a subpopulation of stromal cells controls cancer cell ... · tumor biology and immunology a...

Tumor Biology and Immunology

A Subpopulation of Stromal Cells Controls CancerCell Homing to the Bone MarrowStephanie Rossnagl1,2, Hiba Ghura1,2, Christopher Groth1,2, Eva Altrock1,2,Franz Jakob3, Sarah Schott4, Pauline Wimberger5, Theresa Link5,Jan Dominik Kuhlmann5, Arnulf Stenzl6, J€org Hennenlotter6, Tilmann Todenh€ofer6,Markus Rojewski7, Karen Bieback8, and Inaam A. Nakchbandi1,2

Abstract

Breast and prostate cancer cells home to the bone marrow,where they presumably hijack the hematopoietic stem cell niche.We characterize here the elusive premetastatic niche by examiningthe role of mesenchymal stromal cells (MSC) in cancer cellhoming. Decreasing the number of MSC pharmacologicallyenhanced cancer cell homing to the bone marrow in mice. Incontrast, increasing the number of these MSCs by various inter-ventions including G-CSF administration diminished cancer cellhoming. TheMSC subpopulation that correlated best with cancercells expressed stem, endothelial, and pericytic cell markers,suggesting these cells represent an undifferentiated componentof the niche with vascular commitment. In humans, a MSC

subpopulation carryingmarkers for endothelial and pericytic cellswas lower in the presence of cytokeratinþ cells in bone marrow.Taken together, our data show that a subpopulation of MSC withboth endothelial and pericytic cell surface markers suppresses thehomingof cancer cells to thebonemarrow. Similar to thepresenceof cytokeratinþ cells in the bonemarrow, thisMSC subpopulationcould prove useful in determining the risk of metastatic disease,and its manipulation might offer a new possibility for diminish-ing bone metastasis formation.

Significance: These findings establish an inverse relationshipbetween a subpopulation ofmesenchymal stromal cells and cancercells in the bone marrow. Cancer Res; 78(1); 129–42. �2017 AACR.

IntroductionIn the bonemarrow, hematopoietic stem cells need tomaintain

their stemness but also provide cells that differentiate to thevarious hematopoietic lineages (1). Epithelial cancer cells aredetected in the bone marrow, and represent the so-called dissem-inated tumor cells (DTC; reviewed in ref. 2). These cells cansimilarly stay dormant or proliferate and form metastases. Thisraises the possibility that hematopoietic and cancer cells sharecommon niches. Because two prototypes of epithelial cancers,namely breast and prostate are relatively common and associatedwith bone metastases much effort was spent on characterizationof these niches (3). Increasing the number of niches, defined by

the number of hematopoietic stem cells, led to augmented hom-ing of cancer cells to the bone marrow (4, 5). In addition, cancercells seem to compete with the stem cells for their niches, and usesimilar mechanisms as the hematopoietic stem cells to home tothe bone marrow (5).

In the niche itself, both hematopoietic stem cells and cancercells usually remain in a quiescent G0 state and cancer cells mayalso exhibit a G0 growth arrest after homing to the niche (6). Thiscellular dormancy protects the cancer cells from immune surveil-lance and chemotherapeutics, as the majority of chemotherapeu-tics target rapidly dividing cells (7). Therefore, some quiescenttumor cells can survive within the niches during and after treat-ment, where they later form local or even distant metastases,leading to the reported use of persistent cancer cells in the bonemarrowas an independent predictor of recurrence inpatientswithprostate or breast cancer (8, 9).

The composition of the niche remains the subject of intensediscussions. Osteoblasts in culture support survival, expansion,and differentiation of hematopoietic stem cells (10). In addition,transplanted hematopoietic stem cells engraft close to the end-osteal surface (11), and cancer cells localize close to osteoblast-rich bone (12). Induced osteoblast deficiency led to a diminishednumber of hematopoietic stem cells (13), while stimulating theosteoblasts with intermittent PTH increased the number of cancercells in the bone marrow (5).

The other major components of the niche are the vascular cells.Hematopoietic stem cells localize close to the sinusoid (14).Similarly to the localization of stem and cancer cells in proximityto osteoblasts, both leukemia and breast cancer cells engraft closeto the endothelium in the bone marrow (15). Finally, someinvestigators have shown localization of stem cells to both osteo-blasts and vascular cells (16). The question therefore still remains

1Max-Planck Institute for Biochemistry, Martinsried, Germany. 2Institute ofImmunology, University of Heidelberg, Heidelberg, Germany. 3OrthopedicCenter for Musculoskeletal Research, University of Wuerzburg, Wuerzburg,Germany. 4Department of Gynecology, University of Heidelberg, Heidelberg,Germany. 5Department of Gynecology and Obstetrics, University of Dresden,Dresden, Germany. 6Department of Urology, University of Tuebingen,Tuebingen, Germany. 7Institute for Transfusion Medicine, University of Ulm,Ulm, Germany. 8Institute of Transfusion Medicine and Immunology, MedicalFaculty Mannheim, Mannheim, Germany.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

S. Rossnagl and H. Ghura share first authorship of this article.

CorrespondingAuthor: InaamA. Nakchbandi, Max-Planck Institute of Biochem-istry and University of Heidelberg, Im Neuenheimer Feld 305, 69120 Heidelberg,Germany. Phone: 49-6221-568744; Fax: 49-6221-565611; E-mail:[email protected]

doi: 10.1158/0008-5472.CAN-16-3507

�2017 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 129

on November 16, 2020. © 2018 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst October 24, 2017; DOI: 10.1158/0008-5472.CAN-16-3507

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-16-3507&domain=pdf&date_stamp=2017-12-19

http://cancerres.aacrjournals.org/

whether the osteoblastic and vascular niches are two distinctniches or just specified compartments with distinct features ofone hematopoietic stem cell or premetastatic niche.

Besides osteoblasts and endothelial cells, mesenchymal stro-mal cells (MSC) may also contribute to the stem cell nicheand support hematopoietic stem cells (17). Historically, MSCswere identified by their strong adhesion on plastic surfaces,clonal expansion in vitro (colony-forming-unit fibroblast,CFU-f), ability to differentiate into various cells of the mesen-chymal lineage in vitro, and ability to reconstitute the hemato-poietic microenvironment in vivo when transplanted subcuta-neously (18). A benefit in supporting hematopoietic stem cellswas also achieved when MSCs were cotransplanted withhematopoietic stem cells (19). Yet the phenotypical character-ization of MSCs including the surface markers to be usedremains controversial. Initial excitement and definition ofseveral markers was quickly followed by the realization thatthe cells change their characteristics in culture (20). Somemarkers however are consistent with vascular stem cells orcells of vascular origin, for example CD45�CD146þ (21) orCD45�Ter119�Sca1þCD140aþ (22). Despite these advancesmuch remains to be understood about the function of thesecells and their characteristics.

The aim of this study was to investigate a possible role of MSCsin the premetastatic stem cell niche of the bone marrow and theconsequences of their modification in cancer cell homing.

Materials and MethodsMice

CD1-Foxn1nu mice were obtained from Charles-River-Labora-tories. Their T cells lack thymus schooling and are thereforenonfunctional. These mice are suited for xenotransplantation.Mice possessing the Mx1 promotor driving the cre recombinaseand homozygous for the floxed b1 integrin gene (Mx cre b1fl/fl)were used (23–25).

Animal studies were approved by the appropriate office foranimal welfare and performed according to its guidelines (Regier-ungspraesidium Karlsruhe/Germany). The protocols carry thefollowing numbers: G-139/09, G-44/12, G-73/13, G-102/14,G-186/14, G-276/14, G-6/15; G-110/15, G-180/15, G-275/15,G-6/16, G-1/17, G-111/17, G-135/17, G-139/17).

Pharmacological treatmentHuman PTH 1-34 (MPI of Biochemistry, Martinsried) was

administered for 4 days at 400 mg/kg/d subcutaneously and ZA(Hexal) intraperitoneally on days 1 and 3 of PTH treatment at 100mg/kg. Animals received pravastatin (Hexal) for 4 days orally at100 mg/kg/d, clodronate (Hexal) for 4 days at 50 mg/kg/dintraperitoneally, and G-CSF at 100 mL (6 � 105 units) subcuta-neously daily for 5 days.

Cancer cellsMDA-MB-231B/lucþ or PC-3M-Pro4/lucþ were cultured in

DMEM/10% FCS with 800 and 500 mg/mL geneticine respec-tively. These cells were obtained from M. Cecchini (26) in 2005and labelled P1. They were used in passages ranging between110 and 130, and applied within 4 weeks after thawing.Mycoplasma contamination was never detected in these lines.Cells were counted using an automated cell counter (CASY-TT,Innovatis).

Intracardiac injection of cellsIntracardiac injection was performed as described and 100,000

cells injected (27). CD34þ cells were injected at 500,000/mouse.

Intratibial injection of cellsIntratibial injections were performed as described and 50,000

cells injected (28). Tumor cells were either injected alone or incombination with stromal cell populations at 1:2 ratio.

Collection of bone marrow and tumor cell detectionA total of 5 to 10 mL bone marrow were aspirated from the

anterior iliac crests and tumor cell detection was performed basedon the recommendations published by the German Consensusgroup of Senology.

CFU assaysTo quantify MSCs in murine and human bone marrow, CFU-f

were cultured in vitro. A total of 1 � 106 cells were cultured induplicates in six-well-plates in aMEM medium (Gibco) supple-mented with heparin (1 unit/mL, HEXAL), 1% penicillin–strep-tomycin (Gibco) and 10% platelet lysate (IKT, Ulm, Germany—for production protocol, see ref. 29). CFU-f colonies with morethan 50 cells were counted after 14 days using crystal violetstaining.

For the enumeration of hematopoietic colonies, theMethoCultGFM3434 –Assay (Stemcell Technologies) was used according tothe supplier's protocol.

HistomorphometryHistomorphometry was performed as described (30). Sections

were also used for the analysis of bone marrow vascularity.

HomingEvaluation of homing of tumor cells was performed as

published (27) using the resistance gene geneticine introducedin the MDA and PC3 cell line. CD34þ stem cells were detectedusing human alu primers and probe: forward: 50CATGGTGAAA-CCCCGTCTCTA30; reverse: 50GCCTCAGCCTCCCGAGTAG30;probe: 50ATTAGCCGGGCGTGGTGGCG30. Results were quan-tified using standard curves and normalized to mouse bonemarrow cells using probe #64 and primers for b-actin (Universalprobe library; Roche).

Bioluminescence imagingBioluminescence imagingwas performed as described (10, 28).

Competition of various cells and tumor cells in vivoFor MSCs, bone marrow was depleted of CD45þ cells. In a

second step, Sca1þ cells were isolated using Dynabeads (ThermoFisher), stained with CFSE (1:100; Biolegend) and injected in tailveins. As control, CD45þ cells were depleted of Sca1þ cells. Thehepatocarcinoma cell line Huh-7 and cancer-associated fibro-blasts (CAF) isolated from tumors depleted of murine immunecells (muCD45�, 30-F11) and human cancer cells (b2-microglo-bulin, B2M-01) using beads were also used. Mice received tumorcells after 24 hours and were euthanized after 48 hours.

Human cells and bone marrow biopsiesAll studies involving human material were approved by the

appropriate committees and performed in accordance with the

Rossnagl et al.

Cancer Res; 78(1) January 1, 2018 Cancer Research130




declarationofHelsinki. CD34þ cellswere obtained fromCytotechand the protocol was approved by the human investigationcommittee/University of Heidelberg (S-645/15). Frozen bonemarrow aspirates from patients with prostate or breast cancerwere obtained at theUniversityHospital of Tuebingen orDresdenrespectively, and approved by the appropriate human investiga-tion committees (130/2016BO2, EK 237082012) after obtaininginformed consent.

RNA analysisRNA analysis was performed as described (10, 28) and probes

for HPRT #95 and IL1b #42 with primers as suggested by Rocheuniversal probe library were used.

Western blottingSDS-PAGE (10%) was performed and PTHR1 was detected

using a rabbit polyclonal antibody (1:100; Biolegend, #906401).GAPDH was used as a loading control (1:10,000; Sigma,#SAB2100894).

Flow cytometryMurine bone marrow was flushed from femur with DPBS and

red cells lysed. Human biopsies were thawed on ice and washedwith cold aMEM medium (Gibco). Cells were stained with theappropriate antibodies for 30minutes at 4�C. The used antibodiesare as follows (unless stated otherwise, obtained from Biolegend;clone in brackets): Annexin V; CD271 (polyclonal); CD44(IM7); CD140b (APB5); CD144 (TEA1/31; Beckman;); CD146(P1H12); CD235a (HI264); CD271 (ME20.4); CD31 (WM-59); CD349 (W3C4E11); CD45 (HI30); CD56 (5.1H11); CD73(AD2); FAP (427819; R&D); MSCA1 (W8B2); Stro1 (Stro-1);CD11b (M1/70); CD16/32(93); CD29 (HMb1-1); CD31(MEC13.3); CD34 (RAM34; BD Pharmingen); CD45 (30-F11); CD45R (RA3-6B2); CD5 (53-7.3); CD127 (A7R34);CD140a (APA5); CD144 (BV13); CD146 (ME-9F1); a-SMA(1A4; Sigma); ckit (2B8); Gr1 (RB6-8C5); Leptin receptor(polyclonal; R&D); Sca1 (E13-161.7); Ter-119.

For analysis of apoptosis, cells were stained with Annexin-V/PIfor 15minutes,fixed in 1%PFA for 10minutes on ice anddigestedwith RNAse (50 mg/mL, Fermentas) for 15 minutes at 37�C.Staining for flow cytometry markers followed. Flow cytometrywas performed using LSR-2 (BD-Biosciences), and the BD FACS-Diva Software.

HSPCs, more committed progenitor cells, and MSCs wereisolated by flow cytometry (BD FACSAria). Bone marrow wasdepleted of lineage cells (B220, CD5, Ter119, Gr1, and CD11b)using ProteinGDynabeads and stainedwith ckit and Sca1.HSPCsare defined as c-kitþ Sca-1þ (LSK) and more committed progeni-tors as c-kitþ Sca-1� (LKS-). MSCs were stained for CD45, Ter119,CD31, CD146, and CD44 and subjected to sorting.

Apoptosis after PTH/ZA treatment of bone marrow cultureCells sorted and seeded at 2 � 105 cells/well in 24-well-plates

were treated with PTH (2.5–80 mmol/L) and ZA (2.5–10 mmol/L).Mediumwith PTH and ZAwas removed after 1 hour and replacedwith aMEM medium (Gibco) without any supplement. Apopto-sis was assessed after 24 hours.

Statistical analysesAnalyses were performed using SPSS (V20). Analysis of vari-

ance and repeatedmeasures analysis of variance tests were used as

appropriate. If global probability values were smaller than 5%,subsequent comparisons between selected group pairs were thenperformed using Student t, Mann–Whitney, or Wilcoxon pairedtests as appropriate. Survival was evaluated using the Kaplan–Meier method. Correlations were determined using the Pearsoncorrelation coefficient. Stepwise multilinear regression modelswere calculated to find the best flow cytometry marker combina-tion in vivo. Results are expressed as mean � SEM.

