a non-universal transcription factor? the leishmania tarentolae tata box-binding protein lttbp...

www.elsevier.com/locate/ijpara

International Journal for Parasitology 36 (2006) 1217–1226

A non-universal transcription factor? The Leishmania tarentolae TATAbox-binding protein LtTBP associates with a subset of promoters q

Sean Thomas a, Michael C. Yu b,1, Nancy R. Sturm b,*, David A. Campbell a,b

a Molecular Biology Institute, University of California, 609 Charles E. Young Drive East, Los Angeles, CA, 90095-1489, USAb Department of Microbiology, Immunology and Molecular Genetics, David Geffen School of Medicine, University of California,

609 Charles E. Young Drive East, Los Angeles, CA, 90095-1489, USA

Received 14 March 2006; received in revised form 7 April 2006; accepted 12 April 2006

Abstract

In kinetoplastids a 39-nucleotide spliced leader RNA is trans-spliced to the 5 0 end of nuclear mRNAs before they can be translated,thus the spliced leader is central to gene expression in kinetoplastid biology. The spliced leader RNA genes in Leishmania tarentolae con-tain promoters with important sites at approximately �60 and �30. A complex forms specifically on the �60 element as shown by elec-trophoretic mobility shift. The �60 shift complex has an estimated mass of 159 kDa. An L. tarentolae homologue of TATA-bindingprotein, LtTBP, co-fractionates with the �60 shift complex. Inclusion of anti-LtTBP antiserum in the shift assay disrupts the shift, indi-cating that LtTBP is a component of the complex that interacts with the TATA-less �60 element of the spliced leader RNA gene pro-moter. Both LtTBP and LtSNAP50 are found near the spliced leader RNA gene promoter and the promoters important for tRNAAla

and/or U2 snRNA gene transcription, as demonstrated by chromatin immunoprecipitation. The LtTBP appears to interact with a subsetof promoters in kinetoplastids with an affinity for short transcription units.� 2006 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Keywords: Kinetoplastid; Promoter; RNA polymerase II; RNA polymerase III; Small nuclear activating protein complex 50-kDa subunit; Transcriptionfactor

1. Introduction

Kinetoplastid protozoa form a group of protists thatinclude significant human parasites such as Trypanosoma

brucei (African sleeping sickness), Trypanosoma cruzi (Cha-gas disease) and Leishmania species (leishmaniasis), as wellas important plant and animal pathogens. Kinetoplastidsdiverged relatively early from the main eukaryotic treeand their biology is distinct in many ways from most modeleukaryotes. One of the notable differences with regard to

0020-7519/$30.00 � 2006 Australian Society for Parasitology Inc. Published b

doi:10.1016/j.ijpara.2006.04.004

q Note: Nucleotide sequence data reported in this paper are available inthe GenBank�, EMBL and DDBJ databases under the accession numberAY954044.

* Corresponding author. Tel.: +1 310 206 5556; fax: +1 310 206 5231.E-mail address: [email protected] (N.R. Sturm).

1 Present address: Department of Systems Biology, Harvard MedicalSchool, 200 Longwood Avenue, WAB 536, Boston, MA 02115, USA.

gene expression is that nuclear protein-coding genes aretranscribed polycistronically (Johnson et al., 1987) by bothRNA polymerase (pol) I and RNA pol II. As the polyci-stron is transcribed, a spliced leader (SL) is trans-splicedupstream of each coding region. Subsequent addition of adownstream poly (A) tail converts the polycistronic precur-sor into monocistronic mature mRNAs. The multicopy SL

RNA are transcribed independently by RNA pol II (Gilin-ger and Bellofatto, 2001; Dossin and Schenkman, 2005)controlled by defined promoter elements (Campbell et al.,2000; Gunzl, 2003; Palenchar and Bellofatto, 2006; Dossinand Schenkman, 2005) and a T-tract termination element(Sturm et al., 1999). Before participating in the trans-splic-ing reaction, the SL RNA primary transcript receives am7G cap and extensive 5 0 methylations (Bangs et al.,1992) referred to as cap 4. In Leishmania tarentolae,undermethylation of cap 4 does not affect trans-splicingof the 96-nucleotide substrate SL RNA (Sturm et al.,

y Elsevier Ltd. All rights reserved.

mailto:[email protected]

1218 S. Thomas et al. / International Journal for Parasitology 36 (2006) 1217–1226

1998), but has been correlated with a loss of mRNA load-ing onto polysomes (Zeiner et al., 2003).

RNA pol II presents two distinct modes of transcriptionin kinetoplastids: highly processive synthesis for proteincoding genes with an apparently low rate of initiation(Martınez-Calvillo et al., 2003) and short punctuated syn-thesis with a high rate of initiation for SL RNAs (Kooteret al., 1984; Boothroyd et al., 1985). ‘Switch regions’,non-transcribed inter-cistronic areas likely containing sitesfor initiation of polycistronic transcription, have beencharacterised on chromosomes 1 and 3 in Leishmania major

(Martınez-Calvillo et al., 2003, 2004). Identification ofthese regions could allow a precise definition of mRNApromoters in the near future. SL RNA promoters havebeen characterised in a number of kinetoplastids (Agamiet al., 1994; Gunzl et al., 1997; Nunes et al., 1997; Luoet al., 1999; Campbell et al., 2000), including single nucle-otide resolution of the bipartite promoter of L. tarentolae,with �60 and �30 sequence elements (Yu et al., 1998). Apronounced difference between the activities of RNA polII in kinetoplastids lies in the perception of transcriptiontermination signals: a poly T tract leads to terminationdownstream of the SL RNA (Sturm et al., 1999), whereaseach mRNA possesses a poly-pyrimidine tract upstream ofeach coding region as part of the trans-splicing signal (Cur-otto de Lafaille et al., 1992). Differential RNA pol II behav-iour has been noted in the transcription of small nuclear(sn)RNA and mRNA genes in higher eukaryotes (Hernan-dez, 1992). Metazoan promoter and terminator elementsfor processive and punctuated transcription are not inter-changeable (Hernandez and Weiner, 1986; Neuman de Veg-var et al., 1986; Dahlberg and Schenborn, 1988). It isreasonable to assume that distinct mechanisms of RNApol II initiation will exist in kinetoplastids for the two modes.

Some of the cis-acting proteins involved in SL RNA tran-scription have been identified. The L. tarentolae SL RNA

�60 promoter element (�60PE), which shows similaritiesto the proximal sequence element (PSE) of vertebratesnRNA gene promoters (Yu et al., 1998; Campbell et al.,2000), was bound specifically by a protein complex (Yuet al., 1998), as did a similar element from Leptomonas sey-

mouri, from which the first SL RNA promoter binding pro-teins were reported: p36, p46, and p57 (Luo and Bellofatto,1997). The p57 subunit is an orthologue of the human smallnuclear activating protein complex (SNAPc) subunitSNAP50 (Das and Bellofatto, 2003; Schimanski et al.,2005). In humans SNAPc directs transcription of snRNA

by both RNA pol II and III (Hernandez, 2001). The kineto-plastid SNAP50 protein has been associated with transcrip-tion by all three RNA pols, interacting with the rRNA

(RNA pol I), SL RNA (RNA pol II) and U2/U6 snRNA

(RNA pol III) gene promoters (Gilinger et al., 2004; Schi-manski et al., 2004a); however the interaction with the U2

snRNA promoter was not detected in T. brucei (Schimanskiet al., 2004b).

