a 3-mb sequence-ready contig map - dna research

DNA RESEARCH 4, 281-289 (1997)

A 3-Mb Sequence-Ready Contig Map Encompassing the MultipleDisease Gene Cluster on Chromosome Ilql3.1-ql3.3

Eiko KITAMURA,1 Fumie HOSODA,1 Michiyo FUKUSHIMA,1 Shuichi ASAKAWA,2 Nobuyoshi SHIMIZU,2

Takashi IMAI,3 Eiichi SOEDA,4 and Misao OHKI1'*

Radiobiology Division, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104,JAPAN,x Department of Molecular Biology, Keio University School of Medicine, Shinjuku-ku,Tokyo 160, JAPAN,2 Genome Research Group, National Institute of Radiological Science, 4-9-1 Anagawa,Inage-ku, Chiba 263, JAPAN, 3 and RIKEN Gene Bank, The Institute of Physical and Chemical Research,3-1-1 Koyadai, Tsukuba, 305, JAPAN4

(Received 26 June 1997)

Abstract

Despite the presence of several human disease genes on chromosome Ilql3, few of them have beenmolecularly cloned. Here, we report the construction of a contig map encompassing Ilql3.1-ql3.3 usingbacteriophage PI (PI), bacterial artificial chromosome (BAC), and Pl-derived artificial chromosome (PAC).The contig map comprises 32 PI clones, 27 BAC clones, 6 PAC clones, and 1 YAC clone and spans a 3-Mbregion from D11S480 to D11S913. The map encompasses all the candidate loci of Bardet-Biedle syndrometype I (BBS1) and spinocerebellar ataxia type 5 (SCA5), one-third of the distal region for hereditaryparaganglioma 2 (PGL2), and one-third of the central region for insulin-dependent diabetes mellitus 4(IDDM4)- In the process of map construction, 61 new sequence-tagged site (STS) markers were developedfrom the Not I linking clones and the termini of clone inserts. We have also mapped 30 ESTs on thismap. This contig map will facilitate the isolation of polymorphic markers for a more refined analysis of thedisease gene region and identification of candidate genes by direct cDNA selection, as well as prediction ofgene function from sequence information of these bacterial clones.Key words: chromosome 11; contig; SCA5; BBS1

1. Introduction (SCA5), insulin-dependent diabetes mellitus 4 (IDDM4)and hereditary paraganglioma 2 (PGL2) have been

Human chromosome Ilql3 is one of the most in- shown to overlap at Ilql3.1-ql3.3.tensively studied regions of the human genome be- The development of an accurate physical map and thecause it is particularly rich in a number of disease- assembly of contiguous cloned genomic reagents are nec-associated genes. Certain of these genes, such as essary for the identification of candidate genes using aPYGM for MacArdle disease1 or, more distally, MYO1A positional cloning approach. A number of maps of the(Ilql3.5) for Usher type IB syndrome,2 have already n q i 3 chromosome have been published, including ge-been identified and cloned. Recently, a large-scale col- netic maps13"18 or physical maps.19"26 More recently,laborative effort led to the discovery of MEN IN, a high-resolution physical maps of subregions of I lql3 weregene responsible for multiple endocrine neoplasia type-1 reported.27~29

(MENI).3 Other genes that have been assigned to subre- We previously constructed a complete Not I restrictiongions on Ilql3 include those for Best's disease,4 atopy,5 m a p covering the entire long arm of chromosome 11 usingosteoporosis-pseudoglioma syndrome,6 insulin-dependent linking-clone mapping. This map provides the most ac-diabetes mellitus 4,7-8 spinocerebellar ataxia type 5,9 CUrate ordering and distance estimation to date.30 In thehereditary paraganglioma 2,10 and Bardet-Biedl syn- course of developing the map, it was observed that CEPHdrome type I.11'12 Among these, the loci for Bardet- m e g a YAC library31 screening of the I lql3 region gaveBiedle syndrome type 1 (BBSl), spinocerebellar ataxia 5 o n i y a few YACs; almost all of the other YACs isolated

Communicated by Mituru Takanami s h o w e d s e v e r e deletions or rearrangements, and many* To whom correspondence should be addressed. Tel. +81- were not suitable for further analysis. ° Here, we present

3-3542-2511, ext. 4750, Fax. +81-3-3542-0688, E-mail: a 3-Mb contig map of Ilql3.1-13.3 constructed by [email protected] t h e Not j restriction map as a scaffold and Escherichia

Dow

nloaded from https://academ

ic.oup.com/dnaresearch/article/4/4/281/337010 by U

niwersytet W

arminsko-M

azurski w O

lsztynie user on 01 March 2022

282 A 3-Mb Contig Map of Ilql3.1-ql3.3 [Vol. 4,

coli-ba,sed large insert cloning systems (PI, BAC, andPAC). The contig map constructed using E. co^i-basedlarge-insert cloning systems should be useful for the gen-eration of genomic sequences and transcription maps ofthis important region. Since our map covers the wholeor at least some parts of the regions implicated in BBS1,SCA5, IDDM4, and PGL2, it should contribute to thepositional cloning of these disease-related genes.

2. Material and Methods

2.1. LibrariesFive libraries were screened to construct the contigs:

the CEPH mega YAC library,31 the PI library, the KeioUniversity BAC library, the BAC library from the Re-search Genetics, and the PAC library. The PI librarywas constructed at Du Pont, Inc.32 and corresponds to3.5 equivalents of the human genome. The Keio Univer-sity BAC library was developed by Asakawa et al.33 witha modification of the method by Shizuya et al.,34 andDNA pools corresponding to about 3.5 genome equiva-lents were used for screening. The PAC library (preparedin pCYPAC2 or pPAC4) which consists of 500,000 clones,corresponds to 20 equivalents of genome (from RosewellPark Cancer Institute, Joannou et al.35).

