Molecular & Biochemical Parasitology 128 (2003) 101–105

Short communication

A Plasmodium yoelii yoelii erythrocyte binding protein that usesDuffy binding-like domain for invasion: a rodent model

for studying erythrocyte invasion

C. Durga Prasad, Agam Prasad Singh, Chetan E. Chitnis1, Amit Sharma∗Malaria Group, International Centre for Genetic Engineering and Biotechnology, Aruna Asaf Ali Marg, New Delhi 110 067, India

Received 10 November 2002; received in revised form 20 January 2003; accepted 20 January 2003

Keywords: Erythrocyte invasion; Erythrocyte binding protein;Plasmodium yoelii yoelii; Duffy antigen; Rodent malaria

Malaria continues to be a global health problem and isthe cause of tremendous morbidity and mortality. Invasionof erythrocytes by merozoites is one of the key steps inlife cycle of malaria parasites. This invasion process ismediated by specific receptor–ligand interactions betweenparasite-encoded proteins and erythrocyte surface recep-tors [1]. The human malaria parasitePlasmodium vivax iscompletely dependent on the Duffy blood group antigen forinvasion[2], while Plasmodium falciparum uses both sialicacid-dependent and -independent pathways for erythrocyteinvasion[3–7]. The related simian malaria parasitePasmod-ium knowlesi is able to use the Duffy antigen, sialic acidresidues as well as other as yet unidentified receptors toinvade rhesus erythrocytes[8–10]. A family of erythrocytebinding proteins (EBPs), which includesP. vivax and P.knowlesi Duffy binding proteins (DBPs), theP. knowlesi �and� proteins,P. falciparum EBA-175 and its homologues,mediate interactions with these receptors during erythrocyteinvasion[11]. Based on sequence homology, the extracel-lular domains of these EBPs have been divided into sixsegments (referred to as regions I–VI). Each of these EBPscontains two conserved cysteine-rich regions (regions II andVI) [12]. Expression of different regions of these EBPs onthe surface of COS cells and subsequent erythrocyte bindingassays (EBAs) revealed that the N-terminal cysteine-rich re-gion (region II, also referred to as Duffy binding-like (DBL)domain) had specific erythrocyte binding activity in each

∗ Corresponding author. Tel.:+91-11-26711731;fax: +91-11-26711731.

E-mail addresses: cchitnis@icgeb.res.in (C.E. Chitnis),asharma@icgeb.res.in (A. Sharma).

1 Co-corresponding author.

case[13,14]. Members of the EBP family are located inmicronemes of invasive merozoites and interact with differ-ent erythrocyte surface receptors to mediate invasion[15].EBPs have been identified from primate malaria parasites,such asP. falciparum, P. vivax, Plasmodium reichnowi, P.knowlesi and Plasmodium cynomolgi [1,16–19]. Rodentmalaria parasite species provide an accessible model systemto study parasite biology, and have been used extensivelyto study the various stages of the malaria parasite infectionin the mammalian host. In addition, these rodent modelshave been utilized for the identification and evaluation ofpotential vaccine candidates. So far, EBPs containing DBLdomains have only been identified in primate malaria para-sites[1]. The identification of EBP homologues from rodentmalaria parasite species has not yet been reported.

Earlier, in vivo erythrocyte invasion studies ofPlasmod-ium yoelii yoelii using wild-type and Duffy knockout micerevealed thatP. yoelii yoelii uses the Duffy blood group anti-gen to invade mature erythrocytes, and an unidentified re-ceptor to invade reticulocytes[20]. In this paper, we reportthe identification of aP. yoelii yoelii EBP that uses the proto-typical DBL domain to bind mature mouse erythrocytes. Weshow that theP. yoelii yoelii EBP is a close homologue ofP.vivax andP. knowlesi DBPs. We further show that region IIof theP. yoelii yoelii EBP (PyRII) binds mouse erythrocyteswith specificity. With the identification of an EBP homo-logue inP. yoelii yoelii, it is now possible to study the roleof EBPs in erythrocyte invasion using the widely accessiblerodent malaria parasite model. It will also enable evaluationof receptor-blocking strategies targeting DBL domains.