ResultsThe combination of parathyroid hormone and zoledronic acidenhances cancer cell homing to the bone marrow

To analyze the stem cell niche, osteoblasts and pericytes werestimulated with high-dose parathyroid hormone (PTH), thereceptor of which is expressed on both cell types (31, 32).Because PTH also indirectly stimulates the osteoclasts, leadingto bone resorption and release of the growth factors stored inthe bone matrix, we aimed to prevent this confounding effectby inhibiting the osteoclasts using zoledronic acid (ZA; ref. 33).

Wild-type mice were treated for 4 days with daily injections ofPTH at 400 mg/kg/d, a dose that prevents osteoblast apoptosis.This dose is higher and the duration is shorter than used toincrease the number of hematopoietic stem cells (31, 34). Micealso received ZA at 100 mg/kg once on day 1 and once on day 3.This dose prevents bone loss in cancer (33). On the fifth day, 105

human cancer cells were injected intracardially and the number ofcancer cells in thebonemarrowafter 24hourswas evaluated usingqPCR to detect the construct transfected in the human cells. Thisnumber was adjusted to the number of nucleated murine cells inthe bone marrow.

Only the combination of PTH/ZA resulted in a doubling ofhoming of cancer cells to the bone marrow but not to otherorgans (Fig. 1A; Supplementary Fig. S1A). Neither the numberof bone marrow blood vessels nor binding of cancer cells toendothelial or sinusoidal cells were affected (SupplementaryFig. S1B and S1C). The increase in homing was confirmed byusing two different cancer cell lines (Breast cancer: MDA-MB-231 and prostate cancer: PC3), as well as using nonmalignantcells, namely human CD34þ stem cells, which were detectedusing the human alu sequence. Neither PTH nor ZA aloneincreased homing, however.

Enhanced homing was not linked to an increase in thenumber of osteoblasts, which were elevated only in thePTH-treated group, but diminished with the use of the com-bination of PTH/ZA or ZA alone, presumably due to ZA effectson osteoblasts (35). The change in homing could not beattributed to altered osteoclast numbers (Fig. 1B), or a changein hematopoietic stem and progenitor cells (HSPC), becauseneither the percentage of HSPCs nor the number of colonyforming units that reflect early hematopoietic progenitors,cultured over 2 weeks in specialized media, called CFU-GEMM, or other types of hematopoietic CFUs were affected(Fig. 1C and D; Supplementary Fig. S1D). Instead, both thepercentage and the absolute number of nonhematopoieticcells were diminished with combined PTH/ZA treatment. Thiswas confirmed by quantifying the number of fibroblastic CFU-f(Fig. 1E and F).

In summary, the combination of PTH/ZA increased homing ofcells to the bone marrow and concomitantly decreased nonhe-matopoietic cells, presumably MSCs.

Marrow Stroma Correlates Negatively with Cancer Cell Homing

www.aacrjournals.org Cancer Res; 78(1) January 1, 2018 131




Rossnagl et al.





Characterization of the MSC population affected by PTH/ZAWe next aimed to further define the population changed in

the presence of increased homing. To do this, we repeatedthe experiments of PTH/ZA treatments followed by evaluationof homing. Simultaneously, the bone marrow was stainedwith a variety of markers expressed on MSCs selected basedon the literature and summarized in Supplementary Table S1A.These were Sca1, CD29, CD31, CD44, a-SMA, leptin receptor,CD146, CD140a, CD271, and PTH receptor type I. Thecells were evaluated after exclusion of hematopoietic cells(CD45�Ter119�).

The expression of some, but not all markers was decreased onnonhematopoietic cells of PTH/ZA-treated mice (SupplementaryFig. S2A and S2B). Of those affected by PTH/ZA, we excludedleptin receptor (low expression), aSMA (intracellular stainingrequired), and CD29 (expressed in more than 80% of bonemarrow cells and for reasons shown later). Statistical evaluationof the remaining markers using multiple regression analysis(Supplementary Table S1B) confirmed a correlation between thenumber of cancer cells in the bonemarrowand the subpopulationidentified as CD45�Ter119�Sca1þCD31þCD146þCD44�. Theobtained R2 value of 0.979 was significant (Fig. 1G; Supplemen-tary Table S1B; Supplementary Fig. S3A). Thus, the identifiedMSCsubpopulation expresses a stem cell (Sca1), an endothelial cell(CD31), and a pericyte marker (CD146). In support of thesefindings, the number of CFU-fs also correlated with this MSCsubpopulation (Supplementary Fig. S3B). The decrease in thisMSC subpopulation was further confirmed in mice treated withPTH/ZA but not subjected to cancer cell injections (Supplemen-tary Fig. S3C).

Consequently, we identified a subpopulation of MSCs thatnegatively correlate with the number of cancer cells that home tothe bone marrow.

The role of prenylationThe combination PTH/ZA decreased a subpopulation of

MSCs in the bone marrow. ZA increases cell apoptosis byinhibiting prenylation of proteins that depend on geranylger-anylation for their function (36). Because ZA is quickly incor-porated within the bone matrix, it is released during boneresorption and ingested by the osteoclasts, leading to theirapoptosis. We therefore evaluated whether inhibition of pre-nylation was responsible for our findings. The combination ofPTH with a statin diminished MSCs and increased cancer cellhoming (Fig. 2A). In contrast, inducing apoptosis in osteoclastswithout affecting prenylation as occurs with clodronate admin-

istration neither affected MSCs nor homing (Fig. 2B; ref. 36).Thus, prenylation inhibition mediates the decrease in MSCs,without osteoclast involvement.

We next evaluated apoptosis in bone marrow cells. Both PTH/ZAundZA increased apoptosis in total bonemarrow,CD45þ, andCD31þ cells (Fig. 2C; Supplementary Fig. S3D). In nonhemato-poietic cells (CD45�Ter119�), CD146þ cells or the subpopula-tion of MSCs with the best correlation with homing, apoptosisonly increased in mice that received the combination PTH/ZA(Fig. 2C; Supplementary Fig. S3D). This suggests that stromal cellsand the subpopulation of MSCs is only susceptible to apoptosisinduced by ZA in the presence of PTH. Indeed, PTH receptor Iwas detected on MSCs but not on hematopoietic stem cells (LSK:lin� Sca1þ ckitþ) or early hematopoietic progenitors (LKS�: lin�

ckitþ Sca1�), whereas some expression was detected in CD45þ

cells (Fig. 2D).We therefore cultured sorted stromal CD45�Sca1þ

and hematopoietic CD45þSca1� cells in vitro with a ZA concen-tration that does not induce apoptosis by itself inCD45� cells (2.5mmol/L). Addition of PTH led to higher apoptosis in the stromalCD45� cells, but didnot further enhance ZA-induced apoptosis inthe hematopoietic CD45þ cells (Fig. 2E).

It has been reported that the sensitivity of smooth musclecells to the proapoptotic effect of prenylation inhibitorsincreases in the presence of PTH due to upregulation of IL1b(37). We therefore evaluated IL1b mRNA expression and con-firmed its increase in the bone marrow of PTH/ZA-treated mice(Fig. 2F).

Thus, the combination of PTH and ZA increases apoptosis andleads to diminished numbers of stromal cells.

Increased homing results in enhanced early cancer growthWe next asked whether the increase in homing will result in

increased cancer growth in PTH/ZA-treated mice.Evaluation of bone marrow 1 week after cancer cell injection

confirmed the persistence of elevated cancer cells in the bonemarrow of mice treated with PTH/ZA (Fig. 3A). As would beexpected by enhanced homing in PTH/ZA-treated mice, earlycancer growth presented as the number of lesions as well as totaltumor burden was increased at 2 weeks (Fig. 3B). After 6 weeksgrowth was no longer increased, in line with published reports onthe ability of ZA to inhibit bonemetastasis growth, however (26).Indeed, no differences could be detected between PTH/ZA or ZAalone, except for the number of lesions, which remained higher inPTH/ZA-treated mice in line with a larger number of microfoci atthe start of cancer development (Fig. 3C). Although survivalimproved with treatment with ZA alone, it was no longer

Figure 1.The combination of PTH and ZA increases homing of tumor cells to the bone marrow. A, Only the simultaneous treatment with PTH/ZA over 4 daysincreased the homing of MDA breast cancer cells but not PTH or ZA alone; n ¼ 21/18/15/17 in five experiments. PTH/ZA also stimulated homing when PC3prostate cancer cellswere used;n¼21/19/8/5 in four experiments. Theeffect couldbe further verified for nonmalignant humanCD34þ stemcells;n¼ 7/7/5/6 in threeexperiments. Mice were treated with PTH 400 mg/kg daily for 4 days. In addition, they received ZA at 100 mg/kg on days 1 and 3. On the fifth day, 105 cancer cells or5 � 105 CD34þ cells were injected intracardially and 24 hours later bone marrow isolated and evaluated by qPCR. B, Histomorphometric analysis of bonesections revealed increased osteoblasts (normalized to bone surface) inmice treatedwith PTHonly andadecreasewhenmicewere treatedwith PTH/ZAor ZAalone.Total osteoclasts showed no differences; n ¼ 9/9/9/9 in three experiments. C, Flow cytometry showed no changes in HSPCs; representative gating ofHSPCs is shown on the right; n ¼ 12/14/11/12 in four experiments. D, In vitro culture of stem cells to develop colonies from bone marrow of treated miceconfirmed that there were no changes in early progenitor colonies (CFU-GEMM); n ¼ 6/6/6/6 in three experiments. E, Flow cytometry also showed a decrease ofstromal cell populations (CD45�) only if PTH/ZA were administered simultaneously but not when PTH or ZA was used alone; n ¼ 22/21/18/17 in five experiments.F,Thiswas confirmedby invitroquantification ofCFU-f. Representative crystal violet staining is shownon the right;n¼ 10/22/14/17 in four experiments.G,Analysis ofthe bone marrow subpopulation characterized as CD45�Ter119�Sca1þCD31þCD146þCD44� (in the remainder, referred to as MSCs) revealed diminishedpopulation size only when the animals were treated with PTH/ZA but not PTH or ZA alone. Representative flow cytometry gating is shown on the right;n ¼ 27/30/28/28 in six experiments.






Rossnagl et al.





significantly better with the addition of PTH to ZA (Fig. 3D). Thisshows that PTH/ZA increases homing and early cancer growth inthe bone marrow.

Presence of an inverse relationship between MSCs and homingof cancer cells

Published reports suggest that cancer cells and hematopoieticstem cells compete for the same niches (5). Furthermore, G-CSFmobilizes hematopoietic stem cells out of the niches (38). Wetherefore administeredG-CSF tomice and confirmed adecrease inHSPCs in bone marrow (Fig. 4A; Supplementary Fig. S4A). Incontrast, G-CSF increased both the percentage and absolutenumber of MSCs (Fig. 4A; Supplementary Fig. S4A). Instead ofthe enhanced homing that would have been seen if cancer cellslocalized to the niches emptied fromHSPCs, homing was dimin-ished (Fig. 4A). Furthermore, administration of G-CSF in com-bination with PTH/ZA failed to diminish HSPC numbers in thebone marrow further, but diminished MSCs, leading to increasedhoming (the dotted line represents untreated CT, Fig. 4B; Sup-plementary Fig. S4B). Thus, PTH/ZA enhancement of homing isindependent of a change in HSPCs.

Finally, deleting b1 integrin, which is expressed onMSCs, usingtheMxpromoter to drive cre expression inmice homozygous for afloxed b1 integrin gene succeeded in total bone marrow andstromal cells (which represent less than 15% of total bonemarrow; Fig. 4C). This did not affect HSPCs, but increased MSCsand CFU-fs. Consequently, cancer cell homing was diminished(Fig. 4D; Supplementary Fig. S4C).

Taken together, these data support an inverse relationshipbetween the subpopulation of MSCs and homing of cancer cellsto the bone marrow in various models.

Establishing causality between changes inMSCs and cancer cellhoming

To establish causality between MSCs and cancer cell homing,we increased MSCs in the bone marrow by adoptive transfer.Wild-type bone marrow depleted of CD45þ cells was exposed toSca1-antibody-coated magnetic beads to isolate Sca1þ cells fromthe negative fraction. Purity of the obtained populations wasconfirmed by flow cytometry (Fig. 5A). These cells were stainedwith CFSE in order to track them in the bone marrow. Wild-typemice were injected with increasing numbers of CD45�Sca1þ

prestained cells (0.1–5� 106). This resulted in a stepwise increasein CFSEþ cells and MSCs in the bone marrow after 24 hours and

also led to higher numbers of CFU-fs after culture of the bonemarrow for 2 weeks (Fig. 5B).

We then evaluated the effect of administration of bonemarrowCD45�Sca1þ cells on homing of cancer cells in comparison to 4controls: untreated mice (CT), mice injected with hematopoieticCD45þ cells, fibroblasts isolated from tumors (after depletion ofimmune cells and cancer cells, CAFs) or a cancer cell line that doesnot home to bonemarrow (Huh-7; ref. 27). The number of cancercells in bone marrow 24 hours after intracardiac administration(or 48 hours after cell transfer) was diminished when eitherhematopoietic CD45þ or stromal CD45�Sca1þ cells were admin-istered (Fig. 5C), suggesting that these two cell types share nicheswith cancer cells in line with our suggestion regarding MSCs andpublished reports on hematopoietic stem cell niches (5).

Because our data suggest a beneficial effect of bone marrowfibroblasts in preventing cancer cell homing, while a growthpromoting role for cancer has been attributed to fibroblasts inthe tumors (39), we evaluated whether bone marrowCD45�Sca1þ cells modified local tumor growth, and comparedthese to CAFs. Both bone marrow CD45�Sca1þ cells and CAFsweremixed in a ratio of 2:1 with cancer cells, and injected into thetibia to induce cancer lesions. As shown in Figure 5D, bonemarrow CD45�Sca1þ cells diminished cancer growth. These dataare in linewith aweak inhibitory effect of bonemarrow stromaoncancer growth.

HigherMSCspredict absence of cancer cells in thebonemarrowof breast and prostate cancer patients

To determine whether a similar relationship is found inhumans, various MSC markers were first evaluated using cellsisolated based on plastic adherence of total bone marrow aspi-rates in passages 0 and 1. The following markers were selectedbased on the literature (Supplementary Table S2A), and theirexpression confirmed: CD31, CD44, CD56, CD73, CD140b,CD144, CD146, CD271, CD349, FAP, MSCA1 and Stro1 (Sup-plementary Fig. S4D and S4E). The expression of these markerswas then analysed in bone marrow aspirates obtained at the timeoffirst operation after cancer diagnosis and frozenuntil analysis intwo cohorts of patients with typical bone-metastasizing tumors(Supplementary Table S2B).

The first group consisted of 36 prostate cancer patients: 15patients with no evidence of cytokeratin-stained cells were com-pared to 21 patients with cytokeratinþ cells in bone marrowaspirates (Supplementary Table S3A and Supplementary Fig.

Figure 2.Protein prenylation and apoptosis. A and B, To examine the potential role of apoptosis in increased homing by PTH/ZA treatment, ZA was substituted by a statin(pravastatin) used to inhibit HMG-CoA reductase mainly in the liver and hence inhibit prenylation systemically or non-nitrogen-containing bisphosphonate(clodronate), which is incorporated in bone matrix and inhibits osteoclasts without affecting prenylation. Pravastatin, which inhibits protein prenylation like ZA,increased homing anddiminishedMSCs in the presence of PTH (A), but clodronate, which inhibits osteoclasts by interferingwithATPmetabolism, did not affectMSCsor homing (B); n ¼ 6 to 10/group in four experiments for MSCs and n ¼ 6 to 14/group in five (A) and four (B) experiments for homing. C, Bone marrow cells andhematopoietic cells of treated mice showed increased apoptosis when treated with ZA alone or the combination PTH/ZA, but the MSC subpopulation(CD45�Ter119�Sca1þCD31þCD146þCD44�) showed only elevated apoptosis when the mice were treated with PTH/ZA simultaneously; n ¼ 9/10/9/7 in threeexperiments. Apoptosis was evaluated in the bone marrow of in vivo–treated mice. D, Western blot analysis of different cell populations in the bone marrowrevealed that early hematopoietic progenitors (LKS�, lin� ckitþ Sca1�) and hematopoietic stem cells (LSK, lin� Sca1þ ckitþ) do not express PTH receptor 1,whereas MSCs do (MSC, CD45�Ter119�Sca1þCD31þCD146þCD44�; MSC inverse, CD45�Ter119�Sca1�CD31�CD146�CD44þ cells). Hematopoietic cells (CD45þ)express PTH receptor 1 to a lesser extent. GAPDH was used as a loading control. Bone marrow sorted from two mice was evaluated. E, Treatment of MSCs(CD45�Sca1þ) in vitrowith PTHandZA revealed that a ZAconcentration that did not induce apoptosis by itself (2.5mmol/L) increased apoptosis in stromal cellswhencombined with PTH. PTH did not enhance apoptosis induced by ZA in hematopoietic cells (CD45þSca1�); n ¼ 6 to 10 per group in three experiments.Cells were isolated frommurine bonemarrow by sorting and treatedwith PTH (10–40 mmol/L) or ZA (2.5–10 mmol/L) alone or in combination. Mediumwas replacedafter 1 hour and apoptosis evaluated after 24 hours. F, PTH treatment increased the relative expression of IL1b mRNA in total bone marrow even when ZAwas present; n ¼ 8/8/8/8 in three experiments.






Figure 3.

Tumor growth and survival after PTH/ZA treatment. A, Seven days after tumor cell injection, the number of tumor cells detected in the bone marrow was stillhigher in the PTH/ZA-treated group; n ¼ 22/21 in four experiments. B, Early growth of bone metastases, 2 weeks after tumor cell injection, was onlyincreased after PTH/ZA treatment andwas due tomore lesions and larger tumors; n¼ 17/16/15/16 in four experiments.C, Tumor burden at a later stage, 6weeks aftertumor cell injection, was decreased in ZA-exposed groups (PTH/ZA and ZA). ZA treatment diminishes the number of lesions and results in smaller tumors,whereas PTH/ZA decreased the tumor burden without affecting the number of lesions. Representative bioluminescence images are shown; n ¼ 12/15/13/14in four experiments. D, Survival after tumor cell inoculation was higher in the ZA-treated group and slightly, yet not significantly, elevated after PTH/ZAtreatment. PTH treatment did not improve survival; n ¼ 17/16/15/16 in four experiments.

Rossnagl et al.





Figure 4.

Inverse relationship between cancer cell homing and changes in MSC numbers. A, Mobilization of HSPCs from the bone marrow after treatment with G-CSFwas confirmed by flow cytometry. The dotted line is set at the level of untreated control. G-CSF treatment also resulted in an increase inMSCs anddiminished homingof MDA tumor cells. Animals received 6 � 105 units daily for 5 days subcutaneously, and bone marrow was evaluated on the sixth day; n ¼ 12/14 in threeexperiments. B, Addition of PTH/ZA to G-CSF did not change HSPCs compared with G-CSF alone, but reduced the number of MSCs. As a result, the homing of MDAcancer cells increased; n ¼ 14/14 in three experiments. The dotted line is set at the level of untreated control shown in A. C, Conditional deletion of integrinb1 (Mx b1fl/fl) in the bonemarrowwas successful in the total bonemarrow and in CD45�Ter119� cells. Littermate b1fl/flwere used as the control group (CT).D,Deletionof integrin b1 in the bone marrow did not affect HSPCs, but increased MSCs and CFU-fs. These mice showed decreased homing of MDA cancer cells tothe bone marrow; n ¼ 6/9 in two experiments.






Figure 5.

Competition between stromal cells and cancer cell homing. A, CD45�Sca1þ cells were isolated using antibody-coated magnetic beads over two steps (depletionusing CD45-coated beads, followed by isolation of Sca1þ cells from the CD45� fraction) and characterized by flow cytometry. The isolated cells were CD45� andSca1þ, as shown in representative histograms. Additionally, the isolated cells were stained for CFSE to distinguish between endogenously and exogenously addedMSCs. B, Increasing the number of injected CD45�Sca1þCFSEþ cells (0.1� 106, 0.5� 106, 1� 106, 5� 106) resulted in a step-wise increase of CFSEþ cells or the MSCsubpopulation in the bone marrow; n¼ 9/12/13/13/9 in three experiments. Culturing bone marrow for 2 weeks showed increased fibroblastic colonies (CFU-f) whenmore CD45�Sca1þ cells were injected; n ¼ 7/8/7/6/7 in two experiments. Bone marrow was isolated after 24 hours of CD45�Sca1þ cell injections. C, Bothhematopoietic (CD45þ) and stromal cells (CD45�Sca1þ) suppressed cancer cell homing to the bone marrow, while CAFs or a cancer cell line that normally does nothome to the bonemarrow (Huh-7) did not; n¼ 20/25/19/7/6 in four experiments. Cancer cells were injected 24 hours after transfer of 5� 106 cells by injection in thetail vein and homing evaluated after an additional 24 hours (48 hours after cell transfer). Hematopoietic cells (CD45þ) and nonhematopoietic stromal cells(CD45�Sca1þ) were isolated from the bone marrow, and CAFs were isolated from tumors depleted of immune and cancer cells. D, Bone marrow stromal cells(CD45�Sca1þ) mixed with cancer cells in a 2:1 ratio suppressed local cancer growth. This was not the case when CAFs were used. Cancer cells were eitherinjected directly in the tibia (5 � 104) or mixed with stromal cells or CAFs before injection. Growth was followed by bioluminescence imaging for 6 weeks.n ¼ 12/11/12 in one experiment.

Rossnagl et al.





S5A). We detected an inverse relationship similar to that seen inmice but the panel differed and included CD271þCD31þ cells(Fig. 6A and B; Supplementary Table S2B). This was confirmed byquantifying CFU-fs in bone marrow cultures (Fig. 6C).

The second cohort consisted of 60 breast cancer patients; 30without evidence of cytokeratin-stained cells and 30 harboringcytokeratinþ cells in the bonemarrow (Supplementary Table S3B;Supplementary Fig. S5B). Because of the suggestion that CD146þ,CD140bþ, or CD144þ in single stained cells might be related tothe absence of cancer cells in the bone marrow (Fig. 6D, notchanged in the prostate cohort as shown in Supplementary Fig.S5A), we expanded the combination of markers in the breastcancer samples. The association between higherMSCs andCFU-fsand absence of cytokeratin-stained cells was confirmed (Fig. 6Eand F), andwas evenmore pronounced after inclusionof the threemarkers CD146, CD140b, and CD144 (Fig. 6E; SupplementaryTable S2B). Thus, our MSC population expresses markers ofendothelial cells (CD31, CD144, CD146) and pericytes (CD146,CD140b).

Some breast cancer patients received neoadjuvant chemother-apy by the time of surgery. Separating those who did from thosewho did not receive neodjuvant chemotherapy revealed thatneoadjuvant chemotherapy did not influence the relationshipbetween MSCs and the cytokeratinþ cells in bone marrow. TheMSC subpopulation was decreased in samples containingcytokeratinþ cells from both patient groups (Supplementary Fig.S5C). Interestingly, the only two patients from the breast cancercohort that developed metastatic visceral and bone lesions(markedwith red circles in Fig. 6E) had no evidence of cytokeratinstaining in bone marrow aspirates but had the lowest number ofMSCs in this group using the expanded panel.

Based on these data, we conclude that cancer cell homing to thebone marrow is modified by MSCs expressing endothelial andpericytic markers in patients with prostate and breast cancer.

DiscussionThe principal finding of this study is that a subpopulation of

MSCs prevents the homing of tumor cells to the bone marrow inmice. A related subpopulation is linked to the absence of dissem-inated cancer cells in the bonemarrow of patients with prostate orbreast cancer modifying the prognosis of the disease.

Even though MSCs are accepted as part of the hematopoieticstem cell niche in the bone marrow, further characterization ofthese cells has been difficult. Pending the development of aconsensus, no specific markers can be viewed as better or worse(17). A correlation between various MSCs and CFU-fs has beenshown (40). We therefore evaluated CFU-fs and were able toconfirm that the decrease in theMSC subpopulations led to adropin the number of CFU-fs in all mouse models as well as in thehuman samples.

Culture itself changes the expression of MSC markers and thebehavior of the stromal cells, which then no longer necessarilyrepresent the in vivo population (41). Therefore, in vivo charac-terization of MSCs is more revealing. The subpopulation weidentified in vivo expresses an interesting combination of surfacemarkers. The first marker Sca1 stands for stem cell antigen-1 isrelated to Ly6 expressed on leukocytes and is used for detection ofHSPCs in combination with c-kit (42). The absence of CD44,which is the adhesive hyaluronic acid receptor mostly found onleukocytes speaks for a nonhematopoietic function of this cell

population (43). In the human cells, CD271, also called low-affinity nerve growth factor receptor, was expressed. It has beenlinked to pluripotency of MSCs (44). Thus, both Sca1 andCD271 convey an undifferentiated state of the MSCs. Theendothelial markers CD31 also called PECAM-1 in miceand humans and CD144 also called VE-cadherin in humansamples suggest a vascular role of the MSCs. The remainingmarkers are mainly detected on pericytes, namely CD146 (alsocalled MCAM, less than 5% of endothelial cells in bone marrowexpress it) and CD140b (the PDGF receptor b; refs. 21, 45–47).Some overlap between endothelial and pericytic markers, how-ever has been reported (47) as was a mesenchymal to endo-thelial transition (48). In summary, the population we iden-tified has stem cell characteristics and carries markers charac-teristic of vascular cells. This suggests that cells with vascularand possibly pericytic characteristics constitute part of theelusive niche to which cancer cells home. It is revealing in thiscontext that CD146þ cells in the bone marrow seemed torepresent part of the hematopoietic niche (21).

A possible explanation for enhanced homing in PTH/ZA-treated mice could have been increased porosity in the vascularbarrier attributable to augmented apoptosis in the bone mar-row of ZA-treated mice (49). However, boosted homing/infil-tration of cancer cells in PTH/ZA-treated mice was only detectedin the bone marrow and not in other organs including the liverand spleen, which also contain sinusoids (Supplementary Fig.S1A). Another explanation would be through loss of HSPCs,because tumor cells and hematopoietic stem cells compete forthe same niche, and cancer cells might be even able to dislodgethe hematopoietic stem cells out of their niches to make thesetheir new home (5). The combination of PTH/ZA diminishedthe MSC subpopulation we identified by increasing apoptosis.Because HSPCs do not express the PTH receptor type I, how-ever, the difference in homing of cancer cells cannot be directlyattributed to a pharmacologically induced apoptosis in HSPCsand hence emptying the niches. This was confirmed by our dataemptying the hematopoietic stem cell niches using G-CSF andshowing a decrease in homing instead of enhanced homing.Furthermore, in the genetic Mx-b1fl/fl model no alterations inthe hematopoietic stem cells were detected. Instead, the changein cancer cell homing was opposite to the change in MSCs.Thus, in the models presented, we found that the number ofMSCs correlated with the number of cancer cells that home tothe bone marrow, whereas the number of HSPCs did not. Wetherefore propose that the subpopulation of MSCs we identi-fied is part of the premetastatic niche.

The inverse relationship between MSCs and cancer cells couldhave been a mere association. The adoptive transfer experimentshowever confirm that less cancer cells can home to the bonemarrow whenever the number of cells in the bone marrow isincreased. It is tempting to speculate that decreases in variouspopulations (MSCs or hematopoietic stem cells) leads to theformation of "holes" in the bone marrow that can be invadedby circulating cancer cells, which, depending on their proximity tospecific bone marrow cell types can either stay dormant orproliferate. This raises an interesting possibility. Namely toattempt to increase the number of MSCs or hematopoietic cellsin order to diminish cancer cell homing.

In patients, cells showing staining for cytokeratin, which is onlyexpressed in epithelial cells (and hence in most types of prostateand breast cancer cells) are used as an indicator for the presence of






Figure 6.

Higher MSC numbers are detected in the absence of cancer cells in human bonemarrow biopsies. Human bonemarrow biopsies from patients with prostate cancer (A–C)or breast cancer (D–F) were analysed for cytokeratin staining and the number of MSCs. A, Cell populations with the markers CD271þ or CD31þ were higher in bonemarrow biopsies from patients with prostate cancer, in whom no cytokeratinþ cells were found. Hematopoietic (CD45þ) and erythroid cells (CD235aþ) were excludedbefore gating. B, The CD271þCD31þ (double positive) population was also higher in biopsies without evidence of cytokeratin staining. Representative flow cytometryplots are shown. C, The total number of CFU-f was higher in the absence of cytokeratin-stained cells. Representative crystal violet staining of CFU-f colonies isshown; n ¼ 15/21. D, In breast cancer biopsies, the absence of cytokeratinþ cells was linked to higher percentages of cells that are positive for CD31, CD271, CD146,CD144, CD140b, and CD56. E, The CD271þCD31þ (double positive) populationwas also higher in the absence of cytokeratinþ cells in bonemarrows of patients with breastcancer, as were CD45� CD235a� CD140bþCD31þCD146þCD271þCD144þ cells. Representative flow cytometry plots are shown. Samples from the two patients whodeveloped metastases are circled red. F, Culturing bone marrow also showed more fibroblastic colonies (CFU-fs) in the cytokeratin-negative biopsies; n ¼ 30/30.

