a bet bromodomain inhibitor suppresses adiposity ...€¦ · stimulated tumor formation in vivo. we...

Research Article

A BET Bromodomain Inhibitor SuppressesAdiposity-Associated MalignantTransformationDebrup Chakraborty, Vanessa Benham,Vladislav Jdanov, Blair Bullard,Ana S. Leal, Karen T. Liby, and Jamie J. Bernard

Abstract

Almost half a million of all new cancers have been attribut-ed to obesity and epidemiologic evidence implicates visceraladipose tissue (VAT) and high-fat diets (HFD) in increasingcancer risk. We demonstrated that VAT-derived fibroblastgrowth factor 2 (FGF2) from mice fed an HFD or obeseindividuals stimulates the malignant transformation of epi-thelial cells. Mechanism-based strategies to prevent thisVAT-enhanced tumorigenesis have not been explored. Clinicalstudies have indicated that bromodomain inhibitors haveconsiderable potential as therapeutic agents for cancer by in-hibiting the activity of several oncogenes, including c-Myc;however, their chemopreventiveactivity isunknown.Weshowherein that mice with visceral adiposity have elevated nuclearc-Myc expression in their epidermis. We hypothesized that

the bromodomain inhibitor I-BET-762 (I-BET) would haveefficacy in the prevention of malignant transformation byVAT and FGF2. We tested this hypothesis using our novelmodels of VAT-stimulated transformation in vitro and FGF2-stimulated tumor formation in vivo. We found that I-BETsignificantly attenuates VAT and FGF2-stimulated transfor-mation and inhibits VAT-induced c-Myc protein expressionin several skin and breast epithelial cell lines. Moreover,I-BET attenuated tumor growth significantly in FGF2-treatednudemice.Work is ongoing to determine the role of visceraladiposity in c-Myc activity in several tissues and determinethe inhibitory effect of I-BET on VAT-promoted tumorsin vivo. Cancer Prev Res; 11(3); 129–42. �2017 AACR.See related editorial by Berger and Scacheri, p. 125

IntroductionIt has been estimated that 20% of cancers are caused by

obesity (1). Apart from having excess adipose tissue, datasuggest that body fat distribution is another indicator ofadiposity and cancer risk. Individuals that store propor-tionally more fat around their visceral organs (abdominaladiposity) than on their thighs and hips, as measured bywaist-to-hip ratio (WHR) or waist circumference (WC), areat a higher risk for colon, premenopausal breast, endome-trial, pancreatic, and esophageal cancers (2–7).Epidemiological and clinical data demonstrating a pos-

itive association between VAT and cancer are strengthenedby animal data. Animalmodels have linked visceral adiposetissue (VAT) in high-fat diet (HFD)-fed mice to skin and

colon cancers by showing a reduction in tumors with thesurgical removal of VAT (8, 9). We demonstrated that VATremoval (lipectomy) in HFD-fed mice inhibited ultravioletB (UVB)-induced formation of nonmelanoma skin cancers(NMSC) by 75% to 80% when compared with sham-oper-ated controlmice (9). HFD-fed lipectomizedmice had littleto no VAT but had more subcutaneous (underneath theskin) adipose tissue (SAT), less serum proinflammatorycytokines, and a lower proliferation index in the skin com-pared with HFD-fed sham-operated animals (9). Notably,the compensatory increase in SAT did not replace thepromoting effect of VAT on tumor formation, suggestingthat factors released from VAT promoted tumor formation.The molecular changes in the skin that drive the differencesin proliferation and tumor formation between the animalswith differential adipose tissue distribution are unknown.In a recent publication, we demonstrated that FGF2 is

one of the key factors released fromVAT that enhances skinepithelial cell transformation (10). Circulating FGF2 fromVAT was positively associated with UVB-induced tumorformation in HFD-fed mice (10). Knocking out FGFR-1,the receptor for FGF2, in skin epithelial cells inhibited VAT-and FGF2-induced c-Myc expression and growth in softagar, a marker for tumorigenicity (10). A c-Myc inhibitorsignificantly attenuated the effect of VAT on skin epithelialcells (10). These data suggest FGF2 stimulation of FGFR-1

Department of Pharmacology and Toxicology, Michigan State University, EastLansing, Michigan.

Note: Supplementary data for this article are available at Cancer PreventionResearch Online (http://cancerprevres.aacrjournals.org/).

CorrespondingAuthor: Jamie J. Bernard, Michigan State University, 1355 BogueStreet, Life Science B420 Department of Pharmacology and Toxicology, Michi-gan State University, East Lansing, MI 48824. Phone: 517-353-5326; Fax: 517-353-8915; E-mail: [email protected]

doi: 10.1158/1940-6207.CAPR-17-0262

�2017 American Association for Cancer Research.

CancerPreventionResearch

www.aacrjournals.org 129

http://crossmark.crossref.org/dialog/?doi=10.1158/1940-6207.CAPR-17-0262&domain=pdf&date_stamp=2018-2-22

and downstream c-Myc activation as a previously unap-preciated link between VAT and cell transformation.c-Myc is the target of a diverse set of regulators including

bromodomain and extraterminal domains (BET) proteins.BET proteins act as epigenetic readers mediating protein–protein interactions including the recruitment proteincomplexes that drive transcriptional activation (11). OneBET protein, bromodomain-containing 4 (BRD4), recruitsp-TEFb, cyclin-dependent kinase (CDK) 9, and cyclin T andregulates the transcription of genes responsible for cell-cycle progression, proliferation, and apoptosis, includingc-Myc (12). Until the development of bromodomain(BET) inhibitors, it was difficult to pharmacologicallytarget c-Myc because of the diverse mechanisms drivingits aberrant expression and complexities involved withprotein–DNA interactions (13). BET inhibitors are thoughtto suppress progression of hematologic cancers by inhibit-ing c-Myc; however, BET inhibitors are also efficacious incancers that do not upregulate c-Myc such as pancreaticductal adenocarcinomas and malignant peripheral nervesheath tumors (14–18). Therefore, several smallmoleculeswith high potency and specificity toward BET proteins havebeen developed as chemotherapeutics (19–21).One of themost advanced BET inhibitors, I-BET-762 (I-BET, alsoknown as GSK525762) is selective for BRD4 and is inclinical trials for the treatment of human nuclear protein intestis (NUT) midline carcinoma (22) and other cancers,including breast, prostate, and colorectal cancers.BET proteins are also implicated in the epigenetic regu-

lation of inflammation (23, 24). Excess adiposity resultingin increased inflammation has been strongly implicated inobesity–cancer connection (25, 26). Therefore, we hypoth-esized that inhibitors of BET proteins are preventive forVAT-enhanced transformation. To test this hypothesis,we investigated the inhibitory activity of I-BET on VAT-enhanced cell transformation of nontumorigenic but trans-formation-capable JB6 Pþ (epidermal), MCF-10A (humanmammary epithelial), and NMuMG (mouse mammaryepithelial) cells. The mouse Balb/c epidermal, JB6 Pþ cellline is a well-characterized, in vitro model for neoplastictransformation for tumorpromoters (27–38). JB6Pþ,MCF-10A, and NMuMG cells are initiated but nontumorigenic(they fail to form tumors when injected into immunocom-promised mice; refs. 39, 40). We measured cell transfor-mation using the soft-agar assay, inwhichonly transformedcells can grow to form colonies in an anchorage-indepen-dent manner (39). We found that c-Myc is part of the coretranscriptional program by which VAT enhances neoplastictransformation in skin and breast epithelial cells, and thisactivity can be inhibited with I-BET.

