a hypervariable pig dna fragment

A hypervariable pig DNA fragment

W. COPPIETERS, A. VAN DE WEGHE, A. DEPICKER*, Y. BOUQUET & A. VAN ZEVEREN

Department of Animal Genetics and Breeding, Faculty of Veterinary Medicine, State University of Ghent and *Laboratory of Genetics, State University of Ghent, Belgium

Summary. A new hypervariable tandem repeat was isolated from the pig genome and characterized by DNA sequence. The use of this DNA fragment as a probe in order to follow allelic segregation and DNA fingerprinting in pigs, horses and rabbits is documented. Keywordr: VNTR, DNA fingerprints, minisatellite, pig hypervariable loci

Introduction

Genetic linkage studies with classical antigenic and protein electromorphic markers, and more recently with DNA markers, have made possible the detection of loci which encode genetic defects or disease resistance in domestic livestock.

Although most of these DNA markers detect only diallelic restriction fragment length polymorphisms (RFLPs) , recently developed hypervariable DNA markers (Jeffreys et al. 1986) or VNTR markers (Nakamura et al. 1987) prove to be highly informative, multiallelic markers. These VNTR markers consist of tandem repeats of a short sequence (or minisatellite) and their polymorphism results from allelic differences in the number of repeats (Jeffreys et al. 1985a). On the one hand, a VNTR clone can visualize (by hybridization under low stringency) a whole series of closely related tandem repeats dispersed in the genome simultaneously (‘fingerprints’) (Jeffreys etal. 1985b). On the other hand, it is possible to use a VNTR as a highly polymorphic marker for a particular locus by hybridization under high stringency (Nakamura et al. 1987) and include them in linkage studies when constructing genetic maps.

In this article the isolation and characterization of a VNTR clone from pig DNA is described. This clone was picked up during an attempt to clone the gene for the pig serum protein P02. The Po2 locus is closely linked to the stress susceptibility (Hal) locus (for a review see Archibald & Imlah 1985) and is therefore of interest since its isolation would allow a starting point for genomic walking towards the Hal locus. A genomic pig library was constructed and screened with an oligonucleotide,

Correspondence: Dr A. Van de Weghe, Department of Animal Genetics and Breeding, Faculty of Veterinary Medicine, State University of Ghent, Heidestraat 19, B-9220 Merelbeke, Belgium. Accepted 14 August 1989

29

30 W. Coppieters et al.

complementary to the partial N-terminal sequence of PO2 (Van de Weghe et al. 1988). A false positive clone which reproducibly hybridizes to the oligonucleotide was picked up and revealed after sequencing to contain a tandem repeat. Subsequently, this tandem repeat was tested out for its ability to produce fingerprints.

Materials and methods

Animals pig blood samples were taken from one male and seven sows and their offspring (54 piglets) and also from 33 other individuals selected at random, all belonging to an experimental population of the department.

Horse blood samples were taken from 18 Shetland ponies from which seven were the progeny of one stallion and three mares. The rabbit blood samples were taken from one family with four offspring and six other individuals taken at random.

Preparation of genomic DNA Genomic DNA was prepared from whole blood collected in EDTA Vacutainer tubes and stored at -20°C (Georges etal. 1987). The blood samples were defrosted for 10 min at 37°C. To lOml of blood, 40ml of T&o (10mM TridHCl, 1OmM EDTA, pH 7.5) was added and gently mixed in an overhead tumbler for 10 min. The mixture was centrifugated at 3000gfor 10 min. The supernatant was decanted and the pellet was washed in TloEl (10m Tris/HCl, 1mM EDTA, pH 7.5). Subsequently, the pellet was resuspended and lysed by mixing overnight in 8mM urea, 0 . 3 ~ NaC1,2% SDS, 5 0 m ~ Tris/HCl, 1 mM EDTA, pH 7-5 at room temperature. The lysate was extracted three times with an equal volume of phenolkhloroform (until no more white interphase was visible) and two times with ether. The DNA was then precipitated by the addition of an equal volume of isopropanol; the precipitate was picked out with a molten Pasteur pipette, washed twice in cold 70% ethanol, shortly dried and resuspended in 5OO-lOoO pl TloEl by gently mixing for 24 h at 4°C. A yield of 500 pg DNA from lOml blood was obtained. The samples were stored at -20°C.