2.2. Development of STS primersPI, BAC and PAC DNAs with yields of 5-15 fig

were prepared from 100-ml overnight cultures us-ing an automated plasmid isolation apparatus (PI-100; Kurabo, Japan), followed by PEG precipita-tion, phenol chloroform extraction, and ethanol pre-cipitation. Each SP6 and T7 end of a PI clonewas sequenced directly using primers, PSup-2 andPTup-2, respectively. The sequences of the primers(5' to 3') are as follows; PSup-2, GGCCGTCGACATTTAGGTGACACTA and PTup-2, CGGCCGCTAATACGACTCACTATAG. For BAC end-sequencing, univer-sal and reversal primers (5' to 3') were used; universalprimer, CGACGTTGTAAAACGACGGCCAGT and re-versal primer, TTTCACACAGGAAACAGCTATGAC.The partial sequences of Not I linking clones were ob-tained by end-sequencing of a subclone using the fol-lowing primers (5' to 3'); T7, TAATACGACTCACTATAGGG and T3, ATTAACCCTCACTAAAGGGA oruniversal and reversal primers. End fragments fromPACs were isolated using a modificaion of the ligation-mediated PCR36 as previously described.37 Approxi-mately 0.5 fig of PAC DNA was digested with Ace II,Pvu II, Rsa I, or Sea I and blunt-end ligated to a double-stranded linker in a 25-//1 reaction. The ligated mix-ture was diluted four times, and 2 jA of the dilutionwas amplified using the linker-specific primer36 and apCYPAC2- or pPAC4-specific primer (5' to 3') which

were as follows: PASup-1, ATCCTCCCGAATTGACTAGTGGGTA; PSup-2, described above; PTup-1, TCGAGCTTGACATTGTAGGACTATA and PTup-2, de-scribed above. The amplified fragments were sequencedto develop STSs and were used as probes for Southernblot analysis. Out of the 61 newly generated STS mark-ers, 45 were designed from the insert end sequences ofPI, BAC, and PAC clones and 14 were developed fromthe sequences of Not I linking clones using the PRIMERprogram (Stephen E. Lincoln et al., Whitehead Insti-tute, MIT). Primer SPRK-cend was derived from the se-quence of the src-homology 3 domain-containing proline-rich kinase (SPRK) gene.38 Primer GP17 was developedfrom the sequence of the human muscle glycogen phos-phorylase (PYGM) gene.39 Newly generated STSs weretested for localization on chromosome llq using five so-matic hybrid cell lines (Jl-kc, Jl-44, Jl-7, P3-27A, andR229-3A).40

The additional 12 STS markers used for screeningwere as follows: CN2402A (GDB:6054130), CN3168A(GDB:6054131), cCIll-291B (GDB:6054133), cCIll-534B/D11S711 (GDB:6054134), LN32-32T (GDB:6054135), CN3071B (GDB:6054136), P22E7S (GDB:6054137), P125F11S (GDB:6054138), Y776E2-NB9B(GDB:6054139), P31G3S (GDB:6054140), CN1002A(GDB:6054141), P31G3T (GDB:6054142).30 Othermarkers were obtained from the Genome Data Base(GDB), GenBank, and the scientific literature.41

2.3. Screening and clone analysisAn STS-based PCR screening of DNA pools was done

to determine positive clones within each library. PCRwas performed with a GeneAmp 9600 thermal cycler(Perkin-Elmer) in a reaction volume of 10 /il containing10 mM Tris-HCl (pH 8.0), 1.5 mM MgCl2, 50 mM KC1,200 nM each primer, and 1 unit of Taq DNA polymerase(Boehringer). DNA was denatured at 94°C for 3 min andsubjected to 35 cycles of amplification where each cycleconsisted of denaturation at 94°C for 30 s, annealing attemperatures specific for each primer for 1 min (Table 1).and extension at 72°C for 1 min. A final extension wasperformed at 72°C for 10 min.

Structural analysis of all PCR-positive clones was car-ried out by PFG electrophoresis (CHEF Mapper system;Bio-Rad) after digestion with Not I, Not l+Sal I, orEag I (New England Biolabs). The digested DNA waselectrophoresed through a 1% agarose gel at 200 V for10 h with an initial pulse time of 0.3 s and a final pulsetime of 6.0 s, and blotted onto Hybond N (Amersham)membrane according to the manufacturer's recommenda-tions. Southern blots were hybridized with each radioac-tively labeled PCR product for screening under stringentconditions. STSs and RNA probes derived from SP6 andT7 promoters of isolated PI clones were used to confirm

Dow



niwersytet W

arminsko-M

azurski w O


No. 4] E. Kitamura et al. 283

Table 1. STSs used for contig construction and for mapping into the contig.

R e

D11S480 cCIll-319D11S618 cCIll-207D11S553 cCIll-387

KB314H12KB306G8KB306G8KB191G5KB191G5KB887E2KB292F6KB127A1KB127A1cCIll-398-1KB875E7KB804D3KB882H11KB882H11P110G11818E4818E4KB392D6KB392D6

D11S457 cCIll-247P25H10P25H10P28D2996E1810450211045021

D11S427 cCIll-4PYGM

KB162B12P22G3P22G3

D11S636 cCIll-367P95F6KB36C1KB279B12P90E1P24A2P24A2CN3195CN3179

D11S449 cCIll-219D11S661 cCIll-429

P77F10P110A10-3P110A10-3

D11S628 cCIll-355KB633G7

MLK3LN60-3KB795F3P72A12

D11S546 cCIll-363P22E7-1P125F11-1P88KB11P57C9P61A1P33KB10-1

T7 enT7 ensubcl.

revertu n i veuniverevertrevertrevertuniverevre;subcl.univerevertuniverevertSP6 eSP6 eT7 enu n i verevertsubchSP6 eT7 erT7 crSP6 eSP6 cT7 ersubcl.

BurktreversT7 erSP6 esubcl.SP6 crever;univeT7 erSP6 cT7 ersubcl.subcl.T7 enT7 enT7 erSP6 eT7 erT3 erreversGalloT7 eruniveT7 erT3 crT7 erT7 erSP6 cSP6 cSP6 eSP6 e

i d

i d

one

ser s er s e>e>ei C

r se

a n er s e;er s e

>nd• n d

i d

r s e>C

a n e• n d

i dt d

:nd:ndi d

: etie

i d

:ndone.;ndie

r sei d

Mid

i d

o n eD nei d

i d

i d

:ndi di d

see t

i d

r s ei d

i d

i d

i d

• n d

• n d

• n d

• n d

cCIll-319T7cCIll-207T7CCI11-387BB314H12RB306G8RB306G8UB191G5UB191G5RB887E2RB292F6RB127A1UB127A1RCCI11398-1AB875E7UB804D3RB882H11UB882H11RP110G11S818E4S818E4TB392D6UB392D6RcCIll-247AP25H10SP25H10TP28D2T996E18S1045O21S1045O21TcCIll-4A

al.39 GP17B162B12RP22G3TP22G3ScCIll-367AP95F6SB36C1RB279B12UP90E1TP24A2SP24A2TCN3195ACN3179AcCIll-219T7CCI11-429T7P77F10TP110A10S-3P110A10T-3cCIll-355T3B633G7R

al.3 8 SPRK-cendLN60-3T7B795F3UP72A12TcCIll-363T3P22E7TP125F11TP88KB11SP57C9SP61A1SP33KB10S

GGTCTCAACCAGTTCAAGCTGACCCCTGTTTCAGGGCTCAGGCACAGGGAATTGCAGCAGCAATACTGATTCAAGCTGCCCAATCCAAGATGGGCTGGAAACAACAACAAGGATTTGATTGAGTACTGGAGACATGAATCTTGTCCTTCCAGAATTAGAAGTCCTTCTGCAAAGTATCCAAGCTGCCTTCCCTGCACACATGGAATATTTATGAGAGATTATGGATGGCACCAGGTTAGGAGTTGGCAACAAAATAGCCAACCATTCCCTCCCATGCTGGGAGAAGGGAAGTACCCTTTGGTTCTCCATGACTTTGGTCTCTGGGCCTTCAGATCCCAGGCATTCCACCTTGTTGCTCTGAGCCTCAGTTTCTTTATCTGACCTTCTTGGTCCCTGCACTCTTGCCCTCCACACCTCAAGTTACAGCAGAGCAGCTGTGAGTCTCCGCTGATATTAATTTTGCGGCGACGTTAATCTCAGCTCTGGGATACAGTCAGGCAGGAAGAAGGGCGAGTCCTGGCCCTTTCCTTGTAACCAGAGCATGCAGCAGGCTCAGGTCTGGCTGACTCCTTGAGCACTCTACGCCATGTATAAGTACCGCGTGTGGATTTCTATGGACTCAGC

AAGTGATCCCAGCTGCAGACTGGTAGGAGGTTCACATCAGGCTGGATGGGGTTGTGTGACCCAACAACCCACCTCCACCAATGCCAAATTGGTCCAGAGCTGAGCATGGTGGTGCGTTTCTTGTGAGCTGCTCCCTTTGCCAGTGGTGCATACAGTCTGCTCAAAGGTGGGATGAATAGCTAGTGCAGTGTCTGACATGACTCACTTCTTCAACACTCCCTGCTCAGGCATCTCCTCTGTGCATGAGCGGCAGCACCTGGAGTTCGTGCTCGCCCTTATGACAGGTGTGAGCCATTCTCCAGGGAGTTGTTAGTTCGAGCTGGGACTACAGGCCCACGTCAAAAAGAAAGATGGTTAGAAATGCCTGCTACCTTCATCACCAAATTGAACTCTCCATTTTAGGTCATTGCGCAGGGCACAGACCAAAGAAATAATTTTCTACCAGCTATCCGGGAATGGTCTATATATTGGCAACAGGTCAGTACTCAGAAAGCTCATCATTGCCCTGGACCCCTCATACCATGGCAGCTTTATTCATAATAGCCCAAAGAGGGTGCTGAGAAGGGAGGAAGAAACTGAGGCACGCAGTTAAGTCAACAGCTGGGCGCCTGGGCAACAAAAGTGTGGAGGAGTATTGGTCAGGC

GAGTTTTTTAACCCACACAGCTGACTCACTCACAAGCGCCCTGAGTGACATCCCAGCCCAAGAGAGGGAGAGAGAGAGAGTGGAGGGAGGGGATCAAAAGAGTTTCACCCACCATCCACCAAACACGTTAAGAAACTTCAAGCCTTCCTTCTTGCATCACAAACCGGACTAAACATGTAAGTCCCGCCCCATTAGTTTTCTTTTTTTGACTCGAGCCACTGGTGTGTTTGGCAAATGTCTAGCTGGTGGTCCCATAGGGCTGGCCACAAGAAGGGGTGGTAAGGTATGGGATATAGCCAGGCACAATGGCAACATCAGGGAACCAAGTGGCCCTGCTGGGCACAGTAGGGGTTTCCGTCTATGGGGTGGGTATAATTACATTCGGTTGCAGTGATTGGCTGATTGATTTACTGGCTGCTCTCTCAGGAAGGGAAACTCACTTGCCTGTCCTAGCTTGGCACTCGGTAAGGATTCGAATTTGCTGGAACACTGAGGGGGAAATTGGTTTTAGGAGAGGATACCCCTAAACATAGTGTCCCCTCGTTCAGGTCTGAGGCACAGGAGAACTATGAGTACTGGCCCTCTTCTTGGCCTTGCTGGCTTCCCTTCCTAACACCAAGG

