a trp channel in the lysosome regulates large particle...

Please cite this article in press as: Samie et al., A TRP Channel in the Lysosome Regulates Large Particle Phagocytosis via Focal Exocytosis, Devel-opmental Cell (2013), http://dx.doi.org/10.1016/j.devcel.2013.08.003

Developmental Cell

Article

A TRP Channel in the Lysosome RegulatesLarge Particle Phagocytosis via Focal ExocytosisMohammad Samie,1 Xiang Wang,1 Xiaoli Zhang,1 Andrew Goschka,1 Xinran Li,1 Xiping Cheng,1 Evan Gregg,1

Marlene Azar,1 Yue Zhuo,1 Abigail G. Garrity,1 Qiong Gao,1 Susan Slaugenhaupt,4 Jim Pickel,5 Sergey N. Zolov,3

Lois S. Weisman,3 Guy M. Lenk,2 Steve Titus,6 Marthe Bryant-Genevier,6 Noel Southall,6 Marugan Juan,6 Marc Ferrer,6

and Haoxing Xu1,*1Department of Molecular, Cellular, and Developmental Biology2Department of Human Genetics3Department of Cell and Developmental Biology and Life Sciences Institute

University of Michigan, Ann Arbor, MI 48109, USA4Department of Neurology (Genetics), Center for Human Genetic Research, Massachusetts General Hospital/Harvard Medical School,

CPZN-5254, 185 Cambridge Street, Boston, MA 02114, USA5NIMH Transgenics, National Institutes of Health, 49 Convent Drive Room B1C25, Bethesda, MD 20892, USA6NIH/NCATS/NCGC, 9800 Medical Center Drive, Rockville, MD 20850, USA*Correspondence: [email protected]

http://dx.doi.org/10.1016/j.devcel.2013.08.003

SUMMARY

Phagocytosis of large extracellular particles such asapoptotic bodies requires delivery of the intracellularendosomal and lysosomal membranes to form plas-malemmal pseudopods. Here, we identified mucoli-pin TRP channel 1 (TRPML1) as the key lysosomalCa2+ channel regulating focal exocytosis and phago-some biogenesis. Both particle ingestion and lyso-somal exocytosis are inhibited by synthetic TRPML1blockers and are defective in macrophages isolatedfrom TRPML1 knockout mice. Furthermore, TRPML1overexpression and TRPML1 agonists facilitate bothlysosomal exocytosis and particle uptake. Usingtime-lapse confocal imaging and direct patch clamp-ing of phagosomal membranes, we found that parti-cle binding induces lysosomal PI(3,5)P2 elevation totrigger TRPML1-mediated lysosomal Ca2+ releasespecifically at the site of uptake, rapidly deliveringTRPML1-resident lysosomal membranes to nascentphagosomes via lysosomal exocytosis. Thus phago-cytic ingestion of large particles activates aphosphoinositide- and Ca2+-dependent exocytosispathway to provide membranes necessary for pseu-dopod extension, leading to clearance of senescentand apoptotic cells in vivo.

INTRODUCTION

Macrophages participate in tissue remodeling and cellular clear-

ance by engulfing large extracellular particles, such as apoptotic

cells or senescent red blood cells (RBCs), through a highly regu-

lated process called phagocytosis (Flannagan et al., 2012). Par-

ticle binding to specific cell surface receptors, such as IgG Fc

receptors, triggers a cascade of signaling events to rapidly

extend the plasma membrane around the particle(s) (Aderem

Devel

and Underhill, 1999). Plasma membrane extensions, called

plasmalemmal pseudopods, form phagocytic cups to ingest

particles into vacuole-like structures called phagosomes within

several minutes after particle binding (Niedergang and Chavrier,

2004) (see Figure 6I). Nascent phagosomes then undergo mem-

brane fusion and fission events, collectively called phagosomal

maturation, in a time course of tens of minutes to become phag-

olysosomes tomediate particle digestion (Aderem andUnderhill,

1999; Vieira et al., 2002). Although a large amount of plasma

membrane is internalized during phagocytosis (Aderem and

Underhill, 1999; Touret et al., 2005), paradoxically, the overall

surface area of the phagocytosing cells does not decrease

(Braun and Niedergang, 2006; Huynh et al., 2007) and indeed in-

creases significantly before the closing of the phagocytic cups

(Holevinsky and Nelson, 1998). Consistently, membrane fusion

machinery is shown to be required for phagosome formation/

biogenesis and efficient phagocytosis (Hackam et al., 1998),

and a substantial amount of membrane from intracellular com-

partments are found to be added to the cell surface at the sites

of particle uptake (so called ‘‘focal’’ exocytosis) (Braun et al.,

2004; Czibener et al., 2006).

Recycling endosomes have been shown as a supply of intra-

cellular membrane for phagosome formation and particle uptake

in a vesicle-associated membrane protein 3 (VAMP3)-depen-

dent manner (Cox et al., 1999; Bajno et al., 2000