Rossnagl et al.





cancer in the bone marrow. Therefore, detection of cancer cells inthe bone marrow was evaluated in relationship to prognosis andfound to be a predictor of relapse and/or poor prognosis (8, 9).Our findings in patients do not address the possibility that sometumors might release low numbers of cancer cells, resulting indiminished cancer cell homing to the bonemarrow irrespective ofthe number of MSCs. Furthermore, cancer cells occasionallyundergo epithelial–mesenchymal transition and hence no longerexpress cytokeratins making them undetectable in the bonemarrow (50). Nevertheless, our data show a relationship betweenMSCs and cytokeratin-stained cells in the bone marrow inhumans similar to the relationship between MSCs and cancercell homing in mice. Whether MSC subpopulations might pro-vide a reliablemethod for the predictionofmetastaseswill have tobe determined prospectively in larger cohorts of patients.

The new findings of this study highlight the role of a subpop-ulation of MSCs in early homing of tumor cells in mice andhumans and offers new directions in early diagnosis of bonemetastasis and in modifying the development of metastases.

Disclosure of Potential Conflicts of InterestF. Jakob reports receiving a commercial research grant fromNovartis and has

received speakers bureau honoraria from Amgen, Novartis, Lilly, and Alexion.T. Todenh€ofer is a consultant/advisory board member for Amgen and Astellas.No potential conflicts of interest were disclosed by the other authors.

Authors' ContributionsConception and design: S. Rossnagl, F. Jakob, S. Schott, P. Wimberger,I.A. Nakchbandi

Development of methodology: C. Groth, F. Jakob, I.A. NakchbandiAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.):H.Ghura,C.Groth, E. Altrock, S. Schott, P.Wimberger,T. Link, J.D. Kuhlmann, A. Stenzl, J. Hennenlotter, T. Todenh€ofer, K. Bieback,I.A. NakchbandiAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): S. Rossnagl, H. Ghura, C. Groth, F. Jakob, S. Schott,P. Wimberger, J.D. Kuhlmann, I.A. NakchbandiWriting, review, and/or revision of the manuscript: S. Rossnagl, F. Jakob,S. Schott, P. Wimberger, J.D. Kuhlmann, A. Stenzl, T. Todenh€ofer, K. Bieback,I.A. NakchbandiAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases):C. Groth, P.Wimberger, A. Stenzl, J. HennenlotterStudy supervision: P. Wimberger, A. Stenzl, I.A. NakchbandiOther (conception and design for characterization of mesenchymal stromalcells): M. Rojewski

AcknowledgmentsWe thank R. F€assler for his input. I.A. Nakchbandi (Max-Planck Society: M.

KF.A.BIOC0001;GermanResearchCouncil-DFG-:NA400/5,NA400/7,NA400/9); H. Ghura (Doctoral fellowship from the German Academic ExchangeService-DAAD).

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received December 30, 2016; revised June 26, 2017; accepted October 18,2017; published OnlineFirst October 24, 2017.

References1. Mayani H. The regulation of hematopoietic stem cell populations.

F1000Res 2016;5. doi: 10.12688/f1000research.8532.1.2. Coleman RE. Clinical features of metastatic bone disease and risk of

skeletal morbidity. Clin Cancer Res 2006;12:6243s–9s.3. Weilbaecher KN, Guise TA,McCauley LK. Cancer to bone: a fatal attraction.

Nat Rev Cancer 2011;11:411–25.4. Shiozawa Y, Havens AM, Pienta KJ, Taichman RS. The bone marrow niche:

habitat to hematopoietic andmesenchymal stem cells, and unwitting hostto molecular parasites. Leukemia 2008;22:941–50.

5. ShiozawaY, PedersenEA,HavensAM, JungY,MishraA, Joseph J, et al.Humanprostate cancermetastases target thehematopoietic stemcell niche to establishfootholds in mouse bone marrow. J Clin Invest 2011;121:1298–312.

6. Aguirre-Ghiso JA. Models, mechanisms and clinical evidence for cancerdormancy. Nat Rev Cancer 2007;7:834–46.

7. Meads MB, Hazlehurst LA, Dalton WS. The bone marrow microenviron-ment as a tumor sanctuary and contributor to drug resistance. Clin CancerRes 2008;14:2519–26.

8. Morgan TM, Lange PH, Porter MP, Lin DW, Ellis WJ, Gallaher IS, et al.Disseminated tumor cells in prostate cancer patients after radical prosta-tectomy and without evidence of disease predicts biochemical recurrence.Clin Cancer Res 2009;15:677–83.

9. Pantel K, Brakenhoff RH, Brandt B. Detection, clinical relevance andspecific biological properties of disseminating tumour cells.Nat RevCancer2008;8:329–40.

10. Rossnagl S, Altrock E, Sens C, Kraft S, Rau K, Milsom MD, et al. EDA-fibronectin originating from osteoblasts inhibits the immune responseagainst cancer. PLoS Biol 2016;14:e1002562.

11. Zhang J, Niu C, Ye L, Huang H, He X, Tong WG, et al. Identification of thehaematopoietic stem cell niche and control of the niche size. Nature2003;425:836–41.

12. Wang N, Docherty FE, BrownHK, Reeves KJ, Fowles AC, Ottewell PD, et al.Prostate cancer cells preferentially home toosteoblast-rich areas in the earlystages of bone metastasis: evidence from in vivo models. J Bone Miner Res2014;29:2688–96.

13. Visnjic D, Kalajzic Z, Rowe DW, Katavic V, Lorenzo J, Aguila HL. Hema-topoiesis is severely altered in mice with an induced osteoblast deficiency.Blood 2004;103:3258–64.

14. Kiel MJ, Yilmaz OH, Iwashita T, Terhorst C, Morrison SJ. SLAM familyreceptors distinguish hematopoietic stem and progenitor cells and revealendothelial niches for stem cells. Cell 2005;121:1109–21.

15. Price TT, Burness ML, Sivan A,WarnerMJ, Cheng R, Lee CH, et al. Dormantbreast cancer micrometastases reside in specific bone marrow niches thatregulate their transit to and from bone. Sci Translat Med 2016;8:340ra73.

16. Nombela-Arrieta C, Pivarnik G,Winkel B, Canty KJ, Harley B, Mahoney JE,et al. Quantitative imaging of haematopoietic stem and progenitor celllocalization and hypoxic status in the bone marrow microenvironment.Nat Cell Biol 2013;15:533–43.

17. Kfoury Y, Scadden DT. Mesenchymal cell contributions to the stem cellniche. Cell Stem Cell 2015;16:239–53.

18. DominiciM, Le Blanc K,Mueller I, Slaper-Cortenbach I,Marini F, KrauseD,et al. Minimal criteria for definingmultipotentmesenchymal stromal cells.The international society for cellular therapy position statement. Cytother-apy 2006;8:315–7.

19. Le Blanc K, Samuelsson H, Gustafsson B, Remberger M, Sundberg B,Arvidson J, et al. Transplantation of mesenchymal stem cells to enhanceengraftment of hematopoietic stem cells. Leukemia 2007;21:1733–8.

20. Lin CS, Xin ZC, Dai J, Lue TF. Commonly used mesenchymal stem cellmarkers and tracking labels: Limitations and challenges. Histol Histo-pathol 2013;28:1109–16.

21. Sacchetti B, Funari A, Michienzi S, Di Cesare S, Piersanti S, Saggio I, et al.Self-renewing osteoprogenitors in bone marrow sinusoids can organize ahematopoietic microenvironment. Cell 2007;131:324–36.

22. Morikawa S, Mabuchi Y, Kubota Y, Nagai Y, Niibe K, Hiratsu E, et al.Prospective identification, isolation, and systemic transplantation of mul-tipotent mesenchymal stem cells in murine bone marrow. J Exp Med2009;206:2483–96.