Materials and MethodsCell culture and reagentsJB6 Pþ cells (mouse skin epithelial cells) were obtained

from the American Type Culture Collection. Cells were

grown in MEM (Invitrogen) supplemented with 5% FBSand antibiotics. NMuMG cells were received as a kind giftfrom Dr. Richard Schwartz (MSU) and were grown inDMEM (Invitrogen) supplemented with 10% FBS andantibiotics. MCF-10A cells (Human mammary epithelialcells) were obtained from the American Type CultureCollection. Cells were grown in DMEM/F-12 with 5%horse serum and supplements. HaCaT cells (human ker-atinocyte cells) were obtained as a gift fromDr. Animesh ASinha (University of Buffalo, NY) and were grown inDMEM supplemented with 10% FCS and antibiotics.Pharmacologic inhibitor against I-BET-762 obtained fromJ-Star Research Inc. c-Myc overexpression (OE/pS62) plas-midswereobtained as a gift fromDr. Rosalie Sears (OregonHealth and Science University).Antibodies: c-Myc for Western blot (Cell Signaling

Technology; #5605), c-Myc for immunofluorescence (CellSignaling Technology; #13987), Brd4 (Abcam;#ab75898),NF-kB (Cell Signaling Technology; #8242), Ki67 (CellSignaling Technology; #9129), PCNA (Santa Cruz Biotech-nology; # SC-56), Actin (Sigma #A5060), Anti-Rabbit 2ndAb (Li-Cor; #926-32213), Anti-Mouse 2nd Ab (Li-Cor#926-32212). Anti-mouse CF 488A (Sigma-Aldrich;#SAB4600387), anti-rabbit CFL 555 (Santa Cruz Biotech-nology; #sc-362271), and anti-CD31 antibody (Abcam;#ab28346).

AnimalsHealthy inbred SKH1-E mice (Charles River Laboratories,

6/8 weeks) were kept at environmentally controlled condi-tions inpolypropylene cages andallowed freedrinkingwaterand basal diet ad libitum. All animal protocols wereapproved by the IACUC at MSU. Animals were kept eitheron LFD containing 10 kcal of fat (D11012202) or HFDcontaining 60 kcal of fat (60% kcal form corn oilD11012204, Research Diets, Inc.). At the end of the exper-iment, mice were humanely sacrificed using carbon dioxideandbloodandadipose tissue sampleswere collected. For thelipectomy study, SKH1-E mice (8 weeks, n ¼ 20) were kepton either anLFDorHFD for 2weeks prior to lipectomy. Skinsampleswere collected and used for immunohistochemistry(IHC). For the in vivo tumorigenicity study, nude mice(8 weeks, n ¼ 8) were subcutaneously injected with JB6 Pþ

cells (0.5 � 106/0.2 mL/mouse) in the right flank. Thefollowing day, FGF2 (200 mg/kg) was injected i.p. once perday for the next 7 days. Mice were orally gavaged with I-BET(15 mg/kg b.w.) or vehicle (0.5% DMSO and 5% Tween 20in 0.9% saline) once per day for 14 days. Twenty-four hoursfollowing the first dose of I-BET, cells were injected. Tumorvolumes were assessed by investigators blinded to the exper-imental groups. Mice were sacrificed 14 days after injection.

Anchorage-independent colony formation assay in softagarColony formation assayswere performed in 24-well plates

with either JB6 Pþ, NMuMG,MCF-10A cells (750 cells/well)

Chakraborty et al.

Cancer Prev Res; 11(3) March 2018 Cancer Prevention Research130

in 0.300 mL of 0.3% soft agar with or without fat tissuefiltrate (FTF), FGF2and I-BETon topof a0.35mLbase layerof 0.5% agar. Cells in plate were allowed to settle for 30minutes and cultured for up to 2 weeks (JB6 Pþ and MCF10A cells) or 5 weeks (NMuMG cells). At the end of theincubation period, cells were stained with 0.01% crystalviolet, and colonies were counted manually under themicroscope.

Preparation of fat tissue filtratesOne hundred micrograms of (mouse and human) adi-

pose tissue was gently homogenized in an equal volumeof serum-free MEM on ice for 30 seconds using TissueRuptor (Qiagen) on medium speed. Homogenates werefiltered through hanging 15 mm wide 0.4-mm filter insert(Millicell, cat# MCHT06H48) into a 6-well plate previous-ly filled with 400 mL serum-free MEM and incubated on arocker at room temperature for 1 hour to allow smallmolecules and proteins to diffuse into the medium whileremoving lipids and macromolecules. After incubationfiltrates were centrifuged at 4,500 rpm for 5 minutes, andthe supernatant was collected and filtered through 0.4-mmsyringe filter (Millipore) and protein concentrations werequantified using BCA assay. Concentration (200 mg/mL) ofmouse fat tissue filtrates (MFTF) and 150 mg/mL concen-tration of human fat tissue filtrates (HuFTF) were used forrespective experiments.

Treatment of cells in soft agarFor analysis of I-BET–induced inhibition of malignant

transformation, I-BET were added directly into the toplayers of soft agar containing cells andMFTF/HuFTF/FGF2.At the endof the incubation period, cells werefixed by 70%ethanol and stainedwith 0.01% crystal violet, and colonieswere counted manually under microscope.

Western blotCells (2 � 105) were plated in 35-mm diameter plates

and allowed to grow for 24 hours before treatment. Thecells were treated with either MFTF (at 300 mg/mL dose)or HuFTF (at 200 mg/mL dose) for indicated period. Aftertreatment, cells were harvested, washed, and lysed inRIPA buffer pH 7.4, supplemented with protease andphosphatase inhibitors. Proteins were separated by 12%SDS-PAGE and transferred to nitrocellulose membranes.Membranes were blocked with either 5% nonfat milksolution or 4% BSA and then incubated with the appro-priate primary antibody for overnight at 4�C, followedby 1-hour incubation with fluorochrome-tagged second-ary antibody. Bands were visualized by LI-COR Odysseyclassic image scanner.

IHCFormalin-fixed paraffin-embedded fat tissue sections

frommice were deparaffinized and incubated with antigenretrieval buffer for 1minute at 95�C. Sections were blocked

in 4% BSA for 1 hour at room temperature and thenincubated with primary monoclonal antibody (anti-Ki67/anti-PCNA/TUNEL) antibody (1:100) overnight at4�C, followed by secondary anti-mouse antibody labeledwith HRP. After brief washing, slides were stained for 30seconds using 3,3-diaminobenzidine as substrate. Nucleiwere stained with hematoxylin (Harris) for 30 seconds.Imageswere acquiredwith aNikon digital camera attachedon an Olympus microscope at 400� magnification. Forfluorescence imaging of skin, tissue sections were incubat-ed with anti-rabbit (red) and anti-mouse (green; 1:200dilution) secondary antibody for 1 hour at room temper-ature in dark. Cells were washed twice with PBS and slideswere mounted with cover glass by DAPI and anti-fadeconjugated mounting reagent. Photographs were taken at40�magnification on "Olympus Fluoview SV 1000" con-focal microscope.

ImmunofluorescenceCells were fixed in 4% formaldehyde for 15minutes and

permeabilized with 0.2% PBS-T for 10 minutes, blockedwith 4% BSA for 1 hour. Cells were incubated overnight at4�C with primary anti–c-Myc antibody (1:300 dilution).After 3 washes (5 minutes each) with PBS cells wereincubated with anti-rabbit (red) and anti-mouse (green;1:200 dilution) secondary antibody for 1 hour at roomtemperature indark. Cellswerewashed twicewith PBS, andcoverslips were mounted on the slides by DAPI and anti-fade conjugated mounting reagent. Photographs were tak-en at 40� magnification on Olympus Fluoview SV 1000confocal microscope.

RNA extraction and real-time quantitative-polymerasechain reactionJB6 Pþ cells were treated with MFTF and/or I-BET. Cells

were harvested and RNA was isolated from cells usingQiagen RNeasy mini kit. For reverse transcription (RT),400 ng of total RNA was used as template, and expressionsof c-Myc, NF-kB, Kif5b, Cdx3, and Cdk7 were analyzed byqRT-PCR. Primer sequences are enlisted in Table 1. Taq-Man Reverse Transcription Reagents (Applied Biosystems;#N8080234) were used to convert RNA into cDNA. cDNAwas used for the qPCR. qPCR were performed using SYBR

Table 1. Primer sequences

Gene Primer sequence (50–30)c-MYC-F ACACGGAGGAAAACGACAAGc-MYC-R AGAGGTGAGCTTGTGCTCGTNF-kB-F GGGGATGTGAAGATGTTGCTNF-kB-R CCAAGTGCAGAGGTGTCTGAKif5b-F GCTAGTCCAACTCCGAGCACKif5b-R GGTTTTGGTCTTGGAGGTCACdx3-F GCCTGCCTCCAACTTTACTGCdx3-R AAACTGGGGAGGTCATGTCACdkn3-F GTCCCAAACCTTCTGGACCTCdkn3-R AGGAGGAGACAAGCAGCAAGCdk7-F ACTGCAGCACATCTTCATCGCdk7-R GATTCGCCGGTTCCTTTAAT

A BET Bromodomain Inhibitor Suppresses Transformation

www.aacrjournals.org Cancer Prev Res; 11(3) March 2018 131

Green PCR Master Mix (Applied Biosystems; #4309155)gene expression assay kits in ABI-7500 fast real-time qPCRmachine.

Animal study approvalAll mice used in this study received humane care that

adheres to principles stated in the Guide for the Care andUse of Laboratory Animals (NIH publication, 1996 edi-tion), and the protocol was approved by the IACUC andAnimal Care Program of Michigan State University, EastLansing, MI.

Study approval for human samplesThe Rutgers-Robert Wood Johnson Medical School

Institutional Review Board approved the protocol"Determining the Impact of Human Fat on CancerDevelopment" on October 16, 2015. Informed consentwas obtained from candidates before undergoing gyne-cologic surgery. Intra-abdominal visceral (omental andparametrial) adipose tissue were obtained, and sampleswere deidentified to investigators at Michigan StateUniversity.

Statistical analysisAll animal experiments were performed using at least 8

mice or three technical replicates in three independentexperiments. Data are presented as mean � SD. ANOVAwas used to compare among groups followed by the Tukeytest for multiple comparisons. For all statistical tests, the0.05, 0.01, and 0.001 level of confidence was accepted forstatistical significance.

Data availability statementThe data that support the findings of this study are

available from the corresponding author upon rea-sonable request.

ResultsVAT is associated with c-Myc expressionOur previous studies demonstrated that VAT removal

in HFD-fed mice inhibited UVB-induced formation ofNMSCs by 75% to 80% when compared with sham-operated control mice (9). Histologic data revealed ahigher proliferation index in normal epidermis in ani-mals that were abdominally obese, compared with ani-mals that were subcutaneously obese (9). To understandthis mechanism of enhanced proliferation and reducedapoptosis by visceral adiposity, in epidermal areas awayfrom the tumors, we measured levels c-Myc and NF-kB,two transcription factors known to be involved in cellgrowth and carcinogenesis. Immunofluorescence micros-copy with skin samples from HFD-fed mice indicatedthat lipectomy (removal of VAT) decreased the percent-age of c-Myc–positive cells in precancerous epidermis by85% (P < 0.05; Fig. 1A). The c-Myc expression was

mainly nuclear. Lipectomy showed no effect on p65-positive cells or the nuclear localization of p65 (Fig. 1B).The majority of p65 in precancerous epidermis waslocated in the cytoplasm (Fig. 1B).To determine if factors released from VAT induced c-

Myc in vitro, we used a VAT-conditioned media toevaluate the effects on c-Myc expression. HaCaT, immor-talized human keratinocytes, and JB6 Pþ cells weretreated with a filtered conditioned medium derivedfrom the visceral (parametrial or epididymal) adiposetissue of mice fed an HFD (MFTF) or VAT from obese(BMI>30) humans (HuFTF). HaCaT and JB6 Pþ cellsstimulated with MFTF or HuFTF for 8 hours showedincreased c-Myc nuclear protein expression (Fig. 2A–D).c-Myc induction was prevented by the pretreatment withI-BET-762 (I-BET), an inhibitor of BRD4, an epigeneticreader that regulates c-Myc transcription (Fig. 2E).Because c-Myc is stimulated by VAT, we hypothesizedthat inhibiting c-Myc with I-BET would also prevent theeffects of VAT on early-stage carcinogenesis. Analogouswith the in vivo data, HuFTF had no effect on NF-kB(p65, Rel A) nuclear localization in JB6 Pþ cells (Sup-plementary Fig. S1).

I-BET significantly attenuates MFTF- and HuFTF-stimulated growth of JB6 Pþ cells in soft agarWe previously published that MFTF stimulates non-

tumorigenic mouse epidermal JB6 Pþ cells to grow in softagar (39). Prior to FTF stimulation, we treated JB6 Pþ

cells with I-BET. I-BET dose-dependently attenuated thenumber of JB6 Pþ cells transformed by MFTF (Fig. 3A).I-BET (0.5 mmol/L) had no effect on growth in soft agar,whereas I-BET at 1 and 1.5 mmol/L doses attenuatedgrowth by 47% and 57%. Figure 3B demonstrates thatI-BET attenuated HuFTF-stimulated growth in soft agarby 39%. These data suggest that FTF-stimulated neoplas-tic transformation of skin epithelial cells is partiallydependent on BRD4 activity.

I-BET attenuates expression of genes downstream ofBrd4, triggered by MFTFTo assess BRD4 activity followingMFTF stimulation, the

expression of BRD4 regulated genes was measured by real-time PCR. MFTF significantly induced c-Myc (6 hours),NF-kB (6 hours), Kif5B (6 hours), and Cdk7 (30 minutes)in JB6Pþ cells (Fig. 4A). Cdx3was not significantly inducedat either 30 minutes or 6 hours. Pretreatment with I-BETsignificantly attenuated the induction of all BRD4-regulat-ed genes tested (Fig. 4A). In addition to BRD4 genes beinginduced with VAT, treatment with MFTF for 8 hoursinduced BRD4 and c-Myc protein expression in JB6 Pþ

cells (Fig. 4B and C). These data suggest that BRD4 activityis associated with MFTF-enhanced transformation.To determine c-Myc is important for cellular transfor-

mation in JB6 Pþ cells, c-Myc protein was overexpressedwith the transfection of a c-Myc plasmid or a c-Myc

Chakraborty et al.


phosphomutant, MycS62 plasmid. In addition to havinggreater stability, the pS62 form of c-Myc demonstratesmore oncogenic activity (41–44). Transfection of eitherplasmid significantly enhanced JB6 Pþ cell growth insoft agar (Fig. 4D). Transfection with a c-Myc plasmidinduced enhanced growth in soft agar by 535% andtransfection with a c-Myc phosphomutant enhancedgrowth in soft agar by 329% (Fig. 4D). To determinethe relative contribution of c-Myc for the efficacy of I-BETagainst transformation, c-Myc–overexpressing JB6 Pþ

cells were treated with I-BET (1 mmol/L). I-BET treatedc-Myc–overexpressing cells demonstrated significantlyenhanced colony formation compared with the emptyvector control (Fig. 4E). However, I-BET treatmentreduced the number of c-Myc–overexpressing clonesgrowing in soft agar by 20% (Fig. 4E). These data suggestthat the efficacy of I-BET against transformation inMFTF-treated wild-type JB6 Pþ cells may partially c-Mycdependent.

I-BET inhibits MFTF- and HuFTF-enhancedtransformation and c-Myc expression in mammaryepithelial cellsOur data suggest that FTF-stimulated skin epithelial cell

transformation is dependent on BRD4 activity; however,how generalizable these results are to other cells isunknown. To test this we determined the effect of FTF andI-BET on two nontumorigenic mammary epithelial celllines, MCF-10A and NMuMG cells. Epidemiologic evi-dence implicates obesity in increasingonly postmenopaus-al breast cancer risk. However, a few studies have demon-strated that visceral adiposity may be a risk factor forboth pre- and postmenopausal breast cancers (45–47). Inpremenopausal breast cancer, when adjusted for weight orBMI, women with the smallest waist-to-hip ratios have a37% lower risk (2). I-BET dose-dependently inhibited thenumber ofMCF-10A cells (Fig. 5A) andNMuMG cells (Fig.5B) transformed by FTF. I-BET at 0.5, 1, and 1.5 mmol/Ldoses attenuated MFTF-stimulated growth by 33%, 44%,

Figure 1.

VAT is associated with c-Mycexpression in vivo. SKH-1E mice(n ¼ 5/group) were fed HFD for4 weeks. Mice had a visceral(parametrial) fat lipectomy orreceived a sham-operation. After4 weeks, mice were sacrificed, skinsamples were collected, and proteinexpression was examined byimmunofluorescence. A, c-Myc levelswere reduced in lipectomizedcompared to sham-operated miceand (B) no change was observed withNF-kB expression. Photographs weretaken at 20� magnification.



and 67% and HuFTF-stimulated growth by 43% (1.5 mm)in MCF-10A cells (Fig. 5A). I-BET at 0.5, 1, and 1.5 mmol/Ldoses attenuated HuFTF-stimulated growth by 52%, 64%,and 73% in NMuMG cells. To determine if factors releasedfrom VAT induced c-Myc in these mammary epithelial celllines, we treatedMCF-10A andNMuMGcells withMFTF orHuFTF for 8 hours and demonstrated an induction in c-Myc protein that was prevented by the pretreatment of I-

BET (Fig. 5C and D). These data suggest that FTF-stimu-lated neoplastic transformation of mammary epithelialcells is partially dependent on BRD4 activity.

Attenuation of FGF2-stimulated tumor formationof by I-BET in vivoFGF2 is a critical factor from VAT that stimulates epithe-

lial cell transformation (10). I-BET significantly attenuated

Figure 2.

VAT is associated with c-Myc expression in vitro. I-BET inhibits MFTF (A) and HuFTF (B) induced c-Myc expression. JB6 Pþ cells were treated with eitherMFTF (300mg/mL) or HuFTF (200mg/mL) for 8 hours with or without I-BET (1 mm, 30minute preincubation before FTF treatment). HaCaT cells were treated witheither MFTF (300 mg/mL) or HuFTF (200 mg/mL) for 8 hours with or without I-BET (1 mm, 30 minutes preincubation before FTF treatment). I-BET inhibitsMFTF- (C) and HuFTF (D)-induced c-Myc expression. c-Myc expression in both JB6 Pþ and HaCaT cells were examined by immunofluorescence and confocalmicroscopy. Photographs were taken at 40� magnification. E, c-Myc protein expression was analyzed by Western blot. JB6 Pþ and HaCaT cells were treatedwith MFTF at either 150 or 300 mg/mL with or without I-BET (1 mm). Quantification of band intensities is presented in Supplementary Fig. 2.

Chakraborty et al.


anchorage-independent growth of JB6 Pþ cells treatedwithincreasing concentrations of FGF2 (Fig. 6A). I-BET atten-uated FGF2-induced c-Myc nuclear expression (Fig. 6B).Because our previous study demonstrated that JB6 Pþ cellsproliferate and form carcinomas in immunocompromisedmice injected in vivowith FGF2 (10), we used thismodel totest the efficacy of I-BET for attenuating tumor growthin vivo. After 2 weeks of I-BET treatment, FGF2-inducedtumors were significantly smaller in volume (Fig. 6C–E),showed fewer proliferating cells (Fig. 6F–H), and wereanemic on observation (Fig. 6E). Tumors in the vehicle-treated mice were significantly larger (Fig. 6D) showedmitotic plates and dividing cells (Fig. 6F) and demonstrat-ed nuclear Ki67 staining (Fig. 6G). PCNA staining dem-onstrated significantly more proliferating cells inthe vehicle group compared with the animals that receivedI-BET (Fig. 6H; quantitation Supplementary Fig. S3).TUNEL staining demonstrated that I-BET treatment hadno effect on the number of apoptotic cells; therefore, thedifference in tumor size between groups is reflective of theincreased proliferation in vehicle-treated animals. Clusterof differentiation 31 (CD31) staining of the epithelial cellsdemonstrated that tumors in the vehicle-treated mice hadmore blood vessels of higher caliber and the presence ofswollen blood vessels compared the tumors of I-BET–

treated mice (Fig. 6I). The larger swollen blood vesselswere absent in the I-BET–treated mice. These data demon-strate efficacy of I-BET in vivo for attenuating angiogenesisand FGF-2–induced tumorigenesis.

DiscussionClinical studies have indicated that bromodomain inhi-

bitors have considerable potential as therapeutic agents forcancer; however, their chemopreventive activity isunknown. Herein, we investigated the inhibitory activityof theBRD4 inhibitor, I-BET, onVAT- andFGF2-stimulatedtransformation in vitro and FGF2-stimulated tumor forma-tion in vivo. The main goal of this study was to evaluate theefficacy of I-BET in the prevention of malignant transfor-mation by VAT. The second goal was to evaluate ifthe mechanism of prevention involved inhibiting BRD4-dependent c-Myc transcription. The central finding of thisstudy was that c-Myc is part of the core transcriptionalprogram by which VAT enhances neoplastic transforma-tion in epithelial cells, and this activity can be inhibitedwith I-BET.Obesity is a recognized risk factor for developing cancer.

However, the mechanism by which obesity influencesearly-stage carcinogenesis is not well understood.

Figure 3.