GGTCAAGCTTATCCACATCCGCCCTTTAAATCAGAAAACGGGACTTTTGACAGCAGAGACGGGAAGTGAGAAGTCCCCAAACTGGCTCATCTTCTCCTGGCAACCGTAAGCCACCACGTCAGACAAAGCTTATGCTCTGTTCCCTCCTTCGCAGGTCTGTCCACTTGGCTTTACAAATGGCGGACTCCCATTCCTCGTATCGCTTGCCCAAATTGCATAATGTTCAGTCAACTCCACTGAGGACTCCTGGAGACCCTTGGTGGAGATTTCCCAGCCCTCAGTTATCATCCATCTCAACATTTTGCCTTGACGATGAGACTGTTCCTGGGCAAGATTGCCTGAGGTCATGCCTTTGCCCAACTTAACTTAATTGACAGCTGACCCAGGCAGAACACAAACCTCGTGTAGCCTTCCAGTGTGAAGGCTTCCAAAAGGCGGAAACAACCCGGCCCAATAGTCAGAACCAGCATGAGCCCCTCGTGTTCGAATACCGTCAGCACCACGATTGTGTATTCTTTTGTGCCCCTGATTTAGGGATCACTGCACCGGCAAAGCTGGACAAAGAAGCATGGAAGATGGCAAGCACAGACCTGAGAACTGCTTGATCCCTTCCAAAGAGAACAGCATGG

55555862605555555 55 555555858555555625 8585555555562555 8625 55 56 555555555626262555555555 555555555555 55 55 555555555555 8625 55 55 5

1692422 5 52061942 3 12 6 11991592 0 12721611942 3 02 0 52 1 92 2 41101401121182 0 12141911961611101391523 4 52 0 52 0 72 7 51762061982291912 7 01691702 4 22 5 42 4 91471972 8 01002 7 81832 2 91132 5 01622 4 41802 3 62 1 11632 2 12 3 8

G1JB:6O56875GDB:6056876GDB;6056877GDB;6056878GDB;6056879GDB:6056880GDB:6056881GlTB:6056882GDB;6056884GDB:6056885GDB:6056886GDB:6099557GDB:6056887GDB:6056888GDB;6056889GDB:6056890GDB:6056891GDB:6056892GDB:6056893GDB:6056894GDB:6056895GDB:6056896GDB:6056897GDB:6056898GDB;6056899GDB:6056900GDB:6056901GDB:6056902GDB:6056903GDB:6056904

GDB:6261905GDB:6056905GDB:6056906GDB;6056907GDB:6056908GDB:6056909GDB:6056910GDB:6065060GDB:6065061GDB:6065062GDB;6065063GDB:6065064GDB;6065065GDB:6065066GDB:6065067GDB:6065068GDB:6065069GDB:6103121GDB:6065070GDB:6065071GDB:6065072GDB:6065073GDB:6065074GDB:6065075GDB:6065076GDB:6065077GDB:6065078GDB:6065079GDB:6065080GDB:6065081GDB:6065082

the overlap between clones.

3. Results

3.1. Library screening and contig constructionFigure 1 shows the region containing the cluster of

disease-associated genes investigated in this study. Pre-viously, it has proven difficult to obtain coverage ofthe approximately 3-Mb region flanked by D11S480 andD11S913 in a CEPH mega YAC library31 and, thus, theregion has been considered to contain areas of unstablegenomic DNA refractory to YAC cloning.30 Therefore,we began to survey Du Pont's total human PI library32

to generate a contig map using PCR-based screening(Fig. 2). Nineteen PI clones were initially selected byusing 11 STSs developed from Not I linking clones, oneSTS (GP17) derived from the PYGM gene,39 and two

existing STS markers (WI-4003, FAU). The generationof STSs from some of the ends of the PI clone insertswas hampered due to high GC contents, and the pres-ence of high levels of Alu and of LINE sequences. Inthose cases, a BAC library constructed by Asakawa etal.33 which possesses larger inserts than the PI library(110 kb versus 75-95 kb) was employed as an additonallibrary to isolate new clones, assuming that clones withdifferent terminal sequences might allow to develop newSTSs. This actually allowed the development of 14 newSTSs from the termini of 10 BAC clones isolated using 6STSs derived from Not I linking clones and 3 STS mark-ers (AFMaO85yc9/DllS42O5, WI-9890 and COX8). Intotal, 33 PI and BAC clones were obtained in the in-tial screening. Successive walking from the ends of thesePI and BAC clone inserts allowed us to build six con-tigs. These contigs were located between D11S4205 andCN3168 (contig 1), around PLCB3 (contig 2), between

Dow



niwersytet W

arminsko-M

azurski w O


284 A 3-Mb Contig Map of Ilql3.1-ql3.3 [Vol. 4.

'11S1357

I-0146, D11S446,D11S451,D11S746

CD5.WI-7645. D11S1765, DitS586

PGA5. 011S678

•6919

1S697, D11S71B, D11S453, D11S737

PGL2

•O11S469, D1JS618, D11S553, D11S674.D11S4B0•Ol 1S4205

IDDM4

11

11S479, D11S575

H1S1337H1S619, D11S747

Figure 1. The Not I restriction map and the loci of PGL2, IDDM4, BBSl, and SCA5 on the Ilql3 region. The map represents a partof Not I restriction map of chromosome l lq (Hosoda et al. 1997). The vertical bold lines on the right of the map indicate the lociof respective disease genes (see text). The arrow shows the region where we constructed the contig map.

Dow



niwersytet W

arminsko-M

azurski w O


q 13.

3q1

3.2

q13.

1

TEL

i7

P77F10

P47A3

|p£4A2

P95F(

CE

N

95 CD

Fig

ure

2.

The

.'5-

Mb

cont

ig m

ap o

f th

e Il

ql3.

1-ql

3.3

regi

on.

Th e

top

hor

izon

tal

line

repr

esen

ts t

he N

ot 1

res

tric

tion

map

. V

ertic

al b

ars

on t

he r

estr

icti

on m

ap s

how

Not

I s

ites

and

dott

ed b

ars

show

a p

arti

ally

res

tric

ted

site

on

the

geno

me .

