Molecular Phylogenetics and Evolution 54 (2010) 97–106

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier .com/ locate /ympev

A molecular phylogeny shows the single origin of the Pyrenean subterraneanTrechini ground beetles (Coleoptera: Carabidae)

A. Faille a,b,*, I. Ribera b,c, L. Deharveng a, C. Bourdeau d, L. Garnery e, E. Quéinnec f, T. Deuve a

a Département Systématique et Evolution, ‘‘Origine, Structure et Evolution de la Biodiversité” (C.P.50, UMR 7202 du CNRS/USM 601), Muséum National d’Histoire Naturelle,Bât. Entomologie, 45 rue Buffon, F-75005 Paris, Franceb Institut de Biologia Evolutiva (CSIC-UPF), Passeig Maritim de la Barceloneta 37-49, 08003 Barcelona, Spainc Museo Nacional de Ciencias Naturales (CSIC), José Gutiérrez Abascal 2, 08006 Madrid, Spaind 5 chemin Fournier-Haut, F-31320 Rebigue, Francee Laboratoire Evolution, Génomes, Spéciation, CNRS UPR9034, Gif-sur-Yvette, Francef Unité ‘‘Evolution & Développement”, UMR 7138 ‘‘Systématique, Adaptation, Evolution”, Université P. & M. Curie, 9 quai St–Bernard, F-75005 Paris, France

a r t i c l e i n f o

Article history:Received 16 March 2009Revised 1 October 2009Accepted 5 October 2009Available online 21 October 2009

Keywords:Subterranean environmentConvergenceEndogeanTroglobiticTrechinaeAphaenops

1055-7903/$ - see front matter � 2009 Elsevier Inc. Adoi:10.1016/j.ympev.2009.10.008

* Corresponding author.E-mail addresses: arnaud.faille@ibe.upf-csic.es, fa

cio.ribera@ibe.upf-csic.es (I. Ribera), deharven@mnhnnery@legs.cnrs-gif.fr (L. Garnery), eric.queinnec@snv.j@mnhn.fr (T. Deuve).

a b s t r a c t

Trechini ground beetles include some of the most spectacular radiations of cave and endogean Coleoptera,but the origin of the subterranean taxa and their typical morphological adaptations (loss of eyes andwings, depigmentation, elongation of body and appendages) have never been studied in a formal phylo-genetic framework. We provide here a molecular phylogeny of the Pyrenean subterranean Trechini basedon a combination of mitochondrial (cox1, cyb, rrnL, tRNA-Leu, nad1) and nuclear (SSU, LSU) markers of 102specimens of 90 species. We found all Pyrenean highly modified subterranean taxa to be monophyletic, tothe exclusion of all epigean and all subterranean species from other geographical areas (Cantabrian andIberian mountains, Alps). Within the Pyrenean subterranean clade the three genera (Geotrechus,Aphaenops and Hydraphaenops) were polyphyletic, indicating multiple origins of their special adaptationsto different ways of life (endogean, troglobitic or living in deep fissures). Diversification followed ageographical pattern, with two main clades in the western and central-eastern Pyrenees respectively,and several smaller lineages of more restricted range. Based on a Bayesian relaxed-clock approach, andusing as an approximation a standard mitochondrial mutation rate of 2.3% MY, we estimate the originof the subterranean clade at ca. 10 MY. Cladogenetic events in the Pliocene and Pleistocene were almostexclusively within the same geographical area and involving species of the same morphological type.

� 2009 Elsevier Inc. All rights reserved.

1. Introduction

The origin and evolution of cave organisms has fascinated evo-lutionists and biologists for more than two hundred years, sincethe discovery of the first troglobitic species (Proteus anguinus, de-scribed by Laurenti, 1768). Organisms living in a subterraneanenvironment tend to show a highly modified morphology and biol-ogy, and a mixture of losses (eye degeneration, depigmentation)and adaptations (development of sensory organs, changes in thelife cycle and metabolism, body shape modifications) (Racovitza,1907; Vandel, 1964; Culver et al., 1990). Troglobitic invertebratesisolated in karstic areas are also very good models to study speci-ation and diversification, because of the isolation of populations inwell-defined karstic units with highly restricted gene flow

ll rights reserved.

ille@mnhn.fr (A. Faille), igna.fr (L. Deharveng), Lionel.Garussieu.fr (E. Quéinnec), deuve

(Caccone, 1985). Amongst insects, many groups of Coleoptera haverepeatedly colonised subterranean habitats, but two of them areparticularly diverse: Leiodidae (especially subfamily Cholevinae)in the suborder Polyphaga, and Carabidae of the subfamily Trechi-nae in the suborder Adephaga (Casale et al., 1998). Subterraneanspecies of both groups share morphological modifications consid-ered to be adaptations to a subterranean lifestyle: loss of metatho-racic wings, eyes and pigment, similar changes in body shape andsize (Jeannel, 1926a,b; Vandel, 1964; Barr and Holsinger, 1985),and modifications in their way of life (Deleurance, 1958). Theextensive convergence in morphological characters obscures thephylogenetic relationships among species (Marquès and Gnaspini,2001; Desutter-Grandcolas et al., 2003), which has resulted in ahigh number of taxonomic arrangements with non-monophyletictaxa (see e.g. Fresneda et al., 2007 for an example with a lineageof Leiodidae cave beetles).

The Pyrenean Chain is known to be one of the main world hot-spots for subterranean invertebrate fauna (Culver et al., 2006). Thephylogenetic relationships among the subterranean species ofPyrenean Trechini, one of the groups which have experienced

98 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106

extensive diversification in the area (Jeannel, 1941), are poorlyknown, and studies have so far been based on morphological char-acters only (Jeannel, 1941; Casale et al., 1998; see below).

The subterranean Trechini of the Pyrenees include ca. 80 speciesin three genera, Geotrechus, Aphaenops and Hydraphaenops (Mora-vec et al., 2003; see Appendix for nomenclatorial remarks). Allthe species are Pyrenean endemics (most of them with very nar-row distributions), with different adaptations for life in subterra-nean habitats. They are all completely blind and apterous, with aslender body form, and (in some species) an extreme elongationof the head, pronotum and appendages (Jeannel, 1941; Casaleet al., 1998), resulting in a very characteristic appearance, the‘‘aphaenopsian” morphological type (Jeannel, 1941; Vandel,1964) (Fig. 1). Many subterranean insects around the world haveindependently developed similar characteristics, and ‘‘aphaenop-sian”, ‘‘aphaenopsoid” or ‘‘Aphaenops-like” is commonly used to re-fer to this syndrome in other groups of Carabidae (Barr, 1979;Deuve, 2001; Ortuño et al., 2004; Uéno and Clarke, 2007), and evenother insects (e.g. Hymenoptera, Roncin and Deharveng, 2003).

In this study we provide for the first time a phylogenetic frame-work obtained with numerical algorithms to study the origin anddiversification of the subterranean species of Pyrenean Trechini,based on a combination of nuclear and mitochondrial genes. Weinclude a broad sample of the three subterranean genera (51 spe-cies, some with repeated examples), plus a representation of othertroglobitic species and potential relatives living on the surface inthe Pyrenees and other west Mediterranean areas. Our specificaims were to (1) determine the origin of the subterranean generaand their relationships with epigean species, (2) investigate themonophyly of traditional taxa (genera and subgenera), establishedon external morphological characters, and (3) investigate the rela-tionship between endogean and cave species.

2. Materials and methods

2.1. Historical and taxonomic background of Pyrenean subterraneanTrechini

The first known Pyrenean cave ground-beetles were included inthe genus Anophthalmus, created for an eastern Alpine hypogean

Fig. 1. Habitus of (1) Aphaenops alberti Jeannel (troglobitic), (2) Aphaenops pluto Dieck (trseijasi Español (endogean), and (5) Trechus quadristriatus (Schrank) (epigean). Scale bars

species (A. schmidtii Sturm). Putzeys (1870) transferred thesespecies to the genus Trechus Clairville, which also includes epigeanspecies. Bonvouloir (1862) erected the genus Aphoenops for thesubterranean species A. leschenaulti Bonvouloir on the basis of thenon-dilated protarsi of the male, a character currently consideredof reduced phylogenetic relevance (Bedel and Simon, 1875). Seethe appendix for the use of Aphaenops in place of Aphoenops.

The current concept of the genus Aphaenops includes 41 specieson both sides of the Pyrenees, all of them highly modified andexclusive to karst areas, living either in deep cavities or, in somecases, in the Superficial Hypogean Compartment (‘‘Milieu souter-rain superficiel”, MSS, Juberthie and Bouillon, 1983). Diagnosticcharacters are the presence of incomplete frontal furrows (vs. com-plete in Geotrechus), very elongated legs and antennae, body pale,completely depigmented, and a pronounced narrowing (a ‘‘neck”)at the base of the head (Coiffait, 1962) (Fig. 1). It is subdivided insix subgenera (for the taxonomic ordination of the group we followthe recent catalogue of Moravec et al., 2003, although we do notconsider subspecies unless otherwise stated):

(1) Aphaenops Bonvouloir, 1862: 10 species, mainly found in thewestern Pyrenees.

(2) Geaphaenops Cabidoche, 1965: 7 species, also in the westernPyrenees. All the species of this group seem to be endogean,and their external morphology is very homogeneous.

(3) Cerbaphaenops Coiffait, 1962: 16 species, mainly found in thecentral and eastern Pyrenees, between Bagnères-de-Bigorreand the Ariège River. This is also a group with a very homo-geneous morphology, although no clear diagnostic charac-ters were given by Coiffait (1962) (pubescent head, shortmandibles).

(4) Pubaphaenops Genest, 1983: a single species from a cave inAriège, A. laurenti Genest, fully pubescent.

(5) Arachnaphaenops Jeanne, 1967: three species, one in thewestern Pyrenees, two in Ariège and Haute-Garonne respec-tively, all with very long legs and antennae, which give themthe appearance of an arachnid.

(6) Cephalaphaenops Coiffait, 1962: two species, one in the wes-tern Pyrenees, the other in Ariège and Haute-Garonne, witha large and pubescent head and long mandibles.

oglobitic), (3) Hydraphaenops navaricus Coiffait & Gaudin (troglobitic), (4) Geotrechus, 1 mm. Photos 1–3 P. Déliot, 4 A. Faille, 5 U. Schmidt.

Table 1Checklist of genera and subgenera of subterranean species of Pyrenean Trechini, withtotal number of species and species included in the study. Taxonomy follows Moravecet al. (2003) updated.

Genus Subgenus N. spp. Sampled spp.

Aphaenops Aphaenops 10 8Aphaenops Geaphaenops 7 2Aphaenops Cerbaphaenops 16 14Aphaenops Cephalaphaenops 2 1Aphaenops Arachnaphaenops 3 3Aphaenops Pubaphaenops 1 1Hydraphaenops Hydraphaenops 18 8Geotrechus Geotrechus 8 4Geotrechus Geotrechidius 15 6Trechus Trechus 17a 7

a Species occurring in the Pyrenees, 11 of them endemic.

A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 99

The genus Geotrechus was created by Jeannel (1919) for someblind species with an ‘‘Anophthalmus-like” habitus, in oppositionto the species of Aphaenops. Diagnostic characters of Geotrechusare the presence of frontal furrows and their more robust appear-ance, with short legs and antennae (Coiffait, 1962; Fig. 1). Jeannel(1919) considered the genera Aphaenops and Geotrechus as two clo-sely related but distinct lineages. Most of the 22 known species ofGeotrechus are endogean, and although some populations can belocally abundant in caves, most of them seem to be more commonin the ground at the entrance of the cavities (Jeannel, 1926b, 1941).Some species can also be found under large stones in forests, whenhydric conditions are favourable.

Hydraphaenops was first described as a subgenus of Aphaenopsby Jeannel (1926a), and subsequently upgraded by Coiffait(1962). Currently it includes 18 species, characterised by an elon-gated and parallel-sided, almost cylindrical head, sharp, sickle-shaped mandibles, short appendages and the body at least partiallycovered with pubescence (Jeannel, 1941; Coiffait, 1962) (Fig. 1).Most species are exceedingly rare, some of them being known fromonly one or two specimens, and their biology is virtually unknown(Cabidoche, 1966). They do seem to be highly hygrophilous, requir-ing a water-saturated atmosphere to colonise karstic areas (Deleu-rance-Glaçon, 1963). Some species are known at low altitude (e.g.H. galani Español, found at sea level), while others have only beenfound in high altitude shafts in direct contact with ice (e.g. H. pena-collaradensis Dupré, H. mouriesi Genest) (Español, 1968; Dupré,1991; Genest, 1983). As happens with Aphaenops, Hydraphaen-ops-like species are known in other lineages of subterranean Tre-chinae (Deuve, 2000; Casale, 2004).

2.2. Taxon sampling

Trechini species were collected in caves, shafts and MSS fromthe Pyrenean chain, in France and Spain as listed in Suppl. Table1. Single individuals were used for amplification and sequencing.We included as outgroups several examples of Trechus from thePyrenees (mainly epigean, some of them hypogean), plus someother genera from different geographical areas, including both epi-gean and subterranean species (Suppl. Table 1). To root the tree weused one species of Anillini (Typhlocharis Dieck) and two of Bem-bidiini (Porotachys Netolitzky and Philochthus Stephens), whichare clearly outside Trechini (Grebennikov and Maddison, 2005;Grebennikov, 2008). In total, we sampled 50 specimens of 32 spe-cies of Aphaenops, 11 specimens of 9 species of Hydraphaenops and12 specimens of 10 species of Geotrechus (Table 1; Suppl. Table 1).

2.3. DNA extraction, PCR amplification and sequencing

Specimens were collected alive in the field and directly killedand preserved in 96% ethanol. DNA was extracted from whole spec-imens by a standard phenol–chloroform extraction (Blin and Staf-ford, 1976). DNA extraction was usually non-destructive, topreserve voucher specimens for subsequent morphometric andmorphological study (Pons, 2006; Gilbert et al., 2007; Rowleyet al., 2007). Specimens were incubated overnight in a mix of500 ll of buffer (10 mM Tris, pH 8.0; 0.5% SDS; 0.1 M EDTA, pH8.0) and 25 ll of proteinase K (20 mg/ml) at 55 �C, with the abdom-inal ventrites slightly opened to facilitate the action of the digestionenzyme. The use of non-destructive methods allowed the molecularstudy of very rare species, as even fragile structures of taxonomicimportance, like the chaetotaxy or the internal structures of theaedeagus, were perfectly preserved after extraction (Pons, 2006;Gilbert et al., 2007; Rowley et al., 2007). Voucher specimens arekept in the MNHN (Paris), DNA aliquots are kept in the tissue collec-tions of the MNHN and IBE (CSIC-UPF, Barcelona).

We sequenced three mitochondrial (50 end of cytochrome c oxi-dase subunit 1, cox1; cytochrome b, cyb, 50 end of large ribosomalunit plus the Leucine transfer plus the 30 end of NADH dehydroge-nase subunit 1, rrnl+tRNA-Leu+nad1) and two nuclear (small ribo-somal unit, SSU, large ribosomal unit, LSU) gene fragments (seeTable 2 for the primers used). Sequences were assembled and edi-ted with Bioedit v. 7.00 (Hall, 1999) or Sequencher 4.6 (GeneCodes, Inc., Ann Arbor, MI). New sequences have been depositedin GenBank with Acc. Nos. GQ293502–GQ293896 (395 sequences)(Suppl. Table 1). For some species, the final sequence is a chimeraof sequences obtained from different specimens (labelled with thetwo voucher numbers in all Figures, see Suppl. Table 1). Proteincoding genes were not length variable, and the ribosomal geneswere aligned with the online version of MAFFT v.6 using the G-INS-i algorithm and default parameters (Katoh et al., 2002; Katohand Toh, 2008).

2.4. Phylogenetic analyses

Bayesian analyses were conducted on a combined data matrixwith MrBayes 3.1.2 (Huelsenbeck and Ronquist, 2001), using fivepartitions corresponding to the five sequenced fragments. Evolu-tionary models were estimated prior to the analysis with Model-Test 3.7 (Posada and Crandall, 1998). MrBayes ran for 6 � 106

generations using default values, saving trees each 500. ‘‘Burn-in”values were established after visual examination of a plot of thestandard deviation of the split frequencies between two simulta-neous runs.

We used two additional phylogenetic approaches for compara-tive purposes, maximum likelihood with a genetic algorithmimplemented in Garli v0.9 (Zwickl, 2006), using an estimatedGTR+I+G model for the combined sequence and the default set-tings, and parsimony in PAUP v4.b10 (Swofford, 2002), with10,000 random replicates, swapping on best trees only and not sav-ing multiple trees. Node support was measured with the posteriorprobabilities in MrBayes, and 1000 bootstrap replicates (Felsen-stein, 1985) in Garli and PAUP. To reduce computation time in Gar-li, the number of generations without improving the topologynecessary to complete each replica was reduced to 5000 insteadof the default 10,000. In PAUP we performed heuristic searcheswith random addition of taxa with 10 repetitions for each of1000 replications. Differences between alternative topologies wereevaluated using the tests of Templeton (1983) for parsimony andShimodaira and Hasegawa (1999) for maximum likelihood.

To check for possible topological incongruences we did maxi-mum likelihood analyses in Garli with the nuclear sequence alone,using the GTR+I+G evolutionary model and estimating node sup-port with 1000 bootstrap replicas as above.

Table 2Primers used in the study.

Marker Primer Sequence Ref.

cox1 RON 50GGATCACCTGATATAGCATTCCC30 Simon et al. (1994)HOBBES 50AAATGTTNGGRAAAAATGTTA30 Monteiro and Pierce (2001)TONYA 50GAAGTTTATATTTTAATTTTACCGG30 Monteiro and Pierce (2001)NANCY 50CCCGGTAAAATTAAAATATAAACTTC30 Simon et al. (1994)JERRY 50CAACATTTATTTTGATTTTTTGG30 Simon et al. (1994)PAT 50TCCAATGCACTAATCTGCCATATTA30 Simon et al. (1994)

cyb CB1 50TATGTACTACCATGAGGACAAATATC30 Simon et al. (1994)CP1 50GATGATGAAATTTTGGATC30 Kergoat (pers. comm., 2004)TSERco 50TATTTCTTTATTATGTTTTCAAAAC30 Simon et al. (1994)

rrnl+tRNA-Leu+nad1 NDIA 50GGTCCCTTACGAATTTGAATATATCCT30 Simon et al. (1994)16SaR 50CGCCTGTTTATCAAAAACAT30 Simon et al. (1994)

LSU D3 50GCATAGTTCACCATCTTTC30 Ober (2002)D1 50GGGAGGAAAAGAAACTAAC30 Ober (2002)

SSU 18S-50 50GACAACCTGGTTGATCCTGCCAGT30 Shull et al. (2001)18S-b5.0 50TAACCGCAACAACTTTAAT30 Shull et al. (2001)

100 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106

2.5. Estimation of divergence times

To estimate the relative age of divergence of the lineages weused the Bayesian relaxed phylogenetic approach implementedin BEAST v1.4.7 (Drummond and Rambaut, 2007), which allowsvariation in substitution rates among branches (Drummond et al.,2006). We implemented a GTR+I+G model of DNA substitutionwith four rate categories using the mitochondrial data set onlyand pruning species with more than one missing gene fragment,with an uncorrelated lognormal relaxed molecular clock modelto estimate substitution rates and the Yule process of speciationas the tree prior. The main nodes of the topology were constrainedto match that of the tree obtained with the whole dataset (mito-chondrial plus nuclear) in MrBayes. We ran two independent anal-yses for each group, sampling each 500 generations, and usedTRACER version 1.4 to determine convergence, measure the effec-tive sample size of each parameter, and calculate the mean and95% highest posterior density interval (HPD) for divergence times.Results of the two runs were combined with LogCombiner v1.4.7and the consensus tree compiled with TreeAnnotator v1.4.7(Drummond and Rambaut, 2007).

The analyses were run for 25 � 106 generations, with the initial10% discarded as burn-in. Because of the absence of fossil recordfor both groups, to calibrate the trees we used as a prior a normaldistribution with average equal to the standard rate of 2.3% MY,equivalent to a per-branch rate of 0.0115 substitutions/site/MY(Brower, 1994), and a standard deviation of 0.0001. This rate islower to that obtained by Contreras-Díaz et al. (2007) for the genusTrechus, using calibration points based on the colonisation of theCanary islands (0.015 substitutions/site/MY), although the laterwas based on cox1 and cox2 only, which have faster evolutionaryrates than the ribosomal rrnL (Ribera et al., 2001).

3. Results

3.1. Phylogenetic analysis

The aligned data matrix had 3653 characters, of which 932 wereparsimony informative. There was no length variation in the pro-tein coding genes, and variation in the ribosomal genes was mostlyconcentrated in the LSU, ranging from 862 (Typhlocharis) to 909 bp(Perileptus), both among the outgroups. Length variation in the in-group LSU was reduced to between 867 (G. saulcyi, G. seijasi) and898 bp (Hydraphaenops galani, H. delicatulus). For the SSU fragmentthere was only three bp maximum length difference, and for therrnL+tRNA-LEU fragment the maximum length difference was

14 bp between Geotrechus vandeli and some species of Aphaenops(A. alberti, A. cabidochei, A. ochsi).

The optimal evolutionary model for the mitochondrial genes, asmeasured with Modeltest under the Akaike information criterion,was GTR+I+G. For the SSU the optimal model was TVMef+I, andfor the LSU TVM+I+G. The runs of MrBayes converged at ca.2 � 106 generations, with a standard deviation of the split frequen-cies between the two runs of ca. 0.015. The two runs were inter-rupted at 5 � 106 generations (see the estimated parameters inSuppl. Table 2). A heuristic search using PAUP and assuming anequal weight for all characters resulted in 2151 trees of 4537 steps(consistency index, CI = 0.41, retention index, RI = 0.60).

The topology of the tree, and the support for the main nodes,were very similar for the three reconstruction methods (Bayesianprobabilities, maximum likelihood and parsimony) (Fig. 2, Suppl.Fig. 1). In all cases the three subterranean genera of the Pyrenees(Aphaenops, Hydraphaenops and Geotrechus) formed a clade withexclusion of all epigean species, with strong support (Fig. 2, Suppl.Fig. 1). The Pyrenean subterranean lineage was sister to a poorlysupported clade including all species of Trechus of different areas(including the Pyrenees), plus some other subterranean taxa out-side the Pyrenees (Apoduvalius, Cantabrian mountains; Duvalius,Alps; Paraphaenops, Iberian System) (Suppl. Table 1; Fig. 2, Suppl.Fig. 1). Basal relationships within this clade were not supported.

Within the Pyrenean subterranean clade, the three genera werepolyphyletic under all reconstruction methods, with at least onewell-supported node determining the polyphyly in each case(Fig. 2). We constrained the monophyly of the three genera andsearched the best topology compatible with this constrain bothin PAUP using parsimony and in Garli with maximum likelihood.The search in PAUP with the constraint of the monophyly of thethree subterranean genera resulted in 227 trees of 4691 steps(CI = 0.39; RI = 0.57). The resulting topologies were significantlyworse, as tested both for parsimony (Templeton test, p < 0.0001)and maximum likelihood (Shimodaira–Hasegawa test, p < 0.0005).

The basal nodes of the subterranean clade were not well-sup-ported, but the best topologies in Bayesian analyses and maximumlikelihood placed a paraphyletic series of species of Geotrechusfrom the Eastern Pyrenees at the base (Fig. 2), included in the sub-genus Geotrechidius (the ‘‘vulcanus group” sensu Coiffait, 1962). Therest of the species were included in two main well-supportedclades (pp = 1, bootstrap >70% in all analyses) plus some westernlineages of Hydraphaenops and Geotrechus (Figs. 2 and 3). Thetwo well-supported main lineages were (1) species of Aphaenopsdistributed in the western Pyrenees (clade W), and (2) a clade ofspecies of Aphaenops and Hydraphaenops from the eastern Pyrenees

0.09

P. areolatus MNHN_AF113

A. parallelus MNHN_AF53

Typhlocharis MNHN_AF119

A. catalonicus MNHN_AF2

G. gallicus MNHN_AF76

T. quadristriatus MNHN_AF96

A. sp MNHN_AF42

A. chappuisi MNHN_AF61

A. crypticola MNHN_AF49

T. fulvus MNHN_AF98

A. hustachei MNHN_AF39

A. sioberae MNHN_AF54

S. mayeti MNHN_AF107

A. abodiensis MNHN_AF4

G. saulcyi MNHN_AF86

A. crypticola MNHN_AF134

A. bouilloni MNHN_AF56

A. jeanneli MNHN_AF11

A. bonneti MNHN_AF38

A. jauzioni MNHN_AF33

A. bucephalus MNHN_AF62

A. bessoni MNHN_AF122

H. vasconicus MNHN_AF65

A. alberichae MNHN_AF105

G. seijasi MNHN_AF89

A. michaeli MNHN_AF35

A. leschenaulti MNHN_AF1

T. barnevillei MNHN_AF97

A. mariarosae MNHN_AF57

A. aeacus MNHN_AF40

A. rhadamanthus MNHN_AF13_AF14

H. pandellei MNHN_AF71

Apoduvalius sp MNHN_AF106

A. cerberus MNHN_AF20_AF30

A. robini MNHN_AF112

G. vulcanus MNHN_AF91

A. crypticola MNHN_AF50

H. galani MNHN_AF67

T. distigma MNHN_AF94

D. roberti MNHN_AF129

G. jeanneli MNHN_AF77

T. saxicola MNHN_AF100

A. bouiganensis MNHN-AF46

A. crypticola MNHN_AF48

T. escalerae MNHN_AF104

T. ceballosi MNHN_AF128

T. comasi MNHN_AF127

G. saulcyi MNHN_AF87

H. pandellei MNHN_AF70

G. discontignyi MNHN_AF92

A. alberti MNHN_AF12

T. obtusus MNHN_AF126

H. elegans MNHN_AF120

A. ludovici MNHN_AF15

Agostinia gaudini MNHN_AF116

G. vandeli MNHN_AF88

T. navaricus MNHN_AF103

L. deharvengi MNHN_AF117

A. crypticola MNHN_AF51

A. loubensi MNHN_AF3

P. breuilianus MNHN_AF108

D. berthae MNHN_AF114_AF115

I. bolivari MNHN_AF111

H. penacollaradensis MNHN_AF121

A. delbreili MNHN_AF37

T. schaufussi MNHN_AF101

G. trophonius MNHN_AF83

A. crypticola MNHN_AF135

A. tiresias MNHN_AF59_AF60H. bourgoini MNHN_AF68

G. orpheus MNHN_AF79_AF81H. delicatulus MNHN_AF66

A. crypticola MNHN_AF47

A. carrerei MNHN_AF34

H. ehlersi MNHN_AF64H. pecoudi MNHN_AF72

G. orcinus MNHN_AF85

T. uhagoni MNHN_AF102

A. pluto MNHN_AF58

A. laurenti MNHN_AF63

A. cabidochei MNHN_AF5_AF6

A. sp MNHN_AF133

P. bisulcatus MNHN_AF131

H. bourgoini MNHN_AF69

P. lunulatus MNHN_AF118

A. orionis MNHN_AF9_AF10

A. ochsi MNHN_AF7_AF8

94/1/97

x/0.9/-

58/0.95/-

61/0.72/70

69/0.97/78

64/0.94/x

77/1/78

x/0.91/x

97/1/95

x/0.63/-

x/0.57/x

57/0.79/x

x/0.53/x

98/1/96

x/1/-

x/0.63/x

75/0.98/87

x/1/51

84/0.99/79

100/1/99

59/0.95/-

59/0.81/x

100/1/100

100/1/100

68/0.62/67

100/1/99

x/1/x

74/0.99/76

76/1/69

72/0.99/70

x/1/-

99/0.78/100

97/1/95

99/1/93

80/1/84

71/0.92/x

68/1/58

100/1/100

100/1/100

66/0.99/63

x/0.7/x

x/0.99/-

x/0.61/x

x/0.55/-

x/0.84/x

100/1/99

90/1/x

100/1/100

x/1/59

86/1/71

54/0.74/x59/0.96/67

72/1/70

x/0.94/-

x/0.64/61

73/0.98/97

97/1/88

67/0.96/80

87/1/71

98/1/89

83/1/73

x/0.68/x

52/1/53

53/1/92

x/0.77/63

x/0.86/x

56/0.77/x

100/1/x

86/0.99/69

92/1/80

63/1/57

100/1/99

x/0.53/-

100/1/100

86/1/x

100/1/100

99/1/97

x/0.88/69

100/1/100

x/0.6/x

95/1/97

A. vandeli MNHN-AF45

A. vandeli MNHN-AF43A. vandeli MNHN-AF44

A. crypticola MNHN_AF52

85/-/71

Eastern clade

.

.

Western clade

Pyrenean hypogean clade .

Fig. 2. Phylogram of subterranean Trechini of the Pyrenees obtained with maximum likelihood in Garli, using the combined data matrix. Number in nodes, ML bootstrap/Bayesian posterior probability, obtained in MrBayes/parsimony bootstrap (see Section 2 for details). ‘‘Western” and ‘‘Eastern” clades marked with ‘‘W” and ‘‘E” respectively(see text). In red, species of Aphaenops; in green, species of Hydraphaenops; in blue, species of Geotrechus. Habitus, from top to bottom: Aphaenops pluto, A. bessoni, A. alberti,Hydraphaenops galani, Geotrechus gallicus, G. seijasi, Trechus sp., Paraphaenops breuilianus, Duvalius berthae (see Suppl. Table 1). (For interpretation of colour mentioned in thisfigure the reader is referred to the web version of the article.)

A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 101

Fig. 3. Distribution of the main clades of subterranean Trechini of the Pyrenees, according to the phylogeny in Fig. 2. ‘‘Western” and ‘‘Eastern” clades marked with ‘‘W” and‘‘E” respectively (see text).

102 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106

(clade E). The Eastern group of Aphaenops species correspondsmostly to the subgenus Cerbaphaenops sensu Coiffait (1962), plussome morphologically characteristic species so far placed in thesubgenera Arachnaphaenops, Cephalaphaenops and Pubaphaenops(A. bucephalus, A. laurenti, A. chappuisi, A. pluto and A. tiresias; Suppl.Table 1).

The Western clade of Aphaenops included all species of the sub-genus Geaphaenops (forming a monophyletic lineage) plus speciesof Aphaenops s.str. and A. (Arachnaphaenops) alberti. The eastern-most species of this clade is Aphaenops catalonicus, which is alsothe southern-most species of Aphaenops, with records from thePre-Pyrenees in the Ribagorza valley (Fig. 3). It has morphologicalaffinities to the northern species and in particular to its sister A.leschenaulti (specially the male genitalia, Faille et al., 2006).

Within the Eastern clade (Cerbaphaenops sensu lato), what iscurrently known as A. crypticola is polyphyletic, with some lineagesassociated to other Aphaenops species according to their geo-graphic distribution. These affinities are also supported by mor-phological characters (see Section 4). Similarly, the only speciesof Pubaphaenops (Genest, 1983), A. laurenti, with a peculiar mor-phology, is grouped in a clade (albeit with low support) with thespecies in the same geographical area, between the Lez and theVicdessos valleys, at the eastern limit of the distribution of Aphaen-ops (Figs. 2 and 3).

In all trees the genera Hydraphaenops and Geotrechus (and thesubgenera Geotrechus and Geotrechidius of the later) were polyphy-letic, with strong support (Fig. 2, Suppl. Fig. 1). The two Aphaenopslineages were sister to some species of Hydraphaenops, while Geo-trechus was split between a paraphyletic basal series and somespecies in a lineage with Hydraphaenops (Fig. 2).

In the analyses of the nuclear sequence we excluded six speci-mens because of missing data (see Suppl. Table 1). The tree ob-tained with Garli with the combined SSU + LSU had the samebasic topology as the combined tree (Suppl. Fig. 2), with a well-supported monophyletic lineage for all subterranean species fromthe Pyrenees, and the polyphyly of all three genera. The main sub-terranean clades found in the combined tree (including the basalparaphyly of species of Geotrechus) were also present with boot-strap values above 70%, although, due to the lower variability ofthe nuclear genes, relationships within the two main clades (Wand E in Figs. 2 and 3) were not recovered.

3.2. Divergence time estimates

We combined the results of the two independent runs of Beast,with a final estimation of the rate at 0.0115 ± 0.0002 substitutions/

site MY. The estimated age of the origin of the subterranean cladewas 9.7MY, with a 95% interval of confidence between 7.6 and12.2MY (Fig. 4). The origin of the main clades (Eastern and Wes-tern), and that of the different lineages within each genus, was esti-mated to be in the Upper Miocene, before the end of the Messinian(Fig. 4). Cladogenetic events within the Pliocene and Pleistocenewere almost exclusively within the same geographical area andinvolving species of the same morphological type (i.e. within lin-eages of each of the traditional genera) (Fig. 4).

4. Discussion

4.1. Origin of the subterranean Pyrenean clade

The most remarkable result of our work was the finding that allthe highly modified species of subterranean Trechini from thePyrenees share a common origin, to the exclusion of all sampledepigean species and all highly modified subterranean species con-sidered by some authors to belong to the phyletic lineage ofAphaenops from other geographical areas (Apoduvalius, Speotrechus,Paraphaenops, Suppl. Table 1). Jeannel (1928) hypothesised a com-mon origin for Aphaenops (plus Hydraphaenops) and Geotrechus,well separated from the epigean Trechus, but included in this sub-terranean ‘‘phyletic series” other genera from outside the Pyrenees.According to our results, these highly modified subterranean spe-cies from nearby areas, or less modified troglobitic species fromthe Pyrenees, were nested within Trechus sensu lato, and not di-rectly related with the subterranean clade. This was the case ofSpeotrechus from the Cevennes (Jeannel, 1922), Apoduvalius fromthe Cantabrian chain (Vives, 1980; although see Faille, 2006 for adifferent view), Paraphaenops from the Iberian system, or the micr-ophthalmous (but not blind) Trechus navaricus from the Pyrenees.Other subterranean genera, such as Duvalius and Agostinia, havetraditionally being considered as part of a distinct lineage (the‘‘Duvalius phyletic lineage”), not directly related to Aphaenops, inagreement with our results (e.g. Jeannel, 1928; Casale et al., 1998).

There are several obvious possible caveats to this conclusion:(1) there could be some un-sampled epigean species which couldbelong to this clade, (2) there could be some un-sampled Pyreneansubterranean species outside this clade (i.e. sharing a most recentcommon ancestor with other epigean species, not with the subter-ranean clade), or (3) there could be some un-sampled non-Pyre-nean subterranean species inside this clade. Based on previousmorphological analyses there are no obvious candidate speciesfor the first two cases, but for the third only the study of potentialcandidates (e.g. Sardaphaenops, Italaphaenops, Allegrettia; Casale

1.0

A_cerberus_MNHN_AF20_AF30

A_mariarosae_MNHN_AF57

H_pecoudi_MNHN_AF72

G_orpheus_MNHN_AF79_AF81

A_jauzioni_MNHN_AF33

A_vandeli_MNHN_AF44

H_elegans_MNHN_AF120

A_alberti_MNHN_AF12

A_tiresias_MNHN_AF59_AF60

A_crypticola_MNHN_AF135

A_rhadamanthus_MNHN_AF13_AF14

G_gallicus_MNHN_AF76H_delicatulus_MNHN_AF66

A_sp_MNHN_AF42

A_parallelus_MNHN_AF53

A_pluto_MNHN_AF58

H_ehlersi_MNHN_AF64

A_leschenaulti_MNHN_AF1

A_abodiensis_MNHN_AF4

H_bourgoini_MNHN_AF68

G_saulcyi_MNHN_AF86

A_jeanneli_MNHN_AF11

A_crypticola_MNHN_AF47

A_loubensi_MNHN_AF3

A_crypticola_MNHN_AF49

H_vasconicus_MNHN_AF65

G_trophonius_MNHN_AF83

A_delbreili_MNHN_AF37A_sp_MNHN_AF133

A_laurenti_MNHN_AF63

H_penacollaradensis_MNHN_AF121

A_vandeli_MNHN_AF45

A_hustachei_MNHN_AF39

A_ludovici_MNHN_AF15

H_galani_MNHN_AF67

G_vulcanus_MNHN_AF91H_pandellei_MNHN_AF70

A_bucephalus_MNHN_AF62

A_cabidochei_MNHN_AF5_AF6

A_catalonicus_MNHN_AF2

H_bourgoini_MNHN_AF69

A_ochsi_MNHN_AF7_AF8

1.21.2

6.016.01

4.014.01

3.543.54

1.161.16

0.20.2

7.697.69

3.263.26

7.267.26

3.353.354.244.24

1.051.05

9.699.69

0.730.73

2.12.1

6.286.28

6.296.29

0.860.86

2.022.02

8.418.41

2.62.65.195.19

1.551.55

3.053.05

3.713.71

4.764.76

4.334.33

5.825.82

7.937.93

7.77.7

1.451.45

0.270.27

0.670.67

2.42.4 1.811.81

6.736.73

0.330.33

W

E

[0.05,0.38][0.12,0.57]

[0.07,0.51]

[0.39,1.11]

[0.72,1.75]

[1.17,2.51]

[1.66,3.2]

[0.84,3.32]

[2.4,4.16]

[0.72,2.51][2.3,4.38]

[3.06,4.95]

[0.14,1.37][1.25,4.07]

[3.26,5.22]

[0.29,1.98]

[4.02,6.4]

[2.99,6.47]

[0.81,3.39]

[5.47,8.13]

[0.84,6.96]

[6.28,9.16]

[0.25,1.64]

[2.27,5.23]

[0.35,2.11]

[0.52,2.53]

[4.59,7.07]

[5.07,7.52]

[2.27,6.12]

[4.3,8.12]

[5.97,8.6]

[4.1,7.78]

[0,7.35][5.12,10.12]

[6.65,9.25]

[7.11,9.83]

[7.62,12.25]

Fig. 4. Ultrametric tree of the Phylogeny of subterranean Trechini of the Pyrenees obtained with Beast, using a standard mitochondrial rate (0.0115 substitutions/site/MY).Number above nodes, estimated age (in MY); numbers below nodes, 95% confidence intervals.

A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 103

and Laneyrie, 1982) can establish their phylogenetic relationshipswith certain confidence.

The sister lineage of the subterranean clade was not well-de-fined in our analyses, as support for the basal nodes of the lineageincluding Trechus and related (mostly subterranean) genera waslow. What seems clear from our analyses is that, under its currentconcept, Trechus, with more than 440 species distributed in thenorthern Hemisphere and the mountains of sub-Saharan Africa(Casale and Laneyrie, 1982), includes epigean or weakly modifiedsubterranean species with a plesiomorphic morphology, forminga largely paraphyletic series with numerous genera of highly mod-ified species nested within. A thorough taxonomic revision of Tre-chus sensu lato (including the Pyrenean subterranean taxa) wouldbe highly desirable, but impossible until a more comprehensivephylogeny is available.

The monophyly of all the highly modified subterranean speciesof the Pyrenees strongly suggests a single origin of their shared

character states: loss of eyes, apterism, depigmented body, a sub-terranean life, and a requirement for high levels of humidity (e.g.Jeannel, 1926a; Vannier and Thibaud, 1971). These are also traitsthat have been linked with a reduced dispersal ability (Kaneet al., 1992; Barr and Holsinger, 1985; Caccone, 1985), and thusrun against the interpretation of a single origin of subterraneanadaptations with subsequent diversification over a relatively largegeographical area (ca. 360 km, from the Puigmal massif, Geotrechuspuigmalensis Lagar, 1981, to Guipuzcoa, Hydraphaenops galaniEspañol, 1968). The traditional solution to this dilemma was theassumption that there have been multiple independent active col-onisations of the subterranean environment restricted to a verylimited geographical area, each derived from different epigeanancestors and with a secondary reduction of gene flow (the ‘‘adap-tive shift hypothesis”, Howarth, 1982; Peck and Finston, 1993;Chapman, 1993; Desutter-Grandcolas and Grandcolas, 1996; Rive-ra et al., 2002).

104 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106

Under this scenario, one would expect to find multiple in-stances of species with ‘‘intermediate” morphologies (e.g. partlydepigmented bodies, reduced eyes) interspersed among the highlymodified or epigean ones. Although still based on a limited numberof species, this seems to be the case for the Cantabrian chain, withspecies of Apoduvalius intermixed with epigean Trechus (Fig. 2),and also of the Trechus radiation in the Canary islands, where thesubterranean species of the archipelago are closely related to theepigean species from the same geographical area (Contreras-Díazet al., 2007; Borges et al., 2007). Recent molecular work on othercave-dwelling species also suggests frequent multiple colonisa-tions of the subterranean environment in the same geographic area(Crustacean isopods, Rivera et al., 2002; Amphipods, Fišer et al.,2008).

In our case, this interpretation would require the completeextinction of all species with intermediate morphologies whichcould be included in the Pyrenean subterranean clade. This hasbeen hypothesised for areas subjected to strong fluctuating cli-mate, in particular in areas subjected to dry periods which couldresult in the extinction of epigean hygrophilous species: the ‘‘cli-matic relict hypothesis” of Jeannel (1943) and Peck and Finston(1993). According to our estimations based on a standard mito-chondrial rate, the origin of the Pyrenean subterranean cladewould be mid-late Miocene, a time in when the general climatein the area seems to have been warmer and wetter than today,with extensive forested areas (Bruch et al., 2007; Jiménez-Morenoand Suc, 2007). A possible dry period producing this generalisedextinction, and the separation between the main Eastern and Wes-tern clades, could have been the Messinian salinity crisis at theMiocene–Pliocene boundary, although recent data suggest thatthe vegetation of the north Mediterranean area may not have beendeeply affected (e.g. Bertini, 2006). In any case, it must be stressedthat these dates are based on a fixed rate estimated from a combi-nation of genes in several arthropod groups (0.0115 substitutions/site/MY, Brower, 1994), and thus have to be considered as merelyorientative. The only estimate of mitochondrial evolutionary rateof a closely related group (0.015 substitutions/site/MY for thegenus Trechus) is based on the colonisation of the Canary islands,(Contreras-Díaz et al., 2007). As already noted, this was based ona combination of cox1 and cox2, known to have faster rates thanribosomal genes, and thus not directly applicable to our dataset.

4.2. Diversification of the subterranean Pyrenean clade

Within the subterranean Pyrenean clade, the three currentlyrecognised genera (Aphaenops, Hydraphaenops and Geotrechus)were found to be polyphyletic. These genera were originally de-fined according to their general body shape, especially the headand elytra (Jeannel, 1926b; Coiffait, 1962; see Section 2 above).These are likely to be characters reflecting different adaptationsto the subterranean environment: even if most species are onlyknown from caves, species of Geotrechus are mostly endogean, liv-ing in deep humid soil, while species of Aphaenops live in moreopen subterranean spaces, such as caves or the interstices of theMSS (Jeannel, 1926b; Juberthie and Bouillon, 1983). A particularlyinteresting case is the apparently highly specialised habit of mostof the species of the genus Hydraphaenops, which seem to live inthe cracks of karstic massifs and are only occasionally found incaves. They have a cylindrical head and long and sickled mandibles,likely to be adapted to an unknown prey (Jeannel, 1926b; Deleu-rance-Glaçon, 1963). According to our results, it seems that thegeneral body shape is associated with the particular ecologicaland physical conditions of the subterranean environment colon-ised by these species, with a high degree of homoplasy and conver-gence (Marquès and Gnaspini, 2001; Fišer et al., 2008).

The main lineages within the subterranean clade seem to begeographically well differentiated, with successive splits betweenthe eastern and western Pyrenees resulting in several geographi-cally well-defined clades (Fig. 3). Relationships among closely re-lated species reflect geographical proximity more than generalmorphological similarities, with morphologically highly divergentspecies found in close proximity, as found for other subterraneanorganisms (Fišer et al., 2008). This is for example the case ofHydraphaenops pandellei and Geotrechus gallicus, of very differentmorphology and ecology, or Aphaenops jeanneli and A. alberti. Thelatter (Fig. 1) is a very distinct and scarce species endemic to theArbailles massif, in the western Pyrenees, previously assumed tobe related to some species from the Eastern clade (Cerbaphaenopssensu lato), such as A. bucephalus (Jeannel, 1939; Coiffait, 1962)or A. pluto (Jeanne, 1967). It occurs in the same caves with A. jean-neli, to which it is closely related according to our molecular datadespite its very different body shape, suggesting an ecologicaldifferentiation.

On the other hand, species that were previously considered tobe closely related based on their general appearance, but occurringin different geographical areas, were found to be included in theirlocal clades. Thus, the species of the subgenera Arachnaphaenops(A. pluto, A. tiresias and A. alberti), with a very similar appearance,were included in three different clades with other Aphaenops spe-cies according to their distributions. Similarly, according to our re-sults what is currently considered as Aphaenops crypticola,distributed from caves between Haute-Garonne and Hautes-Pyré-nées, would be polyphyletic. The populations of the western partof the range (Aure valley, Mont Né) are very close to A. crypticolaaeacus and A. hustachei from the same area, while populations fromthe eastern part are subdivided in two groups delimited by theGaronne valley: a western (A. crypticola MNHN-51 and 48) andan eastern group (A. crypticola MNHN-47, 49, 52, 136). Due tothe lack of resolution of the nuclear data (Suppl. Fig. 2) it is not pos-sible to discard the possibility of local introgression among some ofthese closely related species, but there is no evidence of incongru-ence between the nuclear and mitochondrial genomes in any of thelineages for which there is enough resolution, contrary to whathappens in other groups of Carabidae, in which introgressionthrough hybridisation is common (e.g. Sota and Vogler, 2001; Deu-ve, 2004; Streiff et al., 2005; Zhang and Sota, 2007). A re-examina-tion of the morphology of the different populations of A. crypticolain the light of our results revealed differences in the shape of theaedeagus and some male secondary sexual characters consistentwith this geographical split (Faille, 2006).

We found clear differences in the pattern of diversification be-tween the Western and Eastern clades. The Western clade, be-tween Bagnères-de-Bigorre and the Arbailles massif (clade W,Aphaenops s.str. plus A. (Arachnaphaenops) alberti and Geaphaen-ops), seems to be the oldest lineage of troglobitic species, with anestimated Late Miocene basal diversification (Fig. 4). Some of thespecies within this group have secondarily developed endogeanhabits, with a reverse to a more stout (i.e. less ‘‘aphaenopsian”)body shape (A. ludovici, A. rhadamanthus). They were included inthe subgenus Geaphaenops by Cabidoche (1965), together withother endogean species of more uncertain relationships not in-cluded in our study (A. linderi Jeannel, 1938, A. rebereti Gaudin,1947, and also A. cissauguensis Faille and Bourdeau, 2008).

The main clade of the Eastern Pyrenees, between Bagneres-de-Bigorre and the Ariege River (Cerbaphaenops plus the morphologi-cally distinct species A. laurenti, A. bucephalus, A. chappuisi, A. plutoand A. tiresias), seems to be of more recent origin, with a Pliocene–Pleistocene diversification (Fig. 4) and species with a more homo-geneous morphology (Coiffait, 1962). The sampling of this cladewas complete, with two exceptions: (1) A. bourdeaui Coiffait,1976, considered as part of Cerbaphaenops despite being found in

A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106 105

the area of distribution of the W clade. It is only known from twofemales collected the same day (Coiffait, 1976), but never foundagain despite numerous visits to the cave. The lack of males andits geographical distribution cast doubts about its affinities, whichcould only be solved with molecular data. (2) A. hidalgoi Españoland Comas, 1985, also from the W Pyrenees. It was described asCerbaphaenops (Español and Comas, 1985), but it is a Hydraphaen-ops-like species, apparently close to H. penacolladarensis—which isfound in the same geographical area (Faille, unpublished observa-tions). The Western and Eastern clades overlap in the Bigorre area,where one species of each group occur sympatrically in a fewcaves: Aphaenops leschenaulti (Eastern clade) and Aphaenops crypti-cola aeacus (Western clade) (Fresneda et al., 2009).

A potential explanation for the differences between the easternand western lineages of Pyrenean subterranean Trechini could bethe different pattern of the limestone areas in which they arefound. In the west, areas of suitable karstified habitat tend to belarger and more homogeneous, frequently with continuous patchesof ca. 150 km2 (e.g. the Arbailles massif, Vanara, 2000). On the con-trary, in the Eastern Pyrenees karstified limestone is highly frag-mented, opening opportunities for the development of multipleisolated local populations leading to allopatric speciation (Culver,1970; Crouau-Roy, 1986; Faille and Déliot, 2007).