Construction of a pig genomic library A pig genomic library was constructed in the bacteriophage vector EMBL3 (Frischauf et al. 1983). Pig DNA was isolated from whole blood. The high M W DNA was partially digested with Sau3A in order to yield a maximum of fragments in the range of 9-23 kb (Maniatis etal. 1982). The partially digested DNA was fractionated by agarose gel electrophoresis and the gel piece containing the 9-23-kb DNA fraction was cut out. The DNA was purified from the agarose gel by crushing the agarose slice through a 0-45-pm filter (Millex HV, Millipore) (Zhu et al. 1985). Ligation of 0.5 pg EMBL BamHI arms (Promega: EMBL Arms Cloning System) with 0.5 pg 9-23-kb DNA'fragments took place for 20h at 16°C with 2.5 units of T4

Hypervariable pig DNA fragment 31

DNA Ligase (Amersham) in 5 0 m ~ Tris/HCl, pH 7.8, 1 O m ~ MgC12,2Om~ DlT, 1 mM ATP, 50 pg/d BSA V. The ligated DNA was packaged in vitro (Promega: Packagene System) and titrated on E. coli NM 539. Approximately 5 x 16 recombinant A phages per 0.5-pg vector DNA were obtained.

Screening of the library A mixture of eight different oligonucleotides was synthesized based on the N-terminal amino acid sequence of PO2 as shown in Fig. 1. The oligonucleotides contain deoxyinosine at the six ambiguous positions to diminish the complexity of the mixture (Takahashi et al. 1985).

Approximately 106 bacteriophages were plated on 10 megaplates (20 x 20cm - Nunc) and the plaques were replica plated in duplicate to a nylon membrane (Hybond-N, Amersham). The oligonucleotide-probe was end-labelled with T4 b a s e (Pharmacia). Prehybridization and hybridization were carried out as described by Takahashi et al. (1985). The filters were exposed at -70°C to Kodak X-Omat AR for 1-3 days with intensifying screens.

Clones showing positive signals on the duplicate flters were picked out, eluted from the agar plugs, amplified, replated at a lower plaque density and rescreened in order to obtain a pure clone (Maniatis et al. 1982).

A **..-G A T G G A G G A G G T T C A G G T G A T - - - G G A G G T T C A G G T G A T G G A G G A G G T T C A G G T G A T G G G G G A G G T T C A G G T G A T G G G G G A G G T T C A G G T G A T G G G G G A G G T T C A G G T G A T G G A G G A G G T T C A G G T G A T - - - G G A G G T T C A G G T G A T G G G G G A G G T T C A G G T G A T G G G

* AGCCTTATAGGGCAGCAGCGGTAACTTGGAGTTTT ACTCCAAATCGGGTGGGCAGTGTTGGGUTTTGAG GCGGGGAGATGTGTGATC

B

< .. .>

’’ GGAGGTTC AGGTGATGGAGGAGGTTC AGGTGATGGGGGAGGTTC . ” -CCICCYAG TCYM-ICCICCXCCYAG TCYAA-ICCICCICCYAG ’’ tandem repeats

oligonucleotide

..... .. .... ......... .. .... ......... .. ..... .. .... ......... .. .... ......... .. / /

” AC I CGRAG I CGGGTI ” ACICGRAGI CGGGTI . # -< - 7 +

Figure 1. (A) The DNA sequence of the insert in pS3E15 containing the hypervariable tandem repeat. The nine tandem repeats are aligned and the start of the flanking DNA sequence is indicated with an asterisk. (B) Best alignment of the oligonucleotide with two tandem repeats of pS3E15.


Subcloning and sequencing DNA from positive hybridizing X clones was prepared by growing 50-ml lysates and extracting the DNA by phenolkhloroform. Restriction digest analysis of the A clones in comparison with the phage vector was done by separation of the digests in agarose gels. Southern blotting and subsequent hybridization with the oligonucleotides allowed the identification of the genomic restriction fragment which contained the oligonucleotide homologue. Subcloning was performed in pSP72 (Promega Biotech) by standard methods (Maniatis et ul. 1982). Deletion analysis of a 1-8-kb Suu3A fragment, subcloned in pSP72, was done by the ‘Erase-a-Base’ system (Promega) according to the manufacturer’s instructions. Preparation and purification of pSP72 plasmid DNA was carried out according to FPLC Application File 21 (Pharmacia, Sweden). Sequencing by the method of Sanger et al. (1977) was carried out on supercoiled plasmid according to Chen & Seeburg (1985).

Southern blotting Restriction enzyme digests on 10 pg of genomic DNA in a total volume of 30 p1 with the use of 20 units restriction enzyme were performed overnight at 37°C according to the manufacturer’s recommendations in the presence of 4mM spermidine.