23. Kawelke N, Vasel M, Sens C, von Au A, Dooley S, Nakchbandi IA.Fibronectin protects from excessive liver fibrosis by modulating the






availability of and responsiveness of stellate cells to active TGF-beta. PLoSOne 2011;6:e28181.

24. Kraft S, Klemis V, Sens C, Lenhard T, Jacobi C, Samstag Y, et al. Identifi-cation and characterization of a unique role for EDB fibronectin inphagocytosis. J Mol Med (Berl) 2016;94:567–81.

25. Sens C, Huck K, Pettera S, Uebel S, Wabnitz G, Moser M, et al. Fibronectinscontaining extradomain A or B enhance osteoblast differentiation viadistinct integrins. J Biol Chem 2017;292:7745–60.

26. WetterwaldA, vanderPluijmG,Que I, SijmonsB, Buijs J, KarperienM, et al.Optical imaging of cancer metastasis to bone marrow: a mouse model ofminimal residual disease. Am J Pathol 2002;160:1143–53.

27. Rossnagl S, von Au A, Vasel M, Cecchini AG, Nakchbandi IA. Blood clotformation does not affect metastasis formation or tumor growth in amurine model of breast cancer. PLoS One 2014;9:e94922.

28. von Au A, Vasel M, Kraft S, Sens C, Hackl N, Marx A, et al. Circulatingfibronectin controls tumor growth. Neoplasia 2013;15:925–38.

29. Fekete N, Gadelorge M, Furst D, Maurer C, Dausend J, Fleury-Cappellesso S,et al. Platelet lysate from whole blood-derived pooled platelet concentratesandapheresis-derivedplatelet concentrates for the isolationandexpansionofhuman bone marrow mesenchymal stromal cells: production process, con-tent and identification of active components. Cytotherapy 2012;14:540–54.

30. Sens C, Altrock E, Rau K, Klemis V, von Au A, Pettera S, et al. An O-glycosylation of fibronectin mediates hepatic osteodystrophy throughalpha4beta1 integrin. J Bone Miner Res 2017;32:70–81.

31. Jilka RL, Weinstein RS, Bellido T, Roberson P, Parfitt AM, Manolagas SC.Increased bone formation by prevention of osteoblast apoptosis withparathyroid hormone. J Clin Invest 1999;104:439–46.

32. Yu B, Zhao X, Yang C, Crane J, Xian L, Lu W, et al. Parathyroid hormoneinduces differentiation of mesenchymal stromal/stem cells by enhanc-ing bone morphogenetic protein signaling. J Bone Miner Res 2012;27:2001–14.

33. Daubine F, Le Gall C, Gasser J, Green J, Clezardin P. Antitumor effects ofclinical dosing regimens of bisphosphonates in experimental breast cancerbone metastasis. J Natl Cancer Inst 2007;99:322–30.

34. Calvi LM, Adams GB, Weibrecht KW, Weber JM, Olson DP, Knight MC,et al. Osteoblastic cells regulate the haematopoietic stem cell niche. Nature2003;425:841–6.

35. Patntirapong S, Singhatanadgit W, Chanruangvanit C, Lavanrattanakul K,Satravaha Y. Zoledronic acid suppresses mineralization through directcytotoxicity and osteoblast differentiation inhibition. J Oral Pathol Med2012;41:713–20.

36. Roelofs AJ, Thompson K, Gordon S, Rogers MJ. Molecular mechanisms ofaction of bisphosphonates: current status. Clin Cancer Res 2006;12:6222s–30s.

37. Takahashi M, Ogata Y, Okazaki H, Takeuchi K, Kobayashi E, Ikeda U, et al.Fluvastatin enhances apoptosis in cytokine-stimulated vascular smoothmuscle cells. J Cardiovasc Pharmacol 2002;39:310–7.

38. Adams GB, Martin RP, Alley IR, Chabner KT, Cohen KS, Calvi LM, et al.Therapeutic targeting of a stem cell niche. Nat Biotechnol 2007;25:238–43.

39. Spaeth EL, Dembinski JL, Sasser AK, Watson K, Klopp A, Hall B, et al.Mesenchymal stem cell transition to tumor-associated fibroblasts contri-butes to fibrovascular network expansion and tumor progression. PLoSOne 2009;4:e4992.

40. Cuthbert R, Boxall SA, Tan HB, Giannoudis PV, McGonagle D, Jones E.Single-platform quality control assay to quantify multipotential stromalcells in bone marrow aspirates prior to bulk manufacture or direct ther-apeutic use. Cytotherapy 2012;14:431–40.

41. Bara JJ, Richards RG, Alini M, Stoddart MJ. Concise review: Bone marrow-derived mesenchymal stem cells change phenotype following in vitroculture: implications for basic research and the clinic. Stem Cells 2014;32:1713–23.

42. Holmes C, Stanford WL. Concise review: stem cell antigen-1: expression,function, and enigma. Stem Cells 2007;25:1339–47.

43. Qian H, Le Blanc K, Sigvardsson M. Primary mesenchymal stem andprogenitor cells from bone marrow lack expression of CD44 protein.J Biol Chem 2012;287:25795–807.

44. BuhringHJ, Battula VL, Treml S, Schewe B, Kanz L, VogelW. Novelmarkersfor the prospective isolation of human MSC. Ann N Y Acad Sci2007;1106:262–71.

45. Espagnolle N, Guilloton F, Deschaseaux F, GadelorgeM, Sensebe L, BourinP. CD146 expression on mesenchymal stem cells is associated with theirvascular smooth muscle commitment. J Cell Mol Med 2014;18:104–14.

46. Tormin A, Li O, Brune JC, Walsh S, Schutz B, Ehinger M, et al. CD146expression on primary nonhematopoietic bone marrow stem cells iscorrelated with in situ localization. Blood 2011;117:5067–77.

47. Bagley RG, Weber W, Rouleau C, Teicher BA. Pericytes and endothelialprecursor cells: cellular interactions and contributions to malignancy.Cancer Res 2005;65:9741–50.

48. Ubil E, Duan J, Pillai IC, Rosa-Garrido M, Wu Y, Bargiacchi F, et al.Mesenchymal-endothelial transition contributes to cardiac neovascular-ization. Nature 2014;514:585–90.

49. Zhou W, Fong MY, Min Y, Somlo G, Liu L, Palomares MR, et al. Cancer-secreted miR-105 destroys vascular endothelial barriers to promote metas-tasis. Cancer Cell 2014;25:501–15.

50. Yu M, Bardia A, Wittner BS, Stott SL, Smas ME, Ting DT, et al. Circulatingbreast tumor cells exhibit dynamic changes in epithelial andmesenchymalcomposition. Science 2013;339:580–4.


Rossnagl et al.




2018;78:129-142. Published OnlineFirst October 24, 2017.Cancer Res Stephanie Rossnagl, Hiba Ghura, Christopher Groth, et al. the Bone MarrowA Subpopulation of Stromal Cells Controls Cancer Cell Homing to

Updated version

10.1158/0008-5472.CAN-16-3507doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2017/10/24/0008-5472.CAN-16-3507.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/78/1/129.full#ref-list-1

This article cites 49 articles, 11 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/78/1/129.full#related-urls

This article has been cited by 1 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/78/1/129To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-16-3507

http://cancerres.aacrjournals.org/content/suppl/2017/10/24/0008-5472.CAN-16-3507.DC1

http://cancerres.aacrjournals.org/content/78/1/129.full#ref-list-1

http://cancerres.aacrjournals.org/content/78/1/129.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/78/1/129


a subpopulation of stromal cells controls cancer cell ... · tumor biology and immunology a...

Documents