I-BET significantly attenuates MFTF- and HuFTF-stimulated growth of JB6 Pþ cells in soft agar. SKH-1E mice (n ¼ 5/group) were fed an HFD for 4 weeks. Visceral(parametrial and epididymal) adipose tissue was removed to make a filtered conditioned medium (MFTF). A, Percentage of clones growing in soft agar (% colonyformation) significantly increases in JB6 Pþ cells cultured with MFTF compared with I-BET (1 mm) and MFTF treatment together. In the bottom panel, coloniesof JB6Pþ cells in soft agarwere observed under themicroscope andphotographs of thewholewellswere taken.B, Fat tissue filtrateswere alsomade fromhumanVAT(HuFTF) from donors undergoing hysterectomy. I-BET inhibits HuFTF-induced cell growth in soft agar. Data are presented as mean � SD of values from triplicate(Data obtained from three independent sets of experiments). Statistical significance was determined using a one-way ANOVA (� , P < 0.05; �� , P < 0.01).



Figure 4.

I-BET attenuates expression of genes downstream of Brd4, triggered by MFTF.A, JB6 Pþ cells were pretreated with I-BET or left untreated and then stimulated withMFTF (300 mg/mL). Levels of c-Myc, NF-kB, Kif5B, Cdx3, and Cdk7 were measured following 30 minutes or 6 hours of MFTF treatment. Data are presentedas fold induction over the untreated control (Cont.) and normalized to 18S expression. Statistical significance was determined using a one-way ANOVA comparinguntreated to VAT-treated (� , P < 0.05) and VAT-treated without I-BET, to VAT-treated with I-BET (#, P < 0.05). B,MFTF treatment (150 or 300 mg/mL) for 8 hoursinduced both Brd4 and c-Myc protein expression in JB6 Pþ cells. C, Data are presented as fold induction over the untreated control (Cont.) and normalizedto actin expression. Band intensity was quantified using ImageJ software.D, Constitutive activation of c-Myc gene stimulates the growth of JB6 Pþ cells in soft agar.E, Percentage of clones growing in soft agar (% colony formation) is significantly induced in both c-Myc OE cells and I-BET–treated c-Myc OE cells comparedwith empty vector (EV) control (�� , P < 0.001). Percentage of clones growing in soft agar is significantly reduced (20%) in I-BET–treated c-Myc OE cellscompared with untreated c-Myc OE cells (�� , P < 0.01). Data are presented as mean � SD of values from triplicate. Statistical significance was determined usinga one-way ANOVA (�, P < 0.05; �� , P < 0.01; �� , P < 0.001).

Chakraborty et al.


Epidemiologic evidence implicates VAT in increasing can-cer risk in several target tissues (5, 8, 45–51). However,there is conflicting evidence with regard to obesity andNMSC. A few studies have shown that obesity is inverselyassociatedwithNMSC (52, 53)while a positive associationbetween obesity and NMSC has also been described(54, 55). The positive association is only observed in partsof the worldwith lowUVR exposure: impact of higher UVRmay overshadow the less significant effects of obesity (54).The epidemiologic studies are confounded because obeseindividuals spend less time in the sun (53). Adding to thecomplexity, HFD,which can increase VAT, increaseNMSCs(56, 57). Therefore, further studies are needed to furtherunderstand the relationship between adiposity and skincancer risk.Our previous studies demonstrated that VAT removal

in HFD-fed mice inhibited UVB-induced formation ofNMSCs by 75% to 80% when compared with sham-oper-ated control mice (9). Histologic data revealed a higherproliferation index in normal epidermis in animals thatwere abdominally obese, comparedwith animals thatweresubcutaneously obese (9). The mechanisms that contrib-uted to this increased proliferation were unknown. Basedupon our previously published protein array data demon-strating an elevation in proinflammatory cytokines, proan-giogenic factors, and growth factors in viscerally obesemice, we hypothesized that both NF-kB and c-Myc activityare induced in the epidermis and contribute to the increaseproliferation index. We found an increased nuclear local-ization of c-Myc in normal epidermis in animals that wereabdominally obese (sham-operated), compared with ani-mals that were subcutaneously obese (lipectomized).There was no difference in NF-kB protein expressionbetween the two groups (Fig. 1A and B). Furthermore, invitro, VAT increased p65 mRNA but failed to increaseprotein expression or induce nuclear localization. There-fore, we prioritized studying the c-Myc expression inresponse to VAT. This c-Myc signature in the skin ofabdominally obese mice may contribute to the differencesthat are observed in tumorigenesis between animals thatstore fat viscerally compared with animals that store fatsubcutaneously.c-Myc expression is deregulated in 50% of cancers (58)

and contributes to the pathogenesis as it plays a critical rolein a wide range of functions including proliferation, trans-formation, metabolism, and the apoptotic response (59–61). In normal skin, depending on the model studied, thestrength and duration of activity, and the time course ofobservation, c-Myc has been shown to both stimulate pro-liferation and terminal differentiation of epidermal cells(62–65). c-Myc amplification has been found in 50% ofsquamous cell carcinomas arising in patients who haveundergone long-term immunosuppression following organtransplantation (66). Although others have demonstrated arelationship between EGF activity and c-Myc induction in

JB6Pþ cell transformation (29), our study is thefirst to showthat overexpression of c-Myc in an initiated epidermal cell issufficient to drive cell transformation (Fig. 4D).

Figure 5.

I-BET inhibitsMFTF- andHuFTF-enhanced transformation and c-Mycexpressionin mammary epithelial cells. A, MCF-10A cells were treated with either MFTF(200mg/mL) or HuFTF (150mg/mL)with orwithout I-BET at variable doses (0.5,1.0, 1.5 mm). In a dose-dependent manner, I-BET inhibits HuFTF-induced growthof MCF-10A cells in soft agar. B, NMuMG cells were treated with HuFTF(150 mg/mL) with or without I-BET at variable doses (0.5, 1.0, 1.5 mm). In a dose-dependent manner, I-BET attenuates HuFTF-induced growth of NMuMG cells insoft agar. C, c-Myc protein expression levels were analyzed by Western blot.MCF-10Acellswere treatedwithMFTF andNMuMGcellswere treatedwithHuFTFfor 24 hours, with or without I-BET (1 mm). I-BET attenuated MFTF and HuFTFinduced c-Myc upregulation. D, Data are presented as fold induction over theuntreated control (Cont.) and normalized to actin expression. Band intensity wasquantified using ImageJ software. Data are presented as mean � SD of valuesfrom triplicate. Statistical significance was determined using a one-way ANOVA(� , P < 0.05; �� , P < 0.01; �� , P < 0.001). Band intensities significantly decreased inI-BET treated cells compared to MFTF or HuFTF treated cells (#, P < 0.05).



Figure 6.

