a kelbert et al. nature 460 , 1003 - 1006 (2009) doi:10.1038/nature08 257

A Kelbert et al. Nature 460, 1003-1006 (2009) doi:10.1038/nature08257 Regularized degree and order nine electrical conductivity inverse solution.

Upload: illiana-aguilar

Post on 30-Dec-2015

45 views

Category:

Documents

2 download

Report

Download

Embed Size (px):

DESCRIPTION

Regularized degree and order nine electrical conductivity inverse solution. A Kelbert et al. Nature 460 , 1003 - 1006 (2009) doi:10.1038/nature08 257. - PowerPoint PPT Presentation

TRANSCRIPT

A Kelbert et al. Nature 460, 1003-1006 (2009) doi:10.1038/nature08257

Regularized degree and order nine electrical conductivity inverse solution.

Organizational Chart - Trinity Valley Community College Org Chart.pdfStephanie Golem Senior Accountant (Financial Reporting) Accounting Services Kelbert McGee Senior Accountant (Grants

Macroporous nanowire nanoelectronic scaffolds …cmliris.harvard.edu/assets/10.1038-nmat3404.pdfARTICLES PUBLISHED ONLINE: 26 AUGUST 2012 |DOI:10.1038/NMAT3404 Macroporous nanowire

Published in Nature Materials (2016) doi:10.1038/nmat4569

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

XQ Wang et al. Nature 461 , 947 - 955 (2009) doi:10.1038/nature08 435

Nature , 2008, Doi:10.1038/nature07103

Supplementary information - Nature · © 200 9 Macmillan Publishers Limited. ... 10.1038/nchem.290 Supplementary information 6 ... 10.1038/nchem.290 Supplementary information 7 Preparation

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

JB Kim et al. Nature 461 , 649 - 653 (2009) doi:10.1038/nature08 436

doi:10.1038/nature12886 Neanderthal from the Altai

GI Motility online (May 2006) | doi:10.1038/gimo48

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

GI Motility online (May 2006) | doi:10.1038/gimo31

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

GI Motility online (May 2006) | doi:10.1038/gimo6

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/NPHYS3211 Supplementary Information for

União pelo esporte - COBRAPAcobrapa.com.br/paddlelist/17_julho_2012/files/pkt17_web.pdf · Mariana e Laura Altmayer e Mirelle Freitas e Sofia Kelbert da 1ª feminina na ... Pádel,

17 September 2009 doi:10.1038/nature08355 LETTERS

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

Nature Biotechnology: doi:10.1038/nbt

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

GI Motility online (May 2006) | doi:10.1038/gimo46

doi:10.1038/nature05150 LETTERS

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental