5400 hulmeville road bensalem, pa 19020...saint ephrem church bensalem, pennsylvania december 13,...
TRANSCRIPT
![Page 1: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,](https://reader034.vdocuments.net/reader034/viewer/2022052216/609aacaf2460190f4631d600/html5/thumbnails/1.jpg)
Rev. Msgr. Kenneth P McAteer, Pastor Rev. Stephen F. Katziner, Parochial Vicar Rev. Timothy F. O’Sullivan, Parochial Vicar Deacon James P. DeBow, Permanent Deacon Deacon Edward J. Dymek, Permanent Deacon Sister Mary Jane Bransfield, I.H.M., Superior
Sister Shaun Thomas Callahan, I.H.M., Principal Sister Mary Jane Bransfield I.H.M., 215-639-4332
Pastoral Minister to the Sick & Elderly Mrs. Christianne Quinn, 215-639-4895,
C.R.E., P.R.E.P. Mr. Chuck Burgy, 215-245-1698, Business Manager Mr. Ronald Chancler, 267-679-6638
Liturgy and Music Coordinator
PARISH STAFF
MASS SCHEDULE Sunday Vigil: Saturday 5:00 PM
Sunday: 7:30, 10:30 & 12:00 Daily: 7:00 & 8:30 AM - Saturday - 8:30 AM only
Holy Days: Schedule Varies, please check website prior to Holy Day
CONFESSIONS: Saturdays: 4:00 to 4:45 PM Confessions on Wednesdays after the 8:30 AM Mass.
PARISH REGISTRATION: A new parishioner may register in the parish by
speaking with one of the priests in the lobby of the church after one of the Sunday Masses or by calling a priest for an appointment. (215-245-1698)
5400 HULMEVILLE ROAD BENSALEM, PA 19020 RECTORY: 215-245-1698 SCHOOL: 215-639-9488 CONVENT: 215-638-1024 HALL : 215-639-5984
SCHOOL WEBSITE:: SAINTEPHREMSCHOOL.COM PARISH WEBSITE: WWW.STEPHREM.COM
SCHOOL FACEBOOK PAGE: WWW.FACEBOOK.COM/SAINTEPHREMSCHOOL/
![Page 2: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,](https://reader034.vdocuments.net/reader034/viewer/2022052216/609aacaf2460190f4631d600/html5/thumbnails/2.jpg)
Saint Ephrem Church Bensalem, Pennsylvania
December 13, 2020
099 St. Ephrem 1
Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5, 8b-12, 14a, 16 Responsorial Psalm: Psalms 89:2-5, 27, 29 2nd Reading: Romans 16:25-27 Gospel: Luke 1:26-38
PLEASE PRAY FOR OUR SICK PARISHIONERS, FAMILY MEMBERS AND FRIENDS
Sunday, December 13~ Third Sunday of Advent 7:30 Agnes Schrenk req. by Mike & Janice Gallagher 9:00 Phil DeLeo req. by Linda & Ed Smith 10:30 Jane Nowicki req. by Her Family 12:00 For the St. Ephrem Parish Family
Monday, December 14 7:00 Henry Dubiel req. by Stephanie Morris 8:30 Joanne Kirkley req. by Dyanne Alexy
Tuesday, December 15 7:00 Charles S. Giarratano req. by The Medash & Petta Families 8:30 For the Benefactors of the Sanctuary Endowment Fund
Wednesday, December 16 7:00 Mary Pucher, 8th Anniversary req. by Barbara Pucher 8:30 Anthony Duca req. by Mary Boyle
Thursday, December 17 7:00 Agnes Schrenk req. by The Jones Family 8:30 Deena David req. by Friends of Michelle David
Friday, December 18 7:00 A Special Intention req. by Stephanie Morris 8:30 Marita Cliggett req. by Denny & Pat Ziemba
Saturday, December 19 8:30am Mary Zorek req. by Jean & Jack Pawlowski 5:00pm For the St. Ephrem Parish Family
Sunday, December 20~ Fourth Sunday of Advent 7:30 William J. req. by Steve & Evelyn O’Donnell 9:00 Richard Ziemba req. by Ed & Michelle Daley 10:30 Stella Laskowski req. by Jo & Jack Siwinski 12:00 Christopher Craven req. by Sean, Cole, Dee & His Family
Baptisms Baptisms are held the 2nd and 4th Sundays of each month at
1:30 PM. Please contact one of the parish priests to make arrangements. Both parents must attend a Pre-Jordan class
prior to their child's Baptism. Pre-Jordan is held the 1st Monday of each month at 7:30 PM in Church.
Pre-registration for Pre-Jordan is required, and can be done by calling the rectory at 215-245-1698.
Sharon Edwards Irene McCarthy Baby Owen
Baby Joel Heim Bill Storms Mary Biehn
Carol Higgins Michael Acquaviva Paul McGrath
Margaret Griffiths Catherine, Kelly & Samuel Gabriele
Christina Stockton and Newborn
Brian Matsinger, Sr. John Roley Susan Smith
Patricia Grandinetti Kimberly Ann Pastor
Mary Tilton
E.J. Connell Paula Collins Patrick Collins
Michael McGovern Robert Gilmer E.J. Richmond
Kevin Goodwin Trudy Gryniewicz Margaret and Noreen Jardine
Jacki Brady Baby Nicholas Tom Collins
Jacob Simon Margaret Grone Janine Hee
Baby Dexter James Mike Souders Marcia McCullough
Elizabeth DiPasquale
Mary Ellen Seifert Irene Olsen
Judah Jackson Paul Barrett, II Andrew Samora
Baby Steven Infante
Mary Jane Finley Jack Gallen
Bill Butz Tom Zmigiodski Baby Bennett
Charles Sanford C.J. Gryniewicz Brian Feldman
John O’Donnell Roseann Lantz Michael Schultz
Baby Beatrice Finegan
Baby Harper Giempietro Ann Higgins
![Page 3: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,](https://reader034.vdocuments.net/reader034/viewer/2022052216/609aacaf2460190f4631d600/html5/thumbnails/3.jpg)
We can relax...but just a little ! The Liturgy Office of the Archdiocese of Philadelphia, working closing with the Health Department of the Commonwealth of Pennsylvania, as well as closely
following recommendations from The Center for Disease Control (CDC), has recently recommended to parishes
across the Archdiocese several relaxations of the precautionary protocols that we have had in place
since we resumed our public Mass celebrations earlier this year.
Beginning with the First Sunday of Advent, (Saturday, November 28th) we will return Missals to our pews for
those who wish to use them. 11/22 UPDATE : Holy Water will NOT be returned to the fonts at our Church doors until further notice.
All restrictions on singing have been lifted, with the exception of large choirs; and, we will continue to
sanitize our pews and public spaces on a daily basis. Parishioners are reminded that we (continue to) highly
recommend the wearing of masks (for those over the age of two) for the duration of your time in Church; we will continue to offer Holy Communion on the tongue only from the main celebrant of the Mass as he distributes Holy Communion; and, social distancing in Church remains in place, with every other pew roped off to
ensure proper distancing for all who join us for Mass. We ask that you not move the ropes when entering the
Church, as the ropes indicate what pews have been sanitized. We are grateful to all our parishioners who
are working to keep our Church clean and safe! If any parishioners have any questions, comments or
concerns regarding our parish's COVID precautionary protocols, please call the rectory.
JUST A REMINDER
We are now taping our 5:00pm Saturday evening Mass, which will be available for
viewing after 8:00pm on Saturday evening. The Mass will not be available for live-streaming at 5:00pm Saturday evening, but will be available, for your convenience anytime after 8:00pm on
Saturday evening.
The address for the Mass, which lists all the Masses we have recorded thus far, is:
bit.ly/saintephrembensalem
2 099 St. Ephrem
Altar Server Schedule
Saturday Evening (December 19) 5:00 pm Olivia Wright, Annie Conner
Sunday (December 20) 7:30 am Jake Elkins, Owen Elkins
10:30 am Nicholas Riccio, Nathan Barrett
12 Noon Andrew Mizgerd, Ryan Zebrowski
Are You Called to Be a Deacon?
Archdiocese of Philadelphia Permanent Diaconate Information
Night Webinar
Thursday, December 17, 2020
7:00 PM
We invite Catholic men (and their wives, if married) between the ages of 29 and 55 who would like more information
about serving as a permanent deacon to attend an information night.
Join us for a live webinar from a panel of permanent deacons on discerning a vocation to the Permanent Diaconate
and the School for Diaconal Formation Program.
For more information, or to obtain the preregistration link, please visit the
School of Diaconal Formation website:
https://www.scs.edu/diaconal-formation
![Page 4: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,](https://reader034.vdocuments.net/reader034/viewer/2022052216/609aacaf2460190f4631d600/html5/thumbnails/4.jpg)
099 St. Ephrem 3
A Two-Pronged Response to the Addiction Crisis The Church desires to be close to her children who are
struggling with addiction and to bring them the healing power of Jesus Christ's love. The Archdiocese of Philadelphia
offers a two-pronged response to the addiction crisis, which aims to attend to the needs of the whole person, body, mind and spirit. The resources below are for those struggling with
an addiction and/or their family and loved ones: For clinical and social service resources such as local
treatment facilities, AA, NA and Al-Anon groups, insurance information, crisis support, and other
services, visit RecoveryAndHope.org For Catholic spiritual support for addiction offered by our
local Catholic community, please explore the Hope in Christ website at archphila.org/hope.
Nourish for Caregivers Support Group In a recent Sunday Gospel Jesus reminds us that he
desires mercy, not sacrifice. (Mt 9:13) For caregivers, life is often all about sacrifice. Whether it is putting their own needs aside until the end of the day or forgoing self-care altogether, exhaustion & frustration can be
ever present companions. This month, Nourish offers the topic "The Thing About Compassion." We focus on
caring for the caregiver because this role is not just about sacrifice, but also availing one's self to the loving embrace from our merciful Jesus and his most Blessed
Mother. The ministry meets in-person at a variety of times and locations throughout the Archdiocese as well
as virtually via Zoom. For more information visit http://www.phillyevang.org/nourish/ or contact
Aimee Gustitis at 610-724-8950 or [email protected].
CHRISTMAS OUTREACH OPPORTUNITY As we prepare our hearts for the Advent season, we are asked to continue to remember the less
fortunate at this time. If you are able, please consider reaching out to others who are
in need.
The annual CHRISTMAS OUTREACH assists families from St. Ephrem’s Parish who in
need of help with providing a Happy Christmas for their families
Gift cards are a good choice. Food gift cards provide needed money for family dinners and the other store
gift cards assist parents in purchasing needed clothing, etc.
In your generosity we are asking you to donate GIFT CARDS from your choice from the
following stores: GIANT, ACME, SHOP RITE, WAL-MART, KOHL’S, TARGET, DOLLAR
TREE AND AMAZON.
Please drop all gift cards off at the rectory or in the collection basket only Please mark the envelope
“CHRISTMAS OUTREACH” Donations are due by Monday, Dec. 14 so we can
deliver to the families in sufficient time for shopping for their needs.
If you are in need of help, or know someone who is in need, please contact
Sr. Mary Jane –215-639-4332.
Thank you for your Generosity and God bless you!
Extra Advent Confession Times
Wednesday, December 16th join us for our Parish Penance Service from 7-8pm
(extra priests available)
Saturday, December 19th from 3:00-4:45pm
Every Saturday from 4:00-4:45pm.
Every Wednesday at 9:00am, following the 8:30am Mass.
Anytime by appointment.
Call the rectory (215-245-1698) to schedule.
Pre-Cana at Christ the King Christ the King Parish will offer the Pre-Cana program
on Saturday, 1/30/21. Engaged couples of nearby parishes who are planning to celebrate the Sacrament of Matrimony next year are most welcome. Masks, social
distancing and other health-related steps will be in place. For information, please contact Rich Green,
Christ the King Pre-Cana Coordinator, at [email protected].
AANNOUNCEMENT
Dear Parish Family,
As a result of the Covid situation, we have decided to cancel the Appreciation Luncheon normally held in early January. We want all of our parish volunteers to know, however, that we appreciate all that you do to enrich the growth and prosperity of our parish family. Please be assured that we couldn't do it without you! We love you.
Gratefully, Msgr. McAteer
![Page 5: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,](https://reader034.vdocuments.net/reader034/viewer/2022052216/609aacaf2460190f4631d600/html5/thumbnails/5.jpg)
099 St. Ephrem 4
This & That (Fr. S. Katziner)
Christmas Confessions at St. Ephrem– On a Lighter Note
Years ago on a Christmas Eve around 6:30 pm parishioner Ron Ritz was on his way home from work.
A light amount of snow had fallen, around 2-3 inches. He decided to stop at St. Ephrem to make sure everything was ready for midnight Mass. When he pulled into the
parking lot, he saw all of the lights on in the church and he went in. Msgr. Musial (pastor from 1973-1996) and the assistant were hearing confessions. Ron checked all of the lights and decorations, and, as he was leaving, he saw that the front walk was not cleared of snow, so he
looked around for a snow shovel. Ron knew that if someone did not shovel the walk, Msgr. would do it himself, so he started to clear the snow. As he was
shoveling the snow, an elderly woman arrived and asked if they were hearing confessions. Ron said, “Yes, Msgr. was inside.” And as she was walking into church, Ron
added, “Be careful what you tell him, because I just went to confession and this is what I received for my
penance.” Ron then said, “She smiled and thanked me, but went into confession anyway.”
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Ron is an original member and continues to usher at the 7:30 AM Sunday Mass.
Thank you, Ron, for your sense of humor and all of your efforts on behalf of the church.
RCIA–Rite of Christian Initiation of Adults RCIA is a series of weekly study, prayer & reflective
presentations created to provide non-Catholic adults with a greater understanding of the Catholic faith. RCIA is designed as the process for individuals who desire to convert or join the Catholic Church. RCIA provides an
in-depth review of the practices, beliefs and customs of the Catholic faith. In addition, any baptized Catholic who
has not received all of the sacraments is welcome to rediscover their faith and commitment to Christ through
the RCIA process and the reception of these sacraments.
While the classes usually start in September, due to concern for the ongoing Covid-19 issues, we have
decided to begin the RCIA classes in January 2021. The classes will be presented on Wednesday nights from 7:30 to 9:00 P.M. in the Church. The first class
will be a Welcome Night on January 13, 2021. Classes will continue on every Wednesday through
the end of May. If you are considering coming to RCIA or would like more information, please contact Msgr. McAteer at the rectory
at 215-245-1698 or Gerri Donnelly at 215-638-7184.
Cathedral Virtual Christmas Concert Sunday, December 13th, 2020-2:00 PM
The Cathedral Basilica of Saints Peter and Paul proudly presents our first-ever Virtual Christmas Concert, Prayer for Peace, on December 13, 2020 at 2pm.
Join the Cathedral choir and instrumentalists as they perform works by Abbie Betinis, Frank La Rocca, Julian Wachner, William Walton, as well as beloved Christmas Carols for all to participate. May we all experience the
hope, joy and love of our Lord, Jesus Christ, throughout the Christmas season. A link to the concert will be
emailed to you on the day of the concert, or any subsequent day after Dec. 13 when a ticket is purchased.
For tickets, please visit. http://cathedralphila.org/music/choirs-at-the-
cathedral-basilica/
Come and See Events Come and See Events begin in January 2021 and are designed to let young men (high school age and above) who are discerning
the priesthood. Come and See Events are available for high school men (single day program) and post-high school men
(overnight). These events are held monthly between January and March 2021. Specific dates are listed below - to register for one
of these events, please visit Heedthecall.org/comeandsee or contact Fr. DeLacy at [email protected].
High School Days of Discernment Sunday, January 17, 2021
Saturday, February 20, 2021 Saturday, March 13, 2021
Post-High School Overnights January 22-23, 2021 February 26-27, 2021 March 19-20, 2021
![Page 6: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,](https://reader034.vdocuments.net/reader034/viewer/2022052216/609aacaf2460190f4631d600/html5/thumbnails/6.jpg)
099 St. Ephrem, Bensalem, PA (3) John Patrick Publishing Company Inc. 1.800.333.3166 • www.jppc.net
PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING
SENIOR CITIZEN DISCOUNTFREE ESTIMATES
Ph: (215) 728-1482Fax: (215) 742-7098
8675 Torresdale Ave.Philadelphia, PA 19136
WWW.BILLFRUSCO.COM
2436 Bristol Road • Bensalem
Dan Shurdich Offi ce: (215) 752-0560 Owner Fax: (215) 752-0561 Member of Parish Cell Ph. (267) 228-5718
Adjusting Your Insurance Claims Is Our Top Priority!Residential & Commercial • Serving all of PA and NJLicensed and Bonded by the Insurance Department
Paul & Karen LaichParishioners www.flowergirlflorist.com
Showcase Plaza • 2832 Street Road • Bensalem, PA 19020
Wedding Specialist
Steve’s Automotive & Collision5526 Hulmeville Rd. (Right Up The St.)
215-639-9851Discount For St. Ephrem Parishioners With Ad
www.Stevesautomotiveandcollision.netFOR ALL YOUR VEHICLE NEEDS!
Burns Funeral HomesBurns Funeral Homes
9708 Frankford Ave.Phila., PA 19114
(South of Grant Ave.)215-637-1414
Gerard J. Burns, Supv.
1514 Woodbourne Rd.Levittown, PA 19057(Next to K of C Hall)215-547-3040
Lisa Burns Campbell, Supv.
1428 E. Columbia Ave.Phila., PA 19125
(At Frankford Ave.)215-634-6858
Joseph J. Burns, Supv.
Family Owned and Operated Since 1939Family Owned and Operated Since 1939
www.burnsfuneralhome.www.burnsfuneralhome.comcomAllbrook Plumbing Company
www.AllbrookPlumbing.comPlease Check Out Our Website for
Money Saving Specials!215.990.7879 • Bensalem, PA
PA Lic#RCC508 • PA HIC#118447
MAGGIE VELEKNo Nonsense Just Results
Re/Max Realty ServicesCell-215-805-1611Offi [email protected]
It’s a sellers’ market and inventory is needed!If you are wondering what your home is worth in this
market, call me for a free evaluation right away!
ParishionerStephen Gannon
THE GANNON INSURANCE AGENCY
2704 Street RoadBensalem, PA 19020(215) 891-9990
AUTO • HOMELIFE • BUSINESS
[email protected] Office: 215.395.6277
DAN PITTSRealtor® & Parishioner
215.760.7604
In Our 4th Decade of Quality Service
French Drains • Foundation Repair • Mold Remediation
215-639-8500www.morganbasementwaterproofing.com
All Work Guaranteed
MGCLANDSCAPING
Landscaping & Lawn MaintenanceBushes & Trees Thinned
Topped & RemovedStump GrindingFULLY INSUREDFREE ESTIMATES
638-3311PARISHIONER
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg
y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis
cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o
echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n
acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens
dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans
ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker
CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia
ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforcforcforcforcforceement, Public Safety - O
To all those nforcement, Public Sanforcement, Public Sa
essentiallture - Energylture - EnergyWater aste TraWater aste Tra
workerscs - Public Wors - Public WorCommunicatioCommunicatio
keeping echnology Wochnology Woovernment Wovernment W
us safe,acturing Caterials Finanaterials Finan
yournicationnicationWorkerWorke
service isovernment Workovernment Workacturing Chemacturing Chem
invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar
ment, Public Safety - OSafety - Othan
k yo
u
g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tetttttttttteee Transportation & Log
cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCoCCoCCoCCCoooCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicatcaticaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim
echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community
PERSONAL TRAININGColin Hartmann
ACSM Certifi ed • Crossfi t Level 1 Certifi ed
215-450-7588 [email protected]
Sweat is Calories Crying
BASEMENTWATERPROOFING
FOUNDATION REPAIRMOLD REMEDIATION
1-888-5DRY-TECHwww.DryTechCorp.com
Neighboring Parishioner
![Page 7: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,](https://reader034.vdocuments.net/reader034/viewer/2022052216/609aacaf2460190f4631d600/html5/thumbnails/7.jpg)
099 St. Ephrem, Bensalem, PA (I) John Patrick Publishing Company Inc. 1.800.333.3166 • www.jppc.net
James J. DoughertyJames J. DoughertyFuneral Home. Inc.Funeral Home. Inc.
John J. Bonner, Jr., Supervisor2200 Trenton Road, Levittown, PA 19056
215-943-7240
FINN PLUMBINGSERVICE/REPAIRSCOMPLETE BATH
REMODELING215-547-5424
Experience Peace of Mind:Pre-Arrange Your Burial at an
Archdiocese of Philadelphia Cemetery.
• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries
CALL 215-352-4001 TODAY
Visit Our
New LocationFREE Logo Set-Upwith mention of this ad ($35 Value)
Glenn Reineke, OwnerJill Fallon Payne, Manager/AR Grad
Screen Printing • Embroidery • Online SpiritwearTeam/League Uniforms • Corporate Apparel • Banners & Signs
215-752-32232159 Galloway Road • Bensalem
Family owned & operated Since 1898
215-639-3130
864 Bristol Pike (Rt. 13) • 864 Bristol Pike (Rt. 13) • Bensalem, PA 19020Bensalem, PA 19020Joan Fluehr, Owner • Robert J. Mahan, SupervisorJoan Fluehr, Owner • Robert J. Mahan, Supervisor
Only location in Bucks CountyOnly location in Bucks CountyPre-Arranged Funerals • Traditional FuneralsPre-Arranged Funerals • Traditional Funerals
Crematory on PremisesCrematory on Premiseswww.fluehrfh.comwww.fluehrfh.com
$350Off Any New Stairlift With This Ad
• FREE in home evaluations• Family owned & operated for more than 20 years
1.888.900.8883www.Tri-StateStairlifts.com
NAMI of Bucks CountyIS HERE TO HELP
If you or someone you know struggles with Depression, Bipolar Disorder, OCD, Anxiety, PTSD, Schizophrenia, BPD,
Co-occuring mental illness and substance abuse...WE ARE HERE FOR YOU!
• Attend Our FREE Support Groups and/or Forums• Take Our FREE Education Classes (Starting in the Fall)
Bucks County Voice on Mental Illness • Call Our Helpline1(866) 399-NAMI (6264) • www.namibucks.org
Mallory’s Army Foundation
United Together In The Fight Against Bullying...
Don’t Just Teach Kindness...
B E K I N D N E S S !www.MallorysArmy.com
(973) [email protected]
It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.
Message and data rates may apply.
B U I L D I N G A B U I L D I N G A S T R O N G E RS T R O N G E R
C O M M U N I T YC O M M U N I T Y
![Page 8: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,](https://reader034.vdocuments.net/reader034/viewer/2022052216/609aacaf2460190f4631d600/html5/thumbnails/8.jpg)
099 St. Ephrem, Bensalem, PA (B) John Patrick Publishing Company Inc. 1.800.333.3166 • www.jppc.net
A Pharmacy that cares for you!
2217 Bristol Pike - Suite 2Bensalem, PA 19020
tel 215.639.6680www.ricciofamilypharmacy.com
Free Delivery
We Accept Scrip
Customer Loyalty Program
Parishioner
Joe CunninghamJoe CunninghamRE/MAX Eastern, Inc.2471 Grant Avenue • Philadelphia, PA 19114
215-961-6011www.joecsells.com
“I am never too busy for you or your referrals.”
Each Offi ce independently owned and operatedDiocesan MemberDiocesan Member
Jim Byrd, ABR, CDPE, SFR, SRES, Realtor
Cell: 215-840-8019Offi ce: 215-638-3830 [email protected] Bristol Road
www.BucksAndPhillyRealEstate.comONLY 1 ($500) REBATE PER TRANSACTION PAYABLE AT SETTLEMENT
Sell • Buy • Invest$500 Discount
For Parish Members
215-752-9080Plumbing • HeatingOil Burner Servicewww.keseifert.com
John’s Barbershop1664 Street Rd.
Open EarlyMonday to Saturday
215-639-1149
Seniorand
MilitaryDiscounts
THE ORIGINAL
RICK’S
215-785-2168
MentionYour Church
For$50 OFFAny Service
over $500
STOKES MASONRY CONCRETE
BRICK & BLOCK WORKBRICK PAVERS750-3356
"We pave you save"
Serving Community 30+ Years104 E. Maple Ave., Langhorne, PA
215-752-2346www.asphaltpa.com
TOMLINSON FUNERAL HOME, TOMLINSON FUNERAL HOME, P.CP.C.Robert M. Tomlinson, Supervisor
2207 Bristol Pike (at Simons Ave.) Bensalem, PA639-0422639-0422
www.tomlinsonfh.comwww.tomlinsonfh.com
In Business Since 1945In Business Since 1945
PRE-ARRANGED FUNERALS
Gregory Dental Associates, P.C.Gregory Dental Associates, P.C.Christina A. Gregory, DMDChristina A. Gregory, DMD
Archdiocesan MemberArchdiocesan Member
Cosmetic & Family DentistryCosmetic & Family Dentistry2218 Bristol Pike • Bensalem, PA 19020
215-639-6133215-639-6133
Parishioner
CALL TODAY AT 215 752 6145
Home of the$79.95 Diagnos c
Roof Repairand the
Guaranteed Leak RepairNew Roofs & Gu ers • Roof & Gu er Repairs
Siding & Windows • Garage Door Installa on/Repairwww.abrooksconstruc on.com
#PA009390
James O. Bradley Funeral Home Inc.James O. Bradley Funeral Home Inc.260 Bellevue Ave. Penndel, PA 19047
215-757-3379Traditional Funerals & Cremation ServicesTraditional Funerals & Cremation Services
Pre-Planning and Pre-Paid Arrangements AvailableKevin J. Diabelko, SupervisorKevin J. Diabelko, Supervisor
James A. Heisler, EA, CFP® - IRS Enrolled Agent
215-332-4968 • [email protected] Parishioner
Financial planning/Investment ManagementLife/Health/Medicare Insurance/Tax Prep
Special help for women going through divorce or have lost their spouse.
Now Hiring friends and family caregivers.Call today to learn more!
(215) 419-7868www.Bayada.com/careathome
Quality Senior Home Care Services since 1975.
www.stacareers.com