Num

eric

al v

alue

s ad

jace

nt t

o th

e m

ap r

epre

sent

the

phy

sica

l di

stan

ce i

n kb

bet

wee

n N

ot I

site

s. N

ot I

lin

king

clon

es a

re i

ndic

ated

abo

ve t

he l

ine

and

othe

r m

appe

d m

arke

rs a

re m

arke

d be

low

the

lin

e. T

he l

ocat

ions

of

66 c

lone

s al

igne

d on

the

bas

i s o

f th

eir

loci

con

tent

are

ind

icat

edby

thi

n lin

es.

Wal

king

pat

hs a

re s

how

n by

yel

low

lin

es.

Ove

rlap

s co

nfirm

e d b

y th

e us

e of

clo

ne-e

nd s

eque

nces

are

als

o sh

own

by d

otte

d th

i n l

ines

. T

he s

izes

of

indi

vidu

alP

is,

BA

Cs.

PA

Cs

and

YA

Cs

are

illu

stra

ted

acco

rdin

g to

sca

le.

The

loc

i of

30

EST

s pl

aced

on

the

cont

ig m

ap a

re i

llus

trat

ed a

t th

e bo

ttom

. T

he b

old

arro

w a

bove

the

map

repr

esen

ts a

rec

ombi

natio

n ho

t sp

ot (

see

text

). O

ne g

ap i

s la

bele

d w

ith a

red

arr

ow.

Oth

ers

are

show

n on

the

lef

t-si

de d

own

pane

l.

ho

Dow



niwersytet W

arminsko-M

azurski w O



D11S427 and D11S636 (contig 3). between FAU andCN3191 (contig 4), between D11S711 and y776E2-NB9B(contig 5). and around CN1002 (contig 6). Two of them,corresponding to contigs 5 and 6. were connected by thegenetically anchored CEPH mega YAC clone. y776E2.A new set of eight STS markers was then developedfrom the insert end of terminal PI and BAC clones inorder to extend the islands. Their sites are: the reversalendofKB314H12 (B314H12R). the SP6 end of P110G11(P110G11S). the universal end of KB392D6 (B392D6U).the T7 end of P28D2 (P28D2T). the reversal end ofKB162B12 (B162B12R). the universal end of KB279B12(B279B12U). the T7 end of P77F10 (P77F10T). and theSP6 end of P110A10 (P110A10S). Since the screening ofboth PI and BAC libraries with these STSs did not re-sult in the identification of any clones, we utilized thePAC library30 which provides a 20-fold coverage of thehuman genome. Twenty-eight PAC clones were obtainedwith 6 STSs. Of these, three PAC clones connectedthe three contigs between P28D2 and KBf62B12 (ob-tained with 996E18 and 1045O2f) and between KB36C1and KB279B12 (obtained with 969D11). One PAC clone(662A14) bridged the distance between contig f and anorphan BAC clone. KB3f4Hf2. The other PAC clonesdid not link contigs and were used to generate new STSs.There remained two gaps that were noncontiguous at twosites located between KB392D6 and the newly obtainedPAC clone. 8f8E4. and between P77F10 and the PACclone. 825C24. We found no clone in the PL BAC. orPAC libraries which encompasses the STSs B392D6U andP77F10T. Walking from these sites was carried out us-ing the Research Genetics BAC library. This resultedin the identification of clones b45M18 for B392D6U andbl44L4 for P77F10T. Contigs 1 and 2 were connectedby b45M18. Despite extensive screenings using Pf. BACand PAC libraries, we could not fill the gap between con-tigs 4 and 5. Consequently. 1 YAC clone. 32 PI clones.27 BAC clones, and 6 PAC clones were contiguously ar-rayed on the 3-Mb region from D11S480 to CN1002 witha gap between CN3191 and D11S711.

To confirm the overlaps. 61 STSs that have been newlygenerated from Not I linking clones and the insert endsof PL BAC. and PAC clones were hybridized to Southernblots of the individual clones making up the contigs.Each new STS was tested against the five chromosome11 somatic hybrid cell lines. Jl-kc. Jl-44. Jl-7. P3-27A.and R229-3A. to prevent walks to a wrong genomic loca-tion. The 61 new STSs generated in this study are listedin Table 1. These STSs were invaluable for estimatingthe degree of overlap within a contig. Clone-to-cloneSouthern blot and RNA probe hybridization were alsoemployed to verify overlaps uncovered by STS analysisin some of the clones.

3.2. Analysis of the isolated clones and contigThe STSs developed from the end sequences of P113H6

and P22C8 did not map on Hql3. indicating that thesePI clones were chimeras (Fig. 2). P113H6 was isolatedby the cCIll-367A marker which is proximal to PYGM.YAC clones DA1908F2 (350 kb) and 199A7 (200 kb) wereisolated from two YAC libraries'12-'4'5 using GP17 devel-oped by Toda et al.44 Chimerism was also observed forthe YAC clone DA1908F2. The map contained one gapin the region around D11S711 where P22C8 was found tomap. These observations suggest that DNA in the regionfrom D11S480 to D11S460. and especially around PYGMand D11S711. might contain sequences that are hard toclone even with the low-copy-number vectors. Xot I re-striction sites were identified for all the clones along withthe developed contigs. The ATot I restriction patternsof all isolated clones coincided well with the previouslyconstructed Not I restriction map.50 indicating that thegenomic structure is faithfully retained within individualclones. Our map represents a twofold average coverageof the region comprised by the contigs and the depth ofcoverage varied from no clone in one gap to 4 clones insome regions (CN3168 and CN3179).

3.3. Mapping of ESTsSeventy ESTs have been mapped to the region between

D11S1357 and D11S913 (see Fig. 1) by radiation hybridmapping.40 Thirty of them could be integrated within thepresent contig map (Fig. 2) and 40 ESTs were localizedon a YAC contig spanning the region from l l q l l to thecentromeric end of ql3.1 (data not shown), which wasconstructed using genetically anchored YACs from theCEPH mega YAC library31 with the help of the Not Irestriction map (Hosoda ct al.. unpublished data). Asshown in Fig. 2. this contig map established the unequiv-ocal order of ESTs previously mapped to the interval be-tween D11S480 and D11S460. This information shouldprovide a valuable tool for cDXA screening.

4. Discussion

Chromosome I lq l3 is a region characterized by thepresence of a particularly high density of disease genespreviously mapped by genetic likage analysis (Fig. I).46

However, with the exception of MENIN. the molecu-lar cloning of these genes remains to be accomplished,despite the resources that have been made available bythe rapid progress of the human genome project. Werecently reported the construction of a complete A"of Irestriction map spanning the entire long arm of chromo-some 11 and showed that the A*of I sites are highly clus-tered in the ql3 region with an average span of 160 kbbetween them.30 We have also found that CEPH megaYAC clones, which were isolated from eight sites within

Dow



niwersytet W

arminsko-M

azurski w O



the 6-Mb region lying between PGA5 and D11S1917(see Fig. 1), possessed severe deletion or rearrangement,demonstrating the unsuitability of YAC-based mappingfor this region.30 Based on these results, we attemptedthe construction of a contig map spanning the 3 Mb re-gion between D11S480 and D11S913 in ql3 using E. coli-based large-insert cloning systems and the assembled NotI linking clones as scaffolds. Our success in the construc-tion of the present contig map for this region underlinesthe importance of physical maps which serve as a guidein this type of analysis. In addition, this study supportsthe use of large insert bacterial clones as an alternativeto YACs for the contig construction of large genomic in-tervals.

The gap in the contig map (illutsrated by an arrowin Fig. 2) is located in the 200-kb region between Not Isites CN3191 and D11S711, and has a maximal size of70 kb. The gap size was estimated from the size of theNot I fragments of the PI clones P110A10 and P77F10which protrude from Not I sites CN3191 and D11S711,respectively. As bl44L4 is located at the distal end of thecentromeric contig and overlaps with P77F10, determi-nation of its insert size and the extent of overlap shouldallow us to narrow the gap. In spite of extensive screen-ing using various E. coli vector-based libraries includinga PI library, Du Pont's total human library (3.5 genomeequivalents), two BAC libraries (Keio University and Re-search Genetics total human libraries containing 3.5 and4 genome equivalents, respectively) and a PAC library(20 genome equivalents), our efforts to fill this gap wereunsuccessful. This failure might be attributable to theexistence of sequences with high GC contents, high genedensity, or to the presence of unusual sequences affectingthe growth of host cells.

Two groups have recently reported high-resolutionmaps that overlaps ours. Wood et al.27 constructed a1.5-Mb physical map from PYGM to D11S460. Com-parison of our map with their physical map reveals adifference in the order of some of the markers. Ourmap indicates the order, cen-DHS457-DHS427-PYGM-qter (see Fig. 1), while Wood et al.27 reported the or-der, cen-PYGM-DHS427-DHS457-qter. This differencecould be due to the fact that these markers are clus-tered within a very restricted region, and that orderingof markers within such small regions is difficult to resolveby FISH analysis or mapping with somatic cell hybrids.Courseaux et al.26 reported a physical map of the re-gion between D11S471 and D11S460 (see Fig. 1). OurNot I restriction map is in good agreement with theirmap concerning the ordering of markers. However, thereexist some discrepancies with respect to the estimationof the distances. For example, intermarker distances be-tween COX8 and D11S457 and between D11S427 andPYGM are much longer in their physical map than inours (600 kb versus 340 kb and 400 kb versus 80 kb,

respectively). Conversely, the intermarker distance be-tween PYGM and FAU is shorter in their map than inours (180 kb versus 400 kb). This difference may be dueto the scarcity of markers in their experiments.

By comparing our Not I restriction map30 with anintegrated YAC-RH-genetic map constructed by theMIT/Whitehead genome center,47 we found that previ-ously mapped STS markers are very scarce in the ql3 re-gion. As this region is expected to contain a particularlyhigh density of genes, we predicted that the introductionof EST markers as landmarks would make up for thedeficiency in marker density. The recent version of theWhitehead map allocates a number of EST markers45 tothe ql3 region, although their precise ordering remainsto be defined, probably because of the limited resolu-tion of RH mapping. The EST mapping shown in Fig. 2demonstrates that 30 out of the 70 EST markers locatedbetween D11S1357 and D11S913 in their map are withinthe 3 Mb region with an average spacing of 120 kb andwithout strong bias in their distributions. This informa-tion suggests that if YAC clones are unavailable, contigconstruction could be achieved by combining the exten-sive use of EST markers as scaffolds with the constructionof physical maps such as the Not I restriction map.

We have revealed the presence of seven recombinationhot spots on the long arm of chromosome 11 by compar-ing Not I restriction map30 with the Genetic map.48 Oneof them is located between D11S4205 and D11S1883; thissite is found within the contig map presented in this re-port and is covered by the clones KB306G8, KB191G5,KB292F6, and KB387H11. Sequence analysis might pro-vide some insight into why the region displays such ahigh recombination frequency compared to the surround-ing region.

This study provides reagents and mapping informationthat can be used to identify candidate genes assigned toIlql3.1-ql3.3. In addition, our map provides a set ofminimal overlapping bacterial clones that can be used astemplates for determining the nucleotide sequence of thisregion of chromosome 11.

Acknowledgments:We thank Dr. T. Honjo (Kyoto University) for provid-

ing the PI library; Drs. F. Matsuda (Kyoto University)and M. Ohira (Kazusa DNA Research Institute) for ad-vice about PI screening; Dr. F. Morohoshi for providingprimers; and Drs. A. Tanigami and Y. Arai for valuablediscussions. We are grateful to M. Mori and C. Hatanakafor their technical assistance. This work was supported inpart by the Program for Promotion of Fundamental Stud-ies in Health Sciences of the Organization for Drug ADRRelief, R&D Promotion and Product Review of Japan; bya Grant-in-Aid for Scientific Research on Priority Areasfrom the Ministry of Education, Science, Sports and Cul-ture; by a grant from the Special Coordination Funds forthe Promotion of Science and Technology from the Sci-

Dow



niwersytet W

arminsko-M

azurski w O



ence and Technology Agency; by a Grant-in-Aid for theComprehensive 10-Year Strategy for Cancer Control; andby the Grant-in-Aid for Cancer Research from the Min-istry of Health and Welfare of Japan. E. K. was awardeda Research Resident Fellowship from the Foundation forPromotion of Cancer Research.