Acknowledgments

We wish to thank J.P. Besson, F. Brehier, E. Dupré, F. Fadrique, J.Fresneda, G. Jauzion, J.M. Salgado, E. Ollivier, J. Raingeard,C. Vanderbergh and all the collectors mentioned in the Suppl. Table1 for their help during field work, the members of the GroupeSpéléologique du Couserans and Groupe Spéléologique Minos,without whom visiting some particularly difficult cavities wouldhave been impossible, G. Kergoat for the primer cp1, U. Schmidt(http://www.kaefer-der-welt.de/) for the photo of T. quadristriatus,A. Hassanin for help during the PhD of A.F., A. Cieslak, J. Fresneda,A. Casale for multiple discussions on the evolution of the subterra-nean beetles, D.T. Bilton for reading the manuscript, and threeanonymous referees for useful comments on previous versions ofour work. A.F. and C.B. thank the Subterranean laboratory of Moulis(currently Station d’écologie expérimentale du CNRS) for supportduring field work. This study was funded in part by the projectSynthesys (ES-TAF-1540) to A.F. and I.R., the Société Entomologi-que de France (grants ‘‘Germaine Cousin”) to A.F., and the SpanishMICINN project CGL2007-61665 to I.R. We dedicate this work toPhilippe Déliot, recently disappeared, without whom collectingall the species necessary to this study could not have beenpossible.

Appendix A

Bonvouloir (1862) described the genus Aphoenops for a speciescollected in a cave of the central French Pyrenees, A. leschenaultiBonvouloir, 1862. Subsequently, the genus name was written asAphaenops by Grenier (1864), and this has been the spelling usedafterwards by all authors with the only exception of Abeille de Per-rin (1872), Bedel and Simon (1875) and Peyerimhoff (1915). Re-cently Moravec et al. (2003) resurrected the original graphyAphoenops, which has been subsequently used by Lorenz (2005)and some other authors. An opinion to the ICZN is in preparationto conserve Aphaenops, based on the acceptance by the ICZN ofthe equivalence of oe and ae for species-level names (not specifiedfor genus-level names), and the prevalence of use for near 150years, with hundreds of examples of the use of Aphaenops and vir-tually no use of Aphoenops.

Appendix B. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.ympev.2009.10.008.

References

Abeille de Perrin, E., 1872. Etudes sur les Coléoptères cavernicoles suivies de ladescription de 27 Coléoptères nouveaux français. Marius Olive, Marseille, 41 p.

Barr, T.C., 1979. The taxonomy, distribution, and affinities of Neaphaenops, withnotes on associated species of Pseudanophthalmus (Coleoptera, Carabidae). Am.Mus. Novit. 2682, 1–20.

Barr, T.C., Holsinger, J.R., 1985. Speciation in cave faunas. Ann. Rev. Ecol. Syst. 16,313–337.

Bedel, L., Simon, E., 1875. Liste générale des Articulés Cavernicoles de l’Europe. P.Gervais, Paris, IV, pp. 1–69.

Bertini, A., 2006. The Northern Apennines palynological record as a contribute forthe reconstruction of the Messinian palaeoenvironments. Sedim. Geol. 188–189, 235–258.

Blin, N., Stafford, D.W., 1976. A general method for isolation of high molecularweight DNA from Eucaryots. Nucleic Acids Res. 3, 2303.

Bonvouloir, H. de, 1862. Description d’un genre nouveau et de deux espèces nouvellesde coléoptères de France. Ann. Soc. Entomol. Fr. 4 (1), 567–571 (1861).

Borges, P.A.V., Oromí, P., Serrano, A.R.M., Amorim, I.R., Pereira, F., 2007. Biodiversitypatterns of cavernicolous ground-beetles and their conservation status in theAzores, with the description of a new species: Trechus isabelae n. sp.(Coleoptera: Carabidae: Trechinae). Zootaxa 1478, 21–31.

Brower, A.V.Z., 1994. Rapid morphological radiation and convergence among racesof the butterfly Heliconius erato inferred from patterns of mitochondrial DNAevolution. Proc. Natl. Acad. Sci. USA 91, 6491–6495.

Bruch, A.A., Uhl, D., Mosbrugger, V., 2007. Miocene climate in Europe—Patterns andevolution. A first synthesis of NECLIME. Palaeogeog. Palaeoclim. Palaeoecol.253, 1–7.

Cabidoche, M., 1965. Sur les Aphaenops du groupe rhadamanthus (Col. Carab.). Ann.Spéléol. 20 (4), 523–528.

Cabidoche, M., 1966. Contribution à la connaissance de l’écologie des Trechinaecavernicoles pyrénéens. Unpublished thesis. Paris, 228 pp.

Caccone, A., 1985. Gene flow in cave arthropods: a qualitative and quantitativeapproach. Evolution 39, 1223–1234.

Casale, A., 2004. Two new hypogean beetles from Sardinia, Sardaphaenops adelphusn. sp. (Coleoptera Carabidae) and Patriziella muceddai n. sp. (ColeopteraCholevidae) and their biogeographical significance. Boll. Soc. Entomol. Ital.136 (1), 3–31.

Casale, A., Laneyrie, R., 1982. Trechodinae et Trechinae du monde. Tableau des sous-familles, tribus, séries phylétiques, genres, et catalogue général des espèces.Mém. Biospéol. 9, 1–226.

Casale, A., Vigna Taglianti, A., Juberthie, C., 1998. Coleoptera Carabidae. In:Juberthie, C., Decu, V. (Eds.), Encyclopaedia Biospeologica, tome II. SociétéInternationale de Biospéologie. Moulis, France, pp. 1047–1081.

Chapman, P., 1993. Caves and Cave Life. Harper Collins, London. pp. 1–224.Coiffait, H., 1962. Monographie des Trechinae cavernicoles des Pyrénées. Ann.

Spéléol. 17 (1), 119–170.Coiffait, H., 1976. Aphaenops (Cerbaphaenops) bourdeaui, nouvelle espèce des

Pyrénées Atlantiques. Nouv. Rev. Entomol. 6 (3), 247–248.Contreras-Díaz, H.G., Moya, O., Oromí, P., Juan, C., 2007. Evolution and

diversification of the forest and hypogean ground-beetle genus Trechus in theCanary Islands. Mol. Phylogenet. Evol. 42, 687–699.

Crouau-Roy, B., 1986. Population studies on pyrenean troglobitic beetles: localgenetic differentiation and microgeographic variations in natural populations.Biochem. Syst. Ecol. 14 (5), 521–526.

Culver, D.C., 1970. Analysis of simple cave communities. I. Caves as islands.Evolution 24, 463–474.

Culver, D.C., Kane, T.C., Fong, D.W., Jones, R., Taylor, M.A., Sauereisen, S.C., 1990.Morphology of cave organisms—is it adaptative? Mém. Biospéol. 17, 13–26.

Culver, D.C., Deharveng, L., Bedos, A., Lewis, J.J., Madden, M., Reddell, J.R., Sket, B.,Trontelj, P., White, D., 2006. The mid-latitude biodiversity ridge in terrestrialcave fauna. Ecography 29, 120–128.

Deleurance, S., 1958. La contraction du cycle évolutif des Coléoptères Bathysciinaeet Trechinae en milieu souterrain. C. R. Séances Acad. Sci. 247, 752–753.

Deleurance-Glaçon, S., 1963. Contribution à l’étude des coléoptères cavernicoles dela sous-famille des Trechinae. Ann. Spéléol. 18 (2), 227–265.

Desutter-Grandcolas, L., Grandcolas, P., 1996. The evolution toward troglobitic life:a phylogenetic reappraisal of climatic relict and local habitat shift hypotheses.Mém. Biospéol. 23, 57–63.

Desutter-Grandcolas, L., D’Haese, C., Robillard, T., 2003. The problem of characterssusceptible to parallel evolution in phylogenetic reconstructions: a reply toMarquès & Gnaspini (2001) with emphasis on cave life phenotypic evolution.Cladistics 19, 131–137.

Deuve, T., 2000. Nouveaux Trechidae cavernicoles chinois, découverts dans lesconfins karstiques du Sichuan, du Hubei et du Yunnan (Coleoptera, Adephaga).Rev. Fr. Entomol. (n.s.) 21, 151–161.

Deuve, T., 2001. Le genre Eustra Schmidt-Goebel, 1846, insectes (Coleoptera,Paussidae, Ozaeninae) à genitalia femelles orthotopiques. Zoosystema 23 (3),547–578.

106 A. Faille et al. / Molecular Phylogenetics and Evolution 54 (2010) 97–106

Deuve, T., 2004. Illustrated catalogue of the genus Carabus of the world (Coleoptera:Carabidae). Pensoft Publ., Sofia, Moscow, x + 461 pp.

Drummond, A.J., Rambaut, A., 2007. BEAST: Bayesian evolutionary analysis bysampling trees. BMC Evol. Biol. 7, 214.

Drummond, A.J., Ho, S.Y.W., Phillips, M.J., Rambaut, A., 2006. Relaxed phylogeneticsand dating with confidence. PLoS Biol. 4 (5), e88. doi:10.1371/journal.pbio.0040088.

Dupré, E., 1991. Trechini nouveaux ou peu connus de France et d’Espagne(Coléoptères Carabidae). Mém. Biospéol. 18, 287–299.

Español, F., 1968. Un nuevo Hydraphaenops de la provincia de Guipúzcoa (Col.Trechidae). Misc. Zool. 2 (3), 55–58.

Español, F., Comas, J., 1985. Un nuevo Aphaenops Bonv. de la vertiente española delos Pirineos (Col., Carabidae, Trechinae). Misc. Zool. 9, 219–221.

Faille, A., 2006. Endémisme et adaptation à la vie cavernicole chez les TrechinaePyrénéens (Coleoptera: Carabidae). Approches moléculaire et morphométrique.Unpublished thesis. Muséum National d’Histoire Naturelle, Paris, 319 pp.

Faille, A., Déliot, P., Quéinnec, E., 2007. A new cryptic species of Aphaenops(Coleoptera: Carabidae: Trechinae) from a French Pyrenean cave: congruencebetween morphometrical and geographical data confirm species isolation. Ann.Soc. Entomol. Fr. (n.s.) 43 (3), 363–370.

Faille, A., Fresneda, J., Déliot, P., Bourdeau, C., 2006. Description du mâled’Aphaenops catalonicus Escolà & Canció (Coleoptera, Trechinae). Bull. Soc.Entomol. Fr. 111 (2), 247–250.

Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using thebootstrap. Evolution 39, 783–791.

Fišer, C., Sket, B., Trontelj, P., 2008. A phylogenetic perspective on 160 years oftroubled taxonomy of Niphargus (Crustacea: Amphipoda). Zool. Script. 37 (6),665–680.

Fresneda, J., Salgado, J.M., Ribera, I., 2007. Phylogeny of western MediterraneanLeptodirini, with an emphasis on genital characters (Coleoptera: Leiodidae:Cholevinae). Syst. Entomol. 32, 332–358.

Fresneda, J., Bourdeau, C., Faille, A., 2009. Baronniesia delioti gen. n. sp. n., a newsubterranean Leptodirini from the French Pyrenees (Coleoptera: Leiodidae:Cholevinae). Zootaxa 1993, 1–16.

Genest, L.C., 1983. Nouvelles espèces d’Aphaenops et d’Hydraphaenops des PyrénéesCentrales (Coléoptères Trechinae). Mém. Biospéol. 10, 305–310.

Gilbert, M.T.P., Moore, W., Melchior, L., Worobey, M., 2007. DNA extraction from drymuseum beetles without conferring external morphological damage. PLoS ONE2 (3), e272. doi:10.1371/journal.pone.0000272.

Grebennikov, V.V., 2008. Tasmanitachoides belongs to Trechini (Coleoptera:Carabidae): discovery of the larva, its phylogenetic implications and revisedkey to Trechitae genera. Invertebr. Syst. 22, 479–488.

Grebennikov, V.V., Maddison, D.R., 2005. Phylogenetic analysis of Trechitae(Coleoptera: Carabidae) based on larval morphology, with description of first-instar Phrypeus and a key to genera. Syst. Entomol. 30, 38–59.

Grenier, A., 1864. Description de nouvelles espèces de Coléoptères Français desgenres Cionus, Raymondia et Anophthalmus et quelques réflexions sur les yeuxde certaines espèces réputées aveugles. Ann. Soc. Entomol. Fr. 33, 133–140.

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor andanalysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.

Howarth, F.G., 1982. Bioclimatic and geologic factors governing the evolution anddistribution of Hawaiian cave insects. Entomol. Gen. 8 (1), 17–26.

Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: bayesian inference of phylogenetictrees. Bioinformatics 17, 754–755.

Jeanne, C., 1967. Carabiques de la péninsule ibérique (5ème note). Actes Soc. Linn.Bordeaux, Sér. A 10 (104), 1–22.

Jeannel, R., 1919. Diagnoses préliminaires de Trechinae [Col. Carabidae]cavernicoles nouveaux de France. Bull. Soc. Entomol. Fr., 253–255.

Jeannel, R., 1922. Les Trechinae de France (Deuxième partie). Ann. Soc. Entomol. Fr.90, 295–345 (1921).

Jeannel, R., 1926a. Faune cavernicole de la France avec une étude des conditionsd’existence dans le domaine souterrain. Lechevalier, Paris. 334 pp.

Jeannel, R., 1926b. Monographie des Trechinae. Morphologie comparée etdistribution d’un groupe de Coléoptères. L’Abeille 32, 221–550.

Jeannel, R., 1928. Monographie des Trechinae. Morphologie comparée etdistribution d’un groupe de Coléoptères. Troisième Livraison: les Trechinicavernicoles. L’Abeille 35, 1–808.

Jeannel, R., 1939. Un nouvel Aphaenops de la grotte d’Oxibar. Rev. Fr. Entomol. 6 (3–4), 83–85.

Jeannel, R., 1941. Faune de France. Coléoptères Carabiques I, vol. 39. Lechevalier,Paris. 571 pp.

Jeannel, R., 1943. Les fossiles vivants des cavernes. Gallimard, Paris. 321 pp.Jiménez-Moreno, G., Suc, J.P., 2007. Middle Miocene latitudinal climatic gradient in

Western Europe: evidence from pollen records. Palaeogeog. Palaeoclim.Palaeoecol. 253, 208–225.

Juberthie, C., Bouillon, M., 1983. Présence des Aphaenops (Coléoptères Trechinae) dansle milieu souterrain superficiel des Pyrénées françaises. Mém. Biospéol. 10, 91–98.

Kane, T.C., Barr Jr., T.C., Badaracca, W.J., 1992. Cave beetle genetics: geology andgene flow. Heredity 68, 277–286.

Katoh, K., Toh, H., 2008. Recent developments in the MAFFT multiple sequencealignment program. Brief. Bioinform. 9 (4), 286–298.

Katoh, K., Misawa, K., Kuma, K., Miyata, T., 2002. MAFFT: a novel method for rapidmultiple sequence alignment based on fast Fourier transform. Nucleic AcidsRes. 30 (14), 3059–3066.

Laurenti, J.N., 1768. Specimen Medicum, Exhibens Synopsin Reptilium EmendatamCum Experimentis Circa Venena et Antidota Reptilium Austriacorum. Wien. 214 pp.

Lorenz, W., 2005. A Systematic List of Extant Ground Beetles of the World.(Coleoptera ‘‘Geadephaga”: Trachypachidae and Carabidae incl. Paussinae,Cicindelinae, Rhysodinae), second ed. Tutzing, Germany. 530p..

Marquès, A.C., Gnaspini, P., 2001. The problem of characters susceptible to parallelevolution in phylogenetic reconstructions: suggestion of a practical method andits application to cave animals. Cladistics 17, 371–381.

Monteiro, A., Pierce, N.E., 2001. Phylogeny of Bicyclus (Lepidoptera: Nymphalidae)inferred from COI, COII, and Ef-1a gene sequences. Mol. Phylogenet. Evol. 18,264–281.

Moravec, P., Uéno, S.-I., Belousov, I.A., 2003. Tribe Trechini. In: Löbl, Smetana (Eds.),Catalogue of Palaearctic Coleoptera, Archostemata, Myxophaga, Adephaga, vol.1. Apollo Books, Stenstrup, pp. 288–346

Ober, K.A., 2002. Phylogenetic relationships of the carabid subfamily Harpalinae(Coleoptera) based on molecular sequence data. Mol. Phylogenet. Evol. 24, 228–248.

Ortuño, V.M., Sendra, A., Montagud, S., Teruel, S., 2004. Systématique et biologied’une espèce paléoendémique hypogée de la péninsule Ibérique: Ildobatesneboti Español 1966 (Coleoptera: Carabidae: Dryptinae). Ann. Soc. Entomol. Fr.(n.s.) 40 (3–4), 459–475.

Peck, S.B., Finston, T.L., 1993. Galapagos islands troglobites: the question of tropicaltroglobites, parapatric distributions with eyed sister-species, and their origin byparapatric speciation. Mém. Biospéol. 20, 19–37.

Peyerimhoff, P. de, 1915. Variations de contours et de la chétotaxie chez Trechus(Trechopsis) lapiei Peyer.; démonstration de sa parente phylogénique avecAphoenops iblis Peyer. Bull. Soc. Entomol. Fr., 128–133.

Pons, J., 2006. DNA-based identification of preys from non-destructive, total DNAextractions of predators using arthropod universal primers. Mol. Ecol. Notes 6,623–626.

Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution.Bioinformatics 14 (9), 817–818.

Putzeys, J., 1870. Trechorum oculatorum Monographia. Stett. Entomol. Zeit. 31 (1–3), 7–48. 145–201.

Racovitza, E.G., 1907. Essai sur les problèmes biospéologiques. Arch. Zool. Exp. Gén.6 (4ème sér.), 371–488.

Ribera, I., Hernando, C., Aguilera, P., 2001. Agabus alexandrae n.sp. from Morocco,with a molecular phylogeny of the western Mediterranean species of the A.guttatus group (Coleoptera: Dytiscidae). Ins. Syst. Evol. 32, 253–262.

Rivera, M.A.J., Howarth, F.G., Taiti, S., Roderick, G.K., 2002. Evolution in Hawaiiancave-adapted isopods (Oniscidea: Philosciidae): vicariant speciation or adaptiveshifts? Mol. Phylogenet. Evol. 25, 1–9.

Roncin, E., Deharveng, L., 2003. Leptogenys khammouanensis sp. nov. (Hymenoptera:Formicidae). A possible troglobitic species of Laos, with a discussion on caveants. Zool. Sci. 20, 919–924.

Rowley, D.L., Coddington, J.A., Gates, M.W., Norrbom, A.L., Ochoa, R.A., Vandenberg,N.J., Greenstone, M.H., 2007. Vouchering DNA-barcoded specimens: test of anondestructive extraction protocol for terrestrial arthropods. Mol. Ecol. Notes 7,915–925.

Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods withapplications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116.

Shull, V.L., Vogler, A.P., Baker, M.D., Maddison, D.R., Hammond, P.M., 2001. Sequencealignment of 18S Ribosomal RNA and the basal relationships of Adephaganbeetles: evidence for monophyly of aquatic families and the placement ofTrachypachidae. Syst. Biol. 50, 945–969.

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution,weighting and phylogenetic utility of mitochondrial gene sequences and acompilation of conserved polymerase chain reaction primers. Ann. Entomol.Soc. Am. 87, 651–701.

Sota, T., Vogler, A.P., 2001. Incongruence of mitochondrial and nuclear gene trees inthe Carabid beetles Ohomopterus. Syst. Biol. 50, 39–59.

Streiff, R., Veyrier, R., Audiot, P., Meusnier, S., Brouat, C., 2005. Introgression innatural populations of bioindicators: a case study of Carabus splendens andCarabus punctatoauratus. Mol. Ecol. 14, 3775–3786.

Swofford, D.L., 2002. PAUP*: Phylogenetic Analysis Using Parsimony (� and OtherMethods) Version 4. Sinauer Associates, Sunderland, MA.

Templeton, A.R., 1983. Phylogenetic inference from restriction endonucleasecleavage site maps with particular reference to the evolution of man and theapes. Evolution 37, 221–224.

Uéno, S.I., Clarke, A.K., 2007. Discovery of a new aphaenopsoid Trechine Beetle(Coleoptera, Trechinae) in northeastern Jiangxi, East China. Elytra, Tokyo 35 (1),267–278.

Vanara, N., 2000. Le karst des Arbailles (Pyrénées-Atlantiques, France). Karstologia36, 23–42.

Vandel, A., 1964. Biospéologie. La Biologie des Animaux Cavernicoles. Gauthier-Villars, Paris. 619 pp.

Vannier, G., Thibaud, J.M., 1971. Relation entre l’activité motrice d’une espèce deCollemboles cavernicoles et les variations de température dans son biotope.Rev. Ecol. Biol. Sol. 8 (2), 261–286.

Vives, E., 1980. Revision del género Apoduvalius Jeannel (Col. Trechinae). Speleon 25,15–21.

Zhang, A.-B., Sota, T., 2007. Nuclear gene sequences resolve species phylogeny andmitchondrial introgression in Leptocarabus beetles showing trans-speciespolymorphisms. Mol. Phylogenet. Evol. 45, 534–546.

Zwickl, D.J., 2006. Genetic algorithm approaches for the phylogenetic analysis oflarge biological sequence datasets under the maximum likelihood criterion.Ph.D. dissertation. The University of Texas at Austin. Available from:<www.bio.utexas.edu/faculty/antisense/garli/Garli.html>.

Supplementary Fig. 1. Phylogeny of subterranean Trechini of the Pyrenees obtained with parsimony in PAUP, using the combined data matrix. Number in nodes, bootstrap values (if above 50%). “Western” and “Eastern” clades marked with “W” and “E”, respectively (see text).

Supplementary Fig. 2: Phylogeny of subterranean Trechini of the Pyrenees obtained with maximum likelihood in Garli, using only the nuclear sequences (LSU+SSU). Number in nodes, bootstrap values (if above 50%). “Western” clade marked with “W”; “E+” Eastern clade plus some additional species (see text).

Suppl. Table 1. Sequenced specimens, with locality, collectors, sequence accession numbers and ecology (T: troglobitic, E: endogean, Ep: Epigean). Code of specimens used to build composite sequences marked with stars.

No sp locality collector biology code SSU LSU cox1 rrnL tRNA-Leu nad1 cyb1 Trechini2 Aphaenops Bonvouloir, 18623 Aphaenops Bonvouloir, 1862 (sensu stricto)4 Aphaenops leschenaulti Bonvouloir, 1861 Grotte de Castelmouly - Bagnères-de-Bigorre (France-65) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF1 GQ293593 GQ293629 GQ293739 GQ293757 GQ293822 GQ2938865 Aphaenops catalonicus Escolà & Canció, 1983 Cova des Toscllosses - Bonansa (Spain-Huesca) C. Bourdeau, P. Déliot, J. Fresneda T MNHN-AF2 GQ293508 GQ293674 GQ293699 GQ293756 GQ2938216 Aphaenops loubensi Jeannel, 1953 Salle de la Verna - Sainte-Engrâce (France-64) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF3 GQ293660 GQ2938637 Aphaenops abodiensis Dupré, 1988 Villanueva de Aezkoa - Sierra de Abodi - P70 (Spain-Navarra) C. Bourdeau, A. Faille, E. Quéinnec T MNHN-AF4 GQ293555 GQ293627 GQ2938628 Aphaenops bessoni Cabidoche, 1961 Gouffre du Col d’Aran 3 - Bielle (France-64) C. Bourdeau, E. Ollivier T MNHN-AF122 GQ2935549 Aphaenops cabidochei Coiffait, 1959 Salle de la Verna - Sainte-Engrâce (France-64) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF5* GQ293556 GQ293667 GQ293890