We searched the PlasmoDB using amino acid sequence ofthe N-terminal cysteine-rich region (region II, PvRII) ofP.vivax DBP (PvDBP) as a query to identify a homologue of

0166-6851/03/$ – see front matter © 2003 Elsevier Science B.V. All rights reserved.doi:10.1016/S0166-6851(03)00040-9

102 C.D. Prasad et al. / Molecular & Biochemical Parasitology 128 (2003) 101–105

C.D. Prasad et al. / Molecular & Biochemical Parasitology 128 (2003) 101–105 103

DBL domain inP. yoelii yoelii. This BLASTP search identi-fied a 295 residue protein domain inP. yoelii yoelii. The iden-tified domain showed∼30% sequence identity with PvRII,along with conservation of the 12 cysteine residues confirm-ing it as a DBL domain. Subsequent to release of the com-plete genome sequence ofP. yoelii yoelii [21], we searchedthe genomic database using the 295 residueP. yoelii yoeliiDBL domain as a query. This yielded a protein sequence of786 amino acids (accession number AABL01001466) en-coded byP. yoelii yoelii. The corresponding nucleotide se-quence is contained in the contig MALPY01471. Analysisof the protein sequence with the program SignalP identifieda signal sequence at the N-terminus of the protein. However,analysis with the program PSORT indicated lack of a trans-membrane region at the C-terminus. Independent searchesof the EST database, using the nucleotide sequence of the786 residue protein, identified a 669 bp EST sequence (ac-cession number BM166444). This EST sequence showed a401 bp overlap with the DNA sequence encoding the 786residue protein from the contig MALPY01471. Comparisonof the EST and genomic sequences allowed assignment ofexon/intron boundaries (Fig. 1A). Translation of the EST andgenomic sequences allowed us to generate an 839 residueprotein, with a 21 residue putative transmembrane region anda 38 residue putative cytoplasmic domain at the C-terminus(Fig. 1A). The P. yoelii yoelii gene consists of five exonsand four introns (Fig. 1A). Exon 1 encodes a 12 residuesignal sequence. Exon 2 encodes a 762 residue protein thatcontains two cysteine-rich regions (Fig. 1A). The transmem-brane region is encoded by exon 3 while the cytoplasmicdomain is encoded by exons 4 and 5. The overall structureand organization of the assembled gene is very similar togenes encodingP. vivax andP. knowlesi DBPs[12].

Comparison of the identified 839 residueP. yoelii yoeliiprotein with P. vivax and P. knowlesi DBPs allowed us todivide the extracellular domain of theP. yoelii yoelii pro-

�

Fig. 1. The overall structure of genes encoding EBPs. (A) The gene and primary protein sequence structure of PyEBP. The identified DNA sequence(3189 bp) of PyEBP is present in the contig MALPY01471 (chromosome 1, total contig length= 4927 bp). The exon (Ex) boundaries are 1–36 (Ex1),240–2526 (Ex2), 2694–2772 (Ex3), 2929–3002 (Ex4) and 3146–3189 (Ex5). The five exons are represented by boxes while the introns are shown aslines and are drawn to scale. Within exon 2, regions from I to VI are demarcated. The 5′ cysteine-rich domain (region II, also called DBL, in gray)and the 3′ cysteine-rich domain (region VI) are shown, along with the signal sequence and the transmembrane regions. (B) CLUSTALW-based multiplesequence alignment of the Duffy binding domains fromPlasmodium yoelii yoelii, Plasmodium vivax andPlasmodium knowlesi EBPs. Homology searcheswere performed using BLASTP algorithm at NCBI (http://www.ncbi.nlm.nih.gov) and PlasmoDB (http://plasmodb.org). Multiple alignment of amino acidsequences was done using CLUSTALW. Prediction of the transmembrane domain and the signal sequence was done using the programs PSORT andSignalP accessed athttp://www.expasy.ch. (C) Alignment of the corresponding region VI ofP. yoelii yoelii, P. vivax, P. knowlesi EBPs andP. yoeliiyoelii YM MAEBL. Shading of identical and conserved residues was done using the program BOXSHADE. (D) Transcription of the gene encoding theP. yoelii yoelii EBP in the blood stages. BALB/c mice were injected intraperitoneally withP. yoelii yoelii (MR4-Cat. No. MRA-312) and parasite RNAwas purified using standard protocols. This RNA was used in the subsequent RT-PCR experiments. Lane 1: 1 kb plus DNA ladder (Invitrogen); lane2: RT-PCR amplification of the 885 bp fragment corresponding to the DBL domain ofP. yoelii yoelii EBP. Lane 3: negative control for the RT-PCRreaction which is lacking the enzyme reverse transcriptase. No product indicates absence of genomic DNA contamination in the RNA preparation. Lane4: negative control for the PCR reaction without the genomic DNA template; and lane 5: PCR amplification of the 885 bp fragment corresponding to theDBL domain of P. yoelii yoelii EBP with genomic DNA as a template. The following forward and reverse primers were used for the PCR amplificationof the 885 bp fragment: PyDBLf: 5′ AACCAGCTGGTTAATGAATGTAAGGAA 3′ and PyDBLr: 5′ AACGGGCCCAGAACAAACACACAATC 3′. Lane6: molecular weight markers, lane 7: PCR usingP. yoelii yoelii cDNA library from MR4. Lane 8: PCR withP. yoelii yoelii genomic DNA using thesame primers, showing the existence of introns in the PyEBP gene. The following forward and reverse primers were used in these PCR amplifications:PyEx1f: 5′ CAGTATTCGCTTATCACATGCA 3′ and PyEx2r: 5′ CTCCTTCACGTGCTGCATCT 3′. These anneal to exons 1 and 2, respectively.