Searches of the three kinetoplastid genome databases(Berriman et al., 2005; El-Sayed et al., 2005; Ivens

et al., 2005) have revealed few of the standard transcrip-tion factors common to many well-characterised eukary-otes, leading to the conclusion that the transcriptionmachinery in kinetoplastids is reduced and/or divergentfrom that of higher eukaryotes. A T. brucei homologueof the TATA-binding protein (TBP), called TRF4, hasbeen identified (Ruan et al., 2004). In eukaryotes andarchaea, TBP is involved in most transcription initiationevents (Thomm, 1996), and can direct transcriptionfrom TATA-less promoters (Pugh, 2000). Consistentwith this specificity, TbTBP is involved in transcriptionof multiple gene types including the SL RNA (Ruanet al., 2004).

In this paper, we present a molecular characterisation of aprotein shift complex (designated�60SC) that forms on theL. tarentolae SL RNA �60PE. The genes for SNAP50 andTBP homologues were cloned from L. major and L. tarento-

lae, respectively, and antibodies raised against recombinantproteins. The presence of LtTBP in the�60SC was suggestedin vitro by co-fractionation and confirmed by electrophoret-ic mobility shift assay (EMSA). Chromatin immunoprecipi-tation (ChIP) indicated that both LtTBP and LtSNAP50

interact with the SL RNA gene promoter region in vivo.We discuss the implications of these results on formationof the transcription complex on the SL RNA promoter, aswell as on RNA pol I and RNA pol III promoters inkinetoplastids.

2. Materials and methods

2.1. Nuclear extract preparation

Nuclear extracts were prepared as reported previously(Yu et al., 1998) with minor modifications. Mid-logUC(A) strain L. tarentolae cells (grown in brain–heart infu-sion supplemented with 100 lg ml�1 hemin) were centri-fuged at 2000·g and 4 �C for 10 min, washed twice incold PBS buffer. Each gram of pellet was resuspended with5 ml of buffer A (0.3 M sucrose, 10 mM HEPES (pH 7.9),10 mM K-Glu (potassium glutamate), 1.5 mM MgCl2,0.1 mM EDTA, 0.5% NP-40, 0.5 mM dithiothreitol(DTT), 0.5 mM phenylmethylsulphonylfluoride (PMSF),0.7 lg ml�1 pepstatin, 2 lg ml�1 leupeptin) by 20 strokesin a Dounce homogeniser. The lysate was centrifuged at9800·g and 4 �C for 10 min. The resulting pellet was resus-pended with 4 ml of buffer B (10 mM HEPES (pH 7.9),1.5 mM MgCl2, 1.5 mM EDTA, 5% glycerol and100 mM K-Glu) for every gram of initial cell pellet. Highsalt extraction was performed by adding 3.0 M K-Gludropwise to a final concentration of 400 mM with gentlestirring at 4 �C. The suspension was incubated for 30 minwith continued gentle stirring and centrifuged in 1.5 mlmicrofuge tubes at 9800·g for 2 min at 4 �C. The superna-tant was then dialysed overnight at 4 �C against buffer D(20 mM HEPES (pH 7.9), 100 mM K-Glu, 1.5 mM MgCl2,20% glycerol, 0.2 mM EDTA, 1.0 mM DTT and 0.5 mMPMSF).

Table 1Oligonucleotides used in this study

Purpose Name Sequence

ORF

Amplification

5 0 LtTBP ATGGACGATGACTATGCTTT

CTTCG

3 0 LtTBP GGCAGTCTTCCGCTCGTCCAA

5 0 LmSNAPc3 ATGCACGCAAACGGATCGCCTG

3 0 LmSNAPc3 CGTTGCCTTGAAGTAAACC

EMSASL-60WT+DECA GCGGGTACCTGGTGACACGC

TGTGCGGCACGCGG

SL-60MUT+DECA GCGGGTACCTGGGTCACATA

GTTGCGGCACGCGG

DECA (Klenow primer) CCGCGTGCCG

ChIPLt SL RNA �80/�64 GGGCTGCTGTGTGGTGA

Lt SL RNA 19/�3 TACTTATATAGCGTTAGTTGAA

Lt tRNA Ala 1/18 GGGATGTAGCTCAGATGGTAG

Lt tRNA Ala 79/61 GTGCCGTGGAGAAGTTGGGTA

Lt tRNA Thr 1133/1151 AAAAACCACTCACCCGATC

Lt tRNA Thr 1261/1245 GGCCGCTAGGGGGATCG

Lt rRNA F GAGGGACGCGGGGTTTTGAGG

Lt rRNA R CGACACCACCGCACCACCATC

Lt COII F GGTCGCTGTAATGAAATAGTT

Lt COII R GTAAGACACCACAGAGTT

ORF, open reading frame; EMSA, electrophoretic mobility shift assay;ChIP, chromatin immunoprecipitation.

S. Thomas et al. / International Journal for Parasitology 36 (2006) 1217–1226 1219

For ammonium sulphate precipitations, fine ammoniumsulphate powder was added during stirring to a suspensionof nuclear extract at 4 �C to different saturation points asdescribed (Scopes, 1985). The pellets from different precip-itation steps were centrifuged for 15 min at 10,000 rpm in aBeckman JA-20 rotor. The pelleted precipitates were dis-solved in two-times packed pellet volume of buffer D andstored at �80 �C.

2.2. Electrophoretic mobility shift assay

DNA-binding assays were performed as described previ-ously with only slight modification (Yu et al., 1998). Each20 ll binding reaction contained 0.5 ll of 0.25 ng ll�1 dou-ble-stranded radiolabelled probe, 2 ll 10X gel shift buffer(200 mM HEPES–KOH (pH 8.0), 800 mM KCl, 40%Ficoll-400, 0.3% NP-40), 0.5 ll TE (10 mM Tris (pH 8.0),1 mM EDTA), 0.7 lg poly(dI-dC)-poly(dI-dC), and 17 llcrude L. tarentolae nuclear extract as prepared above. Allbinding reactions were performed on ice for 20 min.Ammonium sulphate precipitated nuclear extract (30%)contained enriched �60SC. Supershift assays were per-formed by adding 1 ll of preimmune serum or antiserumagainst TBP or SNAP50 and continuing the incubationfor an additional 15 min. The EMSA reactions wereresolved on a 4% acrylamide/bis-acrylamide (29:1) nativegel in 0.5XTBE buffer for 2.5 h at 150 V. Gels were prerunfor 30 min. Quantitation and normalisation of isotopicband intensities were performed using a PhosphorImager(Molecular Dynamics).

2.3. Gel filtration chromatography

A Superose 6 HR 10/30 column (Amersham-Pharmacia)was calibrated at 150 ll min�1, using buffer A and the fol-lowing standards each with a known Stokes’ radius: bovineliver catalase, 52.2 A; rabbit muscle aldolase, 48.1 A;bovine serum albumin, 35.5 A; and hen egg ovalbumin,30.5 A (Amersham-Pharmacia). Approximately 600 lg ofprotein from the 30% ammonium sulphate-precipitatedfraction was loaded in each run. Five-hundred microliterfractions were collected and concentrated in Microcon-10(Millipore) prior to EMSA analysis.

2.4. Sucrose gradient sedimentation

Gradients consisting of 5–20% (v/v, 12 ml) linearsucrose solution were set. The gradients were overlaid with30% ammonium sulphate precipitated fraction (0.1 ml of400 lg ml�1) or 0.1 ml mixtures containing standards ofknown Svedberg densities: bovine liver catalase, 11.30 S;rabbit muscle aldolase, 7.35 S; bovine serum albumin,4.30 S; and hen egg ovalbumin, 3.66 S (Amersham-Phar-macia). The gradients were centrifuged at 37,000 rpm in aBeckman SW41 rotor at 4 �C for 17 h. Fractions (500 ll)were collected from bottom to top and concentrated inMicrocon-10 (Millipore) prior to EMSA analysis.

2.5. DNA amplification and analysis

The TBP sequences from L. major (LmjF19.1390) andT. brucei (Tb10.61.0330) were obtained from their cognategenome projects (http://www.genedb.org/). The LtTBP

was cloned by PCR using degenerate primers designedfrom the L. major sequence. The sequence and designationof oligonucleotides used for open reading frame (ORF)amplification, EMSA and ChIP are listed in Table 1. TheLmSNAP50 was cloned by PCR using primers designedfrom the L. major sequence (LmjF35.4660). The completeDNA sequence of both amplified genes was determined.

Alignments were created with ClustalX (Thompson et al.,1997) using only the information contained in the conservedC-terminal portion of TBP. The minimum evolution func-tion of Mega2 (Kumar et al., 2004) was then used with1000 replicates to generate the consensus tree and bootstrapvalues. The TBP sequences obtained from GenBank werePw-P62001; Hsal-CAA63691; Tc-AAO17362; Lm-CAC18868; Lt-AY954044; Gi-AAO72319; Hsap-NP 003185;Ce-P32085; Sc-P13393; Ca-AAC49985; At-P28147.

2.6. Generation of antisera

The LtTBP and LmSNAP50 genes were cloned into thepET28 expression vector (Invitrogen). The Escherichia coli

BL21 RIL cells transformed with these vectors wereinduced to express recombinant proteins using 1 mM iso-propyl-b-D-thiogalactopyranoside at 37 �C for 5 h. Recom-binant proteins with dual N and C-terminal histidine tagswere purified over a Ni-NTA column and resolved on anSDS-PAGE gel. Gel-excised purified protein bands were

http://www.genedb.org/

Fig. 1. Ammonium sulphate precipitation profile of the �60SC. Ammoni-um sulphate concentrations are shown above the lanes: each fraction fromthe enrichment steps was subjected to electrophoretic mobility shift assaywith both WT �67/�58 element (W) or 10-bp transversion mutated �67/�58 element (M). The arrow indicates the specific band shift. FP, free probe;sup, supernatant.


sent to Animal Pharm Services (Healdsburg, CA) to beused as antigens to immunise rabbits and generate antisera.The SNAP50 and TBP antisera were used in Western blotsagainst L. tarentolae protein extract at 1:10,000 and1:20,000 dilutions, respectively.

2.7. Anionic-exchange chromatography

Anion-exchange chromatography was performed on pre-packed 5 ml HiTrap Q column (Amersham-Pharmacia)using fast pressured liquid chromatography (FPLC) (Amer-sham-Pharmacia). Approximately 15 mg of protein in a 5 mlvolume of the 30% ammonium sulphate precipitated fractionwas applied per run at 1 ml min�1 flow speed. Proteins wereeluted using a linear 0.1–1 M potassium L-glutamate gradi-ent established by a titration of the column equilibrationbuffer QA (20 mM HEPES–KOH pH 8.0, 200 mM sucrose,10 mM EDTA, 100 mM potassium L-glutamate, 1 mMDTT, 1 mM PMSF, 0.7 lg ml�1 pepstatin, and 2 lg ml�1

leupeptin) with the high-salt buffer QB (20 mM HEPES–KOH pH 8.0, 200 mM sucrose, 10 mM EDTA, 1 M potassi-um L-glutamate, 1 mM DTT, 1 mM PMSF, 0.7 lg ml�1

pepstatin, and 2 lg ml�1 leupeptin). Fractions were dilutedwith buffer QA and subjected to EMSA as described above.The sample and buffers used during the chromatographyprocedure were 0.22 lM filtered prior to application.

2.8. Chromatin immunoprecipitations

To detect protein in close proximity to DNA in vivo,ChIP was performed as described (Strahl-Bolsinger et al.,1997) with modifications for L. tarentolae. For each IP,50 ml of L. tarentolae cells at 5·107 cells ml�1 were incubat-ed with 1% formaldehyde at 25 �C for 15 min. Next 2.5 mlof 2.5 M glycine was added and incubation continued at25 �C for an additional 5 min. The sample was divided inhalf, the cells were pelleted and washed once with 20 mlPBS, pelleted again and washed once more with 2 mlPBS. After the final pelleting, the cells were resuspendedin 400 ll ChIP lysis buffer (50 mM HEPES (pH 7.5),140 mM NaCl, 1% Triton X-100, 0.1% sodium deoxycho-late and cOmplete Protease Inhibitor Tablets [Roche])and an equal volume of glass beads were added. The sam-ple was shaken continuously for 30 min on a vortex at 4 �C.The lysate was recovered by piercing the bottom of thetube and collecting drops. The samples were sheared on aHeatSystems-Ultrasonics Inc. sonicator (Model W-220F)with 6–10 s pulses at level 3 followed by a 15 s pause aftereach pulse. The lysate was centrifuged at 10,000 rpm for10 min at 4�C. The supernatant was taken and its proteinconcentration determined. One mg of protein was usedfor each immunoprecipitation reaction. One-fortieth ofthe amount of lysate that would be used for an immuno-precipitation was reverse-crosslinked (65 �C overnight),and the DNA was purified on a Qiagen QiaQuick� spincolumn and analysed via agarose gel to determine the aver-age genomic fragment size achieved by sonication (300 bp).

Antiserum or preimmune serum (1 ll) and 50 ll proteinA-agarose (equilibrated in lysis buffer) were added to 1 mgof lysate and incubated overnight at 4 �C. Two washes eachof the following were then performed, pelleting beads aftereach wash: 1 ml ChIP lysis buffer (50 mM HEPES pH7.5,140 mM NaCl, 1% Triton X100, 0.1% sodium deoxycho-late, cOmplete Protease Inhibitor Tablets [Roche]), 1 mlhigh salt lysis buffer (same as lysis buffer except 500 mMNaCl), 1 ml ChIP wash buffer (10 mM Tris–HCl pH 8.0,250 mM LiCl, 0.5% NP-40, 0.5% Nadeoxycholate, 1 mMEDTA), and 1 ml TE. The beads were mixed with 75 llof ChIP elution buffer (50 mM Tris–HCl pH 8.0, 1%SDS, 10 mM EDTA) and the sample incubated at 65 �Cfor 10 min. After centrifuging, the supernatant was takenand the beads were eluted again with 75 ll elution buffer.The supernatants were combined and incubated at 65 �Covernight to reverse-crosslink and the liberated DNA waspurified with a Qiagen column. Each 50 ll PCR reactionincluded 1 ll of purified DNA as template.

3. Results

3.1. The mass of the �60SC is approximately 159 kDa

In order to assess the physical characteristics of theDNA-binding complex detected in our gel shift assay, therelative size and physical properties of the �60SC wereaddressed using standard biochemical techniques.