The digests were separated on 0.8% or 1% agarose gel (20 X 35cm or 20 x 20cm), in TAE buffer (NmM Tris, 20mM NaAc, 1 mM EDTA, pH 7.2 with HAc) at 2-5 V/cm. After denaturation (two times 30 min in 1-5M NaC1, 0 . 5 ~ NaOH) and equilibration (two times in 1 M N€&Ac, 0-02M NaOH, pH 7.4) the genomic digests were blotted in equilibration buffer to nylon filter (Hybond-N, Amersham) and fixed by baking at 80°C for 2 h.

Hybridizations Plasmid DNA was radiolabelled by primer extension to a specific activity superior to lo9 cpdpg. For the low stringency hybridizations the filters were prehybridized at 42°C for 2h in 200ml6X SSC, 35% formamide, 5mM EDTA, 0.25% dried skimmed milk (Gloria), and hybridized for 16-20h in the same conditions with 100ng radiolabelled plasmid DNA. The filters were then washed in 2x SSC, 0.1% SDS, two times 20 min at room temperature and four times 20 min at 65°C. Autoradio: graphy was carried out for 2 and 7 days with intensifying screens at -70°C on Kodak X-Omat AR films. The high stringency hybridizations were carried out in 6x SSC, 5x Denhardt’s, 0.5% SDS at 65°C for 16 h. High stringency washes of the filters were twice for 15 min in 2x SSC, once for 30 min in 2X SSC, 0.1% SDS, once for 30 min in 0-1x SSC, 0.5% SDS, all at 68°C.

Results

Isolation of a tandem repeat sequence from the pig genome After screening lo6 plaques of the genomic library with the oligonucleotide mixture, one positive hybridizing clone was detected, with an insert of approximately 11 kb.

Hypervariabfe pig DNA fragment 33

A restriction map of this A clone was constructed with the restriction enzymes BgfII, BumHI, HindIII, SafI and PstI (data not shown). A 5-kb BamHI fragment was shown to contain the sequence detected with the oligonucleotide by Southern blotting and subsequent hybridization. Several attempts to subclone the purified 5-kb BamHI fragment in pSW2 failed. Therefore a Sau3A digest of this DNA fragment was subcloned in pSW2 and a positive 1-8-kb Sau3A-containing clone (pS3) was selected by colony hybridization. Restriction enzyme analysis of pS3 revealed that no restriction sites were present in a segment of k1200bp for the following enzymes (TaqI, Sau3A, AfuI, HpaII, BamHI, PstI, EcoRI, HindIII, Hai 111, Fnu DII, Hinc 11).

To sequence and to characterize this 1200-bp segment further, deletion derivatives were made of pS3 by treating the linearized plasmid with exonuclease 111. The smallest subclone which still hybridized to the oligonucleotide (pS3E15) contained an insert of 250 bp. This plasmid insert was completely sequenced in both directions and the sequence is shown in Fig. 1A. No correlation with the predicted PO2 coding sequence could be found. Part of this 250-bp DNA insert, namely 150 bp, is built up of nine tandem repeats of which two contain a core of 15 basepairs and seven are extended by three nucleotides to 18 basepairs. The consensus repeat sequence and the best alignment with the oligonucleotide probe are presented in Fig. 1B. From this it is obvious that the hybridization signal at low stringency conditions is probably due to the high GC content of the repeated sequence and to the amplification of the signal by the repetitive character of the tandem repeat.

Churpcterization of the pS3 tandem repeat as a VNTR marker Since many similar tandem repetitive sequences, found in human and other organisms, exhibit a highly polymorphic character (Jeffreys et al. 1985a; Nakamura et al. 1987; Vassart et af. 1987) we were interested to find out if the insert in pS3 also displays polymorphism and if it could be used as a VNTR marker. Therefore pS3 was used as a probe and hybridized under different conditions with several digests of genomic DNA of different pigs. Under stringent conditions, pS3 detected multiallelic variation among individuals. Of the restriction enzymes used (EcoRI, BamHI, TaqI, HinfI) the polymorphism was most apparent in BumHI- and HinfI-digested pig DNA.