I-BET prevents FGF2-induced malignant transformation of nontumorigenic epithelial cells. A, I-BET attenuates FGF2-induced growth of JB6 Pþ cells in soft agar.B, Expression of c-Myc is increased in JB6 Pþ cells treated with FGF2 (2.5 ng/mL for 8 hours) compared with control. Pretreatment for 30 minutes with I-BET (1 mm)downregulates FGF2-induced c-Myc expression, examined by immunofluorescence in confocal microscope. Photographs were taken at 40� magnification.C, Nude mice were fed with either vehicle or I-BET (15 mg/kg) by oral gavage a day prior to subcutaneous inoculation of JB6 Pþ cells (0.5� 106). The following day,FGF2 (200 mg/kg) or vehicle was injected i.p. once per day for 7 consecutive days and simultaneously gavaged with I-BET for the next 7 days. Photos showsubcutaneous (s.c.) carcinomas induced by FGF2. D, Growth rates of s.c. tumors formed by JB6 Pþ cells injected into nude mice (n ¼ 5) that were orallygavaged with either vehicle or I-BET. E, The tumor was monitored every day and tumor volume was recorded on days 3, 7, and 15. Volumes of the tumor werecalculated using the formula: V ¼ length � width2 � 0.5. Data are presented as mean � SD of values from triplicates, and statistical significance was determinedusing a one-way ANOVA followed by a Tukey test for multiple comparisons (� , P < 0.05; ��, P < 0.001; �� , P < 0.0001). F, Hematoxylin and eosin stainingof a carcinoma. Arrow points to mitotic and dividing cells in vehicle while necrotic and hemorrhoids in the I-BET–treated group. G, Ki67 staining showed cellproliferation was inhibited by I-BET. Photographswere taken at 20�magnification.H, PCNA staining showed that the number of proliferating cells was significantlyreduced with I-BET. Pictures of six areas were taken from three separate tumors per group. Positive cells were counted in a blinded fashion. I, CD31 stainingshowedmore blood vessels with a higher caliber in vehicle-treatedmice comparedwith I-BET–treatedmice. Representative pictures are shown. Pictures of six areaswere taken from three separate tumors per group. Data are presented as mean � SD of values from triplicates, and statistical significance was determinedusing a one-way ANOVA (�� , P < 0.001). Photographs were taken at 40� magnification.

Chakraborty et al.


The novelty of our study lies in discovering the relation-ship between VAT and c-Myc expression. How havingexcess adipose tissue could influence c-Myc expression isunknown. One study exists that suggests a link betweenobesity-associated tumors and c-Myc expression. In amouse model of gastric cancer, c-Myc expression wasnuclear and significantly higher in the tumors of obesemice compared with lean mice; however, it was not deter-mined which adipose tissue depots were specific for tumorgrowth (67). Our previously published data demonstratethat FGF2 released from VAT signals through FGFR-1 toinduce c-Myc in JB6 Pþ cells (10). c-Myc was not inducedby VAT in cells that lack FGFR-1, suggesting that c-Myc is acritical downstream mediator of FGFR-1 activation (10).Moreover, a c-Myc inhibitor that blocks the c-Myc-MAX(myc-associated factor X) interaction prevented MFTF-transforming activity (10).Historically, it has been difficultto pharmacologically target c-Myc because of diversemechanisms driving its aberrant expression and the diffi-culties of interfering with protein–DNA interactions (68).Epigenetic strategies in the form of bromodomain inhibi-tors now exist to interfere with c-Myc expression at thetranscriptional level (13). Our study is novel in its evalu-ation of the efficacy of I-BET in preventing carcinogenesisby inhibiting VAT-enhanced cell transformation. Zhangand colleagues recently described that the BRD4 inhibitorJQ1 blocks phorbol ester-stimulated transformation (69),suggesting that BET proteins are critical for the onset oftumorigenesis. BRD4plays important role in transcription-al activation of various genes besides c-Myc. We demon-strate that BRD4protein is inducedwithVAT and show thatseveral BRD4 regulated genes (c-Myc, NF-kB, Kif5B, andCdk7) are also induced. Whether these genes are drivers oftransformation or simply bystanders is unclear and thiswill be investigated in future studies. However, the over-expression of c-Myc alone was sufficient to stimulategrowth in soft agar, suggesting that c-Myc as a criticalcomponent of VAT-enhanced transformation. However,I-BET reduced growth in soft agar of c-Myc–overexpressingcells by 20%, suggesting that I-BET has both c-Myc–depen-dent and –independent activities.We also demonstrate that the effects of I-BET on cell

transformation may not be specific to skin, but may havean effect in other tissues. I-BET attenuated the transformingactivity of HuFTF in two humanmammary epithelial cells,

NMuMG and MCF-10A. This diminishing growth in softagar was associated with a downregulation in c-Myc pro-tein expression (Fig. 4B and Fig. 5C).Considerable evidence demonstrates that diet changes

can affect obesity and cancer outcomes (70). However, dueto weight loss challenges, there is a dire need for mecha-nism-based strategies to help viscerally obese individualsavoid cancer. Our work suggests that factors releasedfrom VAT enhance c-Myc activity in nontumorigenic cellsleading to the malignant transformation. Therefore,strategies in the form of bromodomain inhibitors arean attractive therapeutic approach to prevent visceraladiposity-associated epithelial cancers.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: D. Chakraborty, K.T. Liby, J.J. BernardDevelopment of methodology: D. Chakraborty, V. Benham,V. Jdanov, B. Bullard, J.J. BernardAcquisition of data (provided animals, acquired and managedpatients, provided facilities, etc.): D. Chakraborty, V. Jdanov,B. Bullard, A.S. Leal, J.J. BernardAnalysis and interpretation of data (e.g., statistical analysis, bio-statistics, computational analysis): D. Chakraborty, A.S. Leal,K.T. Liby, J.J. BernardWriting, review, and/or revision of the manuscript:D. Chakraborty,V. Benham, K.T. Liby, J.J. BernardAdministrative, technical, or material support (i.e., reporting ororganizing data, constructing databases): V. Benham, J.J. BernardStudy supervision: J.J. Bernard

AcknowledgmentsThis studywas supported byNational Institutes ofHealth grant R00

CA177868 (J.J. Bernard) andMichigan State University start-up fundsand a grant from the Breast Cancer Research Foundation (K.T. Liby).We acknowledge the MSU Investigative HistoPathology Laboratory,Amy S. Porter, HT (ASCP) QIHC, and Kathleen A. Joseph. This workwas also supported by the NIEHS training grant ES007255.

The costs of publication of this article were defrayed in part by thepayment of page charges. This articlemust therefore be herebymarkedadvertisement in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.

Received August 18, 2017; revised October 24, 2017; acceptedDecember 7, 2017; published OnlineFirst December 15, 2017.

References1. Wolin KY, Carson K, Colditz GA. Obesity and cancer. Oncologist

2010;15:556–65.2. Harvie M, Hooper L, Howell AH. Central obesity and breast

cancer risk: a systematic review. Obesity Rev 2003;4:157–73.3. Steffen A, SchulzeMB, Pischon T, Dietrich T, Molina E, Chirlaque

MD, et al. Anthropometry and esophageal cancer risk in theEuropean prospective investigation into cancer and nutrition.Cancer Epidemiol Biomarkers Prev 2009;18:2079–89.

4. Moghaddam AA, Woodward M, Huxley R. Obesity and risk ofcolorectal cancer: a meta-analysis of 31 studies with 70,000events. Cancer Epidemiol Biomarkers Prev 2007;16:2533–47.

5. Dai Z, Xu YC, Niu L. Obesity and colorectal cancer risk: a meta-analysis of cohort studies. World J Gastroenterol 2007;13:4199–206.

6. Friedenreich C, Cust A, Lahmann PH, Steindorf K, Boutron-Ruault MC, Clavel-Chapelon F, et al. Anthropometric factors and



risk of endometrial cancer: the European prospective investiga-tion into cancer and nutrition. Cancer Causes Control 2007;18:399–413.

7. Berrington de Gonzalez A, Spencer EA, Bueno-de-Mesquita HB,Roddam A, Stolzenberg-Solomon R, Halkjaer J, et al. Anthro-pometry, physical activity, and the risk of pancreatic cancer in theEuropean prospective investigation into cancer and nutrition.Cancer Epidemiol Biomarkers Prev 2006;15:879–85.

