to
investigate the CN frequency of other genes encompassing gene duplication like Ace-1 and
esterases in field collected Culex mosquitoes.
In summary, our data suggests a high level of polymorphism in the Vgsc gene in C.
quinquefasciatus resulting in complex haplotype diversity and heterogeneity of individual
genotypes as well as the presence of CNP of the Vgsc gene in Ugandan mosquitoes. As
insecticidal control methods are rolled out across Uganda these techniques will enable
monitoring of CNV, and its association with phenotypic resistance, in these mosquitoes.
Additionally, the approach proposed here has greater applicability to provide more precise
predictions of CN and data validation. Finally, the developed assay can be an important tool for
monitoring and management of variation of gene copy number in insecticide target-site genes.
![Page 122: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/122.jpg)
108
Chapter V
Chapter V - Molecular mechanisms driven resistance to carbamates insecticides in
Ugandan Culex quinquefasciatus mosquitoes
Molecular Mechanisms Underlying Resistance to
Carbamates Insecticides in Ugandan Culex quinquefasciatus
Mosquitoes
5.1 Abstract
Currently, efforts to interrupt lymphatic filariasis (LF) transmission are mainly based
on mass drug administration (MDA) and population control of Culex quinquefasciatus.
However, widespread and intensive application of insecticides has resulted in an
increase of insecticide resistance in C. quinquefasciatus. The objective of this study is
to identify candidate genes associated with insecticide resistance in C.
quinquefasciatus. The transcriptome of bendiocarb-selected adult mosquitoes was
compared to two unexposed groups of mosquitoes using a whole-transcriptome
microarray (Agilent 8 X 60K). Resistance to bendiocarb was marked with high
resistance in WHO standard phenotyping assays (2.04 % [95 % confidence intervals
(CIs) = 1.93-10.2] mortality to standard 1hr exposure; 58.02 % [CI = 6.23-6.49]
mortality following 4hr exposure). Synergist assays using either the P450 inhibitor
PBO or the esterase inhibitor TPP resulted in a marked increase in mortality to 83.14%
(CI = 6.82-9.73) and 80.51% (CI = 7.83-10.91), respectively suggesting the
involvement of metabolic resistance mechanisms. The microarray analysis identified
16 genes significantly overexpressed (false-discovery rate (FDR) adjusted P value >
2) in Uganda bendiocarb-resistant samples compared to other two groups (sympatric
unexposed mosquitoes from Uganda, and the susceptible TPRI strain). These genes
included two P450s (Cyp-Cx1 and Cyp6n23) which showed the highest level of gene
expression compared to the TPRI (8.75 and 4.37 fold-change, respectively). The
present data set suggests that an upregulated P450 could be associated with bendiocarb
resistance in C. quinquefasciatus from Uganda. Additionally, these results highlight
the necessity of combining genomic and transcriptomic tools for a more effective
monitoring of the evolution of resistance as multiple mechanism might underlie the
resistant phenotypes.
![Page 123: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/123.jpg)
109
5.2 Introduction
Lymphatic filariasis (LF), is a major cause of chronic and permanent disability
in tropical and subtropical regions as a result of lymphoedema, elephantiasis and
hydrocele (Bockarie et al. 2009, de Souza et al. 2012). LF is endemic in 83 countries
with more than 1.2 billion people at risk of infection especially in Southeast Asia and
African regions (Katiyar and Singh 2011, Rebollo and Bockarie 2013). In sub Saharan
Africa the causal agent of LF is the nematode Wucheraria bancrofti, which can be
transmitted by both Culicine and Anopheline mosquitoes with Culex quinquefasciatus
being the major vector in urban and semi-urban settings (van den Berg et al. 2013).
In contrast to other vector-borne diseases such as malaria and dengue, for
which anti-vector interventions as the major strategy, the Global Program to Eliminate
LF (GPELF) launched in 2000 is based on Mass Drug Administration (MDA) of
antihelminthics to reduce Wuchereria bancrofti transmission. Whilst vector control is
not the primary strategy of the GPELF, it is still recommended as an intervention for
LF eradication, especially in regions where successful implementation of MDA is
challenging; for instance, in very remote areas or where LF is co-endemic with loiasis,
which can result in adverse reactions to the drug cocktail used for MDA (Gyapong and
Twum‐Danso 2006, Rebollo and Bockarie 2013). Additionally, modelling and field
studies have shown that integration of vector control into MDA programmes can
reduce the required number of chemotherapy rounds and consequently the timeframe
to achieve the microfilaria (MF) prevalence threshold necessary for successful
interruption of LF transmission (Sunish et al. 2007, Bockarie et al. 2009).
Although vector control has successfully reduced the burden of vector-borne
diseases worldwide, the recurrent and extensive application of insecticides in endemic
regions has also triggered an increase in the level of insensitivity to those insecticides
![Page 124: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/124.jpg)
110
approved for public health (Rivero et al. 2010, Nkya et al. 2013). In addition, the
limited number of insecticides available and the occurrence of cross-resistance
between different classes is especially worrying for the sustainability of vector control
(Nauen 2007, Sparks 2013). Consequently, identification and monitoring of resistance
patterns, and understanding of the underlying mechanisms is crucial for extending the
lifespan of currently available insecticide as well as for planning more effective vector
control programmes.
As in many insect species, the insensitivity to insecticides in C.
quinquefasciatus is thought to result mainly through mutations in target-site genes
and/or overproduction of detoxifying enzymes (Rinkevich et al. 2013a). Susceptibility
studies in C. quinquefasciatus from diverse geographical regions have associated two
main target-site mutations to resistant phenotypes. The L1014F mutation in the
voltage-gated sodium channel gene, conferring Kdr (knockdown resistance), has been
associated with pyrethroid and DDT resistance, whilst the G119S mutation in the
acetylcholinesterase (Ace-1) gene is linked to resistance to carbamates and
organophosphates (Jones et al. 2012b, Kioulos et al. 2014, Zhao et al. 2014b).
Metabolic resistance, which involves the over-expression or increased catalytic
capability of metabolic enzymes, is a less tractable mechanism since members of
diverse gene families including esterases, glutathione S-transferases (GST) and
cytochrome P450 monooxygenases (P450), have previously been associated with
resistance to different classes of insecticide in a range of vector species (reviewed in
(Li et al. 2007, David et al. 2013). Over-expression of detoxification genes can be
triggered by genomic divergence; for instance, by gene duplication, as observed for
the resistance to organophosphates in C. quinquefasciatus mediated by esterases
(Hemingway et al. 2004) or enhancement of regulatory elements through DNA
![Page 125: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/125.jpg)
111
sequence variation as shown in Drosophila melanogaster DDT resistance associated
with transcriptional increase of the Cyp6g1 gene (Wilding et al. 2012).
Due to the diversity of genes or gene families involved in metabolic resistance,
identification of candidate genes requires an agnostic survey of the patterns of gene
expression associated with resistant phenotypes. Recently, studies have applied either
microarray or RNA-seq platforms to elucidate the relationship between gene
expression and insecticide resistance (Bonizzoni et al. 2012, Mitchell et al. 2012,
Riveron et al. 2014). But, to date most of these whole-transcriptome studies in vector
insects are restricted to mosquitoes of the genus Anopheles. Despite the role of Culex
in transmission of several pathogens such as West Nile virus (WNV) and filarial
worms, and reports of high levels of insecticide resistance (Farajollahi et al. 2011), in
C. quinquefasciatus few studies have addressed the relative impact of metabolic
resistance (Komagata et al. 2010, Liu et al. 2011a) and none at a whole-transcriptome
scale.
In addition to their role as disease vectors, C. quinquefasciatus are nuisance
biters and the failure to effectively control this species can lead to the perception of
malaria control failure which may ultimately lead to the rejection of controls (e.g.
indoor residual spraying -IRS and insecticide treated nets-ITNs). In this study, C.
quinquefasciatus insecticide susceptibly in mosquitoes from Nagongera, Tororo
District, Uganda was inferred using six insecticides (DDT, permethrin, deltamethrin,
bendiocarb fenitrothion and lambda-cyhalothrin). A novel 8 x 60K whole-
transcriptome microarray design was used to identify candidate genes associated with
bendiocarb resistance. Additionally, Taqman allelic discrimination assay was also
designed to type individual mosquitoes for the G119S target-site mutation, which
![Page 126: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/126.jpg)
112
allowed the inclusion exclusively of wild-type (G119) mosquitoes in the
transcriptomic profiling analysis.
5.3 Materials and methods
5.3.1 Sample collection
Filed collection of mosquitoes was carried out in Osukuru, Tororo, Uganda
(See chapter III, Figure 3.1,) between June and July 2012. Resting adult C.
quinquefasciatus were collected exclusively inside houses using aspirators and
transported to the insectary. From these collections, 64 blood-feed females were
maintained in individual Eppendorf tubes lined with moist filter paper to encourage
egg laying (Morgan et al. 2010). Emergent larvae were fed on tetramin fish food, with
pupae posteriorly transferred to cages and adults allowed to emerge. Eclosion cages
were changed every 3 days so that cages contained only 3-5 day-old adults. Adult
mosquitoes were fed ad libitum on 10% glucose solution, and used for insecticide
susceptibility testing.
Genomic DNA from each female from which egg rafts were obtained to found
the colony was individually isolated using a DNeasy kit (Qiagen) and then used for
identification of C. quinquefasciatus using a diagnostic PCR assay (Smith and Fonseca
2004). In addition to these field-collected mosquitoes, a laboratory colony of C.
quinquefasciatus from the Tropical Pesticides Research Institute (TPRI) Tanzania was
used as a susceptible reference strain for the microarray study.
5.3.2 Insecticide susceptibility test
Bioassays were performed using test kits and insecticide-impregnated papers
according to standard WHO methods (WHO 2013a). Adult F1 females aged 3-5 day-
![Page 127: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/127.jpg)
113
old were assayed in four replicates of 25 non-blood fed mosquitoes in laboratory
conditions with average of temperature of 26 °C and humidity of 63%. Tests were
performed with papers impregnated with diagnostic concentration for six insecticides:
DDT (4%), Permethrin (0.75%), Fenitrothion (1%), Lambda-cyhalothrin (0.05%),
Bendiocarb (0.1%) and Deltamethrin (0.05%). Mosquitoes were exposed to each
insecticide for 1h, with the exception of Bendiocarb and Deltamethrin where four hour
exposures were used, to increase discrimination between resistant and unexposed
sympatric mosquitoes. Control assays were performed with 25 mosquitoes exposed to
non-insecticide treated papers.
Insecticide exposed mosquitoes were then transferred to clean holding tubes
and provided with 10% glucose for a 24-hour period after which mortality was
recorded and dead (susceptible) mosquitoes were collected and individually stored on
silica gel whilst alive (resistant) mosquitoes had a hind leg removed (stored on silica)
and the whole body stored in RNAlater (Sigma Aldrich). RNAlater stored mosquitoes
were initially held overnight at 4 °C to allow the solution to penetrate the carcass
before storage at -20 °C until RNA isolation.
5.3.3 Synergist assays
Synergist tests were carried out following the procedure described above with
an additional pre-exposure to three synergist compounds to investigate the potential
mechanisms of metabolic resistance for bendiocarb and deltamethrin insecticides. For
each synergist assay four batches of 20-25 mosquitoes were either pre-exposed for 1
hour papers (12cm×15 cm, Whatman grade no.1 filter paper) impregnated with a 10%
solution of PBO (piperonyl butoxide – CYP450 synergist), TPP (triphenyl phosphate
– esterase synergist) or DEM (diethyl maleate – GST synergist). These mosquitoes
![Page 128: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/128.jpg)
114
were then exposure to Bendiocarb (0.1%) or Deltamethrin (0.05%) for four hours,
followed by a 24h recovery period. In addition, synergist controls tubes were also run
simultaneously.
5.3.4 Ace- 1 genotyping of bendiocarb phenotyped mosquitoes
Pior to microarray analysis all mosquitoes were genotyped for the G119S
mutation in Ace-1. DNA was isolated from the amputated hind leg of resistant
mosquitoes with 50 µl 10% Chelex 100 and 2 µl of proteinase K (10 mg/mL). The
homogenate was incubated at 94 °C for 30 min followed by centrifugation at 6,000
rpm for 10 min to collect the supernatant.
A TaqMan assay was designed and applied to detect the G119S mutation in the
acetylcholinesterase gene, which was previously associated with resistance to
organophosphates and carbamates (Weill et al. 2004). To identify conserved regions
for primer/probe design a partial fragment of exon 3 including the position G119S was
amplified by PCR, followed by cloning and sequencing. TaqMan assays were carried
out using 3 µl of isolated DNA, 1x SensiMix II probe, 400 nM of each primer and 100
nM of each probe in a final volume of 50 µl. Thermocycling was performed on the
Stratagene MX3005P and consisted of 95 °C for 10 min and 40 cycles of 92 °C for
15sec and 60 °C for 1 min with endpoint discrimination.
5.3.5 Microarray
5.3.5.1 Construction of the 8 X 60K array and study design
The pattern of gene expression in bendiocarb-resistant mosquitoes was
investigated using a newly designed C. quinquefasciatus whole genome
oligonucleotide microarray. An 8 x 60K microarray format with 60-mer
oligonucleotide probes was designed to cover five distinct groups of targets using
![Page 129: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/129.jpg)
115
eArray (http://earray.chem.agilent.com/earray/). The majority of this array
encompassed three probe replicates (56,598 probes) for each of the 19,018 transcripts
in the CpipJ1.3 gene build (Arensburger et al. 2010). Additionally, we downloaded
205,396 ESTs from Vectorbase. From these, we identified 1,987 contigs and 4,109
singleton sequences and designed a single probe for each (from these 1,987 contigs,
only 1,935 had successfully probes designed and from 4,109 singletons 2,862 had
successful probes designed). Additionally, three probe replicates were designed to
each of four alternative GST transcripts not annotated in Vectorbase (Kasai et al.,
2009), and 250 CV (coefficient of variation) probes split into groups of ten, which are
used for correction of the background signal of each dye channel (Figure 5.1A).
From the six insecticides used on Ugandan C. quinquefasciatus, we chose
bendiocarb selected mosquitoes for the microarray analysis because we observed only
moderate mortality for this insecticide following 4h exposure (see Figure5.2) thereby
allowing clear discrimination between resistant and unexposed sympatric mosquitoes)
and we also detected an increase in mortality in the presence of two synergists (See
Figure 5.2; TPP and PBO), indicating a likely involvement of metabolic resistance.
The TPRI strain was included in the analysis as a susceptible allopatric control. The
TPRI colony was bioassayed with bendiocarb to confirm its complete susceptibility,
and the samples used on the microarray were exposed to the same conditions as the
field samples including the use of the same control paper that was applied to the
Ugandan sympatric control. A comparison between the bendiocarb selected samples
and controls (Uganda not exposed and TPRI) was performed using three RNA pools
per group in an interwoven loop design (Figure 5.1B) as described by Vinciotti et al.
(Vinciotti et al. 2005).
![Page 130: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/130.jpg)
116
Figure 5.1: Overview of Culex quinquefasciatus whole-transcriptome analysis. A)
Design of the 8 x 60K Agilent microarray. CpipJ1; consensus gene set of the
automated gene prediction from the C. quinquefasciatus Johannesburg strain genome
sequence. EST; expressed sequence tags. GSTD1, Glutathione S transferase D1. CV
probe; coefficient of variation. B) Interwoven hybridization loop design for
comparison between bendiocarb-exposed, non-exposed Ugandan field-collected
mosquitoes and the TPRI susceptible strain. Circles represents pools of 10 females: C;
Uganda non-exposed mosquitoes (sympatric control), R; Uganda Resistant mosquitoes
and TPRI (Tropical Pesticides Research Institute); C. quinquefasciatus susceptible
strain from Tanzania.
A
B
![Page 131: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/131.jpg)
117
5.3.5.2 RNA extraction, labelling and hybridization
Total RNA was isolated from three pools of 10 female mosquitoes for each
group using RNAqueous-4PCRkit (Ambion) according to the manufacturer`s
instructions. Total RNA quantity was assessed using a nanodrop spectrophotometer
and RNA quality was assessed using an Agilent Bioanalyzer. Each pool of RNA was
individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low
input Quick Amp Labelling Kit (Agilent Technologies) followed by purification
through Qiagen RNeasy Columns (Qiagen), with quality and quantity checked using a
nanodrop spectrophotometer and bioanalyzer, respectively.
Before hybridization, 300 ng of Cy3- and Cy5-labeled cRNA was fragmented
using the gene expression hybridization kit (Agilent) in a total volume of 25 µl
including 5 µl of 10x blocking agent and 1 µl of 25x fragmentation buffer. The
fragmentation reaction was incubated at 60 °C for 30 min, and then chilled on ice for
2 min before addition of 25 µl of 2X GE hybridization buffer Hi-RPM. Each array was
hybridized using 45 µl of the fragmentation solution for 17 hours at 65 °C and 10 rpm.
After hybridization arrays were washed with wash buffers one and two for 1 min each,
followed by acetonitrile for 10 sec and finally fixation solution for 30 sec. Arrays were
scanned using the microarray scanner system (Agilent Technologies) and feature
extraction performed using Feature Extraction software (Agilent Technologies)
according to the manufacturer’s recommendations. All arrays passed the Agilent
quality control with QC score ≥10.
![Page 132: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/132.jpg)
118
5.3.5.3 Data analysis
All microarray data analysis was performed using the R- program (Team
2014). Array normalization was carried out using the Limma 3.2.3 package (Smyth
2005) and data analysis performed using MAANOVA software (Wu et al. 2003) to
detect overall differential levels of gene expression across the three treatment groups.
The most over-expressed genes were selected after ANOVA F-test using a
significance level for the FDR-corrected set at log10 (Q value) > 2. Additionally, the
pattern of differential transcript level was also characterized through pair-wise
comparisons between Ugandan resistant, sympatric control and the TPRI strain using
a Student’s t-test with genes where P < 0.05 considered differentially over-expressed.
Functional characterization of differentially expressed transcripts identified in
the ANOVA and pair-wise t-test were then submitted to a Gene Ontology (GO)
analysis to classify probes on their GO categories (cellular components, biological
process and molecular functions). Two selection criteria were applied to develop the
gene list used on for GO analysis. For the ANOVA analysis we applied a FDR
threshold of logQ value >2, while for the t-test, probes with significant up / down
regulation were selected based on a fold change of two. The list of genes that fit these
criteria was submitted to VectorBase for automated functional annotation (GO term
identification). The REVIGO web server (Supek et al. 2011) was employed to
summarize and visualize the distinct GO terms identified. Relatedness among GO
terms was assessed using the uniqueness method, followed by clustering of GO terms
with closer semantic similarity, which were visualized by scatterplots for each GO
category. The relative frequency of GO terms was assessed through comparison to the
frequency in the Drosophila melanogaster data-base assuming, that both species have
similar frequency of GO terms.
![Page 133: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/133.jpg)
119
5.3.6 RT-qPCR validation
Reverse-transcription quantification PCR (RT-qPCR) was applied to confirm
the expression profile of three out of 16 top candidate gene identified by the microarray
(see Table 5.3). Specific primers to amplify PCR fragments with size ranging from
107 to 176 bp (Table 5.1) were designed using primer3 software (Rozen and Skaletsky
2000); however, only for four genes, Cyp6d3 (here denominated as Cyp-Cx1,see
Figure 5.6 for further details), R2d2, 40S ribosomal protein S3 and β-tubulin) was it
possible to design primers spanning exon junctions. Specificity of primer sets was
verified by identification of a single symmetrical amplicon peak following melting
curve analysis. Additionally, PCR efficiency was verified using a 10-fold serial
dilution of standard cDNA, with only primer sets with an efficiency ranging from 90
to 110% taken forward for RT-qPCR reactions.
Three technical replicates of all RT-qPCR reactions were carried out for each
gene in a total volume of 20 µl including 1 µl of cDNA (1:4 stock diluted), 10 µl of
Brilliant II SYBR® master mix (Agilent Technologies) and 100 nm of each forward
and reverse primer. Amplification was conducted under standard qPCR reaction
conditions on the Mx3500P qPCR system (Agilent Technologies). Gene expression
quantification of the three selected genes was assessed according to the ΔCt method
(Livak and Schmittgen 2001) using two housekeeping genes; 40S ribosomal protein
S3 and β-tubulin as endogenous controls.
![Page 134: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/134.jpg)
120
Table 5.1: PCR primers used for qPCR gene expression analysis
Gene name Sequence (5`-3`) Fragment
size (bp)
Accession
numberA
Cyp-Cx1 F:AATCGCTACCTACCTGAACGA
R: AATCGTTCAGGTAGGTAGCG
107 CPIJ020018-RA
Cyp6n23 F: CCGGAAGAGCTCGCCAAA
R: GCGTCAATCCGTAGCGGT
176 CPIJ005900-RA
D2r2 F: TTCGAGGTTCCAGAGTTTGAG
R: GCATCGCTTGCAGTGTTT
169 CPIJ011746-RA
β-tubulin F: TCGACCTTCATCGGAAACAC
R: GTTCATGTTGCTCTCAGCCT
156 CPIJ003263-RA
40S
ribosomal
protein S3
F: CCTGACTCGCGAGCTGG
R: GAAACCGAATCGCTTCTGGAC
166 CPIJ013941-RA
A VectorBase transcript identification
5.3.7 Manual annotation of the CYP6D3 gene
During qPCR primer design for the top candidate gene Cyp6d3 (CPIJ020018-
RA), we concluded that the available, automated gene annotation is unreliable. The
genomic sequence of this region in Vectorbase includes a region of approximately 810
bp in supercontig 3.2948 with no nucleotide sequence information, which spanned the
automated annotation of Cyp6d3. We suspected that additional coding sequence lay
within this region. To confirm this we designed primers to span the complete region
and amplify a 4.7 kb region covering the full length of the candidate gene genomic
sequence. Nine internal sequencing primers were also designed.
PCR reactions to amplify the Cyp6d3 genomic region were conducted in a final
volume of 20 µl including approx. 40 ng of genomic DNA, 1 X Phusion HF buffer,
200 µM of each dNTP, 0.5 µM of each primer forward:Cx-6D3 and reverse: Cx-6D3
![Page 135: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/135.jpg)
121
(Table 5.2) and 0.02 U/µl of Phusion DNA polymerase. The reaction conditions were
98 °C for 30 sec, 30 cycles of 98 °C for 10 sec, 62 °C for 30 sec and 72 °C for 3 min,
with a final extension of 72 °C for 5 min. The PCR product was purified using the
GeneJET PCR purification kit (Thermo Scientific) followed by cloning in the pJET1.2
PCR vector (Thermo Scientific). Finally, nine primers (Table 5.2) were used for
sequencing the full length of cloned PCR product after plasmid purification using the
GeneJET Plasmid Miniprep Kit (Thermo Scientific).
Sequence traces were analyzed using CodonCode Aligner version 4.2.2.
Following removal of vector sequences, fragments obtained by sequencing using
distinct sequencing primers were assembled to build a single contig. This contig
sequence was then used for gene structure prediction and transcript annotation using
the Augustus web interface (Stanke and Morgenstern 2005).
Table 5.2: Primer sequences for amplification and sequencing of the
Cyp6d3 genomic region
Primer ID Sequence (5`-3`)
PCR primers
Cx-6D3F AAAGGTGAACTGAGGGCAAA
Cx-6D3R CTGATAAACAACGTTCGGACA
Sequencing primers
Cx-6D3seq1 TGGAGGTGAATGCGAAAAGT
Cx-6D3seq2 TTTCATTTCGTGGAGTACATCG
Cx-6D3seq3 ATGGCATCCGTTGAGGTATC
Cx-6D3seq4 TCGAGTACCGATGAGAAGCA
Cx-6D3seq5 CGGCTGATTTCAACCATTTT
Cx-6D3seq6 TTGAAATGTTTTAGGGGAGCA
Cx-6D3seq7 TTTCCGATCTCTTCGCAAAC
Cx-6D3seq8 ATAGTCGTGGGTGCACTTCC
![Page 136: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/136.jpg)
122
5.4 Results
5.4.1 Insecticide susceptibility status
WHO susceptibility tests using F1 female mosquitoes showed high levels of
insecticide resistance to five out of six insecticides tested (Figure 5.2). The lowest
mortality (0.97%) was observed with permethrin, while for DDT, lambdacyhalothrin,
bendiocarb and deltamethrin the mortality rate ranged from 1.63-3.29% (Figure 5.2).
For fenitrothion, we observed the highest mortality among the insecticides tested
(69.42%). To investigate the effect of exposure duration on mortality, bioassays with
bendiocarb and deltamethrin were also carried out for four hours. For both insecticides,
an increase in mortality was detected (Figure 5.2); however, only for bendiocarb did
the mortality increase significantly from 2.04% (95% CI = 1.93-10.2) to 58.02% (95%
CI = 6.23-6.49).
Adult mosquitoes were also assayed with bendiocarb and deltamethrin for four
hours exposure after pre-exposure in parallel to three synergist compounds (TPP, DEM
and PBO). Synergism was observed for both insecticides following TPP and PBO pre-
exposure whilst no significant effect on mortality was detected for DEM (Figure 5.2).
TPP and PBO significantly increased the mortality of bendiocarb by 22.49% and
25.12%, respectively with an increase of mortality from 58.02% (95% CI = 6.23-6.49)
to 80.51% (95% CI = 7.83-10.91) for TPP and to 83.14% (95% CI = 6.82-9.73) for
PBO. For deltamethrin TPP and PBO synergists increased the mortality by 27.67 and
29.48% respectively, with mortality increasing from 9.09 % (95% CI = 2.97-4.5) to
38.57% (95% CI = 11.16-12.42) for TPP and to 36.76% (95% CI = 11.11-12.62) for
PBO.
![Page 137: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/137.jpg)
123
Figure 5.2: Insecticide susceptibility status of C. quinquefasciatus from Tororo, Uganda. Bioassay results following exposure to WHO
insecticide treated papers at standard conditions and effect of insecticide synergists on the susceptibility status. Error bars represent 95% CI.
PBO; piperonyl butoxide, DEM; diethyl maleate, TPP; triphenyl phosphate.
0
10
20
30
40
50
60
70
80
90
100
Female N=91 Female N= 103
Female N= 350
Female N=122 Female N= 49 Female N= 243
Female N=35 Female N= 275
Female N= 77 Female N= 45 Female N= 89 Female N= 45 Female N= 68 Female N= 70
1 hour 1 hour 1 hour 1 hour 1 hour 4 hours 1 hour 4 hours 4 hours 4 hours 4 hours 4 hours 4 hours 4 hours
DDT Permethrin Fenitrothion Lambda-cyhalothrin
Bendiocarb Deltamethrin Bendiocarb +TPP
Bendiocarb+ DEM
Bendiocarb+ PBO
Deltamethrin+ DEM
Deltamethrin + PBO
Deltamethrin+ TPP
Tororo
Mo
rtal
ity
%
![Page 138: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/138.jpg)
124
5.4.2 Frequency of an Ace-1 resistance allele on bendiocarb selected
mosquitoes
Both mosquitoes that did or did not survive exposure to 0.1% bendiocarb (4h) were
genotyped for the Ace1-119S mutation. The wild-type allele was observed at the highest
frequency 86% (95% CI = 0.28-0.39) with homozygous G119 genotypes predominating
72.44% (95% CI = 0.48-0.65) whereas no homozygous resistant genotypes were detected
(Figure 5.3A). Association test between the Ace-1 resistant allele 119S and bendiocarb
resistant phenotype shows a significant genotypic/phenotypic association (P = 0.001, Figure
5.3B).
Figure 5.3: Ace1-G119S allele genotyping and bendiocarb-selected (4h) mosquitoes
association test. A) Ace-1 allelic and genotypic frequencies B) Association of the Ace-1
genotype and bendiocarb resistant phenotype. GG, GS and SS correspond to homozygous
and heterozygous genotypes for the ace1-G119S locus.
5.4.3 Gene expression profiling of bendiocarb-selected mosquitoes
To identify candidate genes associated with resistance in bendiocarb-selected
mosquitoes, transcriptomic profiles of three groups of Ace-1 wild-type (G119) mosquitoes
were compared: Ugandan bendiocarb exposure survivors, Ugandan unexposed (sympatric
control) and an unexposed fully susceptible TPRI strain. Among the three groups we
![Page 139: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/139.jpg)
125
identified 32 probes significantly differently expressed in the ANOVA analysis applying a
threshold of –log10 false-discovery rate (FDR) adjusted P value > 2, 50% of the probes had
higher expression in the Ugandan exposed compared to both the sympatric control and TPRI
(Table 5.3). The list of top candidate genes included two P450s: Cyp6d3 (hereafter
denominated Cyp-Cx1 as described later) and Cyp6n23, which showed the highest level of
gene expression compared to the TPRI strain (8.75 and 4.37 fold-change, respectively).
For functional characterization of the most significantly differentially expressed
probes, a list of probes with a -log false-discovery rate (FDR) > 2 obtained from the ANOVA
(Figure 5.4A) comparison was submitted to a Gene Ontology (GO) analysis. After removing
duplicate probes, 358 unique genes were submitted to VectorBase for the GO term search
and 231 terms were obtained. The majority of extracted GO terms were clustered on the
molecular function and biological process categories with 28 and 15 distinct terms identified
with frequency higher than 1%, respectively (Figure 5.5). Among the top enriched terms,
GO linked to metabolic process, biosynthetic process, transport, membrane, integral
component of membrane, nucleus, binding, cation binding and metal ion binding were
observed with percentage of annotations ranging from 16.80 to 60.61% (Figure 5.4B-D;).
Metabolic process was the predominant term across all categories corresponding to 60.61%
of enriched GO terms, while in the category of molecular function we observed a large
proportion of terms associated with binding functions, with frequencies between 15.70 and
55.14%.
To further explore the transcriptomic profile of the bendiocarb resistance phenotype,
pairwise comparisons using Student’s t-test were applied to compare exposed and unexposed
Ugandan mosquitoes to the TPRI susceptible strain. Significantly up and down-regulated
genes with a fold-change > 2 were also investigated by GO analysis. For down-regulated
genes we observed similar figures between exposed and unexposed mosquitoes in contrast
![Page 140: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/140.jpg)
126
to up-regulated genes where we identified 33 genes exclusively in the exposed mosquitoes
(Figure 5.6A). The pairwise comparison also identified eight significantly expressed putative
genes associated with insecticide detoxification: three exclusively in the pools of exposed
mosquitoes: GSTs (CPIJ018629-RA; fold-change 2.79 and CIPJ018632-RA, fold-change
2.0) and esterase (CPIJ013918-RA; fold-change 2.86) whereas for the other five: P450
(CPIJ020018-RA), GSTs (CPIJ010814-RA, CPIJ018624-RA, CPIJ 018626-RA) and
esterase (CPIJ013917-RA) were observed in both Ugandan exposed and unexposed
mosquitoes.
In general, the GO term enrichment of the up and down-regulated genes for the
Ugandan exposed and unexposed mosquitoes shows a similar list of terms (Figure 5.6B,
Appendix 5-A) with the exception of three terms: metabolic process, phosphate-containing
compound metabolic process and cation biding that were observed exclusively on the
exposed mosquitoes with frequency of 60.61, 16.39 and 17.07%, respectively (Figure 5.6C).
Nevertheless, this analysis excluded 39 and 18 up and down-regulated genes, respectively,
such as esterases (CPIJ013917-RA and CPIJ013918-RA) and Heat shock proteins
(CPIJ013880-RA and CPIJ005642) for instance, that were not associated with GO terms
from VectorBase.
![Page 141: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/141.jpg)
127
Table 5.3: Most differentially expressed genes from microarray analysis comparing Uganda resistant,
sympatric controls and TPRI susceptible mosquitoes.
log Fold-Change (-log Q value)
Gene Transcript GO Ugandan
Bendiocarb vs
TPRI
Ugandan
Sympatric
vs TPRI
CPIJ020018-RA cytochrome P450 6D3 monooxygenase activity 3.13 (2.80) 2.59 (2.80)
CPIJ005900-RA cytochrome P450 6N23 monooxygenase activity 2.13 (2.80) 1.87 (2.80)
CPIJ003654-RA electron transfer electron carrier activity 2.36 (2.58) 2.23 (2.58)
CPIJ010823-RA serine protease 27
precursor
serine-type endopeptidase
activity
4.41 (2.53) 3.86 (2.44)
CPIJ013083-RA brain chitinase and chia hydrolase activity,
hydrolyzing O-glycosyl
compounds
1.31 (2.44) 0.93 (2.38)
CPIJ016928-RA 15.4 kda salivary
peptide
No information in
VectorBase
2.99 (2.44) 2.73 (2.42)
CPIJ004984-RA serine proteases 1/2
precursor
serine-type endopeptidase
activity
4.26 (2.44) 3.60 (2.40)
CPIJ011746-RA R2D2 double-stranded RNA
binding
1.89 (2.41) 1.72 (2.40)
![Page 142: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/142.jpg)
128
CPIJ004019-RA saccharopine
dehydrogenase
oxidoreductase activity 1.47 (2.44) 1.05 (2.30)
CPIJ004019-RA saccharopine
dehydrogenase domain
oxidoreductase activity 1.24 (2.40) 1.11 (2.40)
CPIJ002104-RA plasma alpha-L-
fucosidase precursor
catalytic activity 1.32 (2.44) 0.90 (2.26)
CPIJ015009-RA histone H3.3 type 2 DNA binding 1.32 (2.40) 1.13 (2.38)
CPIJ000182-RA N-acetylneuraminate
lyase
catalytic activity 2.44 (2.42) 1.76 (2.26)
CPIJ011590-RA conserved hypothetical
protein
No information in
VectorBase
0.87 (2.37) 0.81 (2.38)
CPIJ019290-RA DNA ligase 4 DNA binding 1.22 (2.34) 1.20 (2.35)
CPIJ016792-RA hypothetical protein No information in
VectorBase
3.39 (2.38) 2.94 (2.29)
![Page 143: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/143.jpg)
129
Figure 5.4: Candidate genes differentially transcribed in C. quinquefasciatus bendiocarb
selected mosquitoes. A) Changes of gene expression between the three groups (Uganda
exposed, Uganda un-exposed and TPRI) presented as a volcano plot. B, C and D Scatter plots
showing representative GO term clusters (cellular component, biological process and molecular
function, respectively) of differentially expressed transcripts with FDR>2.0. labeled circles are
GO terms with frequency higher than 5%, while circles size indicates the frequency of the GO
term compared to Drosophila melanogaster Go term enrichment.
![Page 144: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/144.jpg)
130
Figure 5.5: Go term enrichment analysis based on significantly differentially expressed probes with a -log false-discovery rate (FDR) > 2
obtained from the ANOVA among three groups (Uganda exposed and non-exposed (sympatric control) and TPRI susceptible strain.
![Page 145: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/145.jpg)
131
Figure 5.6: Transcriptomic profile of differentially expressed genes with fold-change >2 in
Uganda exposed and sympatric mosquitoes compared to TPRI. A) Venn diagram showing
the overlap of up- and down-regulated transcripts between the three groups. B) Comparison
of the number of GO terms identified by each pair-wise comparison. C) GO term enrichment
of up-regulated transcripts between the groups with frequency higher than 2%.
5.4.4 Candidate gene validation by qPCR
The expression patterns of both candidate genes from the P450 family (Cyp-Cx1 and
Cyp6n23) and the gene R2d2 (randomly chosen from the list of top candidate) were
additionally assessed by qPCR. Satisfactory PCR efficiency ranging from 91.4 to 101.8%,
(within the 10% acceptable variation) was obtained for primer pairs designed for candidate
genes and endogenous control (Figure 5.7). Additionally, the primer sets were specific, with
a single symmetrical amplicon peak in melting curve analyses (Appendix 5-B). For all three
candidate genes (Cyp-Cx1, Cyp6n23 and R2d2) we observed a good correlation between the
microarray and RT-qPCR expression fold-change with ratios of up-transcription level
detected by both methods differing by less than 1.5x (Figure 5.8 ).
![Page 146: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/146.jpg)
132
Figure 5.7: Standard curve from primers used on real-time PCR for microarray candidate
genes validation. Squares correspond to 1x10 serial dilution of cDNA. qPCR efficiency (Eff)
and coefficient of determination (Rsq) were calculated for each prime based on two
replicates.
Figure 5.8: Pair wise comparison of microarray and qPCR data based on gene expression
profile for three genes found to be significantly different expressed between Uganda
exposed, non-exposed mosquitoes (sympatric control) and TPRI susceptible strain
31
32
33
34
35
36
37
38
39
40
0.0091586 0.0915858 0.9158576
Ct
(dR
)
Initial Quantity (copies)
Cyp-Cx1
SYBR Standards, RSq:0.980
SYBR, Y = -3.548*LOG(X) + 32.26, Eff. = 91.4%
23
24
25
26
27
28
29
30
31
0.0107176 0.1071756 1.0717564
Ct
(dR
)
Initial Quantity (copies)
Ribosomal protein 3
SYBR Standards, RSq:0.990
SYBR, Y = -3.491*LOG(X) + 23.68, Eff. = 93.4%
31
32
33
34
35
36
37
0.0339041 0.3390408
Ct
(dR
)
Initial Quantity (copies)
Β-tubulin
SYBR Standards, RSq:0.955
SYBR, Y = -3.280*LOG(X) + 31.59, Eff. = 101.8%
28
29
30
31
32
33
34
35
36
37
38
0.0009002 0.0090019 0.0900185
Ct
(dR
)Initial Quantity (copies)
Cyp6n23
SYBR Standards, RSq:0.871
SYBR, Y = -3.343*LOG(X) + 26.94, Eff. = 99.1%
31
32
33
34
35
36
37
38
39
0.0111586 0.1115862 1.1158615
Ct
(dR
)
Initial Quantity (copies)
D2r2
SYBR Standards, RSq:0.992
SYBR, Y = -3.286*LOG(X) + 32.20, Eff. = 101.5%
0
1
2
3
4
Exposed vsTPRI
sympatriccontrol Vs TPRI
Exposed vsTPRI
sympatriccontrol Vs TPRI
Exposed vsTPRI
sympatriccontrol Vs TPRI
Cyp6n23 D2r2 Cyp-Cx1
Log
2-f
old
ch
ange
Selected genes from microarray data
qPCR microarray
![Page 147: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/147.jpg)
133
5.4.5 CYP6D3 gene annotation
After identification of Cyp6d3 (CPIJ020018-RA) as the top candidate gene in the
microarray results, further analyses on the genomic and cDNA sequences available from
VectorBase were conducted. This revealed an atypical gene architecture for a P450 gene
with the presence of an intron between exons 2-3 longer than 3Kb (Figure 5.9A). Closer
analysis of the genomic sequence indicated a region of 809 bp with no nucleotide
information (Ns) internal to the Cyp6d3 genomic sequence. In silico analysis of a contig
constructed after PCR amplification and cloning of the complete region encompassing the
genomic region of interest, suggested the presence of two distinct P450, here named as Cyp-
Cx1 and Cyp-Cx2 instead of the single Cyp6d3 as predicted by the automated annotation in
VectorBase. The two genes predicted are each composed of two exons separated by one
intron, while the microarray probe (gene: Cyp6d3) is based exclusively on the gene Cyp-Cx1
exon-2 (Figure 5.9B and Figure 5.10).
An homology search in the Culex data base in VectorBase for both predicted genes
Cyp-Cx1 and Cyp-Cx2 indicated that the Cyp-Cx1 have 94% similarity to Cyp6z14 , while
the Cyp-Cx2 is 87% similar to Cyp6d3. We note that BLAST analysis of both predicted
amino-acid sequences against A. gambiae and A. aegypti sequences available on VectorBase
and the Cytochrome P450 homepage (Nelson 2009) shows no significant similarity to any
CYP gene of the family D, while for both predicted genes the top hits belong to CYP genes
from the Z family. Together the gene prediction and BLAST analysis carried out indicate
that the top candidate gene from the microarray analysis is more close related to P450 genes
of the Z family, some members of which have previously been associated with metabolic
resistance in both A. gambiae and A. aegypti mosquitoes (Figure 5.9C).
![Page 148: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/148.jpg)
134
Figure 5.9: Cyp6d3 predicted gene structure and annotation. A) Output of the VectorBase
genome browse suggested a gene architecture with four exons and three introns. B)
Schematic representation of the Cyp6d3 after re-annotation using Augustus software, which
indicates two distinct genes here named Cyp-Cx1 (g1.t1) and Cyp-Cx2 (g2.t1). C) Unrooted
distance neighbour joining tree showing phylogenetic relationship of the predicted gene
CYPCx1 from C. quinquefasciatus to A. aegypt and A. gambiae cytochrome P450s from the
CYP6 gene family. The percentage of bootstrap confidence values from 1000 replicates is
shown at the nodes.
A
B
C
![Page 149: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/149.jpg)
135
Figure 5.10: Nucleotide and amino acid sequences of Cyp-Cx1 (g1.t1) and Cyp-Cx2
(g2.t1) genes after re-annotation of the Cyp6d3 gene using Augustus software.
![Page 150: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/150.jpg)
136
5.5 Discussion
In this study, we investigated the insecticide susceptibility status and possible
mechanisms involved with insecticide resistance in C. quinquefasciatus mosquitoes
collected in a region of Uganda (Tororo), where recently non-official vector control
interventions have been conducted against this species, while an ample insecticide-based
program has been implemented targeting other important vector species such as Anopheles
gambiae and Anopheles funestus (Morgan et al. 2010, Mawejje et al. 2013). The present
study demonstrates that even in the absence of a concerted vector control intervention, a high
level of resistance to pyrethroids and DDT is observed. Not surprisingly, the insecticide
susceptibility observed in the C. quinquefasciatus population studied follows a pattern
similar to that detected in Anopheles species, where for decades DDT and more lately
pyrethroids have been the insecticides applied for malaria control (Pocquet et al. 2014,
Fathian et al. 2015).
As reported in monitoring studies of resistance, lower resistance to carbamates
insecticides have been observed across African mosquito populations, indicating that
insecticides from this class are a possible alternative to tackle the evolution of insecticide
resistance. Indeed, Recently, Kigozi et al. (2012) indicated a reduction in malaria prevalence
in the Apac district from Uganda following bendiocarb rounds compared to previous rounds
of IRS with DDT and alpha-cypermethrin, which strongly suggests that the local population
is more susceptible to carbamate insecticides.
Nevertheless, recent evolution of resistance to carbamates insecticides in Culex
populations possibly in response to malaria vector control or agriculture practices, has
already been reported in other African countries such as Tanzania and Zambia (Norris and
Norris 2011, Jones et al. 2012b). In these locations, moderate resistance to bendiocarb was
observed, in contrast to high levels of resistance detected to both pyrethroids and DDT.
![Page 151: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/151.jpg)
137
Hence, although carbamate insecticides might be a primary alternative to replace pyrethroids
in vector control interventions, monitoring the evolution of resistance for these insecticides
is critical to increase the lifespan and sustainability of future action based on this compounds.
Indeed, the genotyping data for the G119S mutation in the Ace-1 gene suggests that
Tororo field-collected mosquitoes have already been exposed to carbamates and/or
organophosphates insecticides, the Ace-1 resistant allele 119S was detected at a frequency
of approximately 20%. However, this frequency was much lower than the frequency
observed in other vector mosquitoes where carbamates are routinely used in vector control
(Edi et al. 2012). Hence, this figure might reflect the very recent introduction of carbamates
insecticide for IRS across Ugandan North region (Indoor Residual Spraying of Insecticide
and Malaria Morbidity in a High Transmission Intensity Area of Uganda. Ruth Kigozi,
2012). Nevertheless, is also important consider that the selection for the 119S resistant allele
can be driven by insecticide exposure due to agricultural activities as described in C.
quinquefasciatus populations from Iran (Vatandoost et al. 2004).