To concentrate and enrich for specific proteins, thenuclear extract was fractionated by ammonium sulphateprecipitation (Scopes, 1985) at 30, 45 and 60% saturation.Fractions were assayed for DNA-binding activity and themajority of the specific DNA-binding activity was presentin the 30% ammonium sulphate pellet (Fig. 1). To deter-mine the size of the DNA-binding activity, the 30% ammo-nium sulphate fraction was subjected to gel filtration andsucrose gradient sedimentation analysis. The fractions col-lected from gel filtration were then used in EMSA to deter-mine which contained specific DNA-binding activity. Bycomparing the elution volume of the active fractions withthe elution volume of standards with known Stoke’s radius

Fig. 2. Physical characterisation of the�60SC reveals a 159-kDa complex.(A) An electrophoretic mobility shift assay (EMSA) of gel filtrationfractions with arrows pointing to UV maxima of independently runstandards. (B) SDS-PAGE (top) of standards and EMSA activity (bottom)of sucrose gradient fractions. (C) Stokes radius calculation from gelfiltration experiment. (D) Svedberg density calculation from sucrosegradient experiment.

Fig. 3. Phylogenetic analysis of kinetoplastid TATA-binding proteins(TBPs). A minimum evolution consensus tree is shown. Numbersrepresent bootstrap values for 1000 replicates. Sequence analysis wasbased on the conserved C-terminal domain (starting at position 156 of thehuman protein and position 87 of LtTBP). The TBP-related factors wereexcluded from the analysis because they are not general transcriptionfactors and are associated with regulated transcription of a subset of genesin metazoa (Hochheimer and Tjian, 2003).


(Scopes, 1985), it was inferred that �60SC had a Stokes’radius of 38.5 A (Fig. 2A and C). To determine the sedi-mentation coefficient of �60SC, the 30% ammonium sul-phate fraction was separated by sucrose gradientsedimentation analysis and the fractions collected wereassayed by EMSA. By comparison of the sedimentationrate of the active fractions with that of known standardsthe S20,w value for the �60SC was determined to be 9.2(Fig. 2B and D). These values were used to estimate thenative molecular weight of this complex by incorporatingboth the Stokes’ radius and sedimentation coefficient in astandard Siegel and Monty equation (Siegel and Monty,1966). A native molecular mass of approximately159 kDa was calculated for the �60SC. The frictional ratio(f/f0) of the �60SC was calculated at 1.03, indicating thatthe complex has a relatively symmetrical shape.

3.2. Characterisation of the Leishmania homologues of TBP

and SNAP50

Based on the similarity to the snRNA proximal sequenceelement (PSE), we proposed previously (Campbell et al.,

2000) that SL RNA transcription factors may be relatedto those used for vertebrate snRNA genes (Mittal and Her-nandez, 1997; Kuhlman et al., 1999; Hernandez, 2001).Regular searches of the genome-project databases revealedcredible matches to the universal transcription factor TBPand to SNAP50 query sequences. We therefore pursued asimultaneous characterisation of these two proteins to testour hypothesis and to facilitate biochemical purification.

The TBP gene was amplified by PCR from L. tarentolae

using oligonucleotide primers based on the L. major

sequence and the product sequenced completely (GenBankaccession number AY954044). The 879-bp ORF, whichencodes a predicted 31.2-kDa protein, was over-expressedin E. coli. Recombinant His6-tagged LtTBP was enrichedto single-band purity as visualised by Coomassie staining(data not shown).

The variable amino-terminal extension, which has a vari-ety of functions in different organisms (Bondareva andSchmidt, 2003), was conserved with that from L. major

but only a small block was conserved with T. brucei. Thekinetoplastid TBP branch formed a clade with Giardia thatwas distinct from other TBP sequences including protists,e.g. Plasmodium and Entamoeba (Fig. 3). The Leishmania

TBP homologues contained a 10-amino acid insertionbetween the a1 0 helix and b2 0 sheet structures that wasabsent from other TBPs, including those of the related Try-

panosoma. A short insertion specific to the kinetoplastidTBPs was present between the b3 0 and b4 0 sheets. Both inser-tions are likely to affect the conformation of the COOH-ter-minal ‘stirrup’ that interacts with transcription factorsTFIIB (RNA pol II) and Brf1 (RNA pol III) in Saccharomy-

ces cerevisiae (Shen et al., 1998; Schroder et al., 2003).The gene for the second transcription factor, SNAP50,

could not be amplified from L. tarentolae using primersbased on the L. major sequence. Because L. tarentolae pro-teins show high sequence identity to homologues in

Fig. 4. Co-fractionation of LtTBP with the �60SC during anion exchange chromatography. (A) Validation of antibodies by Western blotting. Whole cellextract from Leishmania tarentolae was resolved by SDS-PAGE and probed with antisera elicited against LtTBP and LmSNAP50, respectively. (B)Fractions from HiTrapQ chromatography were analysed by dot blotting with anti-LtTBP antibodies and by electrophoretic mobility shift assay (EMSA)using mutated (M) and wild type (W) binding-site probes.

Fig. 5. Antibody inhibition of �60SC binding to the �60PE by anti-LtTBP antibody. Incubation of L. tarentolae nuclear extract with mutatedbinding-site probe (M; lane 1), wild type�60 probe (W; lane 2),�60 probeplus preimmune serum (lane 3), and �60 probe plus anti-LtTBP (lane 4).The arrow indicates a weak potential supershift.


L. major typically, we amplified the L. major SNAP50 gene.The recombinant protein was over-expressed and purified.Antibodies raised against the individual recombinant pro-teins detected single bands of the predicted size, respective-ly, in Western blots of L. tarentolae lysate (Fig. 4A). Thus,antibody against LmSNAP50 is a valid reagent for experi-ments in L. tarentolae.

To investigate the composition of the complex detected byEMSA, the 30% ammonium sulphate fraction was furtherresolved by anion exchange chromatography through a5 ml HiTrapQ column using FPLC. The assay of individualfractions by EMSA and Western dot-blots with a-LtTBPand a-LmSNAP50 antisera revealed co-fractionation ofLtTBP with the �60SC activity in fractions 15 and 16(Fig. 4B). The presence of LtSNAP50 was not detected inany of the fractions. These data suggest that �60SC forma-tion involves a complex of proteins that includes LtTBP.

3.3. LtTBP is necessary for formation of the �60SC in vitro

In order to query the particular participants in the�60SC,the specific antibodies against LtTBP and LmSNAP50 wereused in EMSA experiments. If LtTBP or LtSNAP50 is pres-ent in the �60SC, the cognate antibody would be expectedeither to disrupt complex formation or to reduce the gelmobility of the protein-DNA complex by virtue of increasedprotein mass (a ‘supershift’). Because no covalent linkagesform during this reaction, equilibrium kinetics predict (andwere borne out by data not shown) that the order of additionof antiserum in these reactions has no effect on the final out-come of the experiments.

The addition of preimmune serum to the EMSA hadminimal effect on the production and mobility of theDNA-protein complex that formed specifically on the�60PE (Fig. 5, lane 3). Anti-LtTBP serum from the samerabbit after immunisation ablated the EMSA shift complex(Fig. 5, lane 4) and resulted in a weak band of reducedmobility that likely represents a supershift. Similar experi-ments using LmSNAP50 antiserum revealed no difference in

mobility after addition of antiserum (data not shown). As acontrol, addition of antibodies to reactions with mutantprobes failed to shift the DNA noticeably. When an EMSAgel of wild-type and mutated binding-site probes was ana-lysed by Western blotting LtSNAP50 was detected in thesample but not at the same mobility as the shift complex(data not shown). One interpretation of this result is thatunder these conditions LtSNAP50 is not part of the�60SC. An alternative possibility is that the anti-LtSNAP50 antibodies do not recognise the cognate proteinin the native state of the DNA-bound complex, perhapsbeing masked by other components.