8. Huffman DM, Augenlicht LH, Zhang X, Lofrese JJ, Atzmon G,Chamberland JP, et al. Abdominal obesity, independent fromcaloric intake, accounts for the development of intestinal tumorsin Apc(1638N/þ) female mice. Cancer Prev Res (Phila) 2013;6:177–87.

9. Lu YP, Lou YR, Bernard JJ, Peng QY, Li T, Lin Y, et al. Surgicalremoval of the parametrial fat pads stimulates apoptosis andinhibits UVB-induced carcinogenesis in mice fed a high-fat diet.Proc Natl Acad Sci U S A 2012;109:9065–70.

10. Chakraborty D, Benham V, Bullard B, Kearney T, Hsia HC,GibbonD, et al. Fibroblast growth factor receptor is amechanisticlink between visceral adiposity and cancer. Oncogene 2017;36:6668–79.

11. Dey A, Nishiyama A, Karpova T, McNally J, Ozato K. Brd4 marksselect genes on mitotic chromatin and directs postmitotic tran-scription. Mol Biol Cell 2009;20:4899–909.

12. Dey A, Chitsaz F, Abbasi A, Misteli T, Ozato K. The doublebromodomain protein Brd4 binds to acetylated chromatin dur-ing interphase and mitosis. Proc Nat Acad Sci U S A 2003;100:8758–63.

13. Delmore JE, IssaGC, LemieuxME,Rahl PB, Shi J, JacobsHM, et al.BET bromodomain inhibition as a therapeutic strategy to target c-Myc. Cell 2011;146:904–17.

14. Garcia PL, Miller AL, Kreitzburg KM, Council LN, Gamblin TL,Christein JD, et al. The BET bromodomain inhibitor JQ1 sup-presses growth of pancreatic ductal adenocarcinoma in patient-derived xenograft models. Oncogene 2016;35:833–45.

15. De Raedt T, Beert E, Pasmant E, Luscan A, Brems H, Ortonne N,et al. PRC2 loss amplifies Ras-driven transcription and conferssensitivity to BRD4-based therapies. Nature 2014;514:247–51.

16. Trabucco SE, Gerstein RM, Evens AM, Bradner JE, Shultz LD,Greiner DL, et al. Inhibition of bromodomain proteins for thetreatment of human diffuse large B-cell lymphoma. Clin CancerRes 2015;21:113–22.

17. Berman M, Mattheolabakis G, Suresh M, Amiji M. Reversingepigenetic mechanisms of drug resistance in solid tumors usingtargeted microRNA delivery. Expert Opin Drug Deliv 2016;13:987–98.

18. Lockwood WW, Zejnullahu K, Bradner JE, Varmus H. Sensi-tivity of human lung adenocarcinoma cell lines to targetedinhibition of BET epigenetic signaling proteins. Proc Nat AcadSci U S A 2012;109:19408–13.

19. Filippakopoulos P, Qi J, Picaud S, Shen Y, Smith WB,Fedorov O, et al. Selective inhibition of BET bromodomains.Nature 2010;468:1067–73.

20. DawsonMA, Prinjha RK, DittmannA, Giotopoulos G, BantscheffM, ChanWI, et al. Inhibition of BET recruitment to chromatin asan effective treatment for MLL-fusion leukaemia. Nature 2011;478:529–33.

21. Picaud S, Da Costa D, Thanasopoulou A, Filippakopoulos P, FishPV, Philpott M, et al. PFI-1, a highly selective protein interactioninhibitor, targeting BET Bromodomains. Cancer Res 2013;73:3336–46.

22. Zhao Y, Yang CY, Wang S. The making of I-BET762, a BETbromodomain inhibitor now in clinical development. J MedChem 2013;56:7498–500.

23. Nicodeme E, Jeffrey KL, Schaefer U, Beinke S, Dewell S, ChungCW, et al. Suppression of inflammation by a synthetic histonemimic. Nature 2010;468:1119–23.

24. Shi J, Vakoc CR. The mechanisms behind the therapeuticactivity of BET bromodomain inhibition. Mol Cell 2014;54:728–36.

25. Font-Burgada J, Sun B, KarinM. Obesity and Cancer: TheOil thatFeeds the Flame. Cell Metab 2016;23:48–62.

26. Ramos-Nino ME.The role of chronic inflammation in obesity-associated cancers. ISRN Oncol 2013;2013:697521.

27. Zhang D, Li J, Gao J, Huang C. c-Jun/AP-1 pathway-mediatedcyclin D1 expression participates in low dose arsenite-induced transformation in mouse epidermal JB6 Cl41 cells.Toxicol Appl Pharmacol 2009;235:18–24.

28. Lu FJ, TsengTH, LeeWJ, YenCC, YinYF, LiaoCW, et al. Promotingneoplastic transformation of humic acid inmouse epidermal JB6Cl41 cells. Chem Biol Interact 2006;162:249–58.

29. He Z, Cho YY, Liu G, Ma WY, Bode AM, Dong Z. p38 Mitogen-activated protein kinase regulation of JB6 Cl41 cell transforma-tion promoted by epidermal growth factor. J Biol Chem 2003;278:26435–42.

30. Amstad PA, Liu H, IchimiyaM, Chang S, Berezesky IK, Trump BF.bcl-2 enhancement of malignant transformation in mouse epi-dermal JB6 cells. Mol Carcinog 1997;20:231–9.

31. Dong Z, Lavrovsky V, Colburn NH. Transformation reversioninduced in JB6 RT101 cells by AP-1 inhibitors. Carcinogenesis1995;16:749–56.

32. Dong Z, Birrer MJ, Watts RG, Matrisian LM, Colburn NH. Block-ing of tumor promoter-induced AP-1 activity inhibits inducedtransformation in JB6mouse epidermal cells. ProcNat Acad Sci US A 1994;91:609–13.

33. Smith JS Jr., Wey HE, Leikauf GD, Baxter CS. JB6 murineepidermal cell lines sensitive and resistant to 12-O-tetradeca-noylphorbol-13-acetate (TPA)-induced transformation exhibitdifferential arachidonic acid metabolism in response to TPAand the calcium ionophore A23187. Carcinogenesis 1992;13:189–92.

34. Ben-Ari ET, Bernstein LR, ColburnNH.Differential c-jun expressionin response to tumor promoters in JB6 cells sensitive or resistantto neoplastic transformation. Mol Carcinog 1992;5:62–74.

35. Jain AK, Shimoi K,Nakamura Y, SanoM, Tomita I. Effect of tea on12-O tetradecanoyl-phorbol-13 acetate (TPA) induced promo-tion of transformation in JB6 mouse epidermal cells. Indian JCancer 1989;26:92–8.

36. Nakamura Y, Gindhart TD, Winterstein D, Tomita I, Seed JL,Colburn NH. Early superoxide dismutase-sensitive event pro-motes neoplastic transformation in mouse epidermal JB6 cells.Carcinogenesis 1988;9:203–7.

37. Smith BM, Gindhart TD, Colburn NH. Extracellular calciumrequirement for promotion of transformation in JB6 cells. CancerRes 1986;46:701–6.

38. Srinivas L, Colburn NH. Preferential oxidation of cell surfacesialic acid by periodate leads to promotion of transformation inJB6 cells. Carcinogenesis 1984;5:515–9.

