A couple notes

Lab 4: Transcription and Translation

Where are we today?

Today we’ll go from here... To here

Text

• Transcription:

• Translation:

• Transcription: writing again

• Translation:

• Transcription: writing again

• Translation: changing languages

Off to see the wizard...

• DNA replication

– both strands => new DNA

– => new cell

• Transcription– 1 strand => new RNA– => new protein

Sending ‘messages’ out from DNA

Amino Acids

• You & partner have an amino acid; which is it? (homepage => quick refs -> amino acids)

Amino Acids

• How are they similar?

• How are they different?

• What do the differences mean in terms of “feel”?

• How many are there?

• Possible?

Nucleic Acids• How are they similar?• How are they different?• What do the differences mean in terms of

“feel”?• Which is more diverse in terms of shape

and ‘feel’?• Which would allow for more diverse

shapes and surfaces when ‘connected’?

A little Vocab

• DNA

• mRNA

• rRNA

• tRNA

• Codon

• Anticodon

How does a codon ‘mean’ an amino acid?

Translation

• Short video– http://www.youtube.com/watch?v=5bLEDd-PS

TQ

The Play is the thing…

The Play is the thing…

Or, Fun With Blocks

The Play is the thing…

• ‘Types of Bonds’– Velcro – can be easily broken/re-made

during lab– Duct tape – breaking it gets you a zero (0)

for this week’s quiz

The Play is the thing…

• The Players

The Play is the thing…

• The Players– tRNA

The Play is the thing…

• The Players– tRNA– Ribosome

The Play is the thing…

• The Players– tRNA– Ribosome– Aminoacyl tRNA synthetase

The Play is the thing…

• The Players– tRNA– Ribosome– Aminoacyl tRNA synthetase– RNA polymerase

The Play is the thing…

• The Players– tRNA (4 people)– Ribosome (1)– Aminoacyl tRNA synthetase (4)– RNA polymerase (1-2) * and RNA– Termination factor (1)

Numbers are per molecule for 2 molecules going at once

Learning your ‘lines’

• Handout: In pairs, answer questions related to your task

• Lab manual, textbook, internet OK as sources

• Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts

5’ end is pointy/spiky3’ end is soft/furry

DNA Template

• 5’ CTTAAATCCGAATGCCCATG 3’

5’ is “sticky”, 3’ is “fuzzy”

5’ CTTAAATCCGAATGCCCATG 3’5’ is “sticky”, 3’ is “fuzzy”

Wielding the Power

• ‘Recall’ that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit

• Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!

Walk-through with 1 tRNA• Everybody watches visits to synthetase,

ribosome• In reality, how is everyone finding each

other?• In the real world, everything is happening

all the time; all is happenstance

Ready?• mRNA at the central bench

• ribosome assembles around it

• synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA)

• tRNAs will ‘diffuse’ by following a path through the room

• When any event first happens*, action stops, molecules involved will announce, explain

• Go until a protein happens

Includes ‘didn’t work’

“Who” knows what’s going on?

• What happens if a tRNA carries the wrong amino acid?

• What happens if the mRNA contains a copy error relative to DNA?

• What happens if a tRNA has a mutated anticodon

Meet your new best friends

Protocol

• ½ inch layer of milk onto plate

• 1 drop of each food coloring onto various locations around perimeter

• Dab wooden stick with detergent

• Touch stick to center of milk

• Observe!

• Hypothesize!

• Open rubric

33

Power Balance

34

Background• I want to talk to you briefly about a

product.

• According to a number of testimonials, it can...– improve your balance– improve your athletic performance

35

Says who?

“I don’t really do a lot of testimonials, but this really works! I came across Power Balance when someone did the test on me. That night, while playing for the Phoenix Suns, there were about three of my teammates with the product on and we won that game by 57 points! I kept feeling something when I wore the bracelet, so I kept wearing it. When I took it off I went back to normal. I’ve been wearing the bracelet ever since. I want to do everything to get the slightest advantage; wristbands, necklaces, t-shirts, band-aids, everything and anything we can get our hands on. I’m here to tell you it works!”

SHAQUILLE O'NEAL

36

How does it do that?• According to the company:

...its Performance Technology that uses holograms embedded with frequencies designed to work positively with your body’s natural energy field

--Power Balance websitehttp://www.powerbalance.com

37

Offer• I can get you these for 1/2 off the website’s

selling price of $30• You can take home one of the used ones today

for $10• Anybody interested?

38

Offer• I can get you these for 1/2 off the website’s selling price

of $30• You can take home one of the used ones today for $10• Anybody interested?• What would it take to persuade you?

39

Turn in…• Write names of all group members and

hand in