Fig. 6. LtTBP and LtSNAP50 are present at the SL RNA gene promoterin vivo. (A) Schematic representation of gene templates studied bychromatin immunoprecipitation. TSP, transcription start point. (B)Agarose gel electrophoresis of PCR products obtained from DNAimmunoprecipitated by antiserum against either LtTBP or LmSNAP50

(right lanes) or the corresponding preimmune serum (left lanes). Ampli-fication primer combinations are indicated above the respective gels.Roman numerals to the right of the panels indicate the RNA pol thattranscribes the target gene; mt, mitochondrial.


Although, a weak supershift band was observed, themajor effect of the LtTBP-specific antibodies was to preventassociation of the other components of �60SC with the�60PE. This result strengthens the conclusion that LtTBPis part of the�60SC and further suggests that LtTBP is nec-essary for assembly of the �60SC on the �60PE.

3.4. Both LtTBP and LtSNAP50 interact with the SL RNA

and tRNAAla/U2 promoter regions

In order to confirm and resolve the EMSA-antibodyresults and to extend our analyses beyond the SL RNAgene �60PE in vitro, ChIP analyses were performed usingisolated L. tarentolae nuclei. Representative targets werechosen such that at least one positive result was anticipatedfor each antibody. Indeed, LtTBP would be predicted tointeract universally with all nuclear promoter types (Her-nandez, 1993; Pugh, 2000), while LtSNAP50 might be con-fined to snRNA transcription, and possibly the rRNA

(Schimanski et al., 2004a).The ChIP assays were performed using preimmune

serum, LtTBP antiserum, or LmSNAP50 antiserum and theresulting purified DNA used in PCR with SL RNA,tRNAThr, tRNAAla/snRNA U2, mitochondrial maxicirclecytochrome oxidase II (COII), and rRNA primer sets(Fig. 6A; Table 1). The products from each primer set andChIP condition were collected in addition to input controlsand analysed in a 2% agarose gel for each five-cycle incre-ment from the start through 30 cycles (data not shown). At20, 25 or 30 cycles, one of two conditions arose in each case:simultaneous amplification of the template in preimmuneand immunised-sera treated samples was interpreted asnon-specific association. The presence of a PCR product inthe antiserum treatment and absence of a product in the pre-immune serum treatment indicated a specific interaction ofthe antigen with the promoter. In these assays (Fig. 6B),the SL RNA promoter region was precipitated by bothLtTBP and LmSNAP50 antisera, indicating positive interac-tions with both proteins at the promoter region in vivo. Like-wise, both proteins were detected in the proximity of thetRNAAla promoter that is essential for transcription of theadjacent U2 snRNA in T. brucei (Gunzl et al., 1995). In L. tar-

entolae, however rRNA the tRNAAla promoter is slightly fur-ther away. A B-box found within a purported snoRNA at�158 relative to the U2 snRNA may instead be involved inU2 transcription in L. tarentolae. The tRNAThr was precipi-tated by the LtTBP antiserum but not by the LmSNAP50

antiserum. Neither LtTBP nor LtSNAP50 showed an inter-action with the promoter region that directs transcriptionby RNA pol I. Immunoprecipitations assayed for the COIIgene located in the maxicircle of the kinetoplast, which istranscribed by a mitochondrial RNA pol and thus predictedto be a negative control, did not show specific amplificationfor either LtTBP or LtSNAP50.

These results provide an overview of the interactions ofwith a variety of gene promoters, including those driven byRNA pol I (rRNA), RNA pol II (SL RNA), and RNA pol

III (tRNA and snRNA). Notably, LtTBP did not give theuniversal positive anticipated for nuclear gene transcrip-tion; the common feature among the LtTBP-positive pro-moters is the small size of their transcription units. Thedifferential result for LtSNAP50 between the EMSA andthe ChIP analyses may be due to experimental differences,specifically the inclusion of formaldehyde in the ChIPstudy, which may have provided stabilisation of weak ortransient interactions due to direct crosslinking betweenmembers of the complex. Alternatively, formaldehydemay have denatured epitopes in LtSNAP50 that were notrecognised by antibody in the native complex during super-shift experiments.

4. Discussion

In this study, we present a combination of biochemicaland molecular characterisations of two proteins that


interact with the SL RNA gene promoter in L. tarentolae.The identity of protein components in the �60SC waschallenged with antibodies raised against putative tran-scription factors LtTBP and LmSNAP50. Both proteinswere present at the SL RNA promoter region in ChIPassays; LtTBP was also implicated in snRNA and tRNAgene transcription but not rRNA transcription. We showthat LtTBP associates closely with the SL RNA �60PE.

Vertebrate TBP plays an essential role at snRNA promot-ers in selection of the transcribing RNA pol (Mittal and Her-nandez, 1997; Hernandez, 2001). The presence of a TATAbox at approximately �30 and hence direct contact of TBPwith the DNA, is necessary for transcription by RNA polIII (Lobo and Hernandez, 1989). The absence of a TATAbox selects RNA pol II (Lobo and Hernandez, 1989). Addi-tion of anti-LtTBP antiserum to the EMSA reveals an essen-tial role for LtTBP in assembly of the�60SC on the�60PE.Coincidently, the L. tarentolae SL RNA does not contain anupstream canonical TATA box and is transcribed by RNApol II (Saito et al., 1994; Campbell et al., 2000).

The demonstration by EMSA that LtTBP binds to theL. tarentolae �60PE is consistent with a recent report thatthe TBP homologue is associated with the SL RNA in T.

brucei in ChIP assays (Ruan et al., 2004) and in a complexwith five other proteins, which includes three SNAP homo-logues and two TFIIA homologues, that is necessary forSL RNA transcription (Schimanski et al., 2005). ThatLtSNAP50 is also associated with the L. tarentolae SL

RNA in vivo is consistent with ChIP data obtained inLeishmania seymouri (Gilinger et al., 2004) and in vitrotranscription data from L. seymouri and T. brucei (Dasand Bellofatto, 2003; Schimanski et al., 2004a). The associ-ation of LtSNAP50 with the L. tarentolae tRNAAla/U2

snRNA in vivo is consistent with ChIP data obtained inL. seymouri (Gilinger et al., 2004) but contrasts in vitrotranscription/immunodepletion experiments in T. brucei

that show TbSNAP50 is not involved in U2 snRNA tran-scription (Schimanski et al., 2004a). Kinetoplastid RNApol III type 2 promoters consist of a Box A and a Box Bcontained within the transcribed region of a tRNA. Typi-cally, kinetoplastid snRNA genes are located upstream oftRNA in the opposite orientation and are dependent onthe tRNA Box B promoter element for their transcription(Nakaar et al., 1995). Since, LtSNAP50 does not associatewith the tRNAThr gene, we have inferred that it is not ageneral tRNA-gene transcription factor and favour theimplication that it is involved in kinetoplastid snRNA genetranscription. However, if LtSNAP50 were involved with asubset of tRNA gene promoters (e.g. tRNAAla) theobserved differences could be reconciled.

In ChIPs neither LtTBP nor LtSNAP50 precipitated therDNA promoter region. In most eukaryotes the failure ofSNAPc to interact with the rDNA promoter would beexpected, however the rDNA promoter of T. brucei con-tains an element similar to the SL RNA promoter that doesbind TbSNAP50 (Schimanski et al., 2004a). The L. tarento-

lae rDNA promoter does not have a proximal SL RNA

promoter-like element, nor does LtSNAP50 appear to inter-act with the promoter in this organism. The failure ofLtTBP to interact with the rRNA promoter was unexpect-ed. RNA interference experiments revealed that TBPknockdowns in T. brucei did not affect rRNA transcriptionin nuclear run-on assays (Ruan et al., 2004). Thus the fail-ure of LtTBP antiserum to precipitate the L. tarentolae

rRNA promoter region is consistent with RNA interferenceobservations and further highlights the possibility thatLtTBP plays no role in rRNA transcription.

A further consideration for the binding properties ofLtSNAP50 detected in our ChIP assay is the distributionof potential consensus binding sites. We have defined theL. tarentolae �60SC binding site upstream of the SLRNA as GACN5G (Yu et al., 1998). The correspondingT. brucei consensus sequence is a component of the rRNA

promoter in opposite orientation, 195-bp upstream of thetranscription start site, as well as the SL RNA promoterexplaining why the two promoters compete for transcrip-tion factors (Schimanski et al., 2004a). A perl script (avail-able upon request) was used to locate the L. tarentolae

consensus sequence in the vicinity of other templates usedin our ChIP assay (black boxes; Fig. 6A). Five potentialbinding sites were found close to tRNAAla/U2 snRNA,two being just upstream of the U2 snRNA, which mayaccount for the observed binding of LtSNAP50 in vivo.In contrast, one binding site was found about 100-bpupstream of the tRNAThr and another site about 200-bpupstream of the rRNA transcription start site and in thesame orientation (as opposed to T. brucei where the �60element is closer and in the opposite orientation); in bothcases there was no evidence for LtSNAP50 presence. Giventhe precedent set in T. brucei, it was surprising that thebinding site upstream of the rRNA was not occupied byLtSNAP50. The ability of LtSNAPc to bind to its recogni-tion site must be prevented by physical means such as chro-matin structures of tightly-bound nucleosomes, repressorproteins, DNA and/or protein modifications, or exclusionfrom a sub-cellular domain such as the nucleolus. Prelimin-ary data suggest that the repeat region upstream of therRNA promoter is present in the nucleolus and bound ina nucleosome pattern (R.A. Hitchcock, D.A.C. andN.R.S., unpublished data).

With the identification of transcription factors that bindto the SL RNA promoter (Das et al., 2005; Schimanskiet al., 2005; Palenchar et al., 2006), a base of informationis being gathered that can be compared directly to the fac-tors necessary for mRNA promoter nucleation. Amongthese differences will be the keys to the differential interpre-tation of transcriptional signals controlling RNA pol IIactivities including transcription initiation, processivity andtermination. The primary sequence of the promoter willlikely dictate the transcription factors that bind initially. TheLtTBP is a candidate for early interaction and directDNA contact, and its association with short regions of tran-scription may be indicative of a key difference betweenrRNA and SL RNA promoters. No mRNA promoters have


been identified in L. tarentolae, however the roles of kineto-plastid TBP in processive and punctuated transcription canbe challenged in L. major where two switch regions onchromosomes 1 and 3 contain non-transcribed regions(Martınez-Calvillo et al., 2003, 2004), and hence likely con-tain sites of transcription initiation. The definition of TBP-binding sites in T. brucei did not identify binding of TbTBPto strand switch regions; in addition to SL RNA it was foundassociated with 3 0-untranslated regions of protein-codinggenes (Ruan et al., 2004). In the case of the L. tarentolae

SL RNA promoter, two sequence elements have been identi-fied in stable transfection and in vitro assays (Yu et al., 1998,2000), however no interacting proteins have been identifiedby EMSA for the proximal �30 region element (Yu et al.,1998), contrasting with L. seymouri (Luo and Bellofatto,1997). This sequence element contains critical informationfor RNA pol II activity from the SL RNA promoter, thusfuture studies will be aimed at identifying proteins interact-ing with the �30 element.

Acknowledgements

We thank Dan Ray, Bob Hitchcock, Bidyottam Mittra,Scott Westenberger and Jesse Zamudio for helpful discus-sions and critical reading of the manuscript; and ArthurGunzl and Vivian Bellofatto for communicating data priorto publication. This work was supported by NIH grantAI34536 to D.A.C. M.C.Y. was supported by the Microbi-al Pathogenesis Training Grant, 5-T32-AI-07323.

References

Agami, R., Aly, R., Halman, S., Shapira, M., 1994. Functional analysis ofcis-acting DNA elements required for expression of the SL RNA genein the parasitic protozoan Leishmania amazonensis. Nucleic Acids Res.22, 1959–1965.

Bangs, J.D., Crain, P.F., Hashizume, T., McCloskey, J.A., Boothroyd,J.C., 1992. Mass spectrometry of mRNA cap 4 from trypanosomatidsreveals two novel nucleosides. J. Biol. Chem. 267, 9805–9815.

Berriman, M., Ghedin, E., Hertz-Fowler, C., Blandin, G., Renauld, H.,Bartholomeu, D.C., Lennard, N.J., Caler, E., Hamlin, N.E., Haas, B.,Bohme, U., Hannick, L., Aslett, M.A., Shallom, J., Marcello, L., Hou,L., Wickstead, B., Alsmark, U.C., Arrowsmith, C., Atkin, R.J., Barron,A.J., Bringaud, F., Brooks, K., Carrington, M., Cherevach, I.,Chillingworth, T.J., Churcher, C., Clark, L.N., Corton, C.H., Cronin,A., Davies, R.M., Doggett, J., Djikeng, A., Feldblyum, T., Field, M.C.,Fraser, A., Goodhead, I., Hance, Z., Harper, D., Harris, B.R., Hauser,H., Hostetler, J., Ivens, A., Jagels, K., Johnson, D., Johnson, J., Jones,K., Kerhornou, A.X., Koo, H., Larke, N., Landfear, S., Larkin, C.,Leech, V., Line, A., Lord, A., Macleod, A., Mooney, P.J., Moule, S.,Martin, D.M., Morgan, G.W., Mungall, K., Norbertczak, H.,Ormond, D., Pai, G., Peacock, C.S., Peterson, J., Quail, M.A.,Rabbinowitsch, E., Rajandream, M.A., Reitter, C., Salzberg, S.L.,Sanders, M., Schobel, S., Sharp, S., Simmonds, M., Simpson, A.J.,Tallon, L., Turner, C.M., Tait, A., Tivey, A.R., Van Aken, S., Walker,D., Wanless, D., Wang, S., White, B., White, O., Whitehead, S.,Woodward, J., Wortman, J., Adams, M.D., Embley, T.M., Gull, K.,Ullu, E., Barry, J.D., Fairlamb, A.H., Opperdoes, F., Barrell, B.G.,Donelson, J.E., Hall, N., Fraser, C.M., Melville, S.E., El-Sayed, N.M.,2005. The genome of the African trypanosome Trypanosoma brucei.Science 309, 416–422.

Bondareva, A.A., Schmidt, E.E., 2003. Early vertebrate evolution of theTATA-binding protein, TBP. Mol. Biol. Evol. 20, 1932–1939.

Boothroyd, J.C., Campbell, D.A., Sutton, R.E., 1985. Expression of surfaceantigen genes in Trypanosoma brucei involves a novel system ofdiscontinuous transcription. In: Lerner, R.A., Channock, R.M., Brown,F. (Eds.), Vaccines 85: Modern Approaches to Vaccines. Cold SpringHarbor Laboratory, Cold Spring Harbor, New York, pp. 61–66.