Although this study has detected a high frequency of the Ace-1 resistant allele in
Tororo population, the association between the G119S genotyping and bendiocarb resistant
phenotype indicated that around 60% of the resistant mosquitoes were wild-type for the
G119S mutation, which suggests that the bendiocarb-resistant phenotype is caused by other
mechanism of resistance such as metabolic, behavioural or reduced insecticide penetration
as described in other studies (Ramphul et al. 2009, Ranson et al. 2011, David et al. 2013).
The synergist assays conducted in this study indeed indicates a potential involvement
of metabolic resistance in the bendiocarb-resistant phenotype in C. quinquefasciatus from
Tororo, as was observed an increase in mortality to bendiocarb when mosquitoes were pre-
exposed to either TPP (a synergist of esterases) or PBO (a synergist of cytochrome P450s).
Consequently, together the Ace-1 genotyping and synergist assay data strongly suggested an
![Page 152: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/152.jpg)
138
alternative mechanism of resistance to the well already known Ace1-119S target-site
mutation.
To identify likely candidate genes associated with metabolic resistance a whole-
transcriptomic profiling analysis of the resistant phenotype was conducted using a
microarray platform. Among the list of up-regulated genes significant differently expressed
between the resistant-phenotype and both controls (sympatric mosquitoes non-exposed and
TPRI a susceptible strain), remarkably the GO enrichment analysis indicated a large
proportion of GO terms related to detoxification and to regulatory transcription factors.
Due to the fitness cost associated with the 119S genotype (Labbe et al. 2007b, Labbé
et al. 2014, Weetman et al. 2015), it is possible that alternatively a metabolic resistance have
been mostly driven the evolution of resistance to bendiocarb in Tororo mosquitoes. The two
most over-expressed genes identified in the whole-transcriptomic profiling of the resistant
phenotype, Cyp-Cx1 and Cyp6n23 are especially relevant as many genes belonging to this
gene family have been associated with insecticide metabolism in a variety of vector species
such as Anopheles, Aedes and Culex (Strode et al. 2008, Mitchell et al. 2012). The likely
association of this candidate cytochrome P450s with the carbamate resistant phenotype is
also supported by the synergism effect of PBO on the mosquitoes susceptibility as PBO has
previously been reported as a P450 inhibitor (Feyereisen 2012).
Nevertheless, so far, most CYPs associated with the insecticide resistance phenotype
in mosquitoes, for example Cyp6p3, Cyp9j32 and Cyp6m10 are typically involved with
metabolism of pyrethroids and DDT (Djouaka et al. 2008, Müller et al. 2008, Strode et al.
2008), while to date very few examples of bendiocarb metabolism by P450 have been
reported. For instance, Edi et al. (2014) demonstrated that Cyp6p3 is associated with the
bendiocarb resistance phenotype in A. gambiae from Tiassalé, Cote d’Ivoire and confirmed
its capability to metabolise bendiocarb. Additionally, two other A. gambiae P450s (Cyp6z1
![Page 153: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/153.jpg)
139
and Cyp6z2) have also been demonstrated to be capable of metabolizing the carbamate
insecticide carbaryl (Chiu et al. 2008).
Interestingly, both cytochrome P450s identified here belong to the CYP6 family,
which includes most of the CYPs genes already described as insecticide metabolizers
(Hemingway et al. 2004). Regardless, further analysis of the genomic and transcriptomic
sequences of the top candidate gene CYP6D3 suggests annotation inaccuracy. After re-
annotation, our analysis indicates that the CYP6D3 gene consists of two distinct CYP genes
(here denominated as Cyp-Cx1 and Cyp-Cx2) instead of one as suggested by the automated
annotation of VectorBase. Since the annotation problem as observed in Cyp6d3 might also
occurs on other genes (see Neafsey et al. (2015) for annotation deficiencies of recent
Anopheles sequencing), the design of our whole-transcriptomic microarray may lack some
transcript information. A future review of C. quinquefasciatus gene annotation, especially
of gene families linked to insecticide resistance might be required for effective utility of
microarrays for the monitoring of insecticide resistance. Whilst the increased usage of
RNASeq for differential gene expression analyses would aid in this, the typical RNA-Seq
pipeline maps reads to annotated gene sets and hence a robust annotation of these gene
families would still be beneficial.
BLAST analysis of the amino acid sequence of both predicted genes (Cyp-Cx1 and
Cyp-Cx2) shows higher similarity to genes of the Cyp6 family, while the both predicted
genes are closer related to the sub-family Z instead of D as previously reported in
VectorBase. Remarkably, the predicted gene Cyp-Cx1, which includes the microarray probe,
is very closely related to four P450s already validated in vitro as insecticide metabolizers;
two isolated from A gambiae Cyp6z3 (permethrin) and Cyp6z1 (DDT and carbamate) and
from A. aegypti Cyp6z8 and Cyp6z6 (Deltamethrin). Although we identified a high similarity
between Cyp-Cx1 and other P450s already associated with metabolic resistance, it is not
![Page 154: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/154.jpg)
140
possible infer a direct evidence of the top candidate to bendiocarb metabolism as structural
differences and changes in insecticide recognition site between P450s of the same family
could result in distinct binding activities and insecticide selectivity (Lertkiatmongkol et al.
2011). Consequently, to confirm the possible role of both candidate genes in bendiocarb
resistance, further analysis such as in vitro assays to verify their capability to metabolize
insecticide as well as characterization of the possible mechanisms involved in their over-
expression need to be conducted.
5.6 Conclusion
Our data demonstrate that although Ugandan C. quinquefasciatus mosquitoes is not
targeted by a specific, local vector control program, a high level of insecticide resistance was
identified in the studied population. This indicates that application of insecticide to control
other species with public health importance through indoor residual spray (IRS) and
insecticide treated nets (ITNs), or through application of insecticides for agricultural
purposes, could be driving the evolution of insecticide resistance in this population. This
study also provides strong evidence that a metabolic mechanism is associated with the
bendiocarb resistant phenotype observed in Tororo. Lastly, by a whole-transcriptomic
analysis we identifed two new candidate genes belonging to the cytochrome CPY6 gene
family associated with metabolic resistance to bendiocarb.
![Page 155: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/155.jpg)
141
Chapter VI
Chapter VI – Conclusion
Conclusion
Given the recognized contribution of vector control campaigns in mitigating vector-
borne disease transmission, increased resistance to insecticides represents a major challenge
for the sustained effectiveness of both current and future actions to reduce the global
incidence of vector-borne diseases (Bockarie et al. 2009, Van den Berg et al. 2012,
Karunamoorthi and Sabesan 2013). To overcome the threat of insecticide resistance,
development of molecular tools to monitor and understand the mechanisms driving
resistance are imperative for effective decision-making. In the present study, novel DNA-
based and transcriptomic tools were developed and applied for monitoring resistance and
enhancing our understanding of the evolutionary basis of insecticide resistance in C.
quinquefasciatus. Identifying the mechanisms underlying insecticide resistance in C.
quinquefasciatus is especially important since effective control interventions toward this
species assist to decrease the burden of urban transmission of lymphatic filariasis (LF),
which is recognized as the second largest cause of global disability and retains a heavy social
and economic impact in endemic regions across the tropics and subtropics (Rebollo and
Bockarie 2013, WHO 2013b).
This research was designed to address two main questions. Firstly, to infer the likely
impact of insecticide selection pressure on the genetic diversity and population structure of
Ugandan C. quinquefasciatus mosquitoes, which was conducted through genotyping field-
collected mosquitoes using neutral microsatellite markers, as well as typing two well-known
insecticide resistance associated markers Vgsc-1014F and Ace1-119S (Casida and Durkin
![Page 156: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/156.jpg)
142
2013, Scott et al. 2015). The second aim was to investigate the basis of the molecular
mechanisms driving the evolution of insecticide resistance to four classes of insecticide
(carbamates, organophosphates, pyrethroids and organochlorides), which are recommended
for mosquito vector control (WHO 2012b). This was conducted by combining phenotypic
(insecticide bioassays) and genotypic (resistance associated-markers Vgsc-1014F and Ace1-
119S) assays. In addition, adult mosquitoes were also genotyped to characterize the Vgsc
gene copy number. A whole-transcriptome profiling of bendiocarb resistant mosquitoes was
also utilized to identify candidate genes related to metabolic resistance.
The population genetic study carried out used a five-six microsatellite multiplex
reactions (N loci = 30) demonstrated similar levels of genetic diversity in the four studied C.
quinquefasciatus populations from Uganda’s Eastern-Southwest regions. These results
strongly suggest that demographic effects such as genetic drift, effective population size and
bottleneck effects have not differentially impacted the genetic composition of these
populations.
Despite the observed intense gene flow with a strong pattern of isolation-by-distance,
a low genetic structure among Ugandan C. quinquefasciatus populations was detected by the
microsatellite markers. On the other hand, for both resistant-associated markers (Vgsc-
1014F and Ace1-119S) it was not possible to identify a clear pattern of geographic
distribution, which indicates that across the studied location’s mosquitoes have been exposed
to a heterogeneous insecticide selection pressure imposed by insecticides from distinct
classes with variation in the level of exposure creating a pattern of local adaptation.
Nevertheless, is also important to consider that the non-structured distribution of insecticide-
resistant alleles in the studied populations might also reflect distinct environmental features
across the mosquito collection locations, such as from rural to urban dwellings with distinct
levels of human populous, which could be reflected in mosquito population density.
![Page 157: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/157.jpg)
143
The heterogeneous distribution of both resistant-associated alleles described herein
across the Ugandan populations is especially worrying with regard to future vector control
strategies since resistance can impose additional challenges for developing a nationwide
control program. For instance, the non-structured distribution of both associated-resistant
markers (Vgsc-1014F and Ace1-119S) with distinct frequency across all populations can
limit the use of strategies such as rotation of insecticides (insecticides with different modes
of action are rotated annually). On the other hand, the results of the present study emphasize
the importance of population genetics studies to understand the local pattern of insecticide
resistance evolution, and thus provide valuable information to develop more effective
control action for each local population. Based on the present data, the local government
could, for instance, apply a mosaic IRS approach (insecticides from different classes are used
in distinct local populations despite nearby geographic location) to increase the effectiveness
of control actions, with decision-making for the most suitable class of insecticide for each
location based on frequency and geographic distribution of resistant-allele markers.
Surprisingly, after genotyping field-collected Ugandan mosquitoes for the 1014
variant in the Vgsc gene using two newly-developed assays: a TaqMan allelic discrimination
assay and a pyrosequencing genotyping assay, both methods indicate that some mosquitoes
assessed have likely undergone duplication of the Vgsc gene. This figure was also suggested
from Sanger sequencing and haplotype analysis, which detected one individual containing
at least three Vgsc haplotypes simultaneously. Indeed, the results of the Vgsc-CN assay
corroborate the Vgsc gene copy number suggested by the other genotyping methods, with
variation in copy number (CNV = 3 or 4) detected in around 10% of the mosquitoes
investigated. This result strongly indicates the need to investigate whether the CNV observed
in the Vgsc in C. quinquefasciatus is associated with changes to the level of resistant
phenotypes, as already reported for example for the Ace-1 gene in C. quinquefasciatus
![Page 158: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/158.jpg)
144
(Labbe et al. 2007a), as well as in other insects like T. urticae (Kwon et al. 2010) and A.
gossypii (Shang et al. 2014). Hence, the Vgsc-assay described in this study is an important
tool for inferring CNV in natural populations, which will facilitate future studies to elucidate
the possible impact of the Vgsc copy number to the level of insecticide resistance to
pyrethroids and organochlorines in C. quinquefasciatus.
In addition to the enquiry of the likely evolution of insecticide resistance mediated
by target-site mutations, the possible impact of metabolic resistance was also verified. After
genotypic/ phenotypic association tests were conducted between the 119S resistant allele
and bendiocarb-selected mosquitoes, it was detected that around 60% of resistant mosquitoes
were wild-type (G119), strongly indicating that in Ugandan mosquitoes the carbamate
insecticide resistant-phenotype is likely driven by an independent mechanism of resistance.
The likely involvement of an alternative mechanism to the already well known Ace-1 119S
target-site mutation was also supported by synergist bioassays, which showed an increase in
mortality to bendiocarb in mosquitoes pre-exposed to either TPP (a synergist of esterases)
or PBO (a synergist of cytochrome P450s), indicating a probable resistance mediated by
detoxification enzymes (Moores et al. 2009, Edi et al. 2014, Pereira et al. 2014).
To further investigate the apparent role of metabolic resistance in the Ugandan
bendiocarb resistant-phenotype, this work as far as I know is the first to conduct whole-
transcriptomic analysis using a microarray platform on field-collected C. quinquefasciatus.
Remarkably, among the top candidate genes of the bendiocarb-resistant transcriptome
profiling two P450s (Cyp-Cx1 [see details in chapter V] and Cyp6n23) were identified with
the highest over-expression level in the resistant samples, with both candidate genes belong
to the Cyp6 family, which includes most of the Cyp genes already described as insecticide
metabolizers (Hemingway et al. 2004). Interestingly, genomic sequence of the top candidate
gene Cyp-Cx1 is very closely related to two P450s already validated in vitro as insecticide
![Page 159: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/159.jpg)
145
metabolizers; CYP6Z1 (DDT and carbamate metaboliser) from A. gambiae (David et al.
2005) and CYP6Z6 (Deltamethrin metaboliser) from A. aegypti (Chandor-Proust et al.
2013). Nevertheless, it is important to bear in mind that although a high similarity between
Cyp-Cx1 and other P450s already associated with metabolic resistance was identified, it is
not possible to infer directly that this top candidate gene can metabolise bendiocarb, as
structural differences and changes in insecticide recognition site between P450s of the same
family could result in distinct binding activities and insecticide selectivity (Lertkiatmongkol
et al. 2011).
Although this work applied a custom-designed whole-transcriptomic microarray to
identify candidate genes involved in insecticide metabolic resistance, it is important to note
that the microarray designed may lack some transcript information triggered by inaccuracy
of gene annotation as was described for the candidate gene Cyp6d3 (Cyp-Cx1); herein
annotated as two distinct Cyp genes. This aspect emphasizes the necessity for a future review
of C. quinquefasciatus gene annotation, especially of gene families linked to insecticide
resistance (as was necessary for the recently sequenced 16 Anopheles genomes, see (Neafsey
et al. 2015)) to more effectively apply microarrays and other transcriptomic tools (which
map against known transcripts) for the identification of candidate insecticide resistance
genes.
Whilst the DNA-based and transcriptomic tools developed in this study permitted for
the first time quantification of Vgsc gene copy number in field-collected mosquitoes, as well
as resulting in the identification of new metabolic resistance candidate gene (Cyp-Cx1),
complementary work is required to improve the field-applicability of these markers for
monitoring of insecticide resistance. Firstly, for the Vgsc copy number variation detected in
the investigated populations, additional studies including genotypic/phenotypic association
tests are required before further conclusions about the relationship between the Vgsc copy
![Page 160: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/160.jpg)
146
number and insecticide resistance level can be made. Additionally, future research might
also be conducted to investigate the impact of the Vgsc copy number on mosquito fitness.
In the context of the candidate gene (Cyp-Cx1) future work is also necessary for
functional enzymatic characterization for insecticide metabolism. Thus, additional
investigation on this can be done through in vitro metabolism assay (Mitchell et al. 2012),
or alternatively through in vivo characterization by transgenic gene expression (Riveron et
al. 2013). For both the Vgsc assay and Cyp-Cx1 candidate gene, if this additional research
confirms their role in the resistant phenotype, these studies can be complemented by
including C. quinquefasciatus mosquitoes from distinct geographic backgrounds to verify a
possible broad field-applicability of these markers.
The present study demonstrated that the evolution of insecticide resistance in C.
quinquefasciatus is driven by multiple mechanism of resistance, which together may pose a
severe threat to the effectiveness of the ongoing vector control interventions.
![Page 161: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/161.jpg)
147
Appendices
Appendices
![Page 162: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/162.jpg)
148
Appendix3-A
Table 3-A: Microsatellite locus characterization across all C. quinquefasciatus populations.
Locus Allele
number
Rs PIC HE P FIS FIT FST RST
MCQ 1 4 4.000 0.418 0.490 0.000 0.485 0.487 0.024 0.010
MCQ 2 3 2.884 0.332 0.405 0.000 0.294 0.293 0.025 0.007
MCQ 3 7 6.910 0.454 0.461 0.000 0.252 0.247 0.049 0.034
MCQ 4 4 3.642 0.544 0.621 0.3184 0.065 0.065 0.011 -0.005
MCQ 5 6 5.640 0.641 0.692 0.000 0.199 0.191 0.016 0.030
MCQ 8 5 4.642 0.604 0.664 0.000 0.288 0.294 0.016 -0.015
MCQ 9 6 5.650 0.665 0.709 0.0339 0.141 0.138 0.026 0.029
MCQ 10 8 7.642 0.652 0.694 0.000 0.404 0.407 0.017 -0.006
MCQ 11 7 6.581 0.493 0.545 0.0535 0.094 0.096 0.045 -0.001
MCQ 13 6 5.910 0.602 0.647 0.1393 0.154 0.153 0.036 0.073
MCQ 16 7 7.000 0.696 0.724 0.0281 0.106 0.103 0.014 -0.003
MCQ 19 9 8.596 0.563 0.594 0.0014 0.046 0.044 0.016 0.038
MCQ 20 3 3.000 0.554 0.623 0.000 0.292 0.290 0.018 0.009
MCQ 21 12 11.14 0.617 0.607 0.000 0.303 0.301 0.072 0.113
MCQ 22 9 8.873 0.688 0.723 0.000 0.214 0.214 0.029 0.080
MCQ 23 5 4.600 0.436 0.513 0.000 0.439 0.436 0.009 0.019
MCQ 24 6 5.983 0.653 0.691 0.1059 0.035 0.035 0.017 -0.004
MCQ 25 5 4.985 0.463 0.546 0.000 0.313 0.310 0.012 -0.005
MCQ 26 10 9.873 0.825 0.830 0.6902 0.086 0.084 0.027 0.030
MCQ 28 4 4.000 0.553 0.606 0.000 0.594 0.596 0.022 0.004
![Page 163: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/163.jpg)
149
(Rs), allelic richness. (PIC), polymorphic Information content. (HE), expected heterozygosity.
(FIS, FIT, FST) Weir and Cockerham's (1984) F-Statistics. (P), probability value using Fisher`s
method for Hardy-Weinberg departures.
MCQ 29 5 4.909 0.61 0.662 0.0163 0.07 0.069 0.029 -0.009
MCQ 31 6 5.642 0.717 0.741 0.2309 -0.021 -0.023 0.030 -0.004
MCQ 33 4 4.000 0.368 0.424 0.000 0.649 0.662 0.032 -0.010
MCQ 34 8 7.541 0.625 0.680 0.000 0.264 0.271 0.016 0.008
MCQ 36 4 3.642 0.355 0.429 0.2056 0.012 0.013 0.004 -0.003
MCQ 37 4 4.000 0.361 0.376 0.693 0.052 0.054 0.039 0.037
MCQ 39 7 6.634 0.527 0.567 0.8118 -0.035 -0.040 0.012 0.007
MCQ 41 6 5.989 0.651 0.703 0.1518 -0.018 -0.022 0.020 0.018
MCQ 42 8 7.636 0.548 0.560 0.8428 -0.028 -0.030 0.053 -0.003
MCQ 45 8 7.7 0.589 0.630 0.0158 0.025 0.021 0.019 0.001
![Page 164: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/164.jpg)
150
Appendix 3-B
Table3-B: Summary of microsatellite variation in different Ugandan populations of C. quinquefasciatus.
Location
Jinja Kampala Kanungu Tororo
Locus A HE P FIS A HE P FIS A HE P FIS A HE P FIS
MCQ 1 4 0.532 0.000* 0.504 3 0.459 0.002NS 0.415 2 0.347 0.007NS 0.479 4 0.586 0.000* 0.523
MCQ 2 2 0.420 0.717 0.060 3 0.489 0.002NS 0.328 2 0.284 0.052 0.362 2 0.400 0.015NS 0.418
MCQ 3 5 0.537 0.015NS 0.240 6 0.403 0.002NS 0.334 5 0.617 0.000* 0.181 5 0.257 0.545 0.091
MCQ 4 3 0.630 0.647 0.083 3 0.596 0.677 0.020 4 0.635 1.000 -0.036 3 0.589 0.195 0.208
MCQ 5 5 0.655 0.045NS 0.230 6 0.675 0.001* 0.370 5 0.724 0.101 -0.049 5 0.671 0.005NS 0.228
MCQ 8 4 0.679 0.218 0.221 5 0.674 0.132 0.066 4 0.661 0.000* 0.582 4 0.600 0.016NS 0.310
MCQ 9 5 0.716 0.759 0.058 6 0.693 0.046NS 0.190 5 0.661 0.241 -0.061 5 0.728 0.012NS 0.306
MCQ 10 7 0.717 0.000* 0.398 7 0.576 0.134 0.221 7 0.734 0.000* 0.451 8 0.702 0.000* 0.522
MCQ 11 5 0.566 0.614 0.022 5 0.552 0.399 -0.017 6 0.530 0.158 0.093 6 0.502 0.014NS 0.226
MCQ 13 5 0.554 0.398 0.175 5 0.691 0.523 0.123 5 0.719 0.689 0.086 5 0.588 0.241 0.162
MCQ 16 7 0.744 0.457 0.094 6 0.643 0.138 0.127 6 0.706 0.213 0.032 7 0.765 0.176 0.152
MCQ 19 7 0.481 0.890 -0.050 8 0.586 0.003NS 0.119 6 0.660 0.096 -0.230 7 0.616 0.004NS 0.328
MCQ 20 3 0.636 0.513 0.129 3 0.625 0.006 0.355 3 0.566 0.000* 0.499 3 0.626 0.125 0.193
MCQ 21 10 0.461 0.000* 0.414 10 0.741 0.079 0.208 7 0.712 0.023NS 0.163 5 0.474 0.012NS 0.330
![Page 165: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/165.jpg)
151
(A), number of alleles. (HE), expected heterozygosity. (P), probability value using Fisher`s method for Hardy-Weinberg
departures. (FIS), Weir and Cockerham's (1984) inbreeding coefficient.
