The FASEB Journal • Research Communication

4F Peptide reduces nascent atherosclerosis and inducesnatural antibody production in apolipoprotein E-nullmice

Geoffrey D. Wool,* Veneracion G. Cabana,* John Lukens,* Peter X. Shaw,†

Christoph J. Binder,‡,§ Joseph L. Witztum,† Catherine A. Reardon,* and Godfrey S. Getz*,1

*Department of Pathology, University of Chicago, Chicago, Illinois, USA; †Department of Medicine,University of California, San Diego, California, USA; ‡Center for Molecular Medicine (CeMM),Austrian Academy of Sciences, Vienna, Austria; and §Department of Laboratory Medicine, MedicalUniversity of Vienna, Vienna, Austria

ABSTRACT Our objective was to contrast the effectof apolipoprotein (apo) A-I mimetic peptides, such as4F and 4F-Pro-4F (Pro), on nascent and mature athero-sclerotic lesions and on levels of antibodies againstoxidation-specific epitopes. Chow-fed apoE�/� micewere injected intraperitoneally with either the 4F pep-tide or a tandem helix apoA-I mimetic peptide (Pro)every other day. Mice treated with 4F, but not Pro, for4 wk starting at 10 wk of age showed a dramaticdecrease in atherosclerosis at 2 arterial sites. However,neither peptide was effective in mice treated for 8 wkstarting at 20 wk of age; lesions were larger and moremature at this time point. Peptide treatment causedincreased production of antibodies against oxida-tion-specific epitopes, including a disproportionateinduction of the IgM natural antibody (NAb) E06/T15 to oxidized phospholipids. In summary, 4F, butnot the tandem peptide Pro, effectively inhibited earlyatherogenesis but was ineffective against more maturelesions. Two different apoA-I mimetic peptides in-creased titers of natural antibodies against oxidation-specific epitopes.—Wool, G. D., Cabana, V. G.,Lukens, J., Shaw, P. X., Binder, C. J., Witztum, J. L.,Reardon, C. A., Getz, G. S. 4F Peptide reduces nascentatherosclerosis and induces natural antibody produc-tion in apolipoprotein E-null mice. FASEB J. 25,290–300 (2011). www.fasebj.org

Key Words: mimetic � apoA-I � oxidation � innate immunity� E06/T15

Despite proper medical treatment, dyslipidemicpatients continue to face elevated cardiovascular dis-ease risk if their plasma HDL is low or nonfunctional(1, 2). HDL has several antiatherosclerotic mechanismsof action, including the inhibition of lipoprotein oxi-dation (3) and the removal of cholesterol from athero-sclerotic lesions (4). ApoA-I mimetic peptides thatboost various antiatherogenic properties of HDL havebeen under intense investigation as possible therapeu-tics (5–7). These peptides offer an easier therapeutic

strategy than directly infusing HDL or its major com-ponent apoprotein, apoA-I.

4F is an 18-aa peptide containing 4 phenylalanineresidues, which contribute to its hydrophobic proper-ties. 4F can alleviate chronic inflammation in severalanimal disease models, including atherosclerosis (6, 7).Like HDL, apoA-I mimetic peptides have a variety ofputative atheroprotective mechanisms, including act-ing as an antioxidant (8), mediating cholesterol effluxfrom foam cells (8), and direct antiinflammatory effects(5, 9). One of the most promising peptide mechanisms,which could explain the in vivo efficacy of 4F at lowconcentrations, is its capacity to bind oxidized phos-pholipids with high affinity (10). This finding led us toexplore whether mimetic peptides might influence thelevels of antibodies against oxidized lipids. OxidizedLDL and phospholipids are important for atherogene-sis (11), and antibodies against these lipids couldmodulate atherogenesis.

In our prior studies (8, 9), we investigated the in vitroand short-term in vivo properties of 4F and severaltandem peptides. These tandem peptides involved two4F 18-mer �-helices separated by various linkers (pro-line, alanine, and others). The tandem peptide con-taining a proline linker (referred to as Pro peptide) waschosen for these in vivo studies in light of the conservedproline residues in the interhelical regions of apoA-I(12). The properties of the single-helix 4F and tandem-helix Pro peptide differed from each other in severalrespects (8, 9). 4F remodeled mouse HDL, promotedcholesterol efflux from foam cells, and prevented LDLoxidation in vitro. 4F did not associate with HDL in vivo.The Pro peptide showed increased ability to remodelmouse HDL and promote cholesterol efflux relative tothe 4F peptide but did not prevent LDL oxidationin vitro. The Pro peptide associated with HDL in vivo.These results suggest that 4F and Pro peptide mighthave differing effects on atherosclerosis.

1 Correspondence: 5841 S. Maryland Ave MC1089, Chi-cago, Illinois 60637, USA. E-mail: g-getz@uchicago.edu

doi: 10.1096/fj.10-165670

290 0892-6638/11/0025-0290 © FASEB

The ability of apoA-I mimetic peptides to influenceatherosclerotic lesions at various points of temporaldevelopment has not been adequately investigated.Monotherapy with the peptides D4F or 5F is antiathero-genic for the small, early lesions of 9-wk-old chow-fedapoE�/� mice (13) or 24-wk-old cholate-diet-fed wild-type mice (14). The data conflict in indicating howeffectively 4F, using either l- or d-amino acids, haltsgrowth or regresses already established lesions (15, 16).The effectiveness of apoA-I mimetic peptides on estab-lished lesions is very important if 4F is to be used as ahuman therapeutic (17). Here we investigated theeffects of 4F and Pro in a single animal model at twodifferent time points of lesion development. We havedescribed previously the large, cellular lesions found in27-wk-old chow-fed apoE�/� mice at the aortic root andinnominate artery (18). Lesions from these mice bettermodel clinically significant atherosclerosis than do thesmall scattered foam cell lesions of extremely youngapoE�/� mice.

We assayed the ability of 4F and Pro to modify plasmalipid levels, influence titers of antibodies against oxida-tion-specific epitopes such as those found on oxidizedLDL, and to reduce atherosclerotic lesion area infemale apoE�/� mice fed a chow diet. Two protocols oftreatment were used (Fig. 1). These lengths of treat-ment coincide with previous reports in which peptideshad antiatherosclerotic effects after 4–5 wk (13, 16, 19)or 16 wk of treatment (14).

Based on previous reports, we anticipated that 4Fwould have an antiatherosclerotic effect on young, butnot mature, atherosclerotic lesions (13–16). With thedifferent properties of the monomeric and tandemhelix peptides in mind, we have tested the relativeefficacy of 4F and Pro peptide on both early andestablished atherosclerosis. If HDL remodeling andcholesterol efflux properties are more important forattenuating atherosclerosis, the Pro peptide shouldexhibit greater antiatherosclerotic effects (8). However,if antioxidant ability predominates for peptide efficacy,4F should be more atheroprotective (8).