tein into regions I–VI (Fig. 1A). The P. yoelii yoelii se-quence shares high sequence homology with theP. vivaxandP. knowlesi DBPs in the cysteine-rich regions II and VI(Fig. 1B and C). Overall, theP. yoelii yoelii DBL domainshows∼30% sequence identity to region II ofP. vivax andP. knowlesi DBPs (Fig. 1B). There are no gaps in the se-quence alignment and all 12 cysteines and 8 tryptophans areconserved. Analysis ofP. yoelii yoelii region VI indicateshomology to region VI ofP. vivax and P. knowlesi DBPs(Fig. 1C). TheP. yoelii yoelii region VI also shows homol-ogy to the region VI ofP. yoelii yoelii MAEBL, a chimericEBP found in rodent malaria parasites[22,23]. Given thepresence of a DBL domain in region II and a conserved re-gion VI, we propose that this 839 residueP. yoelii yoelii pro-tein belongs to the EBP family and name itP. yoelii yoeliiEBP (PyEBP). Our analysis suggests the conservation oferythrocyte binding function across phylogenetically distantmalaria species.

PCR amplification using oligonucleotide primers based onthe PyEBP DBL domain andP. yoelii yoelii genomic DNAas template generated a single fragment of 885 bp (Fig. 1D).To determine if the PyEBP gene was transcribed in the bloodstages, we extracted RNA fromP. yoelii yoelii blood stageparasites. The RNA was reverse-transcribed using randomhexamers. The resulting cDNA was used as a template forPCR with primers specific for DBL domain from PyEBP(Fig. 1D). This RT-PCR reaction yielded two fragments of885 and∼400 bp, respectively (Fig. 1D, lane 2). No PCRproducts were seen when RNA was used as a template inPCR without the addition of reverse transcriptase, indicatingthat there was no genomic DNA contamination (Fig. 1D,lane 3). The 885 and∼400 bp DNA fragments were clonedand sequenced. Analysis of the 885 bp fragment sequenceshowed an exact match with the DBL domain of PyEBP. The∼400 bp fragment neither had any open reading frames ofsignificant length, nor showed homology to DBL sequences.

104 C.D. Prasad et al. / Molecular & Biochemical Parasitology 128 (2003) 101–105

Fig. 2. (A) Binding of erythrocytes to transfected COS-1 cells expressing the DBL domain ofPlasmodium yoelii yoelii EBP. Erythrocyte binding can beseen as rosettes of erythrocytes bound to transfected COS-1 cells. (B) The number of COS-1 cells with rosettes of erythrocytes was counted in 50 fieldsat a magnification of 200. Data for three independent EBA experiments are shown. The transfection efficiency of COS-1 cells varied from 0.5 to 1%, asdetermined by immunofluorescence assays.

These RT-PCR experiments indicate that the PyEBP gene istranscribed in the blood stages of theP. yoelii yoelii parasitelife cycle. We also performed PCR reactions on genomicDNA and cDNA using specific primers that amplified acrossan intron boundary (Fig. 1D). There is a predicted intronof 0.2 kb between exons 1 and 2. Correct splicing yielded aPCR product of 0.56 kb using cDNA template and a productof 0.76 kb using genomic DNA template (Fig. 1D, lanes7 and 8). These PCR experiments produced the expectedresults and indicated both expression and correct splicing ofthe PyEBP gene in the blood stage.