References

1. Lebo, R. V., Gorki, F., Fletterick, R. J., Kao, F.-T.,Cheung, M. C, Bruce, B. D., and Kan, Y. W. 1984,High-resolution chromosome sorting and DNA spot-blotanalysis assign McArdle's syndrome to chromosome 11,Science, 225, 57-59.

2. Weil, D., Blanchard, S., Kaplan, J. et al. 1995, Defectivemyosin VIIA gene responsible for Usher syndrome typeIB, Nature, 374, 60-61.

3. Chandrasekharappa, S. C, Guru, S. C, Manickam, P.et al. 1997, Postional cloning of the gene for multipleendocrine neoplasia-type 1, Science, 276, 404-407.

4. Graff, C, Forsman, K., Larsson, C. et al. 1994, Finemapping of Best's macular dystrophy localizes the gene inclose proximity to but distinct from the D11S480/-ROM.Zloci, Genomics, 24, 425-434.

5. Hill, M. R., James, A. L., Faux, J. A. et al. 1995, Fc ep-silon Rl-beta polymorphism and risk of atopy in a generalpopulation sample, Br. Med. J., 311, 776-779.

6. Gong, Y., Vikkula, M., Boon, L. et al. 1996,Osteoporosis-pseudoglioma syndrome, a disorder affect-ing skeletal strength and vision, is assigned to chromo-some region Ilql2-13, Am. J. Hum. Genet, 59, 146-151.

7. Davies, J. L, Kawaguchi, Y., Bennett, S. T. et al. 1994,A genome-wide search for human type 1 diabetes suscep-tibility genes, Nature, 371, 130-136.

8. Hashimoto, L., Habita, C., Beressi, J. P. et al.1994, Genetic mapping of a susceptibility locus forinsulin-dependent diabetes mellitus on chromosome llq,Nature, 371, 161-164.

9. Ranum, L. P. W., Schut, L. J., Lundgren, J. K., Orr, H.T., and Livingston, D. M. 1994, Spinocerebellar ataxiatype 5 in a family descended from the grandparentsof President Lincoln maps to chromosome 11, NatureGenet, 8, 280-284.

10. Mariman, E. C. M., van Beersum, S. E. C., Cremers,C. W. R. J., Struycken, P. M., and Ropers, H. H. 1995,Fine mapping of a putatively imprinted gene for familialnon-chromamn paragangliomas to chromosome Ilql3.1:evidence for genetic heterogeneity, Hum. Genet., 95, 56-62.

11. Leppert, M., Baird, L., Anderson, K. L., Otterud, B.,Lupski, J. R., and Lewis, R. A. 1994, Bardet-Biedl syn-drome is linked to DNA markers on chromosome 1 lq andis genetically heterogeneous, Nature Genet., 7, 108-112.

12. Bruford, E. A., Riise, R., Teague, P. W. et al. 1997,Linkage Mapping in 29 Bardet-Biedl syndrome familiesconfirms loci in chromosomal regions Ilql3, 15q22.3-q23,and 16q21, Genomics, 41, 93-99.

13. Nakamura, Y., Larsson, C., Julier, C. et al. 1989, Local-ization of the genetic defect in multiple endocrine neopla-

sia type 1 within a small region of chromosome 11, Am.J. Hum. Genet., 44, 751-755.

14. Julier, C., Nakamura, Y., Lathrop, M. et al. 1990, Adetailed genetic map of the long arm of chromosome 11,Genomics, 7, 335-345.

15. Fujimori, M., Wells, Jr. S. A., and Nakamura, Y. 1992.Fine-scale mapping of the gene responsible for multi-ple endocrine neoplasia type 1 (MEN 1), Am. J. Hum.Genet, 50, 399-403.

16. Weissenbach, J., Gyapay, G., Dib, C. et al. 1992, Asecond-generation linkage map of the human genome.Nature, 359, 794-801.

17. Buetow, K. H., Weber, J. L., Ludwigsen, S. et al. 1994.Integrated human genome-wide maps constructed usingthe CEPH reference panel, Nature Genet, 6, 391-393.

18. Gyapay, G., Morissette, J., Vignal, A. et al. 1994, The1993-94 Genethon human genetic linkage map, NatureGenet, 7, 246-339.

19. Janson, M., Larsson, C, W'erelius, B. et al. 1991, Detailedphysical map of human chromosomal region Ilql2-13shows high meiotic recombination rate around the MEN1locus, Proc. Natl. Acad. Sci. USA, 88, 10609-10613.

20. Szepetowski, P., Simon, M.-P., Grosgeorge, J. et al. 1992.Localization of Ilql3 loci with respect to regional chro-mosomal breakpoints, Genomics, 12, 738-744.

21. Tanigami, A., Tokino, T., Takita, K., Takiguchi, S., andNakamura, Y. 1992, A 14-Mb physical map of the regionat chromosome Ilql3 harboring the MEN1 locus and thetumor amplicon region, Genomics, 13, 16-20.

22. Kas, K., Schoenmakers, E., van de Ven, W. et al. 1993.Assignment of the human FAU gene to a subregion ofchromosome Ilql3, Genomics, 17, 387-392.

23. Szepetowski, P., Perucca-Lostanlen, D., and Gaudray, P.1993, Mapping genes according to their amplification sta-tus in tumor cells: Contribution to the map of Hql3,Genomics, 16, 745-750.

24. Weber, G., Friedman, E., Grimmond, S. et al. 1994, Thephospholipase C beta 3 gene located in the MEN1 regionshows loss of expression in endocrine tumors, Hum. Mol.Genet, 3, 1775-1781.