39. Bernard JJ, Lou YR, Peng QY, Li T, Vakil PR, Ding N, et al.Parametrial fat tissue from high fat diet-treated SKH-1 micestimulates transformation of mouse epidermal JB6 cells. J Carci-nog Mutagen 2014;5:2157–518.

40. Soule HD, Maloney TM, Wolman SR, Peterson WD Jr., Brenz R,McGrath CM, et al. Isolation and characterization of a sponta-neously immortalized human breast epithelial cell line, MCF-10.Cancer Res 1990;50:6075–86.

41. Hemann MT, Bric A, Teruya-Feldstein J, Herbst A, Nilsson JA,Cordon-Cardo C, et al. Evasion of the p53 tumour surveillance


Chakraborty et al.

network by tumour-derived MYC mutants. Nature 2005;436:807–11.

42. Wang X, Cunningham M, Zhang X, Tokarz S, Laraway B, TroxellM, et al. Phosphorylation regulates c-Myc's oncogenic activity inthe mammary gland. Cancer Res 2011;71:925–36.

43. Benassi B, Fanciulli M, Fiorentino F, Porrello A, Chiorino G, LodaM, et al. c-Myc phosphorylation is required for cellular responseto oxidative stress. Mol Cell 2006;21:509–19.

44. Hydbring P, Bahram F, Su Y, Tronnersjo S, Hogstrand K, vonder Lehr N, et al. Phosphorylation by Cdk2 is required for Mycto repress Ras-induced senescence in cotransformation. ProcNat Acad Sci U S A 2010;107:58–63.

45. Connolly BS, Barnett C, Vogt KN, Li T, Stone J, Boyd NF. A meta-analysis of published literature on waist-to-hip ratio and risk ofbreast cancer. Nutr Cancer 2002;44:127–38.

46. GaudetMM,Carter BD, Patel AV, Teras LR, Jacobs EJ, Gapstur SM.Waist circumference, body mass index, and postmenopausalbreast cancer incidence in the Cancer Prevention Study-II Nutri-tion Cohort. Cancer Causes Control 2014;25:737–45.

47. Hajian-Tilaki KO, Gholizadehpasha AR, Bozorgzadeh S,Hajian-Tilaki E. Body mass index and waist circumferenceare predictor biomarkers of breast cancer risk in Iranianwomen. Med Oncol 2011;28:1296–301.

48. Huang Z, Willett WC, Colditz GA, Hunter DJ, Manson JE, RosnerB, et al. Waist circumference, waist:hip ratio, and risk of breastcancer in the Nurses' Health Study. American J Epidemiol 1999;150:1316–24.

49. Arslan AA, Helzlsouer KJ, Kooperberg C, Shu XO, Steplowski E,Bueno-de-Mesquita HB, et al. Anthropometric measures, bodymass index, and pancreatic cancer: a pooled analysis from thepancreatic cancer cohort consortium (PanScan). Arch InternalMed 2010;170:791–802.

50. Genkinger JM, Spiegelman D, Anderson KE, Bernstein L, van denBrandt PA,Calle EE, et al. Apooled analysis of 14 cohort studies ofanthropometric factors and pancreatic cancer risk. Int J Cancer2011;129:1708–17.

51. Lee JY, LeeHS, LeeDC,Chu SH, Jeon JY, KimNK, et al. Visceral fataccumulation is associated with colorectal cancer in postmeno-pausal women. PloS One 2014;9:e110587.

52. Tang JY, HendersonMT,Hernandez-Boussard T, Kubo J, DesaiM,Sims ST, et al. Lower skin cancer risk in women with higher bodymass index: the women's health initiative observational study.Cancer Epidemiol Biomarkers Prev 2013;22:2412–5.

53. Pothiawala S, Qureshi AA, Li Y, Han J. Obesity and theincidence of skin cancer in US Caucasians. Cancer CausesControl 2012;23:717–26.

54. Courneya KS, Katzmarzyk PT, Bacon E. Physical activity andobesity in Canadian cancer survivors: population-based esti-mates from the 2005Canadian community health survey. Cancer2008;112:2475–82.

55. Sahl WJ, Glore S, Garrison P, Oakleaf K, Johnson SD. Basal cellcarcinoma and lifestyle characteristics. Int J Dermatol 1995;34:398–402.

56. Ibiebele TI, van der Pols JC, Hughes MC, Marks GC, Green AC.Dietary fat intake and risk of skin cancer: a prospective study inAustralian adults. Int J Cancer 2009;125:1678–84.

57. Ibiebele TI, van der Pols JC, Hughes MC, Marks GC, Wil-liams GM, Green AC. Dietary pattern in association withsquamous cell carcinoma of the skin: a prospective study.Am J Clin Nutr 2007;85:1401–8.

58. Morton JP, Sansom OJ. MYC-y mice: from tumour initiation totherapeutic targeting of endogenous MYC. Mol Oncol 2013;7:248–58.

59. Sarveswaran S, Chakraborty D, Chitale D, Sears R, Ghosh J.Inhibition of 5-lipoxygenase selectively triggers disruption ofc-Myc signaling in prostate cancer cells. J Biol Chem 2015;290:4994–5006.

60. Zhang X, Farrell AS, Daniel CJ, Arnold H, Scanlan C, Laraway BJ,et al. Mechanistic insight into Myc stabilization in breast cancerinvolving aberrant Axin1 expression. Proc Nat Acad Sci U S A2012;109:2790–5.

61. Adhikary S, Eilers M. Transcriptional regulation and transforma-tion by Myc proteins. Nat Rev Mol Cell Biol 2005;6:635–45.

62. Coffey RJ Jr., Bascom CC, Sipes NJ, Graves-Deal R, WeissmanBE, Moses HL. Selective inhibition of growth-related geneexpression in murine keratinocytes by transforming growthfactor beta. Mol Cell Biol 1988;8:3088–93.

63. Jensen KB, Watt FM. Single-cell expression profiling of humanepidermal stem and transit-amplifying cells: lrig1 is a regulator ofstem cell quiescence. ProcNat Acad Sci U S A 2006;103:11958–63.

64. Gandarillas A, Watt FM. c-Myc promotes differentiation ofhuman epidermal stem cells. Genes Dev 1997;11:2869–82.

65. Gebhardt A, Frye M, Herold S, Benitah SA, Braun K, Samans B,et al. Myc regulates keratinocyte adhesion and differentiation viacomplex formation with Miz1. J Cell Biol 2006;172:139–49.

66. BoukampP.Non-melanoma skin cancer: what drives tumor devel-opment and progression? Carcinogenesis 2005;26:1657–67.

67. Li HJ, Che XM, Zhao W, He SC, Zhang ZL, Chen R, et al. Diet-induced obesity promotes murine gastric cancer growth througha nampt/sirt1/c-myc positive feedback loop. Oncol Rep 2013;30:2153–60.

68. Prochownik EV, Vogt PK. Therapeutic targeting of Myc. GenesCancer 2010;1:650–9.

69. Zhang C, Su ZY, Wang L, Shu L, Yang Y, Guo Y, et al. Epigeneticblockade of neoplastic transformation by bromodomain andextra-terminal (BET) domain protein inhibitor JQ-1. BiochemPharmacol 2016;117:35–45.

70. Demark-Wahnefried W, Rock CL, Patrick K, Byers T. Lifestyleinterventions to reduce cancer risk and improve outcomes.American Family Phys 2008;77:1573–8.



a bet bromodomain inhibitor suppresses adiposity ...€¦ · stimulated tumor formation in vivo. we...

Documents