To test binding to erythrocytes, the DBL domain ofPyEBP (henceforth called PyRII) was expressed on thesurface of mammalian COS cells as a fusion with HSV gDand tested for binding to erythrocytes as described before[13,24]. EBAs were conducted with mouse, human, rhesusand rabbit red cells. In these experiments, PyRII bound tomouse erythrocytes but not to rhesus or rabbit erythrocytes(Fig. 2A). Very low levels of binding were observed withhuman erythrocytes (Fig. 2B). These results suggested thatPyRII specifically bound mouse erythrocytes. It has beenshown thatP. yoelii yoelii uses the Duffy antigen on mature

mouse erythrocytes as a receptor for invasion[20]. To testwhether the DBL domain identified in this work was theligand for the Duffy antigen, we tested binding of PyRII tomouse erythrocytes treated with various enzymes, such aschymotrypsin, trypsin and neuraminidase. It has previouslybeen shown that chymotrypsin, but not trypsin, specificallycleaves the mouse Duffy blood group antigen while neu-raminidase selectively removes sialic acid residues fromproteoglycans[20]. Chymotrypsin-treated mouse erythro-cytes did not bind PyRII expressed on the surface of COS-1cells (Fig. 2). Further, both trypsin and neuraminidase treat-ments had little or no effect on binding of PyRII to mouseerythrocytes (Fig. 2A). These results suggest that PyRIIbinds with specificity to the mouse Duffy antigen duringinvasion.

The recent completion of the rodent malaria parasitegenome sequencing project[21] assisted us in the rapididentification of aP. yoelii yoelii-encoded EBP. Our iden-tification of an EBP fromP. yoelii yoelii provides a ro-dent malaria model system that can be utilized to studyDBL–Duffy interactions involved in erythrocyte invasion.Recombinant malaria vaccines are being developed based

C.D. Prasad et al. / Molecular & Biochemical Parasitology 128 (2003) 101–105 105

on the DBL domains ofP. vivax DBP andP. falciparumEBA-175 [25–27]. The rodent malaria model can now beused to evaluate whether immune responses elicited againstDBL domains of EBPs can block erythrocyte invasion andthereby provide protection against blood stage infection.In addition, the testing of receptor-blocking peptidomimicsthat block the DBL–Duffy interaction can now be under-taken in a rodent malaria model system.

Acknowledgements

We thank past and present members of the Malaria Group,ICGEB, for laboratory assistance. We thank Indu Sharmaand Ravi Chandra for help with isolation of parasite mate-rial. We also thank Drs. Gary Cohen and Roselyn Eisenbergfor providing the plasmid pRE4 and the monoclonal anti-body DL6. Dr. C. Chitnis is a Howard Hughes InternationalResearch Scholar. Dr. C. Chitnis and Dr. A. Sharma aresupported by International Wellcome Trust Senior ResearchFellowships.

References

[1] Chitnis CE. Molecular insights into receptors used by malaria para-sites for erythrocyte invasion. Curr Opin Hematol 2001;8:85–91.

[2] Miller LH, Mason SJ, Clyde DF, McGinniss MH. The resistancefactor toPlasmodium vivax in blacks. The Duffy-blood-group geno-type, FyFy. New Engl J Med 1976;295:302–4.

[3] Miller LH, Haynes JD, McAuliffe FM, Shiroishi T, Durocher JR,McGinniss MH. Evidence for differences in erythrocyte surface re-ceptors for the malarial parasites,Plasmodium falciparum andPlas-modium knowlesi. J Exp Med 1977;46:277–81.

[4] Orlandi PA, Klotz FW, Haynes JD. A malaria invasion receptor,the 175-kilodalton erythrocyte binding antigen ofPlasmodium fal-ciparum recognizes the terminal Neu5Ac (alpha 2–3)Gal-sequencesof glycophorin A. J Cell Biol 1992;116:901–9.

[5] Dolan SA, Proctor JL, Alling DW, Okubo Y, Wellems TE, Miller LH.Glycophorin B as an EBA-175 independentPlasmodium falciparumreceptor of human erythrocytes. Mol Biochem Parasitol 1994;64:55–63.

[6] Okoyeh JN, Pillai CR, Chitnis CE.Plasmodium falciparum fieldisolates commonly use erythrocyte invasion pathways that are in-dependent of sialic acid residues of glycophorin A. Infect Immun1999;67:5784–91.

[7] Reed MB, Caruana SR, Batchelor AH, Thompson JK, Crabb BS,Cowman AF. Targeted disruption of an erythrocyte binding antigenin Plasmodium falciparum is associated with a switch toward a sialicacid-independent pathway of invasion. Proc Natl Acad Sci USA2000;97:7509–14.

[8] Miller LH, Mason SJ, Dvorak JA, McGinniss MH, Rothman IK. Ery-throcyte receptors for (Plasmodium knowlesi) malaria: Duffy bloodgroup determinants. Science 1975;189:561–3.