10 Villanueva de Aezkoa - Sierra de Abodi - P70 (Spain-Navarra) C. Bourdeau, A. Faille, E. Quéinnec T MNHN-AF6* GQ293520 GQ293741 GQ293778 GQ29383111 Aphaenops ochsi Gaudin, 1925 Grotte d’Ayssaguer - Larrau (France-64) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF7* GQ293666 GQ29389212 Sima de Garralda - P10 (Spain-Navarra) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF8* GQ293521 GQ293601 GQ293740 GQ293777 GQ29383013 Aphaenops jeanneli (Abeille de Perrin, 1905) Aven d’Istaurdy - Aussurucq (France-64) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF11 GQ293594 GQ293661 GQ29389114 Aphaenops orionis Fagniez, 1913 Mine de Larrey - Montory (France-64) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF10* GQ293664 GQ29388515 Gouffre EL71 - Château-Pignon (France-64) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF9* GQ293507 GQ29359216 Geaphaenops Cabidoche, 196617 Aphaenops rhadamanthus (Linder, 1860) Doline de la Sablère - Castet (France-64) C. Bourdeau E MNHN-AF14* GQ293677 GQ293717 GQ293776 GQ293827 GQ29389518 Aven de Nabails - Arthez d'Asson (France-64) C. Bourdeau, P. Déliot, A. Faille E MNHN-AF13* GQ29350619 Aphaenops ludovici Colas & Gaudin, 1935 Grotte d’Ambielle - Arette (France-64) C. Bourdeau, P. Déliot, A. Faille E MNHN-AF15* GQ293550 GQ293676 GQ293716 GQ293775 GQ293828 GQ29389620 Cerbaphaenops Coiffait, 196221 Aphaenops cerberus (Dieck, 1869) Grotte du Sendé - Moulis (France-09) P. Déliot, A. Faille T MNHN-AF30* GQ293589 GQ293646 GQ293718 GQ293779 GQ293835 GQ29387122 Grotte de L'Estelas - Cazavet (France-09) P. Déliot, A. Faille T MNHN-AF20* GQ29352623 Aphaenops jauzioni Faille, Déliot & Quéinnec, 2007 Grotte d’Artigouli - Estadens (France-31) P. Déliot, A. Faille T MNHN-AF33 GQ293581 GQ293640 GQ29387724 Aphaenops carrerei Coiffait, 1953 Gouffre du Trapech d’en Haut - Bordes-sur-Lez (France-09) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF34 GQ293512 GQ293572 GQ29364125 Aphaenops michaeli Fourès, 1954 Grotte de Noël - Seix (France-09) A. Faille T MNHN-AF35 GQ293515 GQ293585 GQ293722 GQ293768 GQ29381526 Aphaenops delbreili Genest, 1983 Gouffre du Petit Mirabat - Ercé (France-09) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF37 GQ293513 GQ293570 GQ293638 GQ293720 GQ293773 GQ29380427 Aphaenops bonneti Fourès, 1948 Trou du Rantou - Suc-et-Sentenac (France-09) P. Déliot, A. Faille T MNHN-AF38 GQ293571 GQ293721 GQ293774 GQ29380528 Aphaenops hustachei Jeannel, 1916 Grotte de l'Eglise - Nistos (France-65) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF39 GQ293514 GQ293573 GQ293636 GQ293711 GQ293751 GQ29384429 Aphaenops sp. Grotte de Frechet-Aure - Frechet-Aure (France-65) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF134 GQ29364330 Aphaenops sp. Grotte de la Cascade - Sarrancolin (France-65) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF135 GQ293576 GQ293635 GQ293710 GQ293749 GQ293842 GQ29388331 Aphaenops crypticola aeacus (Saulcy, 1864) Grotte de Castelmouly - Bagnères-de-Bigorre (France-65) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF40 GQ293574 GQ293712 GQ293750 GQ29384532 Aphaenops sp. Tuto de la Cigalero - Ferrère (France-65) P. Déliot, A. Faille T MNHN-AF42 GQ293583 GQ293637 GQ293696 GQ293752 GQ293843 GQ29388433 Aphaenops vandeli Fourès, 1954 Grotte de Payssa - Salsein (France-09) P. Déliot, A. Faille T MNHN-AF44 GQ293584 GQ293657 GQ293706 GQ293762 GQ293808 GQ29386934 MSS S100 - Illartein (France-09) P. Déliot, A. Faille MSS MNHN-AF43 GQ293648 GQ29385635 Grotte SL1 - Saint-Lary (France-09) P. Déliot, A. Faille T MNHN-AF45 GQ293656 GQ293705 GQ293761 GQ293807 GQ29386736 Aphaenops vandeli bouiganensis Fourès, 1954 Grotte de L'Ournas - Saint-Lary (France-09) P. Déliot, A. Faille T MNHN-AF46 GQ293510 GQ293590 GQ29365437 Aphaenops crypticola (Linder, 1859) Gouffre de Peyreigne - Tibiran-Jaunac (France-65) P. Déliot, A. Faille T MNHN-AF51 GQ293580 GQ29364238 Grotte d’Aron - Portet d’Aspet (France-31) P. Déliot, A. Faille T MNHN-AF52 GQ293591 GQ293651 GQ29385539 Grotte de Gouillou - Aspet (France-31) P. Déliot, A. Faille T MNHN-AF47 GQ293577 GQ293671 GQ293709 GQ293765 GQ293812 GQ29386640 Grotte de Terreblanque - Aspet (France-31) P. Déliot, A. Faille T MNHN-AF50 GQ293579 GQ293650 GQ29385841 Grotte de l’Haiouat de Pelou - Nistos (France-65) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF48 GQ293578 GQ293655 GQ29385942 Grotte de la Maouro - Izaut-de-l'Hôtel (France-31) P. Déliot, A. Faille T MNHN-AF49 GQ293653 GQ293708 GQ293764 GQ293811 GQ29386843 Aphaenops parallelus Coiffait, 1954 Grotte de la Buhadère - Coulédoux (France-31) P. Déliot, A. Faille MSS/T MNHN-AF53 GQ293582 GQ293652 GQ293707 GQ293763 GQ293810 GQ29386544 Aphaenops sioberae Fourès, 1954 Grotte de Payssa - Salsein (France-09) P. Déliot, A. Faille T MNHN-AF54 GQ293516 GQ293587 GQ29363945 Aphaenops bouilloni Coiffait, 1955 Grotte de Pétillac - Bordes-sur-Lez (France-09) P. Déliot, A. Faille T MNHN-AF56 GQ293575 GQ293644 GQ29387046 Aphaenops sp. Grotte d'Aulignac - Bordes-sur-Lez (France-09) A. Faille T MNHN-AF133 GQ293509 GQ293586 GQ293645 GQ293694 GQ293758 GQ293806 GQ29388847 Aphaenops mariaerosae Genest, 1983 Gouffre du Trapech d’en Haut - Bordes-sur-Lez (France-09) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF57 GQ293568 GQ293649 GQ293704 GQ293760 GQ293809 GQ29386048 Aphaenops chappuisi Coiffait, 1955 Grotte de la Maouro - Izaut-de-l'Hôtel (France-31) P. Déliot, A. Faille T MNHN-AF61 GQ293525 GQ293563 GQ29368449 Arachnaphaenops Jeanne, 196750 Aphaenops pluto (Dieck, 1869) Grotte du Sendé - Moulis (France-09) P. Déliot, A. Faille T MNHN-AF58 GQ293567 GQ293647 GQ29386451 Aphaenops tiresias (Piochard de La Brûlerie, 1872) Gouffre de la Peyrère - Balaguères (France-09) A. Faille T MNHN-AF59* GQ293527 GQ293596 GQ293658 GQ293713 GQ293748 GQ29380052 Grotte du Goueil-di-Her - Arbas (France-31) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF60* GQ29388953 Aphaenops alberti Jeannel, 1939 Aven prox. Istaurdy - Aussurucq (France-64) C. Bourdeau T MNHN-AF12 GQ293595 GQ293662 GQ293700 GQ293782 GQ293829 GQ29385354 Cephalaphaenops Coiffait, 196255 Aphaenops bucephalus (Dieck, 1869) Gouffre de la Peyrère - Balaguères (France-09) A. Faille T MNHN-AF62 GQ293511 GQ293588 GQ293675 GQ293693 GQ293747 GQ293814 GQ29387656 Pubaphaenops Genest, 198357 Aphaenops laurenti Genest, 1983 Grotte de Bordes de Crues - Seix (France-09) A. Faille T MNHN-AF63 GQ293569 GQ293634 GQ293719 GQ293767 GQ293813 GQ29387358 Hydraphaenops Jeannel, 192659 Hydraphaenops ehlersi (Abeille de Perrin, 1872) Goueil-di-Her - Arbas (France-31) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF64 GQ293565 GQ293683 GQ29387560 Hydraphaenops vasconicus (Jeannel, 1913) Aven d’Istaurdy - Aussurucq (France-64) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF65 GQ293530 GQ293622 GQ293628 GQ293698 GQ293759 GQ29380361 Hydraphaenops vasconicus delicatulus Coiffait, 1962 Salle de la Verna - Sainte-Engrâce (France-64) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF66 GQ293600 GQ293663 GQ293695 GQ293753 GQ293818 GQ29387262 Hydraphaenops galani Español, 1968 Guardetxe Koleccia - Usurbil (Spain-Guipuzcoa) C. Bourdeau T MNHN-AF67 GQ293524 GQ293602 GQ293697 GQ293746 GQ29381763 Hydraphaenops bourgoini (Jeannel, 1945) Grotte de la Maouro - Izaut-de-l'Hôtel (France-31) P. Déliot, A. Faille T MNHN-AF69 GQ293553 GQ293672 GQ293734 GQ293755 GQ293824 GQ29389464 Grotte de l'Eglise - Nistos (France-65) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF68 GQ293552 GQ293659 GQ293733 GQ293772 GQ293826 GQ29385165 Hydraphaenops pandellei (Linder, 1859) Grotte d’Arréglade - Rébénacq (France-64) C. Bourdeau T MNHN-AF70 GQ293545 GQ293681 GQ293880