MATERIALS AND METHODS

Peptides

Peptides containing l-amino acids were synthesized andpurified as described previously (9), or purified peptides

(�90% purity) were purchased from BioSynthesis (Lewisville,TX, USA). All peptides were N-terminally acetylated andC-terminally amidated (9). We adhere to the standard used byprevious reports in the apoA-I mimetic peptide literature thatthe denomination “4F” denotes the following peptide: Ac-DWFKAFYDKVAEKFKEAF-NH2 (13). “Pro” denotes the fol-lowing peptide: Ac-DWFKAFYDKVAEKFKEAF-P-DWFKAFYD-KVAEKFKEAF-NH2. Peptides administered to mice weresolubilized in sterile PBS.

Mice

All mice were in the C57BL/6 genetic background and werebred in-house. They were housed in microisolators in aspecific pathogen-free barrier facility at the University ofChicago, and experimental procedures were performed inaccordance with U.S. National Institutes of Health guidelinesunder protocols approved by the University of Chicago Ani-mal Care and Use Committee.

Female apoE�/� mice were maintained on a standardlaboratory chow diet (6.25% fat; TD7913; Harlan Teklad,Indianapolis, IN, USA). At 7–8 wk, mice whose total plasmacholesterol fell within the 300- to 500-mg/dl range wereselected for the study. Peptides were administered to miceunder 2 protocols: beginning at 10 wk of age for 4 wk, orbeginning at 20 wk of age for 8 wk (Fig. 1). The total numberof mice in each treatment group is shown in Table 1. All micecompleted the study, with no deaths. For those mice whoseatherosclerotic lesions were quantified, group sizes are asfollows: 4-wk PBS, 8 mice; 4-wk 4F, 8 mice; 4-wk Pro, 9 mice;8-wk PBS, 12 mice; 8-wk 4F, 13 mice; and 8-wk Pro, 11 mice.

Mice received intraperitoneal peptide or PBS injectionsevery other day and were given acidified drinking water withtrimethoprim-sulfamethoxazole. The mice were injected with50 �g 4F or 100 �g Pro peptide in PBS, with a total injectionvolume of 200 �l. This translates as �1.19 �g 4F peptide/gbody weight (bw)/d or �2.38 �g tandem peptide/g bw/d;this represents �0.5 nmol peptide/g bw/d of either peptide.

After 4 or 8 wk of peptide treatment, mice were sacrificed2 h after the last peptide injection and removal of chow.Anesthetized mice were exsanguinated and perfused transcar-dially under physiological pressure with PBS for 2 minfollowed by a 10-min perfusion with buffered formalin solu-tion (4% paraformaldehyde/5% sucrose in PBS). Selectedorgans were isolated prior to perfusion, their wet weight wasdetermined, and they were stored in RNAlater (Qiagen,Valencia, CA, USA) at �20°C.

Serum paraoxonase (PON) activity

PON activity was assayed as described previously (9) at theconclusion of the 8-wk treatment. Using phenyl acetate

Figure 1. Timeline of peptide treatment. Female apoE�/�

mice fed chow diet with total cholesterol between 300 to 500mg/dl at 8 wk of age were selected for the study. Chow-fedmice were either treated for 4 wk starting at 10 wk of age orwere treated for 8 wk starting at 20 wk of age.

TABLE 1. Mouse body and spleen weights at study termination

Treatment Body weight (g) Spleen weight (g)

4 wkPBS (10 mice) 20.48 � 1.15 0.1 � 0.024F (8 mice) 19.49 � 0.98* 0.08 � 0.01*Pro (9 mice) 20.94 � 1.50 0.08 � 0.02*

8 wkPBS (15 mice) 21.3 � 1.7 0.11 � 0.034F (15 mice) 21.0 � 1.3 0.10 � 0.01Pro (14 mice) 20.9 � 1.3 0.10 � 0.01

*P � 0.05 vs. 4 wk PBS treatment.

2914F PREVENTS EARLY ATHEROSCLEROSIS, INCREASES E06

substrate, the arylesterase activity of 6 concentrations ofunfractionated serum was determined for each mouse. Theactivity was monitored as the change in absorbance over 2min on the spectrophotometer. The activities for each serumconcentration were fit to a linear regression line. The worst-fitline had a value of r2 � 0.9938. The slope of the regressionline (change in OD per minute per microliter serum) wasused as the readout of mouse serum activity. This wasconverted to PON arylesterase units (U), or micromolesphenyl acetate hydrolyzed per minute per mililiter: (ODmin�1 ml�1)/(1310 M�1 cm�1).

Plasma SAA levels

At the conclusion of the 8-wk study, whole plasma wasseparated by SDS-PAGE and immunoblotted for SAA andapoA-I, as described previously (9). Relative SAA level wasquantitated by enhanced chemiluminescence (ECL) signalintensity.

Lipoproteins

Lipoprotein distribution was analyzed by fast protein liquidchromatography (FPLC), as described previously (9).

Atherosclerotic lesion size quantitation

The isolated murine heart with the upper arterial vasculatureand major branches intact was infused with Optimum CuttingTemperature (OCT) compound (Sakura Finetek, Torrence,CA, USA), and the superior portion of the heart was embed-ded in OCT, with a liver fragment placed on the heart’sascending aorta side to provide orientation, and frozen at�80°C.

The frozen tissue was sectioned serially into 10-�m sectionson a Leica cryostat (Leica Microsystems, Bannockburn, IL,USA). Specific portions of the innominate artery, ascendingaorta, and aortic root were saved according to the laboratory’sprotocol (18, 20). Atherosclerotic lesion size in the innom-inate artery was assessed using 4 sections between 150 to450 �m above the junction of the innominate artery withthe greater curvature of the aortic arch. Atheroscleroticlesion size in the ascending aorta was assessed using 3sections at the apex of the lesser curvature of the aorticarch. Atherosclerotic lesion size in the aortic root wasassessed using 3 sections beginning at the appearance of acoronary artery and the aortic valve leaflets. The sections inall three sites were separated by 100 �m from each other.Those sections were stained with Oil Red-O and FastGreen. Digital images were captured, and the atheroscle-rotic lesion size was quantified from those images usingOpenLab 3.1.5 software (PerkinElmer, Waltham, MA,USA).

Real-time quantitative PCR analysis

Spleens in RNAlater were disrupted using a polytron homog-enizer, and the mRNA was isolated using the Qiagen Minispin column kit according to the manufacturer’s protocol. Upto 5 �g RNA was used to generate cDNA using oligo dTprimers and the SuperScript III system (Invitrogen, SanDiego, CA, USA) according to the manufacturer’s protocol.Real-time PCR was performed using SYBR green on anApplied Biosystems Step One machine (Applied Biosystems,Foster City, CA, USA). The relative mRNA levels were deter-mined by the CT method, and HPRT was used as theendogenous control transcript. E06/T15 primers are specific

for the known VH complementarity determining region 3(CDR3) of the E06/T15 idiotype.

Oligonucleotides

EO6 VH: forward, CAGAGACACTTCCCAAAGCA; reverse,CCCAGACATCGAAGTACCAG.

HPRT: forward, ACCTCTCGAAGTGTTGGATA; reverse,CAACAACAAACTTGTCTGGA.

Natural antibody ELISA

Titers were assayed by a chemiluminescent immunoassay, asdescribed previously (21). Each condition represents 5–7individual plasma samples harvested at the end of the study.The values are in relative light units (RLU) per 100 ms 103.

To determine titers of IgM and IgG antibodies to OxLDL,50 �l of antigens at 5 �g/ml in PBS (containing 0.25 mMEDTA) was coated onto white, round-bottomed High BindingMicrofluor microtitration plates (Dynex Technologies, Chan-tilly, VA, USA) overnight at 4°C. After washing 4 times withPBS, using an automated plate washer (Biotek, Winooski, VT,USA), wells containing antigens were blocked with 75 �l TBSbuffer (containing 150 mM NaCl, 50 mM Tris base, 0.25 mMEDTA, and 1% BSA) for 30 min. Wells were washed again,and 50 �l of murine sera diluted 1:100 in TBS buffer wasincubated for 2 h at room temperature. After four more washsteps, the amount of murine antibodies bound was detectedby 1 h incubation with 50 �l of either alkaline phosphatase-labeled goat-anti-mouse IgM or goat-anti-mouse IgG (bothSigma, St Louis, MO, USA) diluted in TBS buffer at 1:35,000and 1:30,000, respectively. After further washing, 25 �l of a50% solution of LumiPhos (Lumigen Inc., Southfield, MI,USA) was incubated for 90 min at room temperature indarkness, and antibody binding was measured in RLU per 100ms using a Victor2 (Perkin Elmer). Unless otherwise indi-cated, the incubation times, volumes, and concentrationswere the same as above. For the determination of total IgM orIgG levels, wells were coated with goat-anti-mouse-IgM orgoat-anti-mouse-IgG (Sigma) at 5 �g/ml. Serum samples werediluted at 1:10,000, a concentration previously determined tobe within the linear detection range of this assay.

For the detection of EO6-type antibodies in the plasma ofmice, 2 �g/ml of the monoclonal anti-idiotypic (�T15 idio-type) antibody AB1–2 in PBS was coated onto microtitrationplates overnight at 4°C. After blocking, wells were washedagain, and 50 �l of murine sera diluted 1:100 was incubatedfor 2 h at room temperature. After further washing, boundT15id� IgM (EO6) was detected using AP-conjugated goat-anti-mouse IgM diluted in BSA-PBS followed by LumiPhos.Purified EO6 and EO14 (an IgM NAb specific for MDA-LDL;e.g., a non-T15 idiotype) were used as positive or negativecontrols, respectively.

Statistics

Data are presented as averages � sd. Student’s t test was usedfor determination of significant differences. Values of P �0.05 were considered significant.

RESULTS

Effect of peptide treatment on body and spleenweight, serum PON activity, and plasma SAA level

The terminal weights of mice undergoing peptidetreatment did not differ grossly compared with healthy

292 Vol. 25 January 2011 WOOL ET AL.The FASEB Journal � www.fasebj.org

untreated age-matched mice from our laboratory (datanot shown). Four weeks of 4F, but not Pro peptide,treatment significantly decreased mouse body weight by1 g (Table 1); however, neither the 4F nor Pro peptideaffected weight in the 8-wk-treated animals.

Weight loss can indicate an inflammatory response.We measured spleen weight as a marker of systemicinflammation. Neither control nor peptide injectionsincreased spleen weight relative to healthy untreatedmice from our laboratory (data not shown). In fact, the4-wk 4F and Pro treatments significantly reduced spleenweight by 0.02 g, while the 8-wk treatments had noeffect (Table 1). The drinking water contained tri-methoprim-sulfamethoxazole in order to lessen the riskof bacterial peritonitis. Our laboratory’s prior studieshave also used this antibiotic (18). No animals diedduring the current study, and no animals had evidenceof purulent peritonitis on sacrifice.

PON1 degrades proinflammatory oxidized phospho-lipids, and others have reported that D4F up-regulatesPON1 activity (5). We did not previously observe aneffect of 1 wk of 4F treatment on serum PON activity(9). In this study, 8 wk of 4F treatment caused anonsignificant trend toward increased PON activity(Fig. 2A).

Though we previously observed that a 1-wk treatment ofapoE�/� mice with the Pro peptide significantly de-creased the plasma acute-phase reactant SAA (9), a non-significant decrease in SAA levels was seen for 4F-treated,but not Pro-treated, mice after 8 wk (Fig. 2B).

4F had no effect on plasma cholesterol levels; Propeptide increased LDL-C

We did not expect either 4F or Pro peptides to influ-ence plasma lipid levels, given previous results in ourlaboratory (9) and others (13–16, 19).

In the 4-wk treatment group, 4F had no significanteffect on plasma total cholesterol (TC) compared to

controls, while Pro peptide significantly increased TC(45%, P�0.0001) (Table 2). Plasma triglyceride (TG)levels were decreased significantly by PBS and Protreatment, when comparing pre- and posttreatmentlevels. 4F treatment caused no significant change inposttreatment TG values, relative to pretreatment val-ues. Combined, these effects caused the post-4F-treat-ment TG values to be significantly higher than post-PBS-treatment TG values.

In the 8-wk treatment group, 4F also had no signifi-cant effect on plasma TC compared to controls (Table2). Pro-treated mice had significantly increased plasmacholesterol relative to PBS-treated mice (16%, P�0.04),which was due to an increase in LDL as determined byFPLC (Table 2). HDL-C did not differ significantly.

4F and Pro peptide increased E06/T15 mRNA levelsand natural antibody titers

The development of atherosclerosis is accompanied byincreases in titers of adaptive (IgG) and innate IgMnatural antibodies (NAbs) against oxidation-specificepitopes (22). This response can be monitored byantibody titers against experimentally modified LDL:copper-oxidized LDL (Cu-OxLDL) and malondialde-hyde-modified LDL (MDA-LDL). Dyslipidemia is alsoassociated with increased plasma titers and splenicexpression of the specific IgM NAb E06/T15, an idio-type that specifically binds to the phosphocholine head-group of oxidized phospholipids, inhibits oxLDL up-take by macrophages, and can be found withinatherosclerotic lesions (22, 23). To determine whetherpeptide administration affected the production ofthese antibodies, we measured splenic transcript levelsand plasma titers.

In the 4-wk treatment group, 4F significantly in-creased the level of E06/T15 mRNA 28-fold comparedto PBS controls (Fig. 3). Plasma antibody titers ofE06/T15 IgM from the 4-wk treatment group showed

Figure 2. A) Total serum PON activity is not modified by peptide treatment in 8-wk study. Arylesterase specific activity of serum(micromoles phenylacetate hydrolyzed per minute per milliliter) was determined for each individual mouse. No significantdifferences were seen among PBS (5 mice), 4F (7 mice), or Pro treatment (7 mice). B) Total plasma SAA levels are not modifiedby peptide treatment in 8-wk study. Whole plasma was separated by SDS-PAGE and immunoblotted. No significant differenceswere seen between PBS (3 mice), 4F (3 mice), or Pro treatment (3 mice).

2934F PREVENTS EARLY ATHEROSCLEROSIS, INCREASES E06

no significant effect of 4F administration (data notshown), despite the elevated mRNA level of E06/T15.

In the 8-wk treatment group, 4F was associated with a46-fold increase in E06/T15 mRNA relative to controls(Fig. 3). Eight weeks of Pro peptide treatment caused asignificant 9-fold increase in splenic E06/T15 mRNAlevel (Fig. 3). 4F treatment significantly elevated E06/T15 IgM titers, IgM titers to MDA-LDL and Cu-oxLDL,and IgG titers to Cu-oxLDL (Table 3). E06/T15 showedthe greatest increase, roughly 10-fold. Pro peptidetreatment caused significantly elevated E06/T15 IgMtiters, IgM titers to Cu-oxLDL, and IgG to Cu-oxLDL.Once again, E06/T15 showed the greatest increase ofthe antibodies: a roughly 6-fold increase with the Propeptide. The induction of IgM NAb titers was quitespecific, as total IgM levels did not differ between PBS-,4F-, or Pro-treated animals. In the case of adaptive IgG,total IgG levels were the same between PBS and 4Fmice, though significantly increased in Pro-treatedmice (P�0.05).

Four-week 4F treatment significantly reduced nascentatherosclerosis

In mice treated with PBS for 4 wk starting at 10 wk of age, theinnominate artery (IA) lesions were small (Fig. 4A). 4F-treated mice had 79% smaller IA lesions than PBS controls(P�0.05). Pro-treated mice had nonsignificantly largerlesions than PBS controls. In PBS controls as well asPro-treated mice, foam cells were present on both theintimal surface as well as between the innermost mediallamellae (Fig. 4B). In 4F-treated mice, scattered foamcells were only noted on the intimal surface. No fibrouscaps or acellular gruel were present in the IA regardlessof treatment.T

AB

LE

2.Pl

asm

alip

idan

dlip

opro

tein

leve

ls

Lip

idor

lipop

rote

in

4-w

kst

udy

8-w

kst

udy

PBS,

n�

104F

,n

�8

Pro,

n�

9PB

S,n

�15

4F,

n�

14Pr

o,n

�14

Pre

Post

Pre

Post

Pre

Post

Pre

Post

Pre

Post

Pre

Post

TC

395

�55

438

�95

384

�41

479

�13

237

3�

3463

5�

62ˆ,%

399

�59

526

�15

638

7�

5258

4�

8339

1�

4061

2�

72@

TG

62�

1236

�6

53�

1348

�4*

49�

12&

26�

14*,#

Ch

ylo

rem

nan

t/V

LD

L-C

363

�12

242

6�

9741

3�

83L

DL

-C14

2�

2913

9�

1718

8�

28$

HD

L-C

18�

514

�8

21�

9

Val

ues

are

aver

age

�sd

(mg/

dl).

Pre,

pret

reat

men

tat

8–9

wk;

post

,po

sttr

eatm

ent

atco

ncl

usio

nof

expe

rim

ent;

TC

,to

tal

chol

este

rol;

TG

,tr

igly

ceri

de;

VL

DL

-C,

very

low

den

sity

lipop

rote

inch

oles

tero

l;L

DL

-C,l

ow-d

ensi

tylip

opro

tein

chol

este

rol;

HD

L-C

,hig

h-d

ensi

tylip

opro

tein

chol

este

rol.

ˆP�

0.00

01vs

.4-w

kpo

st-P

BS-

trea

tmen

t;%

P�

0.00

5vs

.4-

wk

post

-4F-

trea

tmen

t;@

P�

0.05

vs.

8-w

kpo

st-P

BS-

trea

tmen

t;*P

�0.

0005

vs.4

-wk

post

-PB

S-tr

eatm

ent;

&P

�0.

02vs

.4w

kpr

e-PB

S-tr

eatm

ent;

#P

�0.

0005

vs.4

-wk

post

-4F-

trea

tmen

t;$P

�0.

005

vs.8

-wk

post

-PB

S-an

dpo

st-4

F-tr

eatm

ent.

Figure 3. Influence of peptides on splenic E06/T15 mRNAlevel. E06/T15 transcript levels were determined by real-timePCR using primers specific for the known VH CDR3 region ofthe E06/T15 idiotype. E06/T15 PCR signal was normalizedagainst HPRT and expressed as levels found in peptide-treated mice relative to those found in PBS-treated controlmice.

294 Vol. 25 January 2011 WOOL ET AL.The FASEB Journal � www.fasebj.org

4F-treated mice had no atherosclerotic lesion in theaortic arch (AA) (Fig. 4A). Lesions from the AA in PBScontrol mice averaged roughly 4400 �m2 in size(P�0.01 as compared to 4F-treated mice) and weremade up of intimal surface foam cells (Fig. 4B). AAlesions from Pro-treated mice averaged 2600 �m2,which did not differ significantly from controls; thoselesions were also made up of intimal surface foam cells.

The aortic root (AR) demonstrated foam-cell richlesions in both peptide-treated mice and controls (Fig.4B). 4F and Pro-treated mice had �25% smaller ARlesions than PBS controls, but these differences did notreach significance (Fig. 4A).

Overall, 4F significantly reduced nascent atheroscle-rosis at 2 of 3 vascular sites studied in 14-wk-old femaleapoE�/� mice treated for 4 wk. Pro peptide caused nosignificant change in lesion size under this treatmentprotocol.

Eight-week peptide treatment did not decreaseatherosclerotic lesion size in older mice

In mice treated for 8 wk starting at 20 wk of age,atherosclerotic lesions were much larger and moremature (Fig. 5) than those from the 4-wk treatmentgroup (Fig. 4); please note the differing scales forquantitation of the lesions.