Campbell, D.A., Sturm, N.R., Yu, M.C., 2000. Transcription of thekinetoplastid spliced leader RNA gene. Parasitol. Today 16, 78–82.

Curotto de Lafaille, M.A., Laban, A., Wirth, D.F., 1992. Gene expressionin Leishmania: analysis of essential 5 0 DNA sequences. Proc. NatlAcad. Sci. USA 89, 2703–2707.

Dahlberg, J.E., Schenborn, E.T., 1988. The human U1 snRNA promoterand enhancer do not direct synthesis of messenger RNA. Nucleic AcidsRes. 16, 5827–5840.

Das, A., Bellofatto, V., 2003. RNA polymerase II-dependent transcriptionin trypanosomes is associated with a SNAP complex-like transcriptionfactor. Proc. Natl Acad. Sci. USA 100, 80–85.

Das, A., Zhang, Q., Palenchar, J.B., Chatterjee, B., Cross, G.A.,Bellofatto, V., 2005. Trypanosomal TBP functions with the multisub-unit transcription factor tSNAP to direct spliced-leader RNA geneexpression. Mol. Cell Biol. 25 (16), 7314–7322.

Dossin, F.d.M., Schenkman, S., 2005. Actively transcribing RNApolymerase II concentrates on spliced leader genes in the nucleus ofTrypanosoma cruzi. Eukaryot. Cell 4, 960–970.

El-Sayed, N.M., Myler, P.J., Bartholomeu, D.C., Nilsson, D., Aggarwal,G., Tran, A.N., Ghedin, E., Worthey, E.A., Delcher, A.L., Blandin,G., Westenberger, S.J., Caler, E., Cerqueira, G.C., Branche, C., Haas,B., Anupama, A., Arner, E., Aslund, L., Attipoe, P., Bontempi, E.,Bringaud, F., Burton, P., Cadag, E., Campbell, D.A., Carrington, M.,Crabtree, J., Darban, H., da Silveira, J.F., de Jong, P., Edwards, K.,Englund, P.T., Fazelina, G., Feldblyum, T., Ferella, M., Frasch, A.C.,Gull, K., Horn, D., Hou, L., Huang, Y., Kindlund, E., Klingbeil, M.,Kluge, S., Koo, H., Lacerda, D., Levin, M.J., Lorenzi, H., Louie, T.,Machado, C.R., McCulloch, R., McKenna, A., Mizuno, Y., Mottram,J.C., Nelson, S., Ochaya, S., Osoegawa, K., Pai, G., Parsons, M.,Pentony, M., Pettersson, U., Pop, M., Ramirez, J.L., Rinta, J.,Robertson, L., Salzberg, S.L., Sanchez, D.O., Seyler, A., Sharma, R.,Shetty, J., Simpson, A.J., Sisk, E., Tammi, M.T., Tarleton, R.,Teixeira, S., Van Aken, S., Vogt, C., Ward, P.N., Wickstead, B.,Wortman, J., White, O., Fraser, C.M., Stuart, K.D., Andersson, B.,2005. The genome sequence of Trypanosoma cruzi, etiologic agent ofChagas disease. Science 309, 409–415.

Gilinger, G., Bellofatto, V., 2001. Trypanosome spliced leader RNA genescontain the first identified RNA polymerase II gene promoter in theseorganisms. Nucleic Acids Res. 29, 1556–1564.

Gilinger, G., Luo, H., Bellofatto, V., 2004. In vivo transcription analysisutilizing chromatin immunoprecipitation reveals a role for trypano-some transcription factor PBP-1 in RNA polymerase III-dependenttranscription. Mol. Biochem. Parasitol. 134, 169–173.

Gunzl, A., 2003. Transcription. In: Marr, J.J., Nilson, T.W., Komuniecki,R.W. (Eds.), Molecular and Medical Parasitology. Academic Press,London, pp. 47–65.

Gunzl, A., Tschudi, C., Nakaar, V., Ullu, E., 1995. Accurate transcriptionof the Trypanosoma brucei U2 small nuclear RNA gene in ahomologous extract. J. Biol. Chem. 270, 17287–17291.

Gunzl, A., Ullu, E., Dorner, M., Fragoso, S.P., Hoffmann, K.F.,Milner, J.D., Morita, Y., Nguu, E.K., Vanacova, S., Wunsch, S.,Dare, A.O., Kwon, H., Tschudi, C., 1997. Transcription of theTrypanosoma brucei spliced leader RNA gene is dependent only onthe presence of upstream regulatory elements. Mol. Biochem.Parasitol. 85, 67–76.

Hernandez, N., 1992. Transcription of vertebrate snRNA genes andrelated genes. In: Yamamoto, K., McKnight, S.L. (Eds.), Transcrip-tional Regulation. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY, pp. 281–313.

Hernandez, N., 1993. TBP, a universal eukaryotic transcription factor?Genes Dev. 7, 1291–1308.


Hernandez, N., 2001. Small nuclear RNA genes: a model system to studyfundamental mechanisms of transcription. J. Biol. Chem. 276, 26733–26736.

Hernandez, N., Weiner, A.M., 1986. Formation of the 30 end of U1 snRNArequires compatible snRNA promoter elements. Cell 47, 249–258.

Hochheimer, A., Tjian, R., 2003. Diversified transcription initiationcomplexes expand promoter selectivity and tissue-specific gene expres-sion. Genes Dev. 17, 1309–1320.

Ivens, A.C., Peacock, C.S., Worthey, E.A., Murphy, L., Aggarwal, G.,Berriman, M., Sisk, E., Rajandream, M.A., Adlem, E., Aert, R.,Anupama, A., Apostolou, Z., Attipoe, P., Bason, N., Bauser, C., Beck,A., Beverley, S.M., Bianchettin, G., Borzym, K., Bothe, G., Bruschi,C.V., Collins, M., Cadag, E., Ciarloni, L., Clayton, C., Coulson, R.M.,Cronin, A., Cruz, A.K., Davies, R.M., De Gaudenzi, J., Dobson,D.E., Duesterhoeft, A., Fazelina, G., Fosker, N., Frasch, A.C., Fraser,A., Fuchs, M., Gabel, C., Goble, A., Goffeau, A., Harris, D., Hertz-Fowler, C., Hilbert, H., Horn, D., Huang, Y., Klages, S., Knights, A.,Kube, M., Larke, N., Litvin, L., Lord, A., Louie, T., Marra, M.,Masuy, D., Matthews, K., Michaeli, S., Mottram, J.C., Muller-Auer,S., Munden, H., Nelson, S., Norbertczak, H., Oliver, K., O’Neil, S.,Pentony, M., Pohl, T.M., Price, C., Purnelle, B., Quail, M.A.,Rabbinowitsch, E., Reinhardt, R., Rieger, M., Rinta, J., Robben, J.,Robertson, L., Ruiz, J.C., Rutter, S., Saunders, D., Schafer, M.,Schein, J., Schwartz, D.C., Seeger, K., Seyler, A., Sharp, S., Shin, H.,Sivam, D., Squares, R., Squares, S., Tosato, V., Vogt, C., Volckaert,G., Wambutt, R., Warren, T., Wedler, H., Woodward, J., Zhou, S.,Zimmermann, W., Smith, D.F., Blackwell, J.M., Stuart, K.D., Barrell,B., Myler, P.J., 2005. The genome of the kinetoplastid parasite,Leishmania major. Science 309, 436–442.