MCQ 22 5 0.637 0.013NS 0.359 4 0.611 0.424 0.060 9 0.811 0.062 0.095 8 0.790 0.007* 0.294
MCQ 23 4 0.500 0.000* 0.598 4 0.531 0.000* 0.367 3 0.494 0.000* 0.475 3 0.488 0.064 0.329
MCQ 24 6 0.702 0.004NS 0.108 6 0.715 0.445 -0.069 5 0.702 0.445 -0.010 6 0.609 0.357 0.105
MCQ 25 4 0.508 0.001* 0.386 5 0.554 0.055 0.272 3 0.565 0.365 0.200 4 0.521 0.002NS 0.405
MCQ 26 10 0.839 0.465 -0.033 9 0.826 0.236 0.103 9 0.820 0.315 0.168 10 0.789 0.251 0.046
MCQ 28 4 0.635 0.000* 0.658 4 0.639 0.000* 0.488 4 0.605 0.000* 0.698 4 0.491 0.000* 0.531
MCQ 29 4 0.676 0.645 -0.127 4 0.600 0.090 0.158 5 0.637 0.007NS 0.145 4 0.698 0.910 0.060
MCQ 31 5 0.697 0.972 -0.107 5 0.730 0.259 -0.015 6 0.723 0.613 -0.015 5 0.778 0.647 -0.035
MCQ 33 3 0.316 0.000* 0.795 3 0.377 0.001* 0.465 3 0.501 0.000* 0.713 4 0.446 0.000* 0.678
MCQ 34 6 0.708 0.001* 0.409 6 0.588 0.000* 0.271 5 0.662 0.000* 0.115 6 0.708 0.003NS 0.285
MCQ 36 3 0.421 0.860 -0.087 2 0.397 1.000 -0.019 3 0.388 0.747 0.086 4 0.488 0.279 0.096
MCQ 37 4 0.483 0.694 0.102 4 0.451 0.249 -0.097 3 0.145 1.000 -0.048 3 0.406 0.631 0.106
MCQ 39 6 0.556 0.245 0.090 5 0.485 1.000 -0.067 5 0.601 0.724 -0.096 7 0.601 0.763 -0.081
MCQ 41 5 0.677 0.707 -0.068 5 0.668 0.288 0.024 4 0.743 0.094 -0.057 4 0.690 0.914 -0.016
MCQ 42 6 0.535 0.869 -0.036 8 0.534 0.558 -0.053 4 0.407 0.676 -0.059 6 0.738 0.655 -0.127
MCQ 45 6 0.658 0.003NS -0.062 7 0.500 0.181 0.056 5 0.682 0.321 0.110 7 0.649 0.006NS -0.041
![Page 166: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/166.jpg)
152
Appendix3-C
Figure 3-C: delta K results for the optimal value of K for structure analysis. Mean
posterior probabilities of twenty runs for each K, K = 1 to K = 7
![Page 167: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/167.jpg)
153
Appendix 3-D
Figure 3-D: Ace-1 target-site mutation (G119S) genotyping in C. quinquefasciatus. A)
Scheme of the TaqMan probes for 119S allelic discrimination. Susceptible allele-specific
probe labelled with HEX and resistant allele-specific probe labelled with 6-FAM. B) Allelic
discrimination for the 119 codon position. X-axis designates the susceptible allele and the y-
axis designates the resistant allele. Blue dots indicate individuals homozygous for the wild-
type and orange squares indicates individuals heterozygous for the mutation.
-926.9373.07
1073.072073.073073.074073.075073.076073.077073.078073.079073.07
10073.0711073.0712073.0713073.0714073.0715073.0716073.0717073.0718073.07
-246.73 753.27 1753.27 2753.27 3753.27 4753.27
AG
C a
llele
dR
Las
t fo
r FA
M
GGC alleledR Last for HEX
Ace-1 genotyping
AGC / GGC
AGC / GGC
B
![Page 168: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/168.jpg)
154
Appendix 4-A
Construction of the Vgsc-Pka plasmid standard for qPCR absolute quantification
PCR conditions
The plasmid used as standard DNA for construction of the standard curve for qPCR
absolute quantification was developed by the fusion of partial fragments of the Vgsc and Pka
gene including the PCR and probe region of the Vgsc-CN assay. The fusion PCR reaction
was carried out on two steps. The first round was conducted in a final volume of 50 µl
reaction including: approx 40 ng of gDNA, 1 X of 5X phusion HF buffer, 200 µM of each
dNTP, 0.4 µM of each primer (Cx:Vgsc-Pka-P1: 5`-GCAAAGGATATAACAAAGCAGT-
3` and Cx: Vgsc-Pka -P2: 5`-AAACCATCTATGCCCTTTGATCTAAGTAGATCCTTTA
GTTCTGAC-3`) and 0.02 U/µl of Phusion DNA polymerase. On the second step, was used
the same condition of the first with the first PCR product diluted 1:10 as template and the
external primers (Cx: Vgsc-Pka-P3: 5`-TCAAAGGGCATAGATGGTTTACAACGTGGA
CCGCTTC-3`and Cx: Vgsc-Pka-P4: 5`-TGCAGTCCCACATGGATTC-3`). Both steps
were amplified with the following conditions: 98 °C for 30 sec, 25 cycles of 98 °C for 10
sec, 57 °C for 30 sec and 72 °C for 15 sec, with a final extension of 72 °C for 5 min. Lastly,
the plasmid containing the Vgsc-Pka fragment of 488 bp (Figure 4A) was linearized with the
Alu I restrict enzyme follow by purification of the digested product extracted from a 2%
agarose gel.
![Page 169: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/169.jpg)
155
Figure 4-A: Partial sequence of the Vgsc-Pka plasmid, which correspond to the linked
partial fragments of the Vgsc and Pka gene obtained by fusion PCR
5`CTATGTGGAACTCCAGAATATTTGGCACCAGAAATAATTTTAAGCAAAG
GATATAACAAAGCAGTTGACTGGTGGGCATTAGGTGTTCTTGTGTACGAGA
TGGCAGCCGGATATCCACCTTTTTTTGCTGATCAGCCAATACAAATTTATGA
AAAAATTGTTTCAGGAAAGGTACGATTTCCATCTCATTTCGGGTCAGAACTA
AAGGATCTACTTAGAAATCTTCTACAAGTTGATTTAACAAAACGTTACGGA
AATCTAAAAGCAGGAGTTAACGACATCAAAGGGCATAGATGGTTTACAACG
TGGACCGCTTCCCGGACAAGGACCTGCCACGGTGGAACTTCACCGACTTCA
TGCACTCATTCATGATCGTGTTCCGGGTGCTGTGCGGCGAGTGGATCGAATC
CATGTGGGACTGCATGCTGGTGGGCGACGTGTCCTGCATTCCGTTCTTCTTG
GCCACCGTAGTGATAGGAAATTTAGTC-3’
![Page 170: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/170.jpg)
156
Appendix 4-B
Figure 4-B: Optimization of annealing temperature and concentration of gDNA for
application of the Vgsc-CN assay on ddPCR analysis. A) Thermal gradient to identify
appropriated fluorescent droplet amplitudes for the Vgsc (blue dots, FAM channel) and Pka
(green dots, VIC channel) genes. B) Two-fold Vgsc-Pka plasmid dilution to identify DNA
concentration to precise CN quantification. Dilution 1 to 4, correspond to concentration
ranging from 17 x 103 copies/µl to 2x103 copies/µl.
![Page 171: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/171.jpg)
157
Appendix 4-C
RQPS Reference-query probe design and construction
The RQ-probe design for C. quinquefasciatus Vgsc CNV analysis was constructed
by the fusion of a partial fragment of the exon 1 of the Pka gene (reference gene with single
copy in Culex genome) and of the exon 20 of the Vgsc gene to a fragment of 386 bp of the
actin gene (CPIJ012573) used as stuffer DNA (A fragment of any gene used to linked the
fragments of both genes of interest) (Figure 4C-1). On the selected fragment of each gene
was introduced a SNP that differ the RQ-probe allele construction from the gDNA allele as
shown in (Figure 4C-1).
The RQ plasmid construction was executed in two rounds of PCR. The first step was
conducted in 50 µl reaction which contained: approx 40 ng of genomic DNA, 1 X of 5X
phusion HF buffer, 200 µM of each dNTP, 0.4 µM of each primer Cx.ref-FI and Cx.quer-RI
(Table 1- 4C) and 0.02 U/µl of Phusion DNA polymerase. The reaction conditions were 98
°C for 30 sec, 25 cycles of 98 °C for 10 sec, 58 °C for 30 sec and 72 °C for 15 sec, with a
final extension of 72 °C for 5 min. The second reaction of the fusion PCR was carried out
using the same concentration and condition of the first, with the exception for the genomic
DNA and primers, which were replaced by the product of the first reaction diluted 1:10 and
the primers Cx.ref-FII and Cx.quer-RII (Table 4C-1).
The PCR product yield on the second round of the fusion PCR was loud on 2%
agarose gel, and then the 551 bp of the fused fragment (Figure 4C-2) was extracted and
purified followed by cloning in the pJet 1.2 PCR vector (Thermo Scientific). Finally, after
the plasmid has been purified and sequenced to confirm the correct insertion of the chemeric
QR-probe in the vector, it was linearized with the Alu I restrict enzyme.
![Page 172: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/172.jpg)
158
Table 4C-1: Primer for RQ plasmid construction by fusion PCR.
Primer Sequence 5`-3`
Fusion PCR Step I
Cx.ref-FI
GATGCCGCAGAAAGTGTAAAACAATTCCTGGATCAAGCTAAAG
AAGATTTGGTATCCTCACCCTGAAGT
Cx.quer-RI AGGTCACGTCGCCCACCAGCATGCAGTCCCACATGGATTCGATC
TCATCAGGTAGTCGGTCAGAT
Fusion PCR Step II
Cx.ref-FII
ATGGGAAACAACGCAACTTCAACAAATAAAAAAGTAGATGCCG
CAGAAAGTGTAAAACA
Cx.quer-RII GAATTCTTCCTATCACTACGGTGGCCAAGAAGAACGGAATGCAG
GtCACGTCGCCCACCAG
A)
5`ATGGGAAACAACGCAACTTCAACAAATAAAAAAGTAGATGCCGCAGAAAGTGTAA
AASAATTCCTGGATCAAGCTAAAGAAGATT3`
B)
5`GATCGAATCCATGTGGGACTGCATGCTGGTGGGCGACGTGWCCTGCATTCCGTTCT
TCTTGGCCACCGTAGTGATAGGAA3`
C)
5`TGGTATCCTCACCCTGAAGTACCCGATCGAGCACGGTATCATCACCAACTGGGATG
ATATGGAGAAGATCTGGCATCACACCTTCTACAATGAGCTGCGTGTTGCCCCAGAGGA
GCACCCAGTCCTGCTGACTGAGGCCCCCCTGAACCCCAAGGCTAACCGCGAGAAGATG
ACTCAGATCATGTTTGAGACCTTCAACTCGCCAGCCATGTATGTTGCCATCCAGGCTGT
CCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTGGATTCCGGAGATGGTG
TCTCTCACACCGTCCCAATCTATGAAGGTTATGCTCTGCCCCATGCCATCCTCCGTCTG
GATCTGGCTGGTCGCGATCTGACCGACTACCTGATGA3`
Figure 4C-1: Sequences of genomic DNA used for construction of the RQPS probe. A and
B) partial fragment of the PkaKA and Vgsc gene, respectively with bold and underlined
bases correspond to a SNP introduced to differ RQ-alleles from gDNA sequence. C) Partial
fragment of the Actin gene (CPIJ012573) used as stuffer region. S; GC. W, TA.
![Page 173: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/173.jpg)
159
A) 5`ATGGGAAACAACGCAACTTCAACAAATAAAAAAGTAGATGCCGCAGAAAGTGTAAAACAAT
TCCTGGATCAAGCTAAAGAAGATTTGGTATCCTCACCCTGAAGTACCCGATCGAGCACGGTATCAT
CACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAATGAGCTGCGTGTTGCCCCAG
AGGAGCACCCAGTCCTGCTGACTGAGGCCCCCCTGAACCCCAAGGCTAACCGCGAGAAGATGACTCA
GATCATGTTTGAGACCTTCAACTCGCCAGCCATGTATGTTGCCATCCAGGCTGTCCTGTCCCTGTACG
CTTCCGGTCGTACCACCGGTATCGTTCTGGATTCCGGAGATGGTGTCTCTCACACCGTCCCAATCTAT
GAAGGTTATGCTCTGCCCCATGCCATCCTCCGTCTGGATCTGGCTGGTCGCGATCTGACCGACTACCT
GATGAGATCGAATCCATGTGGGACTGCATGCTGGTGGGCGACGTGACCTGCATTCCGTTCTTCTT
GGCCACCGTAGTGATAGGAA3`
B)
5`ATGGGAAACAACGCAACTTCAACAAATAAAAAAGTAGATGCCGCAGAAAGTGTAAAASAATTC
CTGGATCAAGCTAAAGAAGATTTGGTATCCTCACCCTGAAGTACCCGATCGAGCACGGTATCATCA
CCAACTGGGATGATATGGAGAAGATCTGGCACCACACCTTCTACAAYGAGCTGCGTGTKGCCCCRG
AGGAGCACCCAGTCCTGCTGACTGAGGCCCCCCTSAACCCSAAGGCTAACCGCGAGAAGATGACTC
AGATCATGTTTGAGACCTTCAACTCGCCRGCCATGTAYGTCGCCATCCAGGCTGTCCTGTCCCTGT
ACGCTTCCGGTCGTACCACCGGTATCGTTCTGGATTCCGGAGATGGTGTCTCTCACACCGTCCCAA
TCTATGAAGGTTATGCYCTGCCCCATGCCATCCTCCGTCTGGATCTGGCTGGTCGCGATCTGACCG
ACTACCTGATGAGATCGAATCCATGTGGGACTGCATGCTGGTGGGCGACGTGWCCTGCATTCCGTT
CTTCTTGGCCACCGTAGTGATAGGAA-3`
Figure 4C-2: Fusion PCR and pyrosequencing primer locations on the RQ-plasmid. A)
Position of both primer sets used on the fusion PCR. Sequences in red and blue font colour
correspond to partial sequences of the Vgsc and Pka, respectively. Sequence in Black
correspond to the partial fragment of the action gene used to link both Vgsc and Pka B)
Sequence of the RQ-plasmid probe showing the location of the SNP introduced in both Vgsc
(S; G to C) and Pka (W, T to A) and PCR and sequencing primers annealing positions used
for the RQPS method.
Vgsc- Forward Vgsc- Reverse Nav-sequencing primer
Forward
Pka- Forward
Pka -Reverse Pka-Sequencing primer
Forward
Step 1
Step 1
Step 2
Step 2
![Page 174: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/174.jpg)
160
Appendix 4-D
Figure 4-D: Primer and probe validation. A) Primer set titration to identify concentration
with similar pattern of amplification based on SYBR-GREEN detection. B) Probe titration
to identify early and constant Ct values.
0
5
10
15
20
25
30
35
40
200 nM 250nM 300nM 350nM 400nM
Ct
primer concentration
Vgsc
Pka
23
24
25
26
27
28
29
30
50 nM 100 nM 150 nM 200 nM 250 nM
Ct
probe concentration
Vgsc
Pka
A
B
![Page 175: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/175.jpg)
161
Appendix 4-E
Figure 4-E: Re-genotyping of likely qPCR CN outliers. Dots and lozenge correspond to
samples genotyped by qPCR-Ct and qPCR-Std, respectively.
0
1
2
3
4
5
6
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33
Cal
cula
ted
CN
Sample
re-genotyping CNV outlier
![Page 176: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/176.jpg)
162
Appendix 5-A
Figure 5-A: Transcriptomic profile of differentially expressed genes with fold-change >2 in
Uganda exposed and sympatric mosquitoes compared to TPRI. GO term enrichment
correspond to Down-regulated transcripts between the groups with frequency higher than
2%.
0.00% 2.00% 4.00% 6.00% 8.00%10.00%12.00%14.00%16.00%
proton transport
tRNA processing
rRNA modification
myosin complex
collagen trimer
troponin complex
protein binding
zinc ion binding
serine-type endopeptidase activity
calcium ion binding
structural constituent of cuticle
N-acetyltransferase activity
carboxypeptidase activity
metallocarboxypeptidase activity
malate dehydrogenase (decarboxylating) (NAD+)…
transferase activity, transferring acyl groups, acyl…
Sympatric Control Vs TPRI Uganda expoded Vs TPRI
![Page 177: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/177.jpg)
163
Appendix 5-B
Figure 5-B: Validation of qPCR primers. Dissociation curves of real-time PCR
amplification of microarray top candidate genes and endogenous control.
![Page 178: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/178.jpg)
164
References
Abreu, A. G., A. Albaina, T. J. Alpermann, V. E. Apkenas, S. Bankhead-Dronnet, S. Bergek, M. L. Berumen, C.-H. Cho, J. Clobert, A. Coulon, D. De Feraudy, A. Estonba, T. Hankeln, A. Hochkirch, T.-W. Hsu, T.-J. Huang, X. Irigoien, M. Iriondo, K. M. Kay, T. Kinitz, L. Kothera, M. Le Henanff, F. Lieutier, O. Lourdais, C. M. T. Macrini, C. Manzano, C. Martin, V. R. F. Morris, G. Nanninga, M. A. Pardo, J. Plieske, S. Pointeau, T. Prestegaard, M. Quack, M. Richard, H. M. Savage, K. D. Schwarcz, J. Shade, E. L. Simms, V. N. Solferini, V. M. Stevens, M. Veith, M.-J. Wen, F. Wicker, J. M. Yost, I. Zarraonaindia, and C. Mol Ecology Resources Primer Dev. 2012. Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011-30 November 2011. Molecular Ecology Resources 12: 374-376.
Addiss, D., and L. Global Alliance Eliminate. 2010. The 6(th) meeting of the global alliance to eliminate lymphatic filariasis: A half-time review of lymphatic filariasis elimination and its integration with the control of other neglected tropical diseases. Parasites & Vectors 3:100.
Alatoom, A., and D. Payne. 2009. An Overview of arboviruses and bunyaviruses. Labmedicine 40: 237-240.
Alkan, C., B. P. Coe, and E. E. Eichler. 2011. Application of next-generation sequencing: Genome structural variation discovery and genotyping. Nature Reviews Genetics 12: 363-375.
Alout, H., and M. Weill. 2008. Amino-acid substitutions in acetylcholinesterase 1 involved in insecticide resistance in mosquitoes. Chemico-biological interactions 175: 138-141.
Alout, H., A. Berthomieu, A. Hadjivassilis, and M. Weill. 2007a. A new amino-acid substitution in acetylcholinesterase 1 confers insecticide resistance to Culex pipiens mosquitoes from Cyprus. Insect Biochemistry and Molecular Biology 37: 41-47.
Alout, H., P. Labbe, N. Pasteur, and M. Weill. 2011. High incidence of ace-1 duplicated haplotypes in resistant Culex pipiens mosquitoes from Algeria. Insect Biochemistry and Molecular Biology 41: 29-35.
Alout, H., P. Labbé, A. Berthomieu, N. Pasteur, and M. Weill. 2009. Multiple duplications of the rare ace-1 mutation F290V in Culex pipiens natural populations. Insect biochemistry and molecular biology 39: 884-891.
Alout, H., A. Berthomieu, F. Cui, Y. Tan, C. Berticat, C. Qiao, and M. Weill. 2007b. Different amino-acid substitutions confer insecticide resistance through acetyleholinesterase 1 insensitivity in Culex vishnui and Culex tritaeniorhynchus (Diptera : Culicidae) from China. Journal of Medical Entomology 44: 463-469.
Ambrose, L., R. D. Cooper, T. L. Russell, T. R. Burkot, N. F. Lobo, F. H. Collins, J. Hii, and N. W. Beebe. 2014. Microsatellite and mitochondrial markers reveal strong gene flow barriers for Anopheles farauti in the Solomon Archipelago: implications for malaria vector control. International Journal for Parasitology 44: 225-233.
Aravindan, V., S. Muthukumaravel, and K. Gunasekaran. 2014. Interaction affinity of Delta and Epsilon class glutathione-s-transferases (GSTs) to bind with DDT for detoxification and conferring resistance in Anopheles gambiae, a malaria vector. Journal of vector borne diseases 51: 8.
Arensburger, P., K. Megy, R. M. Waterhouse, J. Abrudan, P. Amedeo, B. Antelo, L. Bartholomay, S. Bidwell, E. Caler, F. Camara, C. L. Campbell, K. S. Campbell, C. Casola, M. T. Castro, I. Chandramouliswaran, S. B. Chapman, S. Christley, J. Costas, E. Eisenstadt, C. Feschotte, C. Fraser-Liggett, R. Guigo, B. Haas, M. Hammond, B. S. Hansson, J. Hemingway, S. R. Hill, C. Howarth, R. Ignell, R. C. Kennedy, C. D. Kodira, N. F. Lobo, C. Mao, G. Mayhew, K. Michel, A. Mori, N. Liu, H. Naveira, V. Nene, N. Nguyen, M. D. Pearson, E. J. Pritham, D. Puiu, Y. Qi, H. Ranson, J. M. C. Ribeiro, H. M. Roberston, D. W. Severson, M. Shumway, M. Stanke, R. L. Strausberg, C. Sun, G. Sutton, Z. Tu, J. M. C. Tubio, M. F. Unger, D. L. Vanlandingham, A. J. Vilella, O. White, J. R. White, C. S. Wondji, J. Wortman, E. M. Zdobnov, B. Birren, B. M. Christensen, F. H. Collins, A. Cornel, G. Dimopoulos, L. I. Hannick, S. Higgs, G. C.
![Page 179: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/179.jpg)
165
Lanzaro, D. Lawson, N. H. Lee, M. A. T. Muskavitch, A. S. Raikhel, and P. W. Atkinson. 2010. Sequencing of Culex quinquefasciatus Establishes a Platform for Mosquito Comparative Genomics. Science 330: 86-88.
