9/16/2015bchb524 - 2015 - edwards introduction to python bchb524 2015 lecture 5

9/16/2015 BCHB524 - 2015 - Edwards

Introduction to Python

BCHB5242015

Lecture 5

9/16/2015 BCHB524 - 2015 - Edwards

Outline

Review, Homework #2 DNA as a string

Extracting codons in DNA Counting in-frame codons in DNA Reverse Complement

Program Input/Output raw_input, command-line arguments standard-input, standard-output, redirection

2

9/16/2015 BCHB524 - 2015 - Edwards

Review Printing and execution Variables and basic data-types:

integers, floats, strings Arithmetic with, conversion between String characters and chunks, string methods

Functions, using/calling and defining: Use in any expression Parameters as input, return for output

Control Flow: if statements – conditional execution for statements – iterative execution

3

9/16/2015 BCHB524 - 2015 - Edwards

DNA as a string

seq = "gcatgacgttattacgactctgtgtggcgtctgctgggg"

seqlen = len(seq)

# set i to 0, 3, 6, 9, ..., 36for i in range(0,seqlen,3):

# extract the codon as a string codon = seq[i:i+3] print codon

print "Number of Met. amino-acids", seq.count("atg")

4

9/16/2015 BCHB524 - 2015 - Edwards

DNA as a string

What about upper and lower case? ATG vs atg?

Differences between DNA and RNA sequence? Substitute U for each T?

How about ambiguous nucleotide symbols? What should we do with ‘N’ and other ambiguity

codes (R, Y, W, S, M, K, H, B, V, D)? Strings don’t know any biology!

5

9/16/2015 BCHB524 - 2015 - Edwards

DNA as a string

seq = "gcatgacgttattacgactctgtgtggcgtctgctgggg"

def inFrameMet(seq): seqlen = len(seq) count = 0 for i in range(0,seqlen,3): codon = seq[i:i+3] if codon.upper() == "ATG": count = count + 1 return count

print "Number of Met. amino-acids", inFrameMet(seq)

6

9/16/2015 BCHB524 - 2015 - Edwards

DNA as a stringinput_seq = "catgacgttattacgactctgtgtggcgtctgctgggg"

def complement(nuc): nucleotides = 'ACGT' complements = 'TGCA' i = nucleotides.find(nuc) comp = complements[i] return comp

def reverseComplement(seq): newseq = "" for nuc in seq: newseq = complement(nuc) + newseq return newseq

print "Reverse complement:", reverseComplement(input_seq)

7

9/16/2015 BCHB524 - 2015 - Edwards

DNA as a stringinput_seq = "catgacgttattacgactctgtgtggcgtctgctgggg"

def complement(nuc): nucleotides = 'ACGT' complements = 'TGCA' i = nucleotides.find(nuc) if i >= 0: comp = complements[i] else: comp = nuc return comp

def reverseComplement(seq): seq = seq.upper() newseq = "" for nuc in seq: newseq = complement(nuc) + newseq return newseq

print "Reverse complement:", reverseComplement(input_seq) 8

9/16/2015 BCHB524 - 2015 - Edwards

Creating reusable programs

Need to get input data and options from the user …often us, but sometimes others, or us later.

Sometimes, want completely new inputs …but often, want the same or similar input.

Sometimes, typing the input is OK …but often, want to use data in a file.

Sometimes, output to the screen is OK …but often, want the result to go into a file.

9

Interactive input

9/16/2015 BCHB524 - 2015 - Edwards

input_seq = raw_input("Type your codon: ")




10

Command-line input

9/16/2015 BCHB524 - 2015 - Edwards

import sysinput_seq = sys.argv[1]




11

Interactive and file input

9/16/2015 BCHB524 - 2015 - Edwards

import sysinput_seq = sys.stdin.read()




12

File input only

9/16/2015 BCHB524 - 2015 - Edwards

import sysseq_file = sys.argv[1]

# MAGIC: open file, read contents, and remove whitespaceinput_seq = ''.join(open(seq_file).read().split())



print "Reverse complement:", reverseComplement(input_seq) 13

Input Summary

raw_input provides interactive values from the user (also copy-and-paste)

sys.stdin.read() provides interactive or file-based values from the user (also copy-and-paste)

sys.argv[1] provides command-line values from the user (also copy-and-paste) value can be a filename that provides user-input

Terminal standard-input redirection "<" can be used to send a file's contents to raw_input or sys.stdin.read()

9/16/2015 BCHB524 - 2015 - Edwards 14

Output is easy…

Just use print, right? Print statements go to the terminal's

standard-output. We can redirect to a file using ">" Errors still get printed to the terminal.

We can also link programs together – standard-output to standard-input using "|" Also, cat just writes its file to standard out

9/16/2015 BCHB524 - 2015 - Edwards 15

Connect reverse complement w/ codon counting…

Create and test rc.py from earlier slides: Sequence from standard-input Reverse complement sequence to standard-output

Create and test codons.py from earlier slides: Sequence from standard-input Count to standard-output

Place example sequence in file: test.seq Execute:

cat test.seq | python rc.py | python codons.py

9/16/2015 BCHB524 - 2015 - Edwards 16

In general

Windows and OS X have similar facilities cmd in windows, terminal in OS X

Powerful mechanism for making reusable programs No knowledge of python required for use!

Most bioinformatics software is used from the command-line w/ command-line arguments: Files provide sequence data, etc.

I'll promote this style of program I/O.

9/16/2015 BCHB524 - 2015 - Edwards 17

9/16/2015 BCHB524 - 2015 - Edwards

Exercise 1

Use NCBI Probe (“google NCBI Probe”) to look up PCR markers for your favorite gene Write a command-line program to compute the

reverse complement sequence for the forward and reverse primer.

18

9/16/2015 BCHB524 - 2015 - Edwards

Exercise 2

Write a command-line program to test whether a PCR primer is a reverse complement palindrome. Such a primer might fold and self-hybridize! Test your program on the following primers:

TTGAGTAGACGCGTCTACTCAA TTGAGTAGACGTCGTCTACTCAA ATATATATATATATAT ATCTATATATATGTAT

19

9/16/2015 BCHB524 - 2015 - Edwards

Homework 3

Due Monday, September 21st. Submit using Blackboard Use only the techniques introduced so far. Make sure you can run the programs

demonstrated in lecture(s). Exercises 4.1, 4.2 from Lecture 4 Exercises 5.1, 5.2 from Lecture 5

20

9/16/2015bchb524 - 2015 - edwards introduction to python bchb524 2015 lecture 5

Documents