66 Grotte d' Ambielle - Arette (France-64) C. Bourdeau, A. Faille T MNHN-AF71 GQ29354667 Hydraphaenops pecoudi (Gaudin, 1938) Gouffre du Barroti - Lacourt (France-09) A. Faille T MNHN-AF72 GQ293566 GQ293673 GQ293738 GQ29387868 Hydraphaenops elegans Gaudin, 1945 Subterranean river of Artigaléou-Arodets - Esparros (France-65) C. Bourdeau, E. Ollivier, E. Quéinnec T MNHN-AF120 GQ293562 GQ293703 GQ293754 GQ29381669 Hydraphaenops penacollaradensis Dupré, 1991 Aven El Sinistro, Villanúa (Spain-Huesca) C. Bourdeau, E. Ollivier T MNHN-AF121 GQ293564 GQ293702 GQ293771 GQ29382370 Geotrechus Jeannel, 191971 Geotrechus Jeannel, 1919 (sensu stricto)72 Geotrechus discontignyi (Fairmaire, 1863) Grotte du Tuco - Bagnères-de-Bigorre (France-65) C. Bourdeau, P. Déliot, A. Faille E/T MNHN-AF92 GQ293560 GQ29389373 Geotrechus orcinus (Linder, 1859) Gouffre de Peyreigne - Tibiran (France-65) C. Bourdeau, P. Déliot, A. Faille E/T MNHN-AF85 GQ293519 GQ293559 GQ293744 GQ293789 GQ29380274 Geotrechus orpheus (Dieck, 1869) Grotte de la Quère - Mérigon (France-09) P. Déliot, A. Faille E/T MNHN-AF81* GQ293528 GQ293597 GQ293665 GQ29387475 Grotte de Montespan - Ganties (France-31) P. Déliot, A. Faille E/T MNHN-AF79* GQ293723 GQ293780 GQ29383476 Geotrechus trophonius (Abeille de Perrin, 1872) Grotte de Tuto Heredo - Merigon (France-09) A. Faille E/T MNHN-AF83 GQ293561 GQ293631 GQ293715 GQ293766 GQ293825 GQ29385277 Geotrechidius Jeannel, 194778 Geotrechus gallicus (Delarouzee, 1857) Aven de Nabails - Arthez d'Asson (France-64) C. Bourdeau, P. Déliot, A. Faille E MNHN-AF76 GQ293518 GQ293557 GQ293670 GQ293724 GQ293769 GQ29379879 Geotrechus jeanneli Gaudin, 1938 Grotte de la Bouhadère - Saint-Pé-de-Bigorre (France-65) C. Bourdeau, P. Déliot, A. Faille E MNHN-AF77 GQ293517 GQ293558 GQ293725 GQ293770 GQ29379980 Geotrechus saulcyi (Argod-Vallon, 1913) Grotte du Ker - Rivérenert (France-09) P. Déliot, A. Faille E/T MNHN-AF87 GQ293522 GQ293548 GQ29366981 Gouffre du Barroti - Lacourt (France-09) A. Faille E/T MNHN-AF86 GQ293668 GQ29388782 Geotrechus seijasi Español, 1969 Cova d'en Manent - Isòvol (Spain-Girona) P. Déliot, A. Faille E/T MNHN-AF89 GQ293529 GQ293598 GQ29385483 Geotrechus vandeli Coiffait, 1959 Aven d'Anglade - Couflens (France-09) P. Déliot, A. Faille E MNHN-AF88 GQ293523 GQ293549 GQ293714 GQ293784 GQ29383384 Geotrechus vulcanus (Abeille de Perrin, 1904) Perte du Fustié - Saint-Martin-de-Caralp (France-09) C. Bourdeau, A. Faille E/T MNHN-AF91 GQ293599 GQ293701 GQ293786 GQ29383285 Trechus Clairville, 180686 Trechus distigma Kiesenwetter, 1851 Aven de Nabails - Arthez d'Asson (France-64) C. Bourdeau, P. Déliot, A. Faille Ep MNHN-AF94 GQ293611 GQ293678 GQ29387987 Trechus quadristriatus (Schrank, 1781) Collau de la Plana del Turbón - Egea (Spain-Huesca) P. Déliot, A. Faille, J. Fresneda Ep MNHN-AF96 GQ293534 GQ293619 GQ293743 GQ293745 GQ29384188 Trechus barnevillei Pandellé, 1867 Cueva del Pis - Penilla, Santiurde de Toranzo (Spain-Cantabria) C. Bourdeau, P. Déliot, A. Faille Ep/T MNHN-AF97 GQ293533 GQ293607 GQ293680 GQ293727 GQ293783 GQ29384889 Trechus fulvus Dejean, 1831 Cueva del Pis - Penilla, Santiurde de Toranzo (Spain-Cantabria) C. Bourdeau, P. Déliot, A. Faille Ep/T MNHN-AF98 GQ293613 GQ29372990 Trechus saxicola Putzeys, 1870 Braña Caballo - Piedrafita (Spain-León) C. Bourdeau, P. Déliot, A. Faille Ep MNHN-AF100 GQ293614 GQ293682 GQ29388291 Trechus schaufussi Putzeys, 1870 Ciudad Real-Navas de Estena-"El Boqueron" (Spain-Toledo) A. Faille E/MSS MNHN-AF101 GQ293532 GQ293620 GQ293737 GQ293788 GQ29382092 Trechus grenieri uhagoni Crotch, 1869 Cueva de Orobe - Alsasúa (Spain-Navarra) C. Bourdeau T MNHN-AF102 GQ293540 GQ293616 GQ29373093 Trechus navaricus (Vuillefroy, 1869) Grotte de Sare - Sare (France-64) C. Bourdeau T MNHN-AF103 GQ293539 GQ293603 GQ29368794 Trechus escalerai Abeille de Perrin, 1903 Cueva de Porro Covañona - Covadonga (Spain-Asturias) J.M. Salgado T MNHN-AF104 GQ293538 GQ293612 GQ293731 GQ293793 GQ29383995 Trechus obtusus Erichson, 1837 Saint-Pé-de-Bigorre (France-65) C. Bourdeau, A. Faille Ep MNHN-AF126 GQ293608 GQ293726 GQ293795 GQ29384796 Trechus comasi Hernando, 2001 Cueva Basaura - Barindano (Spain-Navarra) J. Fresneda T MNHN-AF127 GQ29361797 Trechus ceballosi Mateu, 1953 Aven de Licie Etsaut, Lanne-en Barétous (France-64) C. Bourdeau, A. Faille Ep MNHN-AF128 GQ293610 GQ293728 GQ293791 GQ29385098 Apoduvalius Jeannel, 195399 Apoduvalius alberichae Español, 1971 Cova de Agudir - Cardano de abajo - Palencia (Spain-Asturias) J.M. Salgado T MNHN-AF105 GQ293536 GQ293618 GQ293632 GQ293732 GQ293794 GQ293840

100 Apoduvalius sp. Cueva Requexada - Piloñeta (Spain-Asturias) J.M. Salgado T MNHN-AF106 GQ293537 GQ293609 GQ293736 GQ293796 GQ293846101 Speotrechus Jeannel, 1922102 Speotrechus mayeti (Abeille de Perrin, 1875) Perte du Rimouren - Saint-Montant (France-07) J-Y. Bigot T MNHN-AF107 GQ293535 GQ293547 GQ293881103 Paraphaenops Jeannel, 1916104 Paraphaenops breuilianus (Jeannel, 1916) Cova Cambra - Tortosa (Spain-Tarragona) C. Bourdeau, P. Déliot, A. Faille T MNHN-AF108 GQ293541 GQ293551 GQ293685105 Iberotrechus Jeannel, 1920106 Iberotrechus bolivari (Jeannel, 1913) Cueva del Pis - Penilla, Santiurde de Toranzo (Spain-Cantabria) C. Bourdeau, P. Déliot, A. Faille Ep/T MNHN-AF111 GQ293615 GQ293679 GQ293735 GQ293781 GQ293819 GQ293861107 Duvalius Delarouzée, 1859108 Duvalius berthae (Jeannel, 1910) Cova d’en Xoles - Pratdip (Spain-Tarragona) C. Bourdeau, P. Déliot, F. Fadrique, A. Faille T MNHN-AF115* GQ293606 GQ293626 GQ293857109 Cova Massega - Llaberia (Spain-Tarragona) C. Bourdeau, P. Déliot, F. Fadrique, A. Faille T MNHN-AF114* GQ293531110 Duvalius roberti (Abeille de Perrin, 1903) Grotte de Peïra Cava - Peïra Cava (France-06) A. Coache, J. Raingeard T MNHN-AF129 GQ293605 GQ293691 GQ293785 GQ293837111 Agostinia Jeannel, 1928112 Agostinia gaudini (Jeannel, 1952) Puits des Bauges - Dévoluy (France-05) J-Y. Bigot T MNHN-AF116 GQ293543 GQ293604 GQ293692 GQ293787 GQ293838113 Laosaphaenops Deuve, 2000114 Laosaphaenops deharvengi Deuve, 2000 Vang Vieng-Nam Xang Tai (Laos) A. Bedos, L. Deharveng T MNHN-AF117 GQ293542 GQ293621 GQ293630115 Aepopsis Jeannel, 1922116 Aepopsis robini (Laboulbène, 1849) Plage du Toëno - Trébeurden (France-22) A. Faille Ep MNHN-AF112 GQ293504 GQ293623 GQ293689 GQ293792 GQ293836117 Perileptus Schaum, 1860118 Perileptus areolatus (Creutzer, 1799) Immouzer des Ida Outanane (Maroc) P. Aguilera, C. Hernando, I. Ribera Ep MNHN-AF113 GQ293503 GQ293625 GQ293688119 Bembidiini120 Philochthus Stephens, 1828121 Philochthus lunulatus (Fourcroy, 1795) Guadalajara - El Pobo de Dueñas (Spain-Guadalajara) A. Cieslak, I. Ribera Ep MNHN-AF118 GQ293505 GQ293686 GQ293690 GQ293797 GQ293801122 Typhlocharis Dieck, 1869123 Typhlocharis sp. Santa Almagrera (Spain-Almería) C. Andujar E MNHN-AF119 GQ293502 GQ293624 GQ293633124 Porotachys Netolitzky, 1914125 Porotachys bisulcatus (Nicolaï, 1822) Grotte des Fées - Saint-Cricq-du-Gave (France-40) C. Bourdeau, A. Faille Ep/T MNHN-AF131 GQ293544 GQ293742 GQ293790 GQ293849

Suppl. Table 2. Estimated parameters in the MrBayes run.

Partition Gene1 LSU2 cox13 cyb4 SSU5 rrnL-tRNA-Leu-nad1

Parameter Mean Variance Lower Upper Median PSRF *TL{all} 4.559693 0.063014 4.07 5.043 4.559 1.018r(A<->C){1} 0.049424 0.000068 0.034689 0.066694 0.049003 1r(A<->G){1} 0.315247 0.000824 0.261275 0.37451 0.314323 1r(A<->T){1} 0.230424 0.00033 0.196747 0.267916 0.230173 1r(C<->G){1} 0.021475 0.000042 0.010314 0.035718 0.020852 1r(C<->T){1} 0.31653 0.000831 0.262069 0.374831 0.315589 1r(G<->T){1} 0.066901 0.000136 0.045651 0.091642 0.066263 1r(A<->C){2} 0.040399 0.00011 0.022005 0.063336 0.039562 1.002r(A<->G){2} 0.311296 0.001581 0.234833 0.392138 0.310238 1.005r(A<->T){2} 0.048516 0.000052 0.03531 0.063409 0.048136 1.01r(C<->G){2} 0.118613 0.000945 0.065049 0.184674 0.116375 1.003r(C<->T){2} 0.46844 0.002121 0.377717 0.555796 0.468631 1.005r(G<->T){2} 0.012735 0.00003 0.004212 0.025192 0.012044 1r(A<->C){3} 0.047638 0.000106 0.030334 0.070141 0.046778 1.003r(A<->G){3} 0.411278 0.003426 0.297987 0.521927 0.413283 1.01r(A<->T){3} 0.037981 0.000054 0.025427 0.053689 0.037463 1.015r(C<->G){3} 0.060626 0.000519 0.023866 0.112859 0.058092 1r(C<->T){3} 0.4055 0.00329 0.302696 0.520306 0.402505 1.008r(G<->T){3} 0.036978 0.000132 0.017882 0.06153 0.035806 1.002r(A<->C){4} 0.01421 0.00008 0.001436 0.035942 0.012656 1.003r(A<->G){4} 0.05063 0.000178 0.030033 0.081783 0.04883 1.001r(A<->T){4} 0.861162 0.000686 0.800711 0.903696 0.864183 1.003r(C<->G){4} 0.003883 0.000004 0.000898 0.00901 0.003525 1r(C<->T){4} 0.064736 0.000298 0.037439 0.103357 0.062386 1r(G<->T){4} 0.005379 0.000018 0.000194 0.015923 0.004471 1r(A<->C){5} 0.021898 0.000096 0.006474 0.044816 0.020428 1r(A<->G){5} 0.62562 0.001727 0.538516 0.703213 0.627552 1r(A<->T){5} 0.115637 0.000267 0.086505 0.150775 0.114925 1r(C<->G){5} 0.024756 0.000488 0.000957 0.082658 0.018881 1r(C<->T){5} 0.144934 0.000931 0.092562 0.212862 0.142116 1r(G<->T){5} 0.067155 0.000222 0.040165 0.098204 0.066398 1pi(A){1} 0.318408 0.000161 0.293197 0.343815 0.318377 1.001pi(C){1} 0.229642 0.000138 0.207182 0.25343 0.229434 1pi(G){1} 0.1729 0.000108 0.152807 0.193682 0.172902 1pi(T){1} 0.27905 0.000141 0.256189 0.302581 0.279116 1pi(A){2} 0.358209 0.000261 0.326175 0.390413 0.358168 1.001pi(C){2} 0.099804 0.000049 0.086864 0.113943 0.09955 1pi(G){2} 0.086904 0.000125 0.067076 0.110516 0.086183 1.01pi(T){2} 0.455084 0.000241 0.424815 0.485691 0.454603 1.002pi(A){3} 0.393645 0.000368 0.35688 0.43187 0.393724 1.003pi(C){3} 0.123165 0.000088 0.105748 0.142669 0.122806 1.006pi(G){3} 0.05234 0.000123 0.034735 0.076711 0.050999 1.013pi(T){3} 0.430851 0.000311 0.396442 0.465501 0.430869 1.002pi(A){5} 0.388421 0.000215 0.359728 0.417285 0.388326 1pi(C){5} 0.058252 0.000063 0.044143 0.074907 0.057884 1.001pi(G){5} 0.08781 0.000081 0.071917 0.107191 0.087314 1pi(T){5} 0.465517 0.000239 0.435488 0.496042 0.465426 1alpha{1} 0.384221 0.00168 0.312122 0.473951 0.381721 1.002alpha{2} 0.666526 0.005281 0.531185 0.81887 0.66541 1alpha{3} 0.887375 0.027705 0.595748 1.240414 0.876048 1.002alpha{5} 0.65994 0.011901 0.47105 0.89661 0.652117 1pinvar{1} 0.221579 0.001691 0.134414 0.297168 0.223342 1pinvar{2} 0.693532 0.000355 0.654392 0.728343 0.694088 1pinvar{3} 0.546503 0.001226 0.470943 0.606305 0.549672 1.001pinvar{4} 0.592707 0.000356 0.554866 0.628952 0.592955 1.001pinvar{5} 0.496361 0.0011 0.42531 0.555367 0.498523 1.002