Babu, B., K. Rath, A. Kerketta, B. Swain, S. Mishra, and S. Kar. 2006. Adverse reactions following mass drug administration during the Programme to Eliminate Lymphatic Filariasis in Orissa State, India. Transactions of the Royal Society of Tropical Medicine and Hygiene 100: 464-469.
Barbosa, S., and I. M. Hastings. 2012. The importance of modelling the spread of insecticide resistance in a heterogeneous environment: the example of adding synergists to bed nets. Malaria journal 11: 258-258.
Bardosh, K., C. Waiswa, and S. C. Welburn. 2013. Conflict of interest: use of pyrethroids and amidines against tsetse and ticks in zoonotic sleeping sickness endemic areas of Uganda. Parasites & Vectors 6:204.
Bass, C., and L. M. Field. 2011. Gene amplification and insecticide resistance. Pest Management Science 67: 886-890.
Bass, C., I. Schroeder, A. Turberg, L. M. Field, and M. S. Williamson. 2004. Identification of mutations associated with pyrethroid resistance in the para-type sodium channel of the cat flea, Ctenocephalides felis. Insect Biochemistry and Molecular Biology 34: 1305-1313.
Bataille, A., A. A. Cunningham, V. Cedeno, M. Cruz, G. Eastwood, D. M. Fonseca, C. E. Causton, R. Azuero, J. Loayza, J. D. Cruz Martinez, and S. J. Goodman. 2009. Evidence for regular ongoing introductions of mosquito disease vectors into the Galapagos Islands. Proceedings of the Royal Society B-Biological Sciences 276: 3769-3775.
Batallán, G. P., E. L. Estallo, F. S. Flores, P. Sartor, M. S. Contigiani, and W. R. Almirón. 2015. St. Louis Encephalitis virus mosquito vectors dynamics in three different environments in relation to remotely sensed environmental conditions. Acta tropica 146: 53-59.
Becker, N., D. Petrić, C. Boase, J. Lane, M. Zgomba, C. Dahl, and A. Kaiser. 2010. Mosquitoes and their control, vol. 2, Springer.
Behura, S. K., N. F. Lobo, B. Haas, B. deBruyn, D. D. Lovin, M. F. Shumway, D. Puiu, J. Romero-Severson, V. Nene, and D. W. Severson. 2011. Complete sequences of mitochondria genomes of Aedes aegypti and Culex quinquefasciatus and comparative analysis of mitochondrial DNA fragments inserted in the nuclear genomes. Insect Biochemistry and Molecular Biology 41: 770-777.
Bellini, R., H. Zeller, and W. Van Bortel. 2014. A review of the vector management methods to prevent and control outbreaks of West Nile virus infection and the challenge for Europe. Parasites Vectors 7: 323.
Bergthorsson, U., D. I. Andersson, and J. R. Roth. 2007. Ohno's dilemma: Evolution of new genes under continuous selection. Proceedings of the National Academy of Sciences of the United States of America 104: 17004-17009.
Berticat, C., G. Boquien, M. Raymond, and C. Chevillon. 2002. Insecticide resistance genes induce a mating competition cost in Culex pipiens mosquitoes. Genetical Research 79: 41-47.
Berticat, C., J. Bonnet, S. Duchon, P. Agnew, M. Weill, and V. Corbel. 2008. Costs and benefits of multiple resistance to insecticides for Culex quinquefasciatus mosquitoes. Bmc Evolutionary Biology 8.
Bhullar, N., and J. Maikere. 2010. Challenges in mass drug administration for treating lymphatic filariasis in Papua, Indonesia. Parasites & Vectors 3:70.
Bingham, G., C. Strode, L. Tran, P. T. Khoa, and H. P. Jamet. 2011. Can piperonyl butoxide enhance the efficacy of pyrethroids against pyrethroid‐resistant Aedes aegypti? Tropical Medicine & International Health 16: 492-500.
Bockarie, M. J., E. M. Pedersen, G. B. White, and E. Michael. 2009. Role of Vector Control in the Global Program to Eliminate Lymphatic Filariasis, pp. 469-487, Annual Review of Entomology, vol. 54.
![Page 180: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/180.jpg)
166
Bonizzoni, M., Y. Afrane, W. A. Dunn, F. K. Atieli, G. Zhou, D. Zhong, J. Li, A. Githeko, and G. Yan. 2012. Comparative Transcriptome analyses of deltamethrin-resistant and - susceptible Anopheles gambiae Mosquitoes from Kenya by RNA-Seq. Plos One 7.
Bourguet, D., T. Guillemaud, C. Chevillon, and M. Raymond. 2004. Fitness costs of insecticide resistance in natural breeding sites of the mosquito Culex pipiens. Evolution 58: 128-135.
Bourguet, D., D. Fournier, J. P. Toutant, and M. Arpagaus. 2013. The mosquito Culex pipiens Structure and Function of Cholinesterases and Related Proteins: 483.
Bourguet, D., M. Raymond, J. Bisset, N. Pasteur, and M. Arpagaus. 1996a. Duplication of the Ace-1 locus in Culex pipiens mosquitoes from the Caribbean. Biochemical Genetics 34: 351-362.
Bourguet, D., M. Raymond, D. Fournier, C. A. Malcolm, J. P. Toutant, and M. Arpagaus. 1996b. Existence of two acetylcholinesterases in the mosquito Culex pipiens (Diptera: Culicidae). Journal of Neurochemistry 67: 2115-2123.
Bourguet, D., T. Lenormand, T. Guillemaud, V. Marcel, D. Fournier, and M. Raymond. 1997. Variation of dominance of newly arisen adaptive genes. Genetics 147: 1225-1234.
Bowman, D. D. 2014. Georgis' parasitology for veterinarians, Elsevier Health Sciences. Bukirwa, H., V. Yau, R. Kigozi, S. Filler, L. Quick, M. Lugemwa, G. Dissanayake, M. Kamya, F.
Wabwire-Mangen, and G. Dorsey. 2009. Assessing the impact of indoor residual spraying on malaria morbidity using a sentinel site surveillance system in Western Uganda. The American journal of tropical medicine and hygiene 81: 611-614.
Buss, D. S., and A. Callaghan. 2004. Molecular comparisons of the Culex pipiens (L.) complex esterase gene amplicons. Insect Biochemistry and Molecular Biology 34: 433-441.
Bustin, S. A., V. Benes, J. A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, T. Nolan, M. W. Pfaffl, G. L. Shipley, J. Vandesompele, and C. T. Wittwer. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical Chemistry 55: 611-622.
Campbell, P. M., R. D. Newcomb, R. J. Russell, and J. G. Oakeshott. 1998. Two different amino acid substitutions in the ali-esterase, E3, confer alternative types of organophosphorus insecticide resistance in the sheep blowfly, Lucilia cuprina. Insect Biochemistry and Molecular Biology 28: 139-150.
Carlsson, J. 2008. Effects of Microsatellite Null Alleles on Assignment Testing. Journal of Heredity 99: 616-623.
Carney, R. M., S. Husted, C. Jean, C. Glaser, and V. Kramer. 2008. Efficacy of aerial spraying of mosquito adulticide in reducing incidence of West Nile virus, California, 2005. Emerging Infectious Diseases 14: 747-754.
Cartaxo, M. F. S., C. F. J. Ayres, and D. Weetman. 2011. Loss of genetic diversity in Culex quinquefasciatus targeted by a lymphatic filariasis vector control program in Recife, Brazil. Transactions of the Royal Society of Tropical Medicine and Hygiene 105: 491-499.
Carvalho, R., Y. Yang, L. M. Field, K. Gorman, G. Moores, M. S. Williamson, and C. Bass. 2012. Chlorpyrifos resistance is associated with mutation and amplification of the acetylcholinesterase-1 gene in the tomato red spider mite, Tetranychus evansi. Pesticide Biochemistry and Physiology 104: 143-149.
Casida, J. E., and K. A. Durkin. 2013. Neuroactive Insecticides: Targets, Selectivity, Resistance, and Secondary Effects. Annual Review of Entomology, Vol 58 58: 99-117.
Chandor-Proust, A., J. Bibby, M. Regent-Kloeckner, J. Roux, E. Guittard-Crilat, R. Poupardin, M. A. Riaz, M. Paine, C. Dauphin-Villemant, S. Reynaud, and J.-P. David. 2013. The central role of mosquito cytochrome P450 CYP6Zs in insecticide detoxification revealed by functional expression and structural modelling. Biochemical Journal 455: 75-85.
Chandre, F., F. Darriet, J. M. C. Doannio, F. Riviere, N. Pasteur, and P. Guillet. 1997. Distribution of organophosphate and carbamate resistance in Culex pipiens quinquefasciatus (Diptera : Culicidae) in West Africa. Journal of Medical Entomology 34: 664-671.
Chandy, A., A. S. Thakur, M. P. Singh, and A. Manigauha. 2011. A review of neglected tropical diseases: filariasis. Asian Pacific Journal of Tropical Medicine 4: 581-586.
![Page 181: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/181.jpg)
167
Chareonviriyaphap, T., M. J. Bangs, W. Suwonkerd, M. Kongmee, V. Corbel, and R. Ngoen-Klan. 2013. Review of insecticide resistance and behavioral avoidance of vectors of human diseases in Thailand. Parasit Vectors 6: 1-28.
Chen, L., D. Zhong, D. Zhang, L. Shi, G. Zhou, M. Gong, H. Zhou, Y. Sun, L. Ma, J. He, S. Hong, D. Zhou, C. Xiong, C. Chen, P. Zou, C. Zhu, and G. Yan. 2010. Molecular Ecology of Pyrethroid Knockdown Resistance in Culex pipiens pallens Mosquitoes. Plos One 5.
Chiu, T.-L., Z. Wen, S. G. Rupasinghe, and M. A. Schuler. 2008. Comparative molecular modeling of Anopheles gambiae CYP6Z1, a mosquito P450 capable of metabolizing DDT. Proceedings of the National Academy of Sciences of the United States of America 105: 8855-8860.
Claudianos, C., R. J. Russell, and J. G. Oakeshott. 1999. The same amino acid substitution in orthologous esterases confers organophosphate resistance on the house fly and a blowfly. Insect Biochemistry and Molecular Biology 29: 675-686.
Claudianos, C., H. Ranson, R. M. Johnson, S. Biswas, M. A. Schuler, M. R. Berenbaum, R. Feyereisen, and J. G. Oakeshott. 2006. A deficit of detoxification enzymes: pesticide sensitivity and environmental response in the honeybee. Insect Molecular Biology 15: 615-636.
Clement, M., D. Posada, and K. A. Crandall. 2000. TCS: a computer program to estimate gene genealogies. Molecular Ecology 9: 1657-1659.
Coats, J. R. 2012. Insecticide mode of action, Academic Press. Coleman, M., and J. Hemingway. 1997. Amplification of a xanthine dehydrogenase gene is
associated with insecticide resistance in the common house mosquito Culex quinquefasciatus. Biochemical Society Transactions 25: 526S-526S.
Corbel, V., R. N'Guessan, C. Brengues, F. Chandre, L. Djogbenou, T. Martin, A. Akogbeto, J. M. Hougard, and M. Rowland. 2007. Multiple insecticide resistance mechanisms in Anopheles gambiae and Culex quinquefasciatus from Benin, West Africa. Acta Tropica 101: 207-216.
Cornel, A., Y. Lee, R. T. Fryxell, S. Siefert, C. Nieman, and G. Lanzaro. 2012. Culex pipiens sensu lato in California: a complex within a complex? Journal of the American Mosquito Control Association 28: 113-121.
Cousin, X., U. Strähle, and A. Chatonnet. 2005. Are there non‐catalytic functions of acetylcholinesterases? Lessons from mutant animal models. Bioessays 27: 189-200.
Cyrino Zequi, J. A., F. P. Dos Santos, and J. Lopes. 2014. Control of Culex quinquefasciatus and Cx. saltanensis (Diptera: Culicidae) with Bacillus thuringiensis israelensis in wastewater treatment lagoons. Revista Colombiana de Entomología 40: 98-103.
David, J.-P., H. M. Ismail, A. Chandor-Proust, and M. J. I. Paine. 2013. Role of cytochrome P450s in insecticide resistance: impact on the control of mosquito-borne diseases and use of insecticides on Earth. Philosophical Transactions of the Royal Society B: Biological Sciences 368.
David, J.-P., C. Strode, J. Vontas, D. Nikou, A. Vaughan, P. M. Pignatelli, C. Louis, J. Hemingway, and H. Ranson. 2005. The Anopheles gambiae detoxification chip: a highly specific microarray to study metabolic-based insecticide resistance in malaria vectors. Proceedings of the National Academy of Sciences of the United States of America 102: 4080-4084.
de Souza, D. K., B. Koudou, L. A. Kelly-Hope, M. D. Wilson, M. J. Bockarie, and D. A. Boakye. 2012. Diversity and transmission competence in lymphatic filariasis vectors in West Africa, and the implications for accelerated elimination of Anopheles-transmitted filariasis. Parasites & Vectors 5.
DeSilva, D., J. Hemingway, H. Ranson, and A. Vaughan. 1997. Resistance to insecticides in insect vectors of disease: estα3, a novel amplified esterase associated with amplifiedestβ1from insecticide resistant strains of the mosquito Culex quinquesfasciatus. Experimental parasitology 87: 253-259.
Diaz-Badillo, A., B. G. Bolling, G. Perez-Ramirez, C. G. Moore, J. P. Martinez-Munoz, A. A. Padilla-Viveros, M. Camacho-Nuez, A. Diaz-Perez, B. J. Beaty, and M. de Lourdes Munoz. 2011.
![Page 182: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/182.jpg)
168
The distribution of potential West Nile virus vectors, Culex pipiens pipiens and Culex pipiens quinquefasciatus (Diptera: Culicidae), in Mexico City. Parasites & Vectors 4:70.
Djogbenou, L., F. Chandre, A. Berthomieu, R. Dabire, A. Koffi, H. Alout, and M. Weill. 2008. Evidence of Introgression of the ace-1(R) Mutation and of the ace-1 Duplication in West African Anopheles gambiae s. s. Plos One 3.
Djogbénou, L., P. Labbé, F. Chandre, N. Pasteur, and M. Weill. 2009. Ace-1 duplication in Anopheles gambiae: a challenge for malaria control. Malaria journal 8: 70.
Djouaka, R. F., A. A. Bakare, O. N. Coulibaly, M. C. Akogbeto, H. Ranson, J. Hemingway, and C. Strode. 2008. Expression of the cytochrome P450s, CYP6P3 and CYP6M2 are significantly elevated in multiple pyrethroid resistant populations of Anopheles gambiae s.s. from Southern Benin and Nigeria. Bmc Genomics 9.
Dobes, C., and S. Scheffknecht. 2012. Isolation and characterization of microsatellite loci for the Potentilla core group (Rosaceae) using 454 sequencing. Molecular Ecology Resources 12: 726-739.
Donnelly, M. J., V. Corbel, D. Weetman, C. S. Wilding, M. S. Williamson, and W. C. Black Iv. 2009. Does kdr genotype predict insecticide-resistance phenotype in mosquitoes? Trends in parasitology 25: 213-219.
Du, W., T. S. Awolola, P. Howell, L. L. Koekemoer, B. D. Brooke, M. Q. Benedict, M. Coetzee, and L. Zheng. 2005. Independent mutations in the Rdl locus confer dieldrin resistance to Anopheles gambiae and An. arabiensis. Insect Molecular Biology 14: 179-183.
Duron, O., P. Labbé, C. Berticat, F. Rousset, S. Guillot, M. Raymond, M. Weill, and D. Promislow. 2006. High Wolbachia density correlates with cost of infection for insecticide resistant Culex pipiens mosquitoes. Evolution 60: 303-314.
Dylo, P., C. Martin, and C. Mhango. 2014. Efficacy of Bacillus thuringiensis var israelinsis (Bti) on Culex and Anopheline mosquito larvae in Zomba. Malawi Journal of Science and Technology 10: 40-52.
Edi, C. V., L. Djogbenou, A. M. Jenkins, K. Regna, M. A. T. Muskavitch, R. Poupardin, C. M. Jones, J. Essandoh, G. K. Ketoh, M. J. I. Paine, B. G. Koudou, M. J. Donnelly, H. Ranson, and D. Weetman. 2014. CYP6 P450 enzymes and ACE-1 duplication produce extreme and multiple insecticide resistance in the malaria mosquito Anopheles gambiae. Plos Genetics 10.
Edi, C. V. A., B. G. Koudou, C. M. Jones, D. Weetman, and H. Ranson. 2012. Multiple-insecticide resistance in Anopheles gambiae mosquitoes, Southern Cote d'Ivoire. Emerging Infectious Diseases 18: 1508-1511.
Edillo, F., A. Kiszewski, J. Manjourides, M. Pagano, M. Hutchinson, A. Kyle, J. Arias, D. Gaines, R. Lampman, R. Novak, I. Foppa, C. Lubelcyzk, R. Smith, A. Moncayo, A. Spielman, and G. Culex Pipiens Working. 2009. Effects of latitude and longitude on the population structure of Culex pipiens s.l., vectors of West Nile Virus in North America. American Journal of Tropical Medicine and Hygiene 81: 842-848.
Enayati, A. A., H. Ranson, and J. Hemingway. 2005. Insect glutathione transferases and insecticide resistance. Insect Molecular Biology 14: 3-8.
Endersby, N. M., P. M. Ridland, and A. A. Hoffmann. 2008. The effects of local selection versus dispersal on insecticide resistance patterns: longitudinal evidence from diamondback moth (Plutella xylostella (Lepidoptera : Plutellidae)) in Australia evolving resistance to pyrethroids. Bulletin of Entomological Research 98: 145-157.
Erlanger, T. E., S. Weiss, J. Keiser, J. Utzinger, and K. Wiedenmayer. 2009. Past, Present, and Future of Japanese Encephalitis. Emerging Infectious Diseases 15: 1-7.
Eusemann, P., S. Fehrenz, and M. Schnittler. 2009. Development of two microsatellite multiplex PCR systems for high throughput genotyping in Populus euphratica. Journal of Forestry Research (Harbin) 20: 195-198.
Excoffier, L., G. Laval, and S. Schneider. 2005. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evolutionary bioinformatics online 1: 47.
![Page 183: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/183.jpg)
169
Excoffier, L., T. Hofer, and M. Foll. 2009. Detecting loci under selection in a hierarchically structured population. Heredity 103: 285-298.
Farajollahi, A., D. M. Fonseca, L. D. Kramer, and A. M. Kilpatrick. 2011. "Bird biting" mosquitoes and human disease: A review of the role of Culex pipiens complex mosquitoes in epidemiology. Infection Genetics and Evolution 11: 1577-1585.
Fathian, M., H. Vatandoost, S. H. Moosa-Kazemi, A. Raeisi, M. R. Yaghoobi-Ershadi, M. A. Oshaghi, and M. M. Sedaghat. 2015. Susceptibility of culicidae mosquitoes to some insecticides recommended by WHO in a malaria endemic area of southeastern Iran. Journal of Arthropod-Borne Diseases 9: 22-34.
Fernandez-Jimenez, N., A. Castellanos-Rubio, L. Plaza-Izurieta, G. Gutierrez, I. Irastorza, L. Castaño, J. C. Vitoria, and J. R. Bilbao. 2011. Accuracy in copy number calling by qPCR and PRT: a matter of DNA. Plos One 6: e28910.
Feyereisen, R. 2005. Insect Cytochrome P450 in: Comprehensive Molecular Insect Science. ed. LI Gilbert, K. Iatrou & SS Gill edition. Elsevier.
Feyereisen, R. 2012. Insect CYP Genes and P450 Enzymes. Insect Molecular Biology and Biochemistry: 236-316.
Ffrench-Constant, R. H. 2007. Which came first: insecticides or resistance? Trends in Genetics 23: 1-4.
Ffrench-Constant, R. H., P. J. Daborn, and G. Le Goff. 2004. The genetics and genomics of insecticide resistance. Trends in Genetics 20: 163-170.
Field, L. M., and A. L. Devonshire. 1998. Evidence that the E4 and FE4 esterase genes responsible for insecticide resistance in the aphid Myzus persicae (Sulzer) are part of a gene family. Biochemical Journal 330: 169-173.
Fonseca, D. M., and C. M. Bahnck. 2006. A first resolved phylogeny of the Culex pipiens complex: Main species, subspecies, and forms. American Journal of Tropical Medicine and Hygiene 75: 210-211.
Fonseca, D. M., C. T. Atkinson, and R. C. Fleischer. 1998. Microsatellite primers for Culex pipiens quinquefasciatus, the vector of avian malaria in Hawaii. Molecular Ecology 7: 1617-1619.
Fonseca, D. M., N. Keyghobadi, C. A. Malcolm, C. Mehmet, F. Schaffner, M. Mogi, R. C. Fleischer, and R. C. Wilkerson. 2004. Emerging vectors in the Culex pipiens complex. Science 303: 1535-1538.
Gazave, É., C. Chevillon, T. Lenormand, M. Marquine, and M. Raymond. 2001. Dissecting the cost of insecticide resistance genes during the overwintering period of the mosquito Culex pipiens. Heredity 87: 441-448.
Gomes, B., C. A. Sousa, M. T. Novo, F. B. Freitas, R. Alves, A. R. Corte-Real, P. Salgueiro, M. J. Donnelly, A. P. G. Almeida, and J. Pinto. 2009. Asymmetric introgression between sympatric molestus and pipiens forms of Culex pipiens (Diptera: Culicidae) in the Comporta region, Portugal. Bmc Evolutionary Biology 9.
Gong, Y., T. Li, L. Zhang, X. Gao, and N. Liu. 2013. Permethrin induction of multiple cytochrome P450 genes in insecticide resistant mosquitoes, Culex quinquefasciatus. International journal of biological sciences 9: 863-871.
Gordon, J. R., and J. Ottea. 2012. Association of esterases with insecticide resistance in Culex quinquefasciatus (Diptera: Culicidae). Journal of economic entomology 105: 971-978.
Goudet, J. 2001. FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9. 3).
Grant, D. F., E. C. Dietze, and B. D. Hammock. 1991. Glutathione S-transferase isozymes in Aedes aegypti: purification, characterization, and isozyme-specific regulation. Insect biochemistry 21: 421-433.
Guillemaud, T., S. Rooker, N. Pasteur, and M. Raymond. 1996. Testing the unique amplification event and the worldwide migration hypothesis of insecticide resistance genes with sequence data. Heredity 77: 535-543.
![Page 184: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/184.jpg)
170
Gunasekaran, K., S. Muthukumaravel, S. Sahu, T. Vijayakumar, and P. Jambulingam. 2011. Glutathione S Transferase activity in Indian vectors of malaria: a defense mechanism against DDT. Journal of medical entomology 48: 561-569.
Gyapong, J. O., and N. A. Y. Twum‐Danso. 2006. Editorial: Global elimination of lymphatic filariasis: fact or fantasy? Tropical Medicine & International Health 11: 125-128.
Hamer, G. L., U. D. Kitron, J. D. Brawn, S. R. Loss, M. O. Ruiz, T. L. Goldberg, and E. D. Walker. 2008. Culex pipiens (Diptera : Culicidae): A bridge vector of West Nile virus to humans. Journal of Medical Entomology 45: 125-128.
Harbach, R. E. 2011. Classification within the cosmopolitan genus Culex (Diptera: Culicidae): The foundation for molecular systematics and phylogenetic research. Acta Tropica 120: 1-14.
Harbach, R. E. 2012. Culex pipiens: Species versus species complex - taxonomic history and perspective. Journal of the American Mosquito Control Association 28: 10-23.
Hardstone, M., O. Komagata, S. Kasai, T. Tomita, and J. Scott. 2010. Use of isogenic strains indicates CYP9M10 is linked to permethrin resistance in Culex pipiens quinquefasciatus. Insect molecular biology 19: 717-726.
Hardstone, M. C., C. Leichter, L. C. Harrington, S. Kasai, T. Tomita, and J. G. Scott. 2007. Cytochrome P450 monooxygenase-mediated permethrin resistance confers limited and larval specific cross-resistance in the southern house mosquito, Culex pipiens quinquefasciatus. Pesticide Biochemistry and Physiology 89: 175-184.
Harrop, T. W. R., T. Sztal, C. Lumb, R. T. Good, P. J. Daborn, P. Batterham, and H. Chung. 2014. Evolutionary changes in gene expression, coding sequence and copy-number at the cyp6g1 locus contribute to resistance to multiple insecticides in Drosophila. Plos One 9: e84879.
Hayes, E. B., N. Komar, R. S. Nasci, S. P. Montgomery, D. R. O'Leary, and G. L. Campbell. 2005. Epidemiology and transmission dynamics of West Nile Virus disease. Emerging Infectious Diseases 11: 1167-1173.
He, L., T. Li, L. Zhang, and N. Liu. 2012. Multiple sodium channel variants in the mosquito Culex quinquefasciatus. International journal of biological sciences 8: 1291.
Hemingway, J. 2014. The role of vector control in stopping the transmission of malaria: threats and opportunities. Philosophical Transactions of the Royal Society B-Biological Sciences 369.
Hemingway, J., and H. Ranson. 2000. Insecticide resistance in insect vectors of human disease. Annual review of entomology 45: 371-391.
Hemingway, J., N. J. Hawkes, L. McCarroll, and H. Ranson. 2004. The molecular basis of insecticide resistance in mosquitoes. Insect Biochemistry and Molecular Biology 34: 653-665.
Hesson, J. C., O. Ostman, M. Schafer, and J. O. Lundstrom. 2011. Geographic distribution and relative abundance of the sibling vector species Culex torrentium and Culex pipiens in Sweden. Vector-Borne and Zoonotic Diseases 11: 1383-1389.
Hickner, P. V., B. de Bruyn, D. D. Lovin, A. Mori, S. K. Behura, R. Pinger, and D. W. Severson. 2010. Genome-based microsatellite development in the Culex pipiens complex and comparative microsatellite frequency with Aedes aegypti and Anopheles gambiae. Plos One 5: 1-8.
Hills, S. L., and D. C. Phillips. 2009. Past, present, and future of japanese encephalitis. Emerging Infectious Diseases 15: 1333-1333.
Hindson, C. M., J. R. Chevillet, H. A. Briggs, E. N. Gallichotte, I. K. Ruf, B. J. Hindson, R. L. Vessella, and M. Tewari. 2013. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nature methods 10: 1003-1005.
Hoffmann, A. A., and Y. Willi. 2008. Detecting genetic responses to environmental change. Nature Reviews Genetics 9: 421-432.
Holleley, C. E., and P. G. Geerts. 2009. Multiplex Manager 1.0: a cross-platform computer program that plans and optimizes multiplex PCR. Biotechniques 46: 511-+.
Hotelier, T., V. Negre, P. Marchot, and A. Chatonnet. 2010. Insecticide resistance through mutations in cholinesterases or carboxylesterases: data mining in the ESTHER database. Journal of Pesticide Science 35: 315-320.
![Page 185: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/185.jpg)
171
Huang, S., G. Molaei, and T. G. Andreadis. 2008. Genetic insights into the population structure of Culex pipiens (Diptera : Culicidae) in the northeastern United States by using microsatellite analysis. American Journal of Tropical Medicine and Hygiene 79: 518-527.
Huggett, J. F., C. A. Foy, V. Benes, K. Emslie, J. A. Garson, R. Haynes, J. Hellemans, M. Kubista, R. D. Mueller, T. Nolan, M. W. Pfaffl, G. L. Shipley, J. Vandesompele, C. T. Wittwer, and S. A. Bustin. 2013. The digital MIQE guidelines: minimum information for publication of quantitative digital PCR experiments. Clinical Chemistry 59: 892-902.
Huppatz, C., C. Capuano, K. Palmer, P. M. Kelly, and D. N. Durrheim. 2009. Lessons from the Pacific programme to eliminate lymphatic filariasis: a case study of 5 countries. Bmc Infectious Diseases 9.
ICEMR. 2015. International Centers of Excellence for Malaria Research (ICEMR). http://www.niaid.nih.gov/labsandresources/resources/icemr/centers/Pages/uganda.aspx.
Ichimori, K., J. D. King, D. Engels, A. Yajima, A. Mikhailov, P. Lammie, and E. A. Ottesen. 2014. Global Programme to Eliminate Lymphatic Filariasis: The Processes Underlying Programme Success. Plos Neglected Tropical Diseases 8: E3328-E3328.
Ikegami, T., and S. Makino. 2011. The pathogenesis of rift valley fever. Viruses-Basel 3: 493-519. Ingham, V. A., C. M. Jones, P. Pignatelli, V. Balabanidou, J. Vontas, S. C. Wagstaff, J. D. Moore,
and H. Ranson. 2014. Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes. Bmc Genomics 15.
Itokawa, K., O. Komagata, S. Kasai, Y. Okamura, M. Masada, and T. Tomita. 2010. Genomic structures of Cyp9m10 in pyrethroid resistant and susceptible strains of Culex quinquefasciatus. Insect Biochemistry and Molecular Biology 40: 631-640.
Itokawa, K., O. Komagata, S. Kasai, H. Kawada, C. Mwatele, G. O. Dida, S. M. Njenga, C. Mwandawiro, and T. Tomita. 2013. Global spread and genetic variants of the two CYP9M10 haplotype forms associated with insecticide resistance in Culex quinquefasciatus Say. Heredity 111: 216-226.
Jakobsson, M., and N. A. Rosenberg. 2007. CLUMPP: a cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 23: 1801-1806.
Jensen, J. L., A. J. Bohonak, and S. T. Kelley. 2005. Isolation by distance, web service. BMC genetics 6: 13.
Johnson, B. J., and D. M. Fonseca. 2015. Insecticide resistance alleles in wetland and residential populations of the West Nile virus vector Culex pipiens in New Jersey. Pest management science.
Jombart, T. 2008. adegenet: a R package for the multivariate analysis of genetic markers. Bioinformatics 24: 1403-1405.
Jones, C. M., M. Liyanapathirana, F. R. Agossa, D. Weetman, H. Ranson, M. J. Donnelly, and C. S. Wilding. 2012a. Footprints of positive selection associated with a mutation (N1575Y) in the voltage-gated sodium channel of Anopheles gambiae. Proceedings of the National Academy of Sciences of the United States of America 109: 6614-6619.
Jones, C. M., C. Machin, K. Mohammed, S. Majambere, A. S. Ali, B. O. Khatib, J. Mcha, H. Ranson, and L. A. Kelly-Hope. 2012b. Insecticide resistance in Culex quinquefasciatus from Zanzibar: implications for vector control programmes. Parasites & Vectors 5.
Kalinowski, S. T., M. L. Taper, and T. C. Marshall. 2007. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology 16: 1099-1106.
Kalinowski, S. T., M. L. Taper, and T. C. Marshall. 2010. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology 19: 1512-1512.
![Page 186: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/186.jpg)
172
Karunamoorthi, K., and S. Sabesan. 2013. Insecticide resistance in insect vectors of disease with special reference to mosquitoes: a potential threat to global public health. Health Scope 2: 4-18.
Kasai, S., I. S. Weerashinghe, T. Shono, and M. Yamakawa. 2000. Molecular cloning, nucleotide sequence and gene expression of a cytochrome P450 (CYP6F1) from the pyrethroid-resistant mosquito, Culex quinquefasciatus Say. Insect Biochemistry and Molecular Biology 30: 163-171.
Katiyar, D., and K. L. Singh. 2011. Filariasis: current status, treatment and recent advances in drug development. Current medicinal chemistry 18: 2174-2185.
Kawecki, T. J., and D. Ebert. 2004. Conceptual issues in local adaptation. Ecology Letters 7: 1225-1241.
Keiser, J., M. F. Maltese, T. E. Erlanger, R. Bos, M. Tanner, B. H. Singer, and J. Utzinger. 2005. Effect of irrigated rice agriculture on Japanese encephalitis, including challenges and opportunities for integrated vector management. Acta Tropica 95: 40-57.
Kelly-Hope, L. A., D. H. Molyneux, and M. J. Bockarie. 2013. Can malaria vector control accelerate the interruption of lymphatic filariasis transmission in Africa; capturing a window of opportunity. Parasit Vectors 6: 39.
Kigozi, R., S. M. Baxi, A. Gasasira, A. Sserwanga, S. Kakeeto, S. Nasr, D. Rubahika, G. Dissanayake, M. R. Kamya, S. Filler, and G. Dorsey. 2012. Indoor residual spraying of insecticide and malaria morbidity in a high transmission intensity area of Uganda. Plos One 7.
Kilpatrick, A. M., L. D. Kramer, M. J. Jones, P. P. Marra, and P. Daszak. 2006. West Nile virus epidemics in North America are driven by shifts in mosquito feeding behavior. PLoS biology 4: 606.
Kioulos, I., A. Kampouraki, E. Morou, G. Skavdis, and J. Vontas. 2014. Insecticide resistance status in the major West Nile virus vector Culex pipiens from Greece. Pest Management Science 70: 623-627.
Knight, K. L. 1978. Supplement to a catalog of the mosquitoes of the World (Diptera: Culicidae). Thomas Say Foundation 6: 1-107.
Kofler, R., C. Schloetterer, and T. Lelley. 2007. SciRoKo: a new tool for whole genome microsatellite search and investigation. Bioinformatics 23: 1683-1685.
Kolaczinski, J. H., N. B. Kabatereine, A. W. Onapa, R. Ndyomugyenyi, A. S. L. Kakembo, and S. Brooker. 2007. Neglected tropical diseases in Uganda: the prospect and challenge of integrated control. Trends in Parasitology 23: 485-493.
Komagata, O., S. Kasai, and T. Tomita. 2010. Overexpression of cytochrome P450 genes in pyrethroid-resistant Culex quinquefasciatus. Insect Biochemistry and Molecular Biology 40: 146-152.
Komagata, O., S. Kasai, I. Obara, N. Motoyama, I. Tanaka, M. Kobayashi, and T. Tomita. 2008. Concomitant identification of subspecies and insecticide resistance-associated mutations in the mosquito Culex pipiens complex by primer extension-based genotyping. Medical Entomology and Zoology 59: 33-46.
Kondrashov, F. A. 2012. Gene duplication as a mechanism of genomic adaptation to a changing environment. Proceedings of the Royal Society B-Biological Sciences 279: 5048-5057.
Kondrashov, F. A., and A. S. Kondrashov. 2006. Role of selection in fixation of gene duplications. Journal of Theoretical Biology 239: 141-151.
Kondrashov, F. A., I. B. Rogozin, Y. I. Wolf, and E. V. Koonin. 2002. Selection in the evolution of gene duplications. Genome Biology 3.
Kothera, L., M. S. Godsey, Jr., M. S. Doyle, and H. M. Savage. 2012. Characterization of Culex pipiens Complex (Diptera: Culicidae) populations in Colorado, USA using microsatellites. Plos One 7.
Kotlyar, S. 2010. Recommendations for control of East african sleeping sickness in Uganda. Journal of global infectious diseases 2: 43-48.
![Page 187: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/187.jpg)
173
Kramer, L. D., L. M. Styer, and G. D. Ebel. 2008. A global perspective on the epidemiology of West Nile virus. Annu. Rev. Entomol. 53: 61-81.
Ku, C. C., F. M. Chiang, C. Y. Hsin, Y. E. Yao, and C. N. Sun. 1994. GLUTATHIONE TRANSFERASE ISOZYMES INVOLVED IN INSECTICIDE RESISTANCE OF DIAMONDBACK MOTH LARVAE. Pesticide Biochemistry and Physiology 50: 191-197.
Kudom, A. A., B. A. Mensah, G. Froeschl, D. Boakye, and H. Rinder. 2015. Preliminary assessment of the potential role of urbanization in the distribution of carbamate and organophosphate resistant populations of Culex species in Ghana. Parasites & Vectors 8.
Kumar, K., A. K. Sharma, S. Kumar, S. Patel, M. Sarkar, and L. S. Chauhan. 2011. Multiple insecticide resistance/susceptibility status of Culex quinquefasciatus, principal vector of bancroftian filariasis from filaria endemic areas of northern India. Asian Pacific Journal of Tropical Medicine 4: 426-429.
Kumari, R., R. Sharma, V. Raina, and L. Chauhan. 2014. Role of integrated vector management for prevention and control of japanese encephalitis/acute encephalitis syndrome (JE/AES)-A review. Journal of Communicable Diseases 46: 93-108.
Kumasaka, N., H. Fujisawa, N. Hosono, Y. Okada, A. Takahashi, Y. Nakamura, M. Kubo, and N. Kamatani. 2011. PlatinumCNV: a Bayesian Gaussian mixture model for genotyping copy number polymorphisms using SNP array signal intensity data. Genetic epidemiology 35: 831-844.
Kushwah, R., P. Mallick, H. Ravikumar, V. Dev, N. Kapoor, T. Adak, and O. Singh. 2015. Status of DDT and pyrethroid resistance in Indian Aedes albopictus and absence of knockdown resistance (kdr) mutation. Journal of vector borne diseases 52: 95-98.
Kwon, D. H., J. M. Clark, and S. H. Lee. 2010. Extensive gene duplication of acetylcholinesterase associated with organophosphate resistance in the two-spotted spider mite. Insect Molecular Biology 19: 195-204.
Kwon, D. H., J. Y. Choi, Y. H. Je, and S. H. Lee. 2012. The overexpression of acetylcholinesterase compensates for the reduced catalytic activity caused by resistance-conferring mutations in Tetranychus urticae. Insect Biochemistry and Molecular Biology 42: 212-219.
Kyelem, D., G. Biswas, M. J. Bockarie, M. H. Bradley, M. El-Setouhy, P. U. Fischer, R. H. Henderson, J. W. Kazura, P. J. Lammie, and S. M. Njenga. 2008. Determinants of success in national programs to eliminate lymphatic filariasis: a perspective identifying essential elements and research needs. The American journal of tropical medicine and hygiene 79: 480-484.
Labbe, P., P. Milesi, A. Yebakima, N. Pasteur, M. Weill, and T. Lenormand. 2014. Gene-dosage effects on fitness in recent adaptive duplications: ace-1 in the mosquito culex pipiens. Evolution 68: 2092-2101.
Labbe, P., A. Berthomieu, C. Berticat, H. Alout, M. Raymond, T. Lenormand, and M. Weill. 2007a. Independent duplications of the acetylcholinesterase gene conferring insecticide resistance in the mosquito Culex pipiens. Molecular Biology and Evolution 24: 1056-1067.
Labbe, P., C. Berticat, A. Berthomieu, S. Unal, C. Bernard, M. Weill, and T. Lenormand. 2007b. Forty years of erratic insecticide resistance evolution in the Mosquito Culex pipiens. Plos Genetics 3: 2190-2199.
Labbé, P., T. Lenormand, and M. Raymond. 2005. On the worldwide spread of an insecticide resistance gene: a role for local selection. Journal of evolutionary biology 18: 1471-1484.
Labbé, P., P. Milesi, A. Yébakima, N. Pasteur, M. Weill, and T. Lenormand. 2014. GENE‐DOSAGE EFFECTS ON FITNESS IN RECENT ADAPTIVE DUPLICATIONS: ace‐1 IN THE MOSQUITO CULEX PIPIENS. Evolution.
Langer, S. M., C. F. H. Longinand, and T. Wuerschum. 2014. Flowering time control in European winter wheat. Frontiers in Plant Science 5: 537-537.
Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, and R. Lopez. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948.
![Page 188: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/188.jpg)
174
Lee, S. H., Y. H. Kim, D. H. Kwon, D. J. Cha, and J. H. Kim. 2015. Mutation and duplication of arthropod acetylcholinesterase: Implications for pesticide resistance and tolerance. Pesticide biochemistry and physiology 120: 118-124.
Lenormand, T. 2002. Gene flow and the limits to natural selection. Trends in Ecology & Evolution 17: 183-189.
Lenormand, T., T. Guillemaud, D. Bourguet, and M. Raymond. 1998. Appearance and sweep of a gene duplication: adaptive response and potential for new functions in the mosquito Culex pipiens. Evolution: 1705-1712.
Lequime, S., and L. Lambrechts. 2014. Vertical transmission of arboviruses in mosquitoes: A historical perspective. Infection Genetics and Evolution 28: 681-690.
Lertkiatmongkol, P., E. Jenwitheesuk, and P. Rongnoparut. 2011. Homology modeling of mosquito cytochrome P450 enzymes involved in pyrethroid metabolism: insights into differences in substrate selectivity. BMC research notes 4: 321-321.
Li, C.-X., P. E. Kaufman, R.-D. Xue, M.-H. Zhao, G. Wang, T. Yan, X.-X. Guo, Y.-M. Zhang, Y.-D. Dong, and D. Xing. 2015. Relationship between insecticide resistance and kdr mutations in the dengue vector Aedes aegypti in Southern China. Parasites & vectors 8:325: 325.
Li, T., L. Zhang, W. R. Reid, Q. Xu, K. Dong, and N. Liu. 2012. Multiple mutations and mutation combinations in the sodium channel of permethrin resistant mosquitoes, Culex quinquefasciatus. Scientific Reports 2.
Li, X., M. A. Schuler, and M. R. Berenbaum. 2007. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 52: 231-253.
Liu, H.-M., P. Cheng, X. Huang, Y.-H. Dai, H.-F. Wang, L.-J. Liu, Y.-Q. Zhao, H.-W. Wang, and M.-Q. Gong. 2013. Identification of TCT, a novel knockdown resistance allele mutation and analysis of resistance detection methods in the voltage-gated Na+ channel of Culex pipiens pallens from Shandong Province, China. Molecular Medicine Reports 7: 525-530.
Liu, H., E. W. Cupp, K. M. Micher, A. Guo, and N. Liu. 2004. Insecticide resistance and cross-resistance in Alabama and Florida strains of Culex quinquefaciatus. Journal of medical entomology 41: 408-413.
Liu, N. 2015. Insecticide Resistance in Mosquitoes: Impact, Mechanisms, and Research Directions. Annual Review of Entomology, Vol 60 60: 537-559.
Liu, N., F. Zhu, Q. Xu, J. W. Pridgeon, and X. Gao. 2006. Behavioral change, physiological modification, and metabolic detoxification: mechanisms of insecticide resistance. Acta Entomologica Sinica 49: 671.
Liu, N., T. Li, W. R. Reid, T. Yang, and L. Zhang. 2011a. Multiple cytochrome P450 genes: Their constitutive overexpression and permethrin induction in insecticide resistant mosquitoes, Culex quinquefasciatus. Plos One 6.
Liu, Y., H. Zhang, C. Qiao, X. Lu, and F. Cui. 2011b. Correlation between carboxylesterase alleles and insecticide resistance in Culex pipiens complex from China. Parasites & Vectors 4.
Liu, Z., D. L. Schneider, K. Kornfeld, and R. Kopan. 2010. Simple copy number determination with reference query pyrosequencing (RQPS). Cold Spring Harbor Protocols 2010: pdb. prot5491.
Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25: 402-408.
Long, M., N. W. VanKuren, S. Chen, and M. D. Vibranovski. 2013. New Gene Evolution: Little Did We Know. Annual Review of Genetics, Vol 47 47: 307-333.
Lovin, D. D., K. O. Washington, B. deBruyn, R. R. Hemme, A. Mori, S. R. Epstein, B. W. Harker, T. G. Streit, and D. W. Severson. 2009. Genome-based polymorphic microsatellite development and validation in the mosquito Aedes aegypti and application to population genetics in Haiti. Bmc Genomics 10.
Lumjuan, N., S. Rajatileka, D. Changsom, J. Wicheer, P. Leelapat, L.-a. Prapanthadara, P. Somboon, G. Lycett, and H. Ranson. 2011. The role of the Aedes aegypti Epsilon
![Page 189: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/189.jpg)
175
glutathione transferases in conferring resistance to DDT and pyrethroid insecticides. Insect biochemistry and molecular biology 41: 203-209.
Macedo, P. A., J. J. Schleier, III, M. Reed, K. Kelley, G. W. Goodman, D. A. Brown, and R. K. D. Peterson. 2010. Evaluation of efficacy and human health risk of aerial ultra-low volume applications of pyrethrins and piperonyl butoxide for adult mosquito management in response to west nile virus activity in sacramento county, california. Journal of the American Mosquito Control Association 26: 57-66.
Malaria Vectors, I. 2012. Global Plan for Insecticide Resistance Management. Marcombe, S., A. Farajollahi, S. P. Healy, G. G. Clark, and D. M. Fonseca. 2014. Insecticide
resistance status of United States populations of Aedes albopictus and mechanisms involved.
Marcombe, S., M. Paris, C. Paupy, C. Bringuier, A. Yebakima, F. Chandre, J.-P. David, V. Corbel, and L. Despres. 2013. Insecticide-driven patterns of genetic variation in the dengue vector Aedes aegypti in Martinique Island. Plos One 8.
Martinez‐Torres, D., C. Chevillon, A. Brun‐Barale, J. B. Bergé, N. Pasteur, and D. Pauron. 1999. Voltage‐dependent Na+ channels in pyrethroid‐resistant Culex pipiens L mosquitoes. Pesticide Science 55: 1012-1020.
Martins, A. J., L. P. Brito, J. G. B. Linss, G. B. d. S. Rivas, R. Machado, R. V. Bruno, J. B. P. Lima, D. Valle, and A. A. Peixoto. 2013. Evidence for gene duplication in the voltage-gated sodium channel gene of Aedes aegypti. Evolution, medicine, and public health 2013: 148-160.
Masi, P., P. L. S. Zeuli, and P. Donini. 2003. Development and analysis of multiplex microsatellite markers sets in common bean (Phaseolus vulgaris L.). Molecular Breeding 11: 303-313.
Matsuda, K., S. Kanaoka, M. Akamatsu, and D. B. Sattelle. 2009. Diverse actions and target-site selectivity of neonicotinoids: structural insights. Molecular pharmacology 76: 1-10.
Matthews, G. 2008. Pesticide application methods, John Wiley & Sons. Mawejje, H. D., C. S. Wilding, E. J. Rippon, A. Hughes, D. Weetman, and M. J. Donnelly. 2013.
Insecticide resistance monitoring of field‐collected Anopheles gambiae sl populations from Jinja, eastern Uganda, identifies high levels of pyrethroid resistance. Medical and Veterinary Entomology 27: 276-283.
Megy, K., S. J. Emrich, D. Lawson, D. Campbell, E. Dialynas, D. S. T. Hughes, G. Koscielny, C. Louis, R. M. MacCallum, S. N. Redmond, A. Sheehan, P. Topalis, D. Wilson, and C. VectorBase. 2012. VectorBase: improvements to a bioinformatics resource for invertebrate vector genomics. Nucleic acids research 40: D729-D734.
Mikhail, F. M. 2014. Copy number variations and human genetic disease. Current opinion in pediatrics 26: 646-652.
Mitchell, S. N., B. J. Stevenson, P. Müller, C. S. Wilding, A. Egyir-Yawson, S. G. Field, J. Hemingway, M. J. I. Paine, H. Ranson, and M. J. Donnelly. 2012. Identification and validation of a gene causing cross-resistance between insecticide classes in Anopheles gambiae from Ghana. Proceedings of the National Academy of Sciences 109: 6147-6152.
Mitchell, S. N., D. J. Rigden, A. J. Dowd, F. Lu, C. S. Wilding, D. Weetman, S. Dadzie, A. M. Jenkins, K. Regna, and P. Boko. 2014. Metabolic and target-site mechanisms combine to confer strong DDT resistance in Anopheles gambiae. PloS one 9: 92662.
Mohammed, B. R., C. S. Wilding, P. J. Collier, and Y. Y. Deeni. 2014. Bioinformatic analysis of regulatory elements within the promoter region of the cytochrome P450 Gene, CYP6M2 in Anopheles gambiae. European Journal of Biotechnology and Bioscience.
Molaei, G., S. Huang, and T. G. Andreadis. 2012. Vector-host interactions of Culex pipiens complex in northeastern and southwestern USA. J Am Mosq Control Assoc 28: 127-136.
Montella, I. R., R. Schama, and D. Valle. 2012. The classification of esterases: an important gene family involved in insecticide resistance - A Review. Memorias Do Instituto Oswaldo Cruz 107: 437-449.
![Page 190: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/190.jpg)
176
Moores, G. D., D. Philippou, V. Borzatta, P. Trincia, P. Jewess, R. Gunning, and G. Bingham. 2009. An analogue of piperonyl butoxide facilitates the characterisation of metabolic resistance. Pest Management Science 65: 150-154.
Morgan, J. C., H. Irving, L. M. Okedi, A. Steven, and C. S. Wondji. 2010. Pyrethroid Resistance in an Anopheles funestus Population from Uganda. Plos One 5.
Mori, A., N. F. Lobo, B. deBruyn, and D. W. Severson. 2007. Molecular cloning and characterization of the complete acetylcholine sterase gene (Ace1) from the mosquito Aedes aegypti with implications for comparative genome analysis. Insect Biochemistry and Molecular Biology 37: 667-674.
Mota-Sanchez, D., P. S. Bills, and M. E. Whalon. 2002. Arthropod resistance to pesticides: Status and overview. Pesticides in Agriculture and the Environment: 241-272.
Mourya, D. T., J. Hemingway, and C. J. Leake. 1993. Changes in enzyme titers with age in 4 geographical strains of Aedes aegypti and their association with insecticide resistance. Medical and Veterinary Entomology 7: 11-16.
Mukherjee, A., G. Dass, G. J. Mohanarao, V. K. Katneni, D. Banerjee, T. K. Das, M. Gohain, A. K. Chakrabarty, T. K. Datta, and S. De. 2015. Copy number differences of Y chromosomal genes between superior and inferior quality semen producing crossbred (Bos taurus x Bos indicus) Bulls. Animal Biotechnology 26: 65-72.
Mukhopadhyay, S., R. J. Kuhn, and M. G. Rossmann. 2005. A structural perspective of the Flavivirus life cycle. Nature Reviews Microbiology 3: 13-22.
Mulamba, C., J. M. Riveron, S. S. Ibrahim, H. Irving, K. G. Barnes, L. G. Mukwaya, J. Birungi, and C. S. Wondji. 2014. Widespread pyrethroid and DDT resistance in the major malaria vector Anopheles funestus in East Africa is driven by metabolic resistance mechanisms.
Müller, P., E. Warr, B. J. Stevenson, P. M. Pignatelli, J. C. Morgan, A. Steven, A. E. Yawson, S. N. Mitchell, H. Ranson, and J. Hemingway. 2008. Field-caught permethrin-resistant Anopheles gambiae overexpress CYP6P3, a P450 that metabolises pyrethroids. Plos Genetics 4: e1000286.
N'Guessan, R., P. Boko, A. Odjo, B. Knols, M. Akogbeto, and M. Rowland. 2009. Control of pyrethroid-resistant Anopheles gambiae and Culex quinquefasciatus mosquitoes with chlorfenapyr in Benin. Tropical Medicine & International Health 14: 389-395.
Nabyonga, L., S. Nalwanga, W. Buwembo, M. K. Mukasa, and F. Kironde. 2013. Plasmodium falciparum transmission and insecticide resistance in Iganga, Uganda. Pathogens and Global Health 107: 438-439.
Nalwanga, E., and J. C. Sempebwa. 2011. Knowledge and practices of in-home pesticide use: a community survey in Uganda. Journal of environmental and public health 2011: 230894-230894.
Namountougou, M., F. Simard, T. Baldet, A. Diabate, J. B. Ouedraogo, T. Martin, and R. K. Dabire. 2012. Multiple insecticide resistance in Anopheles gambiae s.l. populations from Burkina Faso, West Africa. Plos One 7.
Nauen, R. 2007. Insecticide resistance in disease vectors of public health importance. Pest Management Science 63: 628-633.
Neafsey, D. E., R. M. Waterhouse, M. R. Abai, S. S. Aganezov, M. A. Alekseyev, J. E. Allen, J. Amon, B. Arca, P. Arensburger, G. Artemov, L. A. Assour, H. Basseri, A. Berlin, B. W. Birren, S. A. Blandin, A. I. Brockman, T. R. Burkot, A. Burt, C. S. Chan, C. Chauve, J. C. Chiu, M. Christensen, C. Costantini, V. L. M. Davidson, E. Deligianni, T. Dottorini, V. Dritsou, S. B. Gabriel, W. M. Guelbeogo, A. B. Hall, M. V. Han, T. Hlaing, D. S. T. Hughes, A. M. Jenkins, X. Jiang, I. Jungreis, E. G. Kakani, M. Kamali, P. Kemppainen, R. C. Kennedy, I. K. Kirmitzoglou, L. L. Koekemoer, N. Laban, N. Langridge, M. K. N. Lawniczak, M. Lirakis, N. F. Lobo, E. Lowy, R. M. MacCallum, C. Mao, G. Maslen, C. Mbogo, J. McCarthy, K. Michel, S. N. Mitchell, W. Moore, K. A. Murphy, A. N. Naumenko, T. Nolan, E. M. Novoa, S. O'Loughlin, C. Oringanje, M. A. Oshaghi, N. Pakpour, P. A. Papathanos, A. N. Peery, M. Povelones, A. Prakash, D. P. Price, A. Rajaraman, L. J. Reimer, D. C. Rinker, A. Rokas, T. L.
![Page 191: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/191.jpg)
177
Russell, N. F. Sagnon, M. V. Sharakhova, T. Shea, F. A. Simao, F. Simard, M. A. Slotman, P. Somboon, V. Stegniy, C. J. Struchiner, G. W. C. Thomas, M. Tojo, P. Topalis, J. M. C. Tubio, M. F. Unger, J. Vontas, C. Walton, C. S. Wilding, J. H. Willis, Y.-C. Wu, G. Yan, E. M. Zdobnov, X. Zhou, F. Catteruccia, G. K. Christophides, F. H. Collins, R. S. Cornman, et al. 2015. Highly evolvable malaria vectors: The genomes of 16 Anopheles mosquitoes. Science 347: 43-+.
Nelson, D. R. 2009. The Cytochrome P450 Homepage. Human Genomics 4: 59-65. Nkya, T. E., I. Akhouayri, W. Kisinza, and J.-P. David. 2013. Impact of environment on mosquito
response to pyrethroid insecticides: Facts, evidences and prospects. Insect Biochemistry and Molecular Biology 43: 407-416.
Norris, L. C., and D. E. Norris. 2011. Insecticide resistance in Culex quinquefasciatus mosquitoes after the introduction of insecticide-treated bed nets in Macha, Zambia. Journal of Vector Ecology 36: 411-420.
O'Reilly, A. O., B. P. S. Khambay, M. S. Williamson, L. M. Field, B. A. Wallace, and T. G. E. Davies. 2006. Modelling insecticide-binding sites in the voltage-gated sodium channel. Biochemical Journal 396: 255-263.
Onapa, A. W., P. E. Simonsen, E. M. Pedersen, and D. O. Okello. 2001. Lymphatic filariasis in Uganda: baseline investigations in Lira, Soroti and Katakwi districts. Transactions of the Royal Society of Tropical Medicine and Hygiene 95: 161-167.
Orsini, L., J. Mergeay, J. Vanoverbeke, and L. De Meester. 2013. The role of selection in driving landscape genomic structure of the waterflea Daphnia magna. Molecular Ecology 22: 583-601.
Ortelli, F., L. Rossiter, J. Vontas, H. Ranson, and J. Hemingway. 2003. Heterologous expression of four glutathione transferase genes genetically linked to a major insecticide-resistance locus from the malaria vector Anopheles gambiae. Biochem. J 373: 957-963.
Osta, M. A., Z. J. Rizk, P. Labbé, M. Weill, and K. Knio. 2012a. Insecticide resistance to organophosphates in Culex pipiens complex from Lebanon. Parasit Vectors 5: 1-6.
Osta, M. A., Z. J. Rizk, P. Labbe, M. Weill, and K. Knio. 2012b. Insecticide resistance to organophosphates in Culex pipiens complex from Lebanon. Parasites & Vectors 5.
Ottesen, E. A. 2006. Lymphatic filariasis: treatment, control and elimination. Advances in parasitology 61: 395-441.
Palmisano, C. T., V. Taylor, K. Caillouet, B. Byrd, and D. M. Wesson. 2005. Impact of West Nile virus outbreak upon St. Tammany parish Mosquito abatement district. Journal of the American Mosquito Control Association 21: 33-38.
Paris, M., S. Boyer, A. Bonin, A. Collado, J.-P. David, and L. Despres. 2010. Genome scan in the mosquito Aedes rusticus: population structure and detection of positive selection after insecticide treatment. Molecular Ecology 19: 325-337.
Paton, M. G., S. Karunaratne, E. Giakoumaki, N. Roberts, and J. Hemingway. 2000. Quantitative analysis of gene amplification in insecticide-resistant Culex mosquitoes. Biochemical Journal 346: 17-24.
Peakall, R., and P. E. Smouse. 2012. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 28: 2537-2539.
Penilla, R. P., A. D. Rodríguez, J. Hemingway, J. L. Torres, F. Solis, and M. H. Rodríguez. 2006. Changes in glutathione S-transferase activity in DDT resistant natural Mexican populations of Anopheles albimanus under different insecticide resistance management strategies. Pesticide biochemistry and physiology 86: 63-71.
Pepin, M., M. Bouloy, B. H. Bird, A. Kemp, and J. Paweska. 2010. Rift Valley fever virus (Bunyaviridae: Phlebovirus): an update on pathogenesis, molecular epidemiology, vectors, diagnostics and prevention. Veterinary Research 41.
Pereira, B. B., J. E. Limongi, E. O. d. Campos Júnior, D. P. Luiz, and W. E. Kerr. 2014. Effects of piperonyl butoxide on the toxicity of the organophosphate temephos and the role of
![Page 192: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/192.jpg)
178
esterases in the insecticide resistance of Aedes aegypti. Revista da Sociedade Brasileira de Medicina Tropical 47: 579-582.
Pinheiro, L. B., V. A. Coleman, C. M. Hindson, J. Herrmann, B. J. Hindson, S. Bhat, and K. R. Emslie. 2012. Evaluation of a Droplet Digital Polymerase Chain Reaction Format for DNA Copy Number Quantification. Analytical Chemistry 84: 1003-1011.
Pocquet, N., F. Darriet, B. Zumbo, P. Milesi, J. Thiria, V. Bernard, C. Toty, P. Labbe, and F. Chandre. 2014. Insecticide resistance in disease vectors from Mayotte: an opportunity for integrated vector management. Parasites & Vectors 7.
Pocquet, N., P. Milesi, P. Makoundou, S. Unal, B. Zumbo, C. Atyame, F. Darriet, J.-S. Dehecq, J. Thiria, A. Bheecarry, D. P. Iyaloo, M. Weill, F. Chandre, and P. Labbe. 2013. Multiple insecticide resistances in the disease Vector Culex p. quinquefasciatus from Western Indian Ocean. Plos One 8.
Ponce, G., I. P. Rodriguez‐Sanchez, S. Garcia, J. M. Torrado, S. Lozano, and A. E. Flores. 2015. First report of kdr mutation (L1014F) in Culex quinquefasciatus of México. Insect science.
Porta, J., J. M. Porta, G. Martinez-Rodriguez, and M. D. Alvarez. 2006. Development of a microsatellite multiplex PCR for Senegalese sole (Solea senegalensis) and its application to broodstock management. Aquaculture 256: 159-166.
Pritchard, J. K., M. Stephens, and P. Donnelly. 2000. Inference of population structure using multilocus genotype data. Genetics 155: 945-959.
Ramphul, U., T. Boase, C. Bass, L. M. Okedi, M. J. Donnelly, and P. Müller. 2009. Insecticide resistance and its association with target-site mutations in natural populations of Anopheles gambiae from eastern Uganda. Transactions of the Royal Society of Tropical Medicine and Hygiene 103: 1121-1126.
Ranson, H., B. Jensen, J. M. Vulule, X. Wang, J. Hemingway, and F. H. Collins. 2000. Identification of a point mutation in the voltage-gated sodium channel gene of Kenyan Anopheles gambiae associated with resistance to DDT and pyrethroids. Insect Molecular Biology 9: 491-497.
Ranson, H., R. N'Guessan, J. Lines, N. Moiroux, Z. Nkuni, and V. Corbel. 2011. Pyrethroid resistance in African anopheline mosquitoes: what are the implications for malaria control? Trends in parasitology 27: 91-98.
Ranson, H., L. ROSSITER, F. ORTELLI, B. JENSEN, X. WANG, C. Roth, F. Collins, and J. HEMINGWAY. 2001. Identification of a novel class of insect glutathione S-transferases involved in resistance to DDT in the malaria vector Anopheles gambiae. Biochem. J 359: 295-304.
Ranson, H., C. Claudianos, F. Ortelli, C. Abgrall, J. Hemingway, M. V. Sharakhova, M. F. Unger, F. H. Collins, and R. Feyereisen. 2002. Evolution of supergene families associated with insecticide resistance. Science 298: 179-181.
Raymond, M., C. Chevillon, T. Guillemaud, T. Lenormand, and N. Pasteur. 1998. An overview of the evolution of overproduced esterases in the mosquito Culex pipiens. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 353: 1707-1711.
Raymond, M., C. Berticat, M. Weill, N. Pasteur, and C. Chevillon. 2001. Insecticide resistance in the mosquito Culex pipiens: what have we learned about adaptation?, pp. 287-296, Microevolution Rate, Pattern, Process. Springer.
Rebollo, M. P., and M. J. Bockarie. 2013. Toward the elimination of lymphatic filariasis by 2020: treatment update and impact assessment for the endgame.
Reddy, B. N., G. Prasad, and K. Raghavendra. 2011. In silico characterization and comparative genomic analysis of the Culex quinquefasciatus glutathione S-transferase (GST) supergene family. Parasitology research 109: 1165-1177.
Reddy, B. N., B. P. Rao, G. Prasad, and K. Raghavendra. 2012. Identification and classification of detoxification enzymes from Culex quinquefasciatus (Diptera: Culicidae). Bioinformation 8: 430-436.
Remnant, E. J., R. T. Good, J. M. Schmidt, C. Lumb, C. Robin, P. J. Daborn, and P. Batterham. 2013. Gene duplication in the major insecticide target site, Rdl, in Drosophila melanogaster.
![Page 193: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/193.jpg)
179
Proceedings of the National Academy of Sciences of the United States of America 110: 14705-14710.
Remnant, E. J., C. J. Morton, P. J. Daborn, C. Lumb, Y. T. Yang, H. L. Ng, M. W. Parker, and P. Batterham. 2014. The role of Rdl in resistance to phenylpyrazoles in Drosophila melanogaster. Insect biochemistry and molecular biology 54: 11-21.
Ren, X., Z. Han, and Y. Wang. 2002. Mechanisms of monocrotophos resistance in cotton bollworm, Helicoverpa armigera (Hübner). Archives of insect biochemistry and physiology 51: 103-110.
Reusken, C. B. E. M., A. de Vries, J. Buijs, M. A. H. Braks, W. den Hartog, and E. J. Scholte. 2010. First evidence for presence of Culex pipiens biotype molestus in the Netherlands, and of hybrid biotype pipiens and molestus in northern Europe. Journal of Vector Ecology 35: 210-212.
Rinkevich, F. D., Y. Du, and K. Dong. 2013a. Diversity and convergence of sodium channel mutations involved in resistance to pyrethroids. Pesticide Biochemistry and Physiology 106: 93-100.
Rinkevich, F. D., C. A. Leichter, T. A. Lazo, M. C. Hardstone, and J. G. Scott. 2013b. Variable fitness costs for pyrethroid resistance alleles in the house fly, Musca domestica, in the absence of insecticide pressure. Pesticide Biochemistry and Physiology 105: 161-168.
Rinkevich, F. D., C. Su, T. A. Lazo, D. J. Hawthorne, W. M. Tingey, S. Naimov, and J. G. Scott. 2012. Multiple evolutionary origins of knockdown resistance (kdr) in pyrethroid-resistant Colorado potato beetle, Leptinotarsa decemlineata. Pesticide Biochemistry and Physiology 104: 192-200.
Rivero, A., J. Vezilier, M. Weill, A. F. Read, and S. Gandon. 2010. Insecticide control of vector-borne diseases: when is insecticide resistance a problem? PLoS pathogens 6: e1001000.
Riveron, J. M., H. Irving, M. Ndula, K. G. Barnes, S. S. Ibrahim, M. J. Paine, and C. S. Wondji. 2013. Directionally selected cytochrome P450 alleles are driving the spread of pyrethroid resistance in the major malaria vector Anopheles funestus. Proceedings of the National Academy of Sciences 110: 252-257.
Riveron, J. M., S. S. Ibrahim, E. Chanda, T. Mzilahowa, N. Cuamba, H. Irving, K. G. Barnes, M. Ndula, and C. S. Wondji. 2014. The highly polymorphic CYP6M7 cytochrome P450 gene partners with the directionally selected CYP6P9a and CYP6P9b genes to expand the pyrethroid resistance front in the malaria vector Anopheles funestus in Africa. Bmc Genomics 15.
Roehrig, J. T. 2013. West Nile virus in the United States—a historical perspective. Viruses 5: 3088-3108.
Rousset, F. 2008. GENEPOP ' 007: a complete re-implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103-106.
Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for general users and for biologist programmers. Methods in molecular biology (Clifton, N.J.) 132: 365-386.
Russell, R. C. 2012. A review of the status and significance of the species within the Culex pipiens group in Australia. Journal of the American Mosquito Control Association 28: 24-27.
Samra, A. I., S. G. Kamita, H. W. Yao, A. J. Cornel, and B. D. Hammock. 2012. Cloning and characterization of two glutathione S‐transferases from pyrethroid‐resistant Culex pipiens. Pest management science 68: 764-772.
Sanchez-Bayo, F. 2012. Insecticides mode of action in relation to their toxicity to non-target organisms.
Sanil, D., V. Shetty, and N. Shetty. 2014. Differential expression of glutathione s-transferase enzyme in different life stages of various insecticide-resistant strains of Anopheles stephensi: A malaria vector. Journal of vector borne diseases 51: 97.
Santolamazza, F., M. Calzetta, J. Etang, E. Barrese, I. Dia, A. Caccone, M. J. Donnelly, V. Petrarca, F. Simard, J. Pinto, and A. della Torre. 2008. Distribution of knock-down resistance
![Page 194: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/194.jpg)
180
mutations in Anopheles gambiae molecular forms in west and west-central Africa. Malaria journal 7.
Sarkar, M., A. Borkotoki, I. Baruah, I. K. Bhattacharyya, and R. B. Srivastava. 2009. Molecular analysis of knock down resistance (kdr) mutation and distribution of kdr genotypes in a wild population of Culex quinquefasciatus from India. Tropical Medicine & International Health 14: 1097-1104.
Schmidt, K., K. M. Dressel, M. Niedrig, M. Mertens, S. A. Schuele, and M. H. Groschup. 2013. Public Health and Vector-Borne Diseases - A New Concept for Risk Governance. Zoonoses and Public Health 60: 528-538.
Schrider, D. R., and M. W. Hahn. 2010. Gene copy-number polymorphism in nature. Proceedings of the Royal Society B-Biological Sciences 277: 3213-3221.
Schuler, M. A., and M. R. Berenbaum. 2013. Structure and function of cytochrome P450S in insect adaptation to natural and synthetic toxins: Insights gained from molecular modeling. Journal of chemical ecology 39: 1232-1245.
Scott, J. G., M. H. Yoshimizu, and S. Kasai. 2015. Pyrethroid resistance in Culex pipiens mosquitoes. Pesticide Biochemistry and Physiology 120: 68-76.
Selkoe, K. A., and R. J. Toonen. 2006. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecology Letters 9: 615-629.
Severson, D. W., and S. K. Behura. 2012. Mosquito Genomics: Progress and Challenges. Annual Review of Entomology, Vol 57 57: 143-166.
Shang, Q., Y. Pan, K. Fang, J. Xi, A. Wong, J. A. Brennan, and C. Cao. 2014. Extensive Ace2 duplication and multiple mutations on Ace1 and Ace2 are related with high level of organophosphates resistance in Aphis gossypii. Environmental Toxicology 29: 526-533.
Silva, A. P. B., J. M. M. Santos, and A. J. Martins. 2014. Mutations in the voltage-gated sodium channel gene of anophelines and their association with resistance to pyrethroids - a review. Parasites & Vectors 7.
Simonsen, P. E., and M. E. Mwakitalu. 2013. Urban lymphatic filariasis. Parasitology Research 112: 35-44.
Smith, J. L., and D. M. Fonseca. 2004. Rapid assays for identification of members of the Culex (Culex) pipiens complex, their hybrids, and other sibling species (Diptera: Culicidae). The American journal of tropical medicine and hygiene 70: 339-345.
Smith, J. L., N. Keyghobadi, M. A. Matrone, R. L. Escher, and D. M. Fonseca. 2005. Cross-species comparison of microsatellite loci in the Culex pipiens complex and beyond. Molecular Ecology Notes 5: 697-700.
Smyth, G. K. 2005. Limma: linear models for microarray data, pp. 397-420, Bioinformatics and computational biology solutions using R and Bioconductor. Springer.
Soares-da-Silva, J., V. C. S. Pinheiro, E. Litaiff-Abreu, R. A. Polanczyk, and W. P. Tadei. 2015. Isolation of Bacillus thuringiensis from the state of Amazonas, in Brazil, and screening against Aedes aegypti (Diptera, Culicidae). Revista Brasileira de Entomologia 59: 1-6.
Soderlund, D. M. 2008. Pyrethroids, knockdown resistance and sodium channels. Pest Management Science 64: 610-616.
Soderlund, D. M. 2012. Molecular mechanisms of pyrethroid insecticide neurotoxicity: recent advances. Archives of toxicology 86: 165-181.
Sonoda, S., X. Shi, D. Song, P. Liang, X. Gao, Y. Zhang, J. Li, Y. Liu, M. Li, and M. Matsumura. 2014. Duplication of acetylcholinesterase gene in Diamondback moth strains with different sensitivities to acephate. Insect biochemistry and molecular biology 48: 83-90.
Sparks, T. C. 2013. Insecticide discovery: an evaluation and analysis. Pesticide Biochemistry and Physiology 107: 8-17.
Spinsanti, L., A. L. Basquiera, S. Bulacio, V. Somale, S. C. H. Kim, V. Re, D. Rabbat, A. Zarate, J. C. Zlocowski, C. Q. Mayor, M. Contigiani, and S. Palacio. 2003. St. Louis encephalitis in Argentina: The first case reported in the last seventeen years. Emerging Infectious Diseases 9: 271-273.
![Page 195: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/195.jpg)
181
Stanke, M., and B. Morgenstern. 2005. AUGUSTUS: a web server for gene prediction in eukaryotes that allows user-defined constraints. Nucleic acids research 33: W465-W467.
Strode, C., C. S. Wondji, J.-P. David, N. J. Hawkes, N. Lumjuan, D. R. Nelson, D. R. Drane, S. H. P. P. Karunaratne, J. Hemingway, W. C. Black, and H. Ranson. 2008. Genomic analysis of detoxification genes in the mosquito Aedes aegypti. Insect Biochemistry and Molecular Biology 38: 113-123.
Sunil, S., O. P. Singh, N. Nanda, K. Raghavendra, B. P. N. Reddy, and S. K. Subbarao. 2013. Analysis of population genetic structure of Indian Anopheles culicifacies species A using microsatellite markers. Parasites & Vectors 6.
Sunish, I. P., R. Rajendran, T. R. Mani, A. Munirathinam, A. P. Dash, and B. K. Tyagi. 2007. Vector control complements mass drug administration against bancroftian filariasis in Tirukoilur, India. Bulletin of the World Health Organization 85: 138-145.
Supek, F., M. Bošnjak, N. Škunca, and T. Šmuc. 2011. REVIGO summarizes and visualizes long lists of gene ontology terms. Plos One 6: e21800.
Syvanen, M., Z. H. Zhou, and J. Y. Wang. 1994. Glutathione transferase gene family from the housefly musca-domestica. Molecular & General Genetics 245: 25-31.
Syvanen, M., Z. Zhou, J. Wharton, C. Goldsbury, and A. Clark. 1996. Heterogeneity of the glutathione transferase genes encoding enzymes responsible for insecticide degradation in the housefly. Journal of molecular evolution 43: 236-240.
Takken, W., and B. G. Knols. 2009. Malaria vector control: current and future strategies. Trends in parasitology 25: 101-104.
Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739.
Tang, A. H., and C. Tu. 1994. Biochemical characterization of Drosophila glutathione S-transferases D1 and D21. Journal of Biological Chemistry 269: 27876-27884.
Tantely, M. L., P. Tortosa, H. Alout, C. Berticat, A. Berthomieu, A. Rutee, J.-S. Dehecq, P. Makoundou, P. Labbe, N. Pasteur, and M. Weill. 2010. Insecticide resistance in Culex pipiens quinquefasciatus and Aedes albopictus mosquitoes from La Reunion Island. Insect Biochemistry and Molecular Biology 40: 317-324.
Team, R. C. 2014. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria, 2012. ISBN 3-900051-07-0.
Terbot, J. W., M. R. Nikbakhtzadeh, and W. A. Foster. 2015. Evaluation of Bacillus thuringiensis israelensis as a control agent for adult Anopheles gambiae. Journal of the American Mosquito Control Association 31: 258-261.
Toma, L., M. Menegon, R. Romi, E. De Matthaeis, M. Montanari, and C. Severini. 2011. Status of insecticide resistance in Culex pipiens field populations from north‐eastern areas of Italy before the withdrawal of OP compounds. Pest management science 67: 100-106.
Uganda Bureau of Statistics, U. 2012. Uganda Demographic and Health Survey 2011, Kampala, Uganda: Uganda Bureau of Statistics, Maryland: ICF International Inc.
Uganda Bureau of Statistics, U. 2014. Replublic of Uganda National Population and Housing Census 2014: Provisional Results, Kampala, Uganda.
Uganda Bureau of Statistics, U. 2015. Uganda Malaria Indicator Survey 2014-15: Key Indicators. UBOS and ICF International, Kampala, Uganda, and Rockville, Maryland, USA.
van den Berg, H. 2011. Global status of DDT and its alternatives for use in vector control to prevent disease. Ciencia & Saude Coletiva 16: 575-590.
van den Berg, H., L. A. Kelly-Hope, and S. W. Lindsay. 2013. Malaria and lymphatic filariasis: the case for integrated vector management. The Lancet infectious diseases 13: 89-94.
Van den Berg, H., M. Zaim, R. S. Yadav, A. Soares, B. Ameneshewa, A. Mnzava, J. Hii, A. P. Dash, and M. Ejov. 2012. Global trends in the use of insecticides to control vector-borne diseases. Environmental health perspectives 120: 577-582.
![Page 196: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/196.jpg)
182
van den Hurk, A. F., S. A. Ritchie, and J. S. Mackenzie. 2009. Ecology and Geographical Expansion of Japanese Encephalitis Virus. Annual Review of Entomology 54: 17-35.
Van Oosterhout, C., W. F. Hutchinson, D. P. M. Wills, and P. Shipley. 2004. MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535-538.
Vatandoost, H., L. Ezeddinloo, A. H. Mahvi, M. R. Abai, E. B. Kia, and I. Mobedi. 2004. Enhanced tolerance of house mosquito to different insecticides due to agricultural and household pesticides in sewage system of Tehran, Iran. Iranian Journal of Environmental Health Science & Engineering 1: 46-50.
Verhaeghen, K., W. Van Bortel, P. Roelants, P. E. Okello, A. Talisuna, and M. Coosemans. 2010. Spatio-temporal patterns in kdr frequency in permethrin and DDT resistant Anopheles gambiae s.s. from Uganda. American Journal of Tropical Medicine and Hygiene 82: 566-573.
Vinciotti, V., R. Khanin, D. D'Alimonte, X. Liu, N. Cattini, G. Hotchkiss, G. Bucca, O. de Jesus, J. Rasaiyaah, C. P. Smith, P. Kellam, and E. Wit. 2005. An experimental evaluation of a loop versus a reference design for two-channel microarrays. Bioinformatics 21: 492-501.
Vinogradova, E. B. 2000. Culex pipiens pipiens mosquitoes: taxonomy, distribution, ecology, physiology, genetics, applied importance and control, Pensoft Publishers.
Vontas, J., J. P. David, D. Nikou, J. Hemingway, G. Christophides, C. Louis, and H. Ranson. 2007. Transcriptional analysis of insecticide resistance in Anopheles stephensi using cross‐species microarray hybridization. Insect molecular biology 16: 315-324.
Vontas, J. G., G. J. Small, and J. Hemingway. 2001. Glutathione S-transferases as antioxidant defence agents confer pyrethroid resistance in Nilaparvata lugens. Biochemical Journal 357: 65-72.
Vulule, J. M., R. F. Beach, F. K. Atieli, J. C. McAllister, W. G. Brogdon, J. M. Roberts, R. W. Mwangi, and W. A. Hawley. 1999. Elevated oxidase and esterase levels associated with permethrin tolerance in Anopheles gambiae from Kenyan villages using permethrin-impregnated nets. Medical and Veterinary Entomology 13: 239-244.
Wada, Y. 1988. Strategies for control of Japanese encephalitis in rice production systems in developing countries. Vector-borne disease control in humans through rice agroecosystem management: 153-160.
Wang, J.-y., S. McCommas, and M. Syvanen. 1991. Molecular cloning of a glutathione S-transferase overproduced in an insecticide-resistant strain of the housefly (Musca domestica). Molecular and General Genetics MGG 227: 260-266.
Wang, W., S. L. Liu, Y. Y. Liu, C. L. Qiao, S. L. Chen, and F. Cui. 2015. Over‐transcription of genes in a parathion‐resistant strain of mosquito Culex pipiens quinquefasciatus. Insect science 22: 150-156.
Wang, Z. M., C. X. Li, D. Xing, Y. H. Yu, N. Liu, R. D. Xue, Y. D. Dong, and T. Y. Zhao. 2012. Detection and widespread distribution of sodium channel alleles characteristic of insecticide resistance in Culex pipiens complex mosquitoes in China. Medical and Veterinary Entomology 26: 228-232.
Waterhouse, A. M., J. B. Procter, D. M. A. Martin, M. Clamp, and G. J. Barton. 2009. Jalview Version 2—a multiple sequence alignment editor and analysis workbench. Bioinformatics 25: 1189-1191.
Weetman, D., and M. J. Donnelly. 2015. Evolution of insecticide resistance diagnostics in malaria vectors. Transactions of The Royal Society of Tropical Medicine and Hygiene 109: 291-293.
Weetman, D., S. N. Mitchell, C. S. Wilding, D. P. Birks, A. E. Yawson, J. Essandoh, H. D. Mawejje, L. S. Djogbenou, K. Steen, and E. J. Rippon. 2015. Contemporary evolution of resistance at the major insecticide target site gene Ace‐1 by mutation and copy number variation in the malaria mosquito Anopheles gambiae. Molecular ecology.
![Page 197: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/197.jpg)
183
Weill, M., C. Malcolm, F. Chandre, K. Mogensen, A. Berthomieu, M. Marquine, and M. Raymond. 2004. The unique mutation in ace-1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect Molecular Biology 13: 1-7.
Weill, M., G. Lutfalla, K. Mogensen, F. Chandre, A. Berthomieu, C. Berticat, N. Pasteur, A. Philips, P. Fort, and M. Raymond. 2003. Insecticide resistance in mosquito vectors (vol 423, pg 136, 2003). Nature 425: 366-366.
Weissenböck, H., Z. Hubálek, T. Bakonyi, and N. Nowotny. 2010. Zoonotic mosquito-borne flaviviruses: worldwide presence of agents with proven pathogenicity and potential candidates of future emerging diseases. Veterinary microbiology 140: 271-280.
Whalon, M. E., D. Mota-Sanchez, and R. M. Hollingworth. 2008. Analysis of Global Pesticide Resistance in Arthropods. Global Pesticide Resistance in Arthropods: 5-31.
WHO. 2003. WHO Pesticide Evaluation Scheme (WHOPES). WHO. 2005. Global programme to eliminate lymphatic filariasis. Releve epidemiologique
hebdomadaire / Section d'hygiene du Secretariat de la Societe des Nations = Weekly epidemiological record / Health Section of the Secretariat of the League of Nations 80: 202-212.
WHO. 2011. Global insecticide use for vector-borne disease control: a 10-year assessment [2000-2009].
WHO. 2012a. Global programme to eliminate lymphatic filariasis: progress report, 2011. Wkly Epidemiol Rec 87: 346-356.
WHO. 2012b. Handbook for integrated vector management. WHO. 2013a. Test procedures for insecticide resistance monitoring in malaria vector mosquitoes. WHO. 2013b. Lymphatic filariasis: a handbook of practical entomology for national lymphatic
filariasis elimination programmes. Whyard, S., A. E. Downe, and V. K. Walker. 1995. Characterization of a novel esterase conferring
insecticide resistance in the mosquito Culex tarsalis. Archives of insect biochemistry and physiology 29: 329-342.
Wielgosz, B., E. Kato, and C. Ringler. 2014. Agro-ecology, household economics and malaria in Uganda: empirical correlations between agricultural and health outcomes. Malaria journal 13.
Wilding, C., D. Weetman, E. Rippon, K. Steen, H. Mawejje, I. Barsukov, and M. Donnelly. 2014. Parallel evolution or purifying selection, not introgression, explains similarity in the pyrethroid detoxification linked GSTE4 of Anopheles gambiae and An. arabiensis. Molecular Genetics and Genomics 290: 201-215.
Wilding, C. S., I. Smith, A. Lynd, A. E. Yawson, D. Weetman, M. J. I. Paine, and M. J. Donnelly. 2012. A cis-regulatory sequence driving metabolic insecticide resistance in mosquitoes: Functional characterisation and signatures of selection. Insect Biochemistry and Molecular Biology 42: 699-707.
Williamson, M. S., D. MartinezTorres, C. A. Hick, and A. L. Devonshire. 1996. Identification of mutations in the housefly para-type sodium channel gene associated with knockdown resistance (kdr) to pyrethroid insecticides. Molecular and General Genetics 252: 51-60.
Wondji, C. S., W. A. P. P. De Silva, J. Hemingway, H. Ranson, and S. H. P. P. Karunaratne. 2008. Characterization of knockdown resistance in DDT- and pyrethroid-resistant Culex quinquefasciatus populations from Sri Lanka. Tropical Medicine & International Health 13: 548-555.
Wondji, C. S., R. K. Dabire, Z. Tukur, H. Irving, R. Djouaka, and J. C. Morgan. 2011. Identification and distribution of a GABA receptor mutation conferring dieldrin resistance in the malaria vector Anopheles funestus in Africa. Insect biochemistry and molecular biology 41: 484-491.
Wood, O., S. Hanrahan, M. Coetzee, L. Koekemoer, and B. Brooke. 2010. Cuticle thickening associated with pyrethroid resistance in the major malaria vector Anopheles funestus. Parasit Vectors 3: 1-7.
![Page 198: livrepository.liverpool.ac.uklivrepository.liverpool.ac.uk/2047820/1/SilvaMartinsWal... · 2016-01-20 · Acknowledgements I would like to thank my supervisors Professor Martin Donnelly](https://reader034.vdocuments.net/reader034/viewer/2022042205/5ea7010023cd126ec76ac210/html5/thumbnails/198.jpg)
184
Wu, H., M. K. Kerr, X. Cui, and G. A. Churchill. 2003. MAANOVA: a software package for the analysis of spotted cDNA microarray experiments. The analysis of gene expression data: methods and software: 313-341.
Xu, Q., H. Q. Liu, L. Zhang, and N. N. Liu. 2005. Resistance in the mosquito, Culex quinque-fasciatus, and possible mechanisms for resistance. Pest Management Science 61: 1096-1102.
Xu, Q., L. Tian, L. Zhang, and N. Liu. 2011. Sodium channel genes and their differential genotypes at the L-to-F kdr locus in the mosquito Culex quinquefasciatus. Biochemical and Biophysical Research Communications 407: 645-649.
Yadouleton, A., K. Badirou, R. Agbanrin, H. Joest, R. Attolou, R. Srinivasan, G. Padonou, and M. Akogbeto. 2015. Insecticide resistance status in Culex quinquefasciatus in Benin. Parasites & Vectors 8.
Yan, L., P. Yang, F. Jiang, N. Cui, E. Ma, C. Qiao, and F. Cui. 2012. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families. Bmc Genomics 13.
Yang, T., and N. Liu. 2013. Permethrin resistance profiles in a field population of mosquitoes, Culex quinquefasciatus (Diptera: Culicidae). Journal of Medical Entomology 50: 585-593.
Yang, T., and N. Liu. 2014. Permethrin resistance variation and susceptible reference line isolation in a field population of the mosquito, Culex quinquefasciatus (Diptera: Culicidae). Insect Science 21: 659-666.
Yeka, A., A. Gasasira, A. Mpimbaza, J. Achan, J. Nankabirwa, S. Nsobya, S. G. Staedke, M. J. Donnelly, F. Wabwire-Mangen, A. Talisuna, G. Dorsey, M. R. Kamya, and P. J. Rosenthal. 2012. Malaria in Uganda: Challenges to control on the long road to elimination I. Epidemiology and current control efforts. Acta Tropica 121: 184-195.
Yewhalaw, D., F. Wassie, W. Steurbaut, P. Spanoghe, W. Van Bortel, L. Denis, D. A. Tessema, Y. Getachew, M. Coosemans, L. Duchateau, and N. Speybroeck. 2011. Multiple Insecticide Resistance: An Impediment to Insecticide-Based Malaria Vector Control Program. Plos One 6.
Yu, Q.-Y., C. Lu, W.-L. Li, Z.-H. Xiang, and Z. Zhang. 2009. Annotation and expression of carboxylesterases in the silkworm, Bombyx mori. BMC genomics 10: 553.
Zhang, H. G., R. H. Ffrenchconstant, and M. B. Jackson. 1994. A unique amino-acid of the Drosophila GABA receptor with influence on drug-sensitivity by 2 mechanisms. Journal of Physiology-London 479: 65-75.
Zhao, M., Y. Dong, X. Ran, Z. Wu, X. Guo, Y. Zhang, D. Xing, T. Yan, G. Wang, X. Zhu, H. Zhang, C. Li, and T. Zhao. 2014a. Point Mutations Associated with Organophosphate and Carbamate Resistance in Chinese Strains of Culex pipiens quinquefasciatus (Diptera: Culicidae). Plos One 9.
Zhao, M., Y. Dong, X. Ran, X. Guo, D. Xing, Y. Zhang, T. Yan, X. Zhu, J. Su, H. Zhang, G. Wang, W. Hou, Z. Wu, C. Li, and T. Zhao. 2014b. Sodium channel point mutations associated with pyrethroid resistance in Chinese strains of Culex pipiens quinquefasciatus (Diptera: Culicidae). Parasites & Vectors 7.
Zhao, Q., M.-J. Han, W. Sun, and Z. Zhang. 2014c. Copy number variations among silkworms. Bmc Genomics 15.
Zhao, Q., Z. Zhu, M. Kasahara, S. Morishita, and Z. Zhang. 2013. Segmental duplications in the silkworm genome. Bmc Genomics 14.
Zhong, Y., Y. Jia, Y. Gao, D. Tian, S. Yang, and X. Zhang. 2013. Functional requirements driving the gene duplication in 12 Drosophila species. Bmc Genomics 14.
Zielke, E., and F. Kuhlow. 1977. Inheritance of susceptibility for infection with Wuchereria bancrofti in Culex pipiens fatigans. Tropenmedizin Und Parasitologie 28: 68-70.