Figure 2A shows a genomic hybridization of HinfI-digested DNA of at random chosen pigs to the pS3 probe. Either one or two fragments hybridize per individual and this clearly indicates that pS3 can be used as a locus specific probe. In the sample of 20 chosen individuals, at least seven different alleles, ranging between 2-3 and 0.8 kb, can easily be discerned. Probably many more alleles exist but microheterogeneity, resulting in closely spaced bands, is difficult to resolve. Figure 2B shows a genomic hybridization of HinfI-digested DNA of two related pig families to the pS3 probe. It also illustrates the effect of a higher resolution: due to other gel dimensions, it is clear that two different E alleles exist in the second family. In a total of 41 analysed unrelated individuals, a heterozygosity of 73% was observed. Since


A

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

2.2-

1.8 -

1.2 -

Figure 2. Autoradiograms of Southern blots of 10 pg Hinfr digested pig DNA hybridized with labelled pS3 DNA. (A) Twenty individuals taken at random. Separation on a 20 X 20cm 1% agarose gel. M: molecular weight marker lane; sizes given in kilobases. (B) Two related families separated on a 20 X 35cm 1% agarose gel.

parental HinfI fragments segregate in the offspring, these results strongly support our conclusion that the pS3 repeat is a probe for a highly informative multiallelic locus.

Genomic hybridizations under low stringency conditions between the pS3 probe and pig DNA gave fingerprint-like patterns. Figure 3 shows a Southern blot of HinfI-digested DNAs extracted from a family of pigs. In general, 6 to 12 distinguishable polymorphic bands between 3 and 15 kb could be observed while above 15kb, only very weak polymorphic bands could be detected. Some of the


I I I I I I I I_

FIpm 3. DNA fingerprints of related pigs. Electrophoresis of Hitin digests of 10 pg pig DNA on a 35 x 20an 0.8% agarosegel, Southern blotting and hybridization with labelled pS3 DNA. The numbers 6,8,11 refer to Fig. 2A. Parental HinfI allelic fragments are joined together by: full lines to the left for parent 6, dotted lines to the left for parent 8, full lines to the right for parent 11 respectively. Molecular weight sizes are given in kilobases to the right.

bands could be combined in allelic pairs by pairwise comparision of the segregation patterns of the parental bands. Since pS3 is a highly informative probe for chromosomal segregation studies as well as for DNA fingerprinting of the pig genome, we wanted to check this probe also for other domestic animals. Figure 4A shows HinfI-digested horse DNA. Only very weak signals are observed on fragments about 4 kb but at least four distinct polymorphic bands can be detected in the range between 2-5 and 4kb.

The HinfI Southern blots of rabbit DNA in Fig. 4B demonstrate that at least 15 strong hybridizing bands in the range from 23 to 3 kb are hybridizing to the pS3 probe. In comparison to the other tested animals under the same conditions these hybridization signals were very strong as compared to the signals obtained in the pig and horse DNA.


A oO*o 0

823.1

- 9.4

-6.6

-4,4

-2.3

-2.0

-9.4

-6.6

.4.4

-2.3

-2.0

Figure 4. (A) DNA fingerprints of related and unrelated horses DNA. Hinfl digests of 10 pg DNA were electrophoresed on a 35 X 20cm 1% agarose gel, Southern blotted and hybridized with labelled pS3 DNA. (B) Fingerprints of related and unrelated rabbit DNA, under the same conditions as A.

Discussion

A hypervariable locus from the pig genome (comparable to the VNTRs in human) was cloned and characterized. The sequence analysis demonstrates that this clone contains a tandem repeat. The sequence of pS3 was compared with the common core sequencies, obtained by Jeffreys et al. (1985a), Nakamura et al. (1987) and Vassart et al. (1987). A certain homology between the pS3 core sequence and the common core in the Jeffreys study was found, as shown in Figure 5 .

In this context, we investigated whether this clone pS3 could also be used as a multiallelic RFLP probe in pig and as a multilocus hypervariable probe in other domestic animals. Our results indicate that this pS3 probe detects a highly polymorphic locus with more than seven alleles in pigs. This can be important for genetic linkage studies because the informative value of a locus is directly related to


Camon sequence Nakamura et a l . (1987) GGGNNGTGGGG Consensus sequence V a s s a r t e t a l . (1987) GAGGGTGGXGGXTCT

CQmnon core J e f f r e y s e t a l . (1985a) GGAGGTGGGCAGGAXG Core sequence pS3 t h i s s tudy GGAGGTTCAGGlGeGA --

Figure 5. Common core sequences of some previously described VNTR loci and the core sequence, ascertained in this study. The most similar parts in Jeffreys' common core and the core of pS3 are underlined.

the potential heterozygosity in a population. Since VNTR markers are multiallelic there is an increased probability that two individuals will be heterozygous. Therefore these markers increase the efficiency of linkage analysis. One of the problems encountered was the limited resplution of the different pS3 HinfI alleles in the molecular weight range of interest, namely 2-5 to 0-5 kb. We were able to distinguish seven alleles rather easily on a 20-cm long agarose gel. Some other closely spaced alleles could only be separated on longer agarose gels of 35cm. Theoretically, the smallest difference between two alleles is one repeat unit, which is 15 or 18 bp, so that the number of alleles is virtually unlimited. This microheterogeneity is frequently found when dealing with hypervariable DNA markers. Superior resolution for certain molecular weight ranges obtained by field inversion gel electrophoresis (FIGE) as indicated by Gejman et al. (1988) is one of the possibilities to improve the detection of different alleles especially in the range of 22.1-9.4kb and 4-l.7kb. The use of this pig pS3 as a multilocus hypervariable probe has proven helpful in parentage control for pigs, horses and rabbits, but it could also be a start to isolate other multiallelic locus specific RF'LP probes for pigs. This can be done by subcloning particular bands from the fingerprint obtained after hybridization with pS3, under non-stringent conditions. Many different multiallelic probes can then be of great value for the establishment of linkage groups with other genes affecting important traits.

Acknowledgements

This research was kindly supported by grants from the IWONL Foundation, Brussels and Versele-Laga N.V. Deinze (Belgium). The authors are grateful to F. Leenaerts, L. Van Kaar, H. Denoo, J. Gielen and D. Van Assche for excellent technical assistance.

References

Archibald A.L. & Imlah P. (1985) The halothane sensitivity locus and its linkage relationships. Animal

Chen E.Y. & Seeburg P.H. (1985) Supercoil sequencing: a fast and simple method for scquencingplasmid

Frischauf A., Lehrach H., Poustka A. & Murray N.J. (1983) Lambda replacement vectors carrying

Blood Groups and Biochemical Genetics 16.25M3.

DNA. DNA 4,165-70.

polyiinker sequences. Journal of Molecular Biology 170,82742.


GejmanP.V., SitaramV.,Hsieh W.T., Gelernter J. &GershonE.S. (1988)Theeffectsof fieldinversion electrophoresis on small DNA fragment mobility and his relevance to DNA polymorphism research. Applied and Theoretical Electrophoresis 1,29-34.

Georges M., LequarrC AS., Hanset R. & Vassart G. (1987) Genetic variation of the bovine thyroglobulin gene studied at the DNA level. Animal Genetics 18,41-50.

Jeffreys A.J., Wilson V. & Thein S.L. (1985a) Hypervariable ‘minisatellite’ regions in Human DNA. Nature 314,67-73.

Jeffreys A.J., Wilson V. & Thein S.L. (1985b) Individual specific ‘fingerprints’ of human DNA. Nature 316, 76-9.

Jeffreys A.J., Wilson V., Thein S.L., Weatherall D.J. & Ponder B.A.J. (1986) DNA ‘fingerprints’ and segregation analysis of multiple markers in human pedigrees. American Journal of Human Genetics 39,

Maniatis T., Fritsch E.F. & Sambrook J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

Nakamura Y., Leppert M., O’Connell P., Wolff R., Holm T., Culver M., Martin C., Fujimoto E., Hoff M., Kumlin E. &White R. (1987) Variable number of tandem repeat (VNTR) markers for human gene mapping. Science 235,161622.

Sanger F.S., Nicklen S. Br Coulson S.A. (1977) DNA sequencing with chain terminating inhibitors. Proceedings of the National Academy of Sciences of the USA 74,5463-7.

Takahashi Y., Kato K., Hayashizaki Y., Wakabayashi T., Ohtsuka F., Matsuki S., Ikehara M. & Matsubara K. (1985) Molecular cloning of the human cholecystokinin gene by use of a synthetic probe containing deoxyinosine. Proceedings of the National Academy of Sciences of the USA 82,1931-5.

Van de Weghe A., Coppicters W., Bauw G., Vandekerckhove J. & Bouquet Y. (1988) The homology between the serum proteins PO2 in pig, Xk in horse and a 1B-glycoprotein in human. Comparative Biochemistry and Physiology 9OB, 751-6.

Vassart G., Georges M., Monsieur R., B r o w H., LequarrC AS. & Chxistophe D. (1987) A sequence in M13 phage detects hypervariable minisatellites in human and animal DNA. Science 235,683-94.

Zhu J., Kcmpenaers W., Van der Straeten D., Contreras R. & Fiers W. (1985) A method for fast and pure DNA elution from agarose gels by centrifugal filtration. BiolTechnology 3,101416.

11-24.

a hypervariable pig dna fragment

Documents