4F- and Pro-treated mice had smaller IA lesions thancontrols, but these differences were not significant (Fig.5A). The IA lesions were large, complex, and cellular.No consistent morphological differences were seenbetween any treatment groups. Lesions typically con-tained multiple layers, and acellular necrotic gruel wasprominent. Fibrous caps over the lesions were generallyquite thin, only 1–2 cells thick (Fig. 5B).

4F-treated mice had smaller AA lesions than PBScontrols, but again, this difference was not significant(Fig. 5A). AA lesion size in Pro-treated mice was com-parable to controls. The AA lesions in the 8-wk treat-ment group had fibrous caps and areas of acellularmaterial (Fig. 5B).

The AR demonstrated quite robust lesions for eachtreatment group (Fig. 5A). 4F- and Pro-treated micehad slightly larger AR lesions than controls, but neitherresult reached significance. The AR lesions were large,complex, and cellular. No consistent morphologicaldifferences were seen between any treatments. Lesions

encompassed all three sinuses, though the left coronarysinus (LCS) had the largest lesion size, as expected(24). Cholesterol clefts and areas of amorphous ne-crotic gruel were ubiquitous. The coronary ostia fre-quently showed lesion formation (Fig. 5B).

Overall, neither apoA-I mimetic peptide significantlyaffected atherosclerotic lesion size or morphology inchow-fed 28-wk-old female apoE�/� mice.

DISCUSSION

This is the first demonstration of the differential effec-tiveness of 4F on atherosclerosis depending on thestage of lesion development within the same murinemodel and experimental conditions. Navab et al. (25)previously showed that D4F combined with a statin wasatheroprotective regardless of lesion maturity. We showhere that intraperitoneal administration of l-aminoacid-based 4F alone can inhibit early lesion formationbut does not influence the progression of more maturelesions. Pro peptide, however, was not effective atpreventing atherosclerosis at either time point.

A 4-wk treatment of 4F dramatically reduced athero-sclerosis in 14-wk-old chow-fed apoE�/� mice in theinnominate artery and aortic arch, but not the aorticroot. As expected, this reduction in atherosclerosis wasnot associated with any change in plasma TC or HDL-C.4F treatment did not significantly affect TG levels, whilePBS- and Pro-treated mice had significantly decreasedTG levels. This decrease in TG levels may be due to atransient mild sterile inflammatory response (40) re-lated to injection, as lipids were measured 2 h after thelast peptide injection. If this transient inflammatoryresponse had truly occurred, it was not great enough tocause splenic enlargement. 4F-treated mice had nochange in TG levels, which might indicate that 4Fblocked an inflammatory reaction.

A 4-wk treatment with Pro peptide had no effect onlesion size but did significantly increase plasma TC levels.Eight weeks of 4F or Pro peptide did not influenceatherosclerosis in chow-fed 28-wk-old apoE�/� mice,though Pro peptide treatment significantly increasedLDL-C levels. We have shown that biotinylated Pro pep-tide associates with LDL (9), an effect that might interferewith LDL clearance and cause increased LDL-C. Potential

TABLE 3. Plasma antibodies against oxidized epitopes in 8 wk mice

Antibody specificity Antibody class PBS, n � 5 4F, n � 5 Pro, n � 8

MDA-LDL IgM 235.43 � 19.2 287.22 � 26.1* 242.77 � 37.3IgG 35.03 � 26.9 17.38 � 12.8 19.17 � 3.7

Cu-oxLDL IgM 101.81 � 33.0 249.85 � 20.0* 162.08 � 52.6*IgG 1.29 � 0.2 4.49 � 0.6* 3.0 � 1.0*

E06/T15 IgM 25.7 � 32.1 251.32 � 6.0* 165.0 � 76.3*Plasma total IgM 149.95 � 38.8 143.22 � 15.5 119.73 � 25.9Plasma total IgG 21.43 � 12.2 29.45 � 5.4 43.51 � 12.6*

Values are average � sd luminescence (103 RLU/100 ms); intratiter comparisons. *P � 0.05 vs. PBS treatment.

2954F PREVENTS EARLY ATHEROSCLEROSIS, INCREASES E06

antiatherogenic effects of Pro peptide could have beenoverridden by the elevated LDL levels.

Previous reports have suggested that the atheropro-tective ability of apoA-I mimetic peptides is sensitive tothe stage of lesion evolution. Li et al. (15) have exam-ined the effect of d-amino acid 4F on the accelerated

lesions of 20-week old apoE�/� mice fed 21% fat/0.15% cholesterol diet. Four weeks of D4F did notreverse atherosclerosis in established aortic root le-sions. These lesions were large (�4105 �m2), similarto the aortic root lesions described in our 8-wk treat-ment group. In contrast to this, the peptides D4F and

Figure 4. A) Reduction of atherosclerotic lesion size in 4-wk protocol. Lesions were significantly reduced in the innominateartery (IA) and aortic arch (AA) in 4F-treated mice. Reduction of lesion size in the aortic root (AR) did not reach significance.B) Photomicrographs of representative lesions from the 4-wk study. Arrows indicate the small atherosclerotic lesions present atthis time point.

296 Vol. 25 January 2011 WOOL ET AL.The FASEB Journal � www.fasebj.org

5F were antiatherogenic in the small, early lesions of9-wk-old chow-fed apoE�/� mice (13) or 24-wk-oldcholate-diet-fed wild-type mice (14). Here, we haveconfirmed an important temporal limitation to pep-tide efficacy within the same mouse model andvascular site.

The Garber et al. (14) study showed an antiathero-genic effect of 5F after injecting mice intraperitoneallydaily for 16 wk. The treatment groups were controls

(200 �l PBS) or 5F (20 �g 5F in 200 �l PBS). We usedthe Garber et al. (14) study as a guide for our chosenmethods. To lessen peritoneal trauma, we halved theinjection frequency and increased the peptide dose2.5-fold (50 �g). Whereas we injected �1.19 �g 4F/gbw/d, Garber et al. injected roughly �0.952 �g 5F/gbw/d. We administered Pro peptide at an equal molardose compared to 4F (2.38 �g/g bw/d). In the Li et al.(15) study, despite IP injection of 50 �g of D4F daily (in

Figure 5. A) Lack of peptide effect in 8-wk protocol. 4F or Pro peptide did not significantly influence lesion size at any vascularsite in the 8-wk protocol. B) Photomicrographs of representative lesions from the 8-wk study.

2974F PREVENTS EARLY ATHEROSCLEROSIS, INCREASES E06

200 �l saline) for 4 wk, established aortic root lesionswere not reversed.