[9] Haynes JD, Dalton JP, Klotz FW, et al. Receptor-like specificity ofa Plasmodium knowlesi malarial protein that binds to Duffy antigenligands on erythrocytes. J Exp Med 1988;167:1873–81.

[10] Ranjan A, Chitnis CE. Mapping regions containing binding residueswithin functional domains ofPlasmodium vivax and Plasmodiumknowlesi erythrocyte-binding proteins. Proc Natl Acad Sci USA1999;96:14067–72.

[11] Adams JH, Blair PL, Kaneko O, Peterson DS. An expanding eblfamily of Plasmodium falciparum. Trends Parasitol 2001;17:297–9.

[12] Adams JH, Sim BK, Dolan SA, Fang X, Kaslow DC, Miller LH.A family of erythrocyte binding proteins of malaria parasites. ProcNatl Acad Sci USA 1992;89:7085–9.

[13] Chitnis CE, Miller LH. Identification of the erythrocyte bindingdomains ofPlasmodium vivax and Plasmodium knowlesi proteinsinvolved in erythrocyte invasion. J Exp Med 1994;180:497–506.

[14] Sim BK, Chitnis CE, Wasniowska K, Hadley TJ, Miller LH. Receptorand ligand domains for invasion of erythrocytes byPlasmodiumfalciparum. Science 1994;264:1941–4.

[15] Adams JH, Hudson DE, Torii M, et al. The Duffy receptor family ofPlasmodium knowlesi is located within the micronemes of invasivemalaria merozoites. Cell 1990;63:3141–53.

[16] Ozwara H, Kocken CH, Conway DJ, Mwenda JM, Thomas AW.Comparative analysis ofPlasmodium reichenowi and P. falciparumerythrocyte-binding proteins reveals selection to maintain polymor-phism in the erythrocyte-binding region of EBA-175. Mol BiochemParasitol 2001;116:81–4.

[17] Sim BK, Orlandi PA, Haynes JD, et al. Primary structure of the175K Plasmodium falciparum erythrocyte binding antigen and iden-tification of a peptide which elicits antibodies that inhibit malariamerozoite invasion. J Cell Biol 1990;111:1877–84.

[18] Fang XD, Kaslow DC, Adams JH, Miller LH. Cloning of thePlas-modium vivax Duffy receptor. Mol Biochem Parasitol 1991;44:125–32.

[19] Okenu DM, Malhotra P, Lalitha PV, Chitnis CE, Chauhan VS.Cloning and sequence analysis of a gene encoding an erythrocytebinding protein fromPlasmodium cynomolgi. Mol Biochem Parasitol1997;89:301–6.

[20] Swardson-Olver CJ, Dawson TC, Burnett RC, et al.Plasmodiumyoelii uses the murine Duffy antigen receptor for chemokines asa receptor for normocyte invasion and an alternative receptor forreticulocyte invasion. Blood 2002;99:2677–84.

[21] Carlton JM, Angiuoli SV, Suh BB, et al. Genome sequence and com-parative analysis of the model rodent malaria parasitePlasmodiumyoelii yoelii. Nature 2002;419:512–9.

[22] Kappe SH, Curley GP, Noe AR, Dalton JP, Adams JH. Erythro-cyte binding protein homologues of rodent malaria parasites. MolBiochem Parasitol 1997;89:137–48.

[23] Kappe SH, Noe AR, Fraser TS, Blair PL, Adams JH. A family ofchimeric erythrocyte binding proteins of malaria parasites. Proc NatlAcad Sci USA 1998;95:1230–5.

[24] Cohen GH, Wilcox WC, Sodora DL, Long D, Levin JZ, Eisenberg RJ.Expression ofHerpes simplex virus type 1 glycoprotein D deletionmutants in mammalian cells. J Virol 1988;62:1932–40.

[25] Singh S, Pandey K, Chattopadhayay R, et al. Biochemical, biophys-ical, and functional characterization of bacterially expressed and re-folded receptor binding domain ofPlasmodium vivax Duffy-bindingprotein. J Biol Chem 2001;276:17111–6.

[26] Singh AP, Puri SK, Chitnis CE. Antibodies raised against receptor-binding domain ofPlasmodium knowlesi Duffy binding protein in-hibit erythrocyte invasion. Mol Biochem Parasitol 2002;121:21–31.

[27] Pandey KC, Singh S, Pattnaik P, et al. Bacterially expressed andrefolded receptor binding domain ofPlasmodium falciparum EBA-175 elicits invasion inhibitory antibodies. Mol Biochem Parasitol2002;123:23–33.