Johnson, P.J., Kooter, J.M., Borst, P., 1987. Inactivation of transcriptionby UV irradiation of T. brucei provides evidence for a multicistronictranscription unit including a VSG gene. Cell 51, 273–281.

Kooter, J.M., De Lange, T., Borst, P., 1984. Discontinuous synthesis ofmRNA in trypanosomes. Eur. Mol. Biol. Org. J. 3, 2387–2392.

Kuhlman, T.C., Cho, H., Reinberg, D., Hernandez, N., 1999. The generaltranscription factors IIA, IIB, IIF, and IIE are required for RNApolymerase II transcription from the human U1 small nuclear RNApromoter. Mol. Cell Biol. 19, 2130–2141.

Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software forMolecular Evolutionary Genetics Analysis and sequence alignment.Brief. Bioinform. 5, 150–163.

Lobo, S.M., Hernandez, N., 1989. A 7 bp mutation converts a humanRNA polymerase II snRNA promoter into an RNA polymerase IIIpromoter. Cell 58, 55–67.

Luo, H., Bellofatto, V., 1997. Characterization of two protein activitiesthat interact at the promoter of the trypanosomatid spliced leaderRNA. J. Biol. Chem. 272, 33344–33352.

Luo, H., Gilinger, G., Mukherjee, D., Bellofatto, V., 1999. Transcriptioninitiation at the TATA-less spliced leader RNA gene promoter requiresat least two DNA-binding proteins and a tripartite architecture thatincludes an Initiator element. J. Biol. Chem. 274, 31947–31954.

Martınez-Calvillo, S., Yan, S., Nguyen, D., Fox, M., Stuart, K., Myler, P.J.,2003. Transcription of Leishmania major friedlin chromosome 1 initiatesin both directions within a single region. Mol. Cell 11, 1291–1299.

Martınez-Calvillo, S., Nguyen, D., Stuart, K., Myler, P.J., 2004.Transcription initiation and termination on Leishmania major chro-mosome 3. Eukaryot. Cell 3, 506–517.

Mittal, V., Hernandez, N., 1997. Role for the amino-terminal region ofhuman TBP in U6 snRNA transcription. Science 275, 1136–1140.

Nakaar, V., Tschudi, C., Ullu, E., 1995. An unusual liaison: Small nuclearand cytoplasmic RNA genes team up with tRNA genes in trypano-somatid protozoa. Parasitol. Today 11, 225–228.

Neuman de Vegvar, H.E., Lund, E., Dahlberg, J.E., 1986. 30 endformation of U1 snRNA precursors is coupled to transcription fromsnRNA promoters. Cell 47, 259–266.

Nunes, L.R., Carvalho, M.R., Shakarian, A.M., Buck, G.A., 1997. Thetranscription promoter of the spliced leader gene from Trypanosoma

cruzi. Gene 188, 157–168.

Palenchar, J.B., Bellofatto, V., 2006. Gene transcription in trypanosomes.Mol. Biochem. Parasitol. 146, 135–141.

Palenchar, J.B., Liu, W., Palenchar, P.M., Bellofatto, V., 2006. Adivergent transcription factor TFIIB in trypanosomes is required forRNA polymerase II-dependent spliced leader RNA transcription andcell viability. Eukaryot. Cell 5 (2), 293–300.

Pugh, B.F., 2000. Control of gene expression through regulation of theTATA-binding protein. Gene 255, 1–14.

Ruan, J.P., Arhin, G.K., Ullu, E., Tschudi, C., 2004. Functionalcharacterization of a Trypanosoma brucei TATA-binding protein-related factor points to a universal regulator of transcription intrypanosomes. Mol. Cell Biol. 24, 9610–9618.

Saito, R.M., Elgort, M.G., Campbell, D.A., 1994. A conserved upstreamelement is essential for transcription of the Leishmania tarentolae mini-exon gene. Eur. Mol. Biol. Org. J. 13, 5460–5469.

Schimanski, B., Laufer, G., Gontchorova, L., Gunzl, A., 2004a. TheTrypanosoma brucei spliced leader RNA and rRNA gene promotershave interchangeable TbSNAP50-binding elements. Nuclei Acids Res.32, 700–709.

Schimanski, B., Ma, L., Gunzl, A., 2004b. Failure to detect binding ofTrypanosoma brucei SNAPc to U2 and U6 snRNA gene sequences byin vitro transcription competition and pull-down assays. Mol.Biochem. Parasitol. 137, 293–296.

Schimanski, B., Nguyen, T.N., Gunzl, A., 2005. Characterization of amulti-subunit transcription factor complex essential for SL RNA genetranscription in Trypanosoma brucei. Mol. Cell Biol. 25 (16),7303–7313.

Schroder, O., Bryant, G.O., Geiduschek, E.P., Berk, A.J., Kassavetis,G.A., 2003. A common site on TBP for transcription by RNApolymerases II and III. Eur. Mol. Bio. Org. J. 22, 5115–5124.

Scopes, R.K., 1985. Protein Purification Principles and Practice. Springer,New York.

Shen, Y., Kassevetis, G.A., Bryant, G.O., Berk, A.J., 1998. Polymerase(Pol) III TATA box-binding protein (TBP)-associated factor Brf bindsto a surface on TBP also required for activated Pol II transcription.Mol. Cell Biol. 18, 1692–1700.

Siegel, L.M., Monty, K.J., 1966. Determination of molecular weights andfrictional ratios of proteins in impure systems by use of gel filtration anddensity gradient centrifugation. Application to crude preparations ofsulfite and hydroxylamine reductases. Biochim. Biophys. Acta 112,346–362.

Strahl-Bolsinger, S., Hecht, A., Luo, K., Grunstein, M., 1997. SIR2 andSIR4 interactions differ in core and extended telomeric heterochro-matin in yeast. Genes Dev. 11, 83–93.

Sturm, N.R., Fleischmann, J., Campbell, D.A., 1998. Efficient trans-splicing of mutated spliced leader exons in Leishmania tarentolae. J.Biol. Chem. 273, 18689–18692.

Sturm, N.R., Yu, M.C., Campbell, D.A., 1999. Transcription terminationand 3 0-end processing of the spliced leader RNA in kinetoplastids.Mol. Cell Biol. 19, 1595–1604.

Thomm, M., 1996. Archaeal transcription factors and their role intranscription initiation. Fed. Eur. Microbiol. Soc. Microbiol. Rev. 18,159–171.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins,D.G., 1997. The CLUSTAL X windows interface: flexible strategiesfor multiple sequence alignment aided by quality analysis tools.Nucleic Acids Res. 25, 4876–4882.

Yu, M.C., Sturm, N.R., Saito, R.M., Roberts, T.G., Campbell, D.A.,1998. Single nucleotide resolution of promoter activity and proteinbinding for the Leishmania tarentolae spliced leader RNA gene. Mol.Biochem. Parasitol. 94, 265–281.

Yu, M.C., Roberts, T.G., Sturm, N.R., Campbell, D.A., 2000. In vitrotranscription of mutated Leishmania tarentolae spliced leader RNAgenes approximates in vivo patterns. Mol. Biochem. Parasitol. 111,391–399.

Zeiner, G.M., Sturm, N.R., Campbell, D.A., 2003. The Leishmania

tarentolae spliced leader contains determinants for association withpolysomes. J. Biol. Chem. 278, 38269–38275.

a non-universal transcription factor? the leishmania tarentolae tata box-binding protein lttbp...

Documents