25. Courseaux, A., Grosgeorge, J., Gamier, G., Larsson, C.Ayraud, N., Gaudray, P., and Raynaud, S. D. 1995, Rear-rangement of proximal Ilql3 band in a CMML in acutetransformation, Leukemia, 9, 1313-1317.

26. Courseaux, A., Grosgeorge, J., Gaudray, P. et al. 1996,Definition of the minimal MEN1 candidate area basedon a 5-Mb integrated map of proximal Ilql3, Genomics,37, 354-365.

27. Wood, T. F., Srivatsan, E. S., Chakrabarti, R. et al. 1996,A 1.5-Megabase physical map encompassing the multipleendocrine neoplasia type-1 (MEN1) locus on chromosomeIlql3, Genomics, 38, 166-173.

28. Courseaux, A., Szepetowski, P., Fernandes, M. etal. 1997, Framework YAC contig anchored into a3.2-Mb high-resolution physical map in proximal Ilql3,Genomics, 40, 13-23.

29. Cooper, P. R., Nowak, N. J., Higgins, M. J. et al. 1997, Asequence-ready high-resolution physical map of the Best'smacular dystrophy gene region in Ilql2-ql3, Genomics,41, 185-192.

Dow



niwersytet W

arminsko-M

azurski w O



30. Hosoda, F., Arai, Y., Kitamura, E. et al. 1997, A com-plete Not I restriction map covering the entire long armof human chromosome 11, Genes to Cells (in press).

31. Chumakov, I. M., Rigault, P., Gall, I. et al. 1995, A YACcontig map of the human genome, Nature, 377, 175—297.

32. Shepherd, N. S., Pfrogner, B. D., Coulby, J. N. et al.1994, Preparation and screening of an arrayed humangenomic library generated with the PI cloning system,Proc. Natl. Acad. Sci. USA, 91 , 2629-2633.

33. Asakawa, S., Abe, I., Kudoh, Y. et al. 1997, HumanBAC library: construction and rapid screening, Gene (inpress).

34. Shizuya, H., Birren, B., Kim, U.-J., Mancino, V., Slepak,T.. Tachiiri, Y., and Simon, M. 1992, Cloning and sta-ble maintenance of 300-kilobase-pair fragments of humanDNA in Escherichia coli using an F-factor-based vector,Proc. Natl. Acad. Set. USA, 89, 8794-8797.

35. Joannou, P. A. and de Jong, P. J. 1996, Construction ofbacterial artificial chromosome libraries using the mod-ified PI (PAC) system, In Current protocols in humangenetics (ed, Dracopoli, N. C , Haines, J. L., Korf, B. R.,Moir, D. T., Morton, C. C , Seidman, C. E., Seidman, J.G., and Smith. D. R. pp. 5.15. 1-24, John Wiley&Sons,New York.

36. Kere, J., Nagaraja, R., Mumm, S., Ciccodicola, A.,D'Urso, M., and Schlessinger, D. 1992, Mapping hu-man chromosomes by walking with sequence-tagged sitesfrom end fragments of yeast artificial chromosome inserts,Genomics, 14, 241-248.

37. Arai, Y., Hosoda, F., Nakayama, K., and Ohki, M. 1996,A yeast artificial chromosome contig and Not I restric-tion map that spans the tumor suppressor gene(s) locus,Ilq22.2-q23.3, Genomics, 35, 196-206.

38. Gallo, K. A., Mark, M. R., Scadden, D. T., Wang, Z., Gu,Q.. and Godowski, P. J. 1994, Identification and char-acterization of SPRK, a novel src-homology 3 domain-containing proline-rich kinase with serine/threonine ki-nase activity, J. Biol. Chem., 269, 15092-15100.

39. Burke, J., Hwang, P., Anderson, L., Lebo, R., Gorin,F., and Fletterick, R. 1987, Intron/exon structure of thehuman gene for the muscle isozyme of glycogen phospho-rylase, Proteins, 2, 177-187.

40. Tokino, T., Takahashi, E., Mori, M. et al. 1991, Isola-tion and mapping of 62 new RFLP markers on humanchromosome 11, Am. J. Hum. Genet, 48, 258-268.

41. Smith, M. W., Clark, S. P., Hutchinson, J. S. et al. 1993,A sequence-tagged site map of human chromosome 11,Genomics, 17, 699-725.

42. Imai, T. and Olson, M. V. 1990, Second-generation ap-proach to the construction of yeast artificial-chromosomelibraries, Genomics, 8, 297-303.

43. Albertsen, H. M., Abderrahim, H., Cann, H. M., Dausset,J., Paslier, D., and Cohen, D. 1990, Construction andcharacterization of a yeast artificial chromosome librarycontaining seven haploid human genome equivalents,Proc. Natl. Acad. Set. USA, 87, 4256-4260.

44. Toda, T., Iida, A., Miwa, T., Nakamura, Y., and Imai,T. 1994, Isolation and characterization of a novel geneencoding nuclear protein at a locus (D11S636) tightlylinked to multiple endocrine neoplasia type 1 (MEM1),Hum. Mol. Genet, 3, 465-470

45. Schuler, G. D., Boguski, M. S., Stewart, E. A. et al. 1996,A gene map of the human genome, Science, 274, 540-546.

46. Shows, T. B., Alders, M., Bennett, S. et al. 1996, Re-port of the fifth international workshop on human chro-mosome 11 mapping (1995), Cytogenet. Cell Genet, 74,1-56.

47. Hudson, T. J., Stein, L. D., Gerety, S. S. et al. 1995,An STS-based map of the human genome, Science, 270,1945-1954.

48. Dib, C , Faure S., Fizames, C. et al. 1996, A comprehen-sive genetic map of the human genome based on 5,264microsatellites, Nature, 380, 152-154.

Dow



niwersytet W

arminsko-M

azurski w O


Dow



niwersytet W

arminsko-M

azurski w O


a 3-mb sequence-ready contig map - dna research

Documents