Lipoprotein oxidation creates a cascade of oxidizedproducts, including conjugated dienes, hydroperox-ides, aldehydes such as malondialdehyde, and aldehydeadducts with apoB (26). These adducts serve as neo-epitopes for both adaptive (IgG) as well as natural(IgM) T-cell-independent antibodies. NAbs are pre-dominantly produced by B-1 cells (27), which initiallyreside in body cavities such as the peritoneum beforemigrating to the spleen and differentiating into plasmacells. The prototypic NAb, E06/T15, recognizes thephosphocholine headgroup of oxidized phospholipids,but not of native phospholipids (28). The titers of suchoxidation-specific antibodies appear to reflect a re-sponse to the ongoing generation of oxidative epitopes,as occurs in atherogenesis. Typically, the titers of anti-oxLDL antibodies correlate with plasma lipid elevationand atherosclerotic lesion progression in mice (29).Substantially increasing anti-oxLDL antibody titers viaimmunization is atheroprotective in animal models(30, 31).

We had expected that 4F, known to inhibit lipopro-tein oxidation and scavenge oxidized lipids (5, 6),would decrease oxidation-specific NAb titers. Unex-pectedly, we found that both 4F and Pro peptidessignificantly increased transcript levels (after 4 and 8 wkof treatment) and plasma titers (8 wk of treatment) ofNAbs against oxidation-specific epitopes. However, to-tal IgM levels were not increased in these mice. Thisfinding suggests that the apoA-I mimetic peptidescaused the selective expansion of B-1 cells with anti-body specificity for oxidation-specific epitopes. Thisexpansion was not consistently associated with in-creased plasma lipid levels.

The mechanism by which apoA-I mimetic peptidesincrease NAbs is currently unknown. However, the factthat the peptides were much more effective at increas-ing the titer of the oxidized phospholipid-specific NAbE06/T15 than the titers of other IgM antibodies againstmodified LDLs, which are presumably predominantlyNAbs as well, suggests a potential mechanism. E06/T15recognizes the phosphocholine headgroup of oxidizedphospholipids. Others have reported that 4F selectivelybinds oxidized phospholipid with high affinity (10),and apoA-I mimetic peptides can extract oxidizedphospholipid hydroperoxides from lipoproteins andcells (32). If the apoA-I mimetics preferentially bindoxidized phospholipid in vivo, they might then prefer-entially present to professional antigen presenting cellsand/or B-1 cells leading to enhanced generation ofE06/T15, similar to lipid antigen presentation via CD1molecules activating natural killer T cells (33, 34).Indeed, E06/T15 plasma titers increased ten-fold ormore with both mimetic peptides, whereas the titers ofIgM to OxLDL and MDA-LDL (which comprise a widevariety of oxidized epitopes other than oxidized phos-pholipid) increased only 2-fold. Future studies will beneeded to test this hypothesis.

The increase in the splenic transcripts for E06/T15at the end of the 4-wk intervention reflects the earlyexpansion of E06/T15 generating B-1 cells, but in-creases in plasma E06/T15 titers were not yet observed.The difference between splenic transcript and titercould reflect the production of membrane-bound IgMbefore switching to secreted IgM, causing a delay in theelevation of plasma titers (35, 36). The real-time prim-ers span the E06/T15 VH CDR3 region only. Therefore,transcript levels would be increased during synthesis ofmembrane-bound E06/T15 while the titer would re-main low. Previously we found that it took at least 6 wkfollowing the transfer of B-1 cells into the peritoneumof RAG1�/� mice before plasma titers of IgM could beobserved (unpublished observations). In this interval,the B-1 cells must migrate to the spleen, proliferate,and differentiate into plasma cells before IgM Ab canbe released into the plasma in sufficient titers to bemeasured. Indeed, observable increases in E06/T15titers of nearly 10-fold were seen 8 wk after the intro-duction of the apoA-I peptides.

Previous studies have shown that marked elevationsof E06/T15 titers achieved by exogenous immuniza-tions (up to 10,000-fold over that found in nonimmu-nized mice) over 6 mo to 1 yr provided atheroprotec-tion (27, 37). In the current studies, the much moremodest change in E06/T15 titers (only 10-fold) over arelatively short duration precludes any definitive con-clusion about the relationship between the titer ofthese antibodies and the progression of atherosclerosis.The minimum level of NAb that affords atheroprotec-tion is currently unknown and needs further study.

The Li et al. (15) study is the only previous report toexamine the influence of apoA-I mimetic peptides onantibodies against oxidized epitopes. The titer of IgGagainst Cu-oxLDL was not changed by D4F. In contrastto the Li et al. (15) study, we have shown that 4Ftreatment increased the titers of IgG against Cu-oxLDLas well as several natural IgM antibodies. The reason forthis difference is unknown.

Our results correlate peptide atheroprotection withthe antioxidative capacities of 4F and its high affinityfor oxidized lipids. The putative mechanisms by whichapoA-I mimetic peptides function as atheroprotectiveagents have recently been reviewed (6, 7). Besidesits antioxidative mechanisms of action, 4F might haveadditional important effects on cytokine production bymacrophages or reverse cholesterol transport (RCT).Navab and colleagues (5, 39) have shown that D4Fadministration to mice increased pre-� HDL levels.That lipoprotein subclass can initiate RCT (38), andD4F increased the cholesterol efflux acceptance capac-ity of HDL ex vivo (5, 39). We have shown previouslythat Pro peptide more potently effluxes cholesterolfrom cultured foam cells and generates pre-� HDL invitro, as compared to 4F (8). However, we saw noincrease in pre-� HDL after a 1-wk 4F treatment (9),nor any change in the lipoprotein distribution after anytreatment presented here (Table 2). It is also unlikelythat even an undetectable increase in pre-� HDL took

298 Vol. 25 January 2011 WOOL ET AL.The FASEB Journal � www.fasebj.org

place in our study, as the ex vivo cholesterol effluxacceptance capacity of plasma from peptide treatedmice was not increased (data not shown). In our hands,neither 4F nor Pro caused an increase in HDL-C, shiftin plasma FPLC cholesterol profile consistent withpre-� HDL formation, nor a change in the ex vivocholesterol efflux acceptance capacity of the plasma.

Despite the more potent in vitro formation of pre-�HDL and cholesterol efflux by the Pro peptide, itaffords no atheroprotection against early atherogene-sis. Whether higher levels of Pro peptide would bemore effective remains to be determined. However, thelower levels of NAbs seen with the Pro peptide treat-ment could indicate that this peptide does not bind orpresent oxidized lipids as effectively as does 4F.

In summary, intraperitoneal l-amino acid 4F peptidecan reduce nascent, but not mature, atheroscleroticlesions. The effects of 4F are unique to its sequence, asthe tandem helix peptide Pro was ineffective at athero-prevention. However, both 4F and Pro peptide treat-ment induced production of NAbs against oxidizedlipids, with 4F being more effective than the Propeptide.

This work was supported by the U.S. National Institutes ofHealth/National Heart, Lung, and Blood Institute (HL68661to GSG) and the Foundation Leducq (to G.S.G., C.J.B., andJ.L.W.). G.D.W. has received support from the NationalInstitute of Child Health and Human Development(HD007009 Graduate Training in Growth and Develop-ment), the Francis L. Lederer Foundation Scholarship Fund,and an American Heart Association predoctoral fellowship.J.L.W. is named as inventor in patents and patent applicationsfrom the University of California–San Diego for the potentialcommercial use of antibodies to oxidized LDL.

REFERENCES

1. Kontush, A., and Chapman, M. J. (2006) Functionally defectivehigh-density lipoprotein: a new therapeutic target at the cross-roads of dyslipidemia, inflammation, and atherosclerosis. Phar-macol. Rev. 58, 342–374

2. Duffy, D., and Rader, D. J. (2009) Update on strategies toincrease HDL quantity and function. Nat. Rev. Cardiol. 6,455–463

3. Shao, B., and Heinecke, J. W. (2009) HDL, lipid peroxidation,and atherosclerosis. J. Lipid Res. 50, 599–601

4. Rader, D. J., Alexander, E .T., Weibel, G. L., Billheimer, J., andRothblat, G. H. (2009). The role of reverse cholesterol transportin animals and humans and relationship to atherosclerosis. J.Lipid Res. 50(Suppl.), S189–S194

5. Navab, M., Anantharamaiah, G. M., Reddy, S. T., Hama, S.,Hough, G., Grijalva, V. R., Yu, N., Ansell, B. J., Datta, G., Garber,D. W., and Fogelman, A. M. (2005) Apolipoprotein A-I mimeticpeptides. Arterioscler. Thromb. Vasc. Biol. 25, 1325–1331

6. Getz, G. S., Wool, G. D., and Reardon, C. A. (2009) ApoproteinA-I mimetic peptides and their potential anti-atherogenic mech-anisms of action. Curr. Opin. Lipidol. 20, 171–175

7. Navab, M., Shechter, I., Anantharamaiah, G. M., Reddy, S. T.,Van Lenten, B. J., and Fogelman, A. M. (2010) Structure andfunction of HDL mimetics. Arterioscler. Thromb. Vasc. Biol. 30,164–168

8. Wool, G. D., Reardon, C. A., and Getz, G. S. (2008) Apolipopro-tein A-I mimetic peptide helix number and helix linker influ-ence potentially anti-atherogenic properties. J. Lipid Res. 49,1268–1283

9. Wool, G. D., Vaisar, T., Reardon, C. A., and Getz, G. S. (2009)An apoA-I mimetic peptide containing a proline residue hasgreater in vivo HDL binding and anti-inflammatory ability thanthe 4F peptide. J. Lipid Res. 50, 1889–1900

10. Van Lenten, B. J., Wagner, A. C., Jung, C. L., Ruchala, P.,Waring, A. J., Lehrer, R. I., Watson, A. D., Hama, S., Navab, M.,Anantharamaiah, G. M., and Fogelman, A. M. (2008) Anti-inflammatory apoA-I-mimetic peptides bind oxidized lipids withmuch higher affinity than human apoA-I. J. Lipid Res. 49,2302–2311

11. Glass, C. K., and Witztum, J. L. (2001) Atherosclerosis: the roadahead. Cell 104, 503–516

12. Carnemolla, R., Ren, X., Biswas, T. K., Meredith, S. C., Reardon,C. A., Wang, J., and Getz, G. S. (2008) The specific amino acidsequence between helices 7 and 8 influences the bindingspecificity of human apolipoprotein A-I for high density lipopro-tein (HDL) subclasses: a potential for HDL preferential gener-ation. J. Biol. Chem. 283, 15779–15788

13. Navab, M., Anantharamaiah, G. M., Hama, S., Garber, D. W.,Chaddha, M., Hough, G., Lallone, R., and Fogelman, A. M.(2002) Oral administration of an Apo A-I mimetic Peptidesynthesized from D-amino acids dramatically reduces athero-sclerosis in mice independent of plasma cholesterol. Circulation105, 290–292

14. Garber, D. W., Datta, G., Chaddha, M., Palgunachari, M. N.,Hama, S. Y., Navab, M., Fogelman, A. M., Segrest, J. P., andAnantharamaiah, G. M. (2001) A new synthetic class A amphi-pathic peptide analogue protects mice from diet-induced ath-erosclerosis. J. Lipid Res. 42, 545–552

15. Li, X., Chyu, K. Y., Faria Neto, J. R., Yano, J., Nathwani, N.,Ferreira, C., Dimayuga, P. C., Cercek, B., Kaul, S., and Shah,P. K. (2004) Differential effects of apolipoprotein A-I-mimeticpeptide on evolving and established atherosclerosis in apoli-poprotein E-null mice. Circulation 110, 1701–1705

16. Van Lenten, B. J., Wagner, A. C., Navab, M., Anantharamaiah,G. M., Hama, S., Reddy, S. T., and Fogelman, A. M. (2007)Lipoprotein inflammatory properties and serum amyloid Alevels but not cholesterol levels predict lesion area in cholesterol-fed rabbits. J. Lipid Res. 48, 2344–2353

17. Bloedon, L. T., Dunbar, R., Duffy, D., Pinell-Salles, P., Norris, R.,DeGroot, B. J., Movva, R., Navab, M., Fogelman, A. M., andRader, D. J. (2008) Safety, pharmacokinetics, and pharmacody-namics of oral apoA-I mimetic peptide D-4F in high-risk cardio-vascular patients. J. Lipid Res. 49, 1344–1352

18. Reardon, C. A., Blachowicz, L., White, T., Cabana, V., Wang, Y.,Lukens, J., Bluestone, J., and Getz, G. S. (2001) Effect ofimmune deficiency on lipoproteins and atherosclerosis in maleapolipoprotein E-deficient mice. Arterioscler. Thromb. Vasc. Biol.21, 1011–1016

19. Ou, J., Wang, J., Xu, H., Ou, Z., Sorci-Thomas, M. G., Jones,D. W., Signorino, P., Densmore, J. C., Kaul, S., Oldham, K. T.,and Pritchard Jr., K.A. (2005) Effects of D-4F on vasodilationand vessel wall thickness in hypercholesterolemic LDL receptor-null and LDL receptor/apolipoprotein A-I double-knockoutmice on Western diet. Circ. Res. 97, 1190–1197

20. VanderLaan, P. A., Reardon, C. A., Sagiv, Y., Blachowicz, L.,Lukens, J., Nissenbaum, M., Wang, C.-R., and Getz, G. S. (2007)Characterization of the natural killer T-cell response in anadoptive transfer model of atherosclerosis. Am. J. Pathol. 170,1100–1107

21. Chou, M. Y., Fogelstrand, L., Hartvigsen, K., Hansen, L. F.,Woelkers, D., Shaw, P. X., Choi, J., Perkmann, T., Backhed, F.,Miller, Y. I., Horkko, S., Corr, M., Witztum, J. L., and Binder,C. J. (2009) Oxidation-specific epitopes are dominant targets ofinnate natural antibodies in mice and humans. J. Clin. Invest.119, 1335–1349

22. Chou, M. Y., Hartvigsen, K., Hansen, L. F., Fogelstrand, L.,Shaw, P. X., Boullier, A., Binder, C. J., and Witztum, J. L. (2008)Oxidation-specific epitopes are important targets of innateimmunity. J. Intern. Med. 26 3, 479–488

23. Shaw, P. X., Horkko, S., Chang, M. K., Curtiss, L. K., Palinski, W.,Silverman, G. J., and Witztum, J. L. (2000) Natural antibodies withthe T15 idiotype may act in atherosclerosis, apoptotic clearance,and protective immunity. J. Clin. Invest. 105, 1731–1740

24. VanderLaan, P. A., Reardon, C. A., and Getz, G. S. (2004) Sitespecificity of atherosclerosis: site-selective responses to athero-sclerotic modulators. Arterioscler. Thomb. Vasc. Biol. 24, 12–22

2994F PREVENTS EARLY ATHEROSCLEROSIS, INCREASES E06

25. Navab, M., Anantharamaiah, G. M., Hama, S., Hough, G.,Reddy, S. T., Frank, J. S., Garber, D. W., Handattu, S., andFogelman, A. M. (2005) D-4F and statins synergize to renderHDL antiinflammatory in mice and monkeys and cause lesionregression in old apolipoprotein E-null mice. Arterioscler.Thromb. Vasc. Biol. 25, 1426–1432

26. Stocker, R., and Keaney Jr., J.F. (2004) Role of oxidativemodifications in atherosclerosis. Physiol. Rev. 84, 1381–1478

27. Binder, C. J., Hartvigsen, K., Chang, M. K., Miller, M., Broide,D., Palinski, W., Curtiss, L. K., Corr, M., and Witztum, J. L.(2004) IL-5 links adaptive and natural immunity specific forepitopes of oxidized LDL and protects from atherosclerosis.J. Clin. Invest. 114, 427–437

28. Friedman, P., Horkko, S., Steinberg, D., Witztum, J. L., andDennis, E. A. (2002) Correlation of antiphospholipid antibodyrecognition with the structure of synthetic oxidized phospho-lipids. Importance of Schiff base formation and aldol conden-sation. J. Biol. Chem. 277, 7010–7020

29. Tsimikas, S., Palinski, W., and Witztum, J. L. (2001) Circulatingautoantibodies to oxidized LDL correlate with arterial accumu-lation and depletion of oxidized LDL in LDL receptor-deficientmice. Arterioscler. Thromb. Vasc. Biol. 21, 95–100

30. Palinski, W., Miller, E., and Witztum, J. L. (1995) Immunizationof low density lipoprotein (LDL) receptor-deficient rabbits withhomologous malondialdehyde-modified LDL reduces athero-genesis. Proc. Natl. Acad. Sci. U. S. A. 92, 821–825

31. Caligiuri, G., Khallou-Laschet, J., Vandaele, M., Gaston, A. T.,Delignat, S., Mandet, C., Kohler, H. V., Kaveri, S. V., andNicoletti, A. (2007) Phosphorylcholine-targeting immunizationreduces atherosclerosis. J. Am. Coll. Cardiol. 50, 540–546

32. Navab, M., Hama, S. Y., Cooke, C. J., Anantharamaiah, G. M.,Chaddha, M., Jin, L., Subbanagounder, G., Faull, K. F., Reddy,S. T., Miller, N. E., and Fogelman, A. M. (2000) Normal highdensity lipoprotein inhibits three steps in the formation of mildlyoxidized low density lipoprotein: step 1. J. Lipid Res. 41, 1481–1494

33. Salio, M., Silk, J. D., and Cerundolo, V. (2010) Recent advancesin processing and presentation of CD1 bound lipid antigens.Curr. Opin. Immunol. 22, 81–88

34. Barral, P., Eckl-Dorna, J., Harwood, N. E., De Santo, C., Salio, M.,Illarionov, P., Besra, G. S., Cerundolo, V., and Batista, F. D. (2008)B cell receptor-mediated uptake of CD1d-restricted antigen aug-ments antibody responses by recruiting invariant NKT cell help invivo. Proc. Natl. Acad. Sci. U. S. A. 105, 8345–8350

35. Danner, D., and Leder, P. (1985) Role of an RNA cleavage/poly(A) addition site in the production of membrane-boundand secreted IgM mRNA. Proc. Natl. Acad. Sci. U. S. A. 82,8658 – 8662

36. Ross, D. A., Wilson, M. R., Miller, N. W., Clem, L. W., and Warr,G. W. (1998) Evolutionary variation of immunoglobulin muheavy chain RNA processing pathways: origins, effects, andimplications. Immunol. Rev. 166, 143–151

37. Binder, C. J., Horkko, S., Dewan, A., Chang, M. K., Kieu, E. P.,Goodyear, C. S., Shaw, P. X., Palinski, W., Witztum, J. L., andSilverman, G. J. (2003) Pneumococcal vaccination decreasesatherosclerotic lesion formation: molecular mimicry betweenStreptococcus pneumoniae and oxidized LDL. Nat. Med. 9,736 –743

38. Nanjee, M. N., Cooke, C. J., Garvin, R., Semeria, F., Lewis, G.,Olszewski, W. L., and Miller, N. E. (2001) Intravenous apoA-I/lecithin discs increase pre-beta-HDL concentration in tissuefluid and stimulate reverse cholesterol transport in humans. J.Lipid Res. 42, 1586–1593

39. Navab, M., Anantharamaiah, G. M., Reddy, S. T., Hama, S.,Hough, G., Grijalva, V. R., Wagner, A. C., Frank, J. S., Datta,G., Garber, D., and Fogelman, A. M. (2004) Oral D-4F causesformation of pre-beta high-density lipoprotein and improveshigh-density lipoprotein-mediated cholesterol efflux and re-verse cholesterol transport from macrophages in apolipopro-tein E-null mice. Circulation 109, 3215–3220

40. Cabana, V. G., Lukens, J. R., Rice, K. S., Hawkins, T. J., andGetz, G. S. (1996) HDL content and composition in acutephase response in three species: triglyceride enrichment ofHDL a factor in its decrease. J. Lipid Res. 37, 2662–2674

Received for publication July 27, 2010.Accepted for publication September 9, 2010.

300 Vol. 25 January 2011 WOOL ET AL.The FASEB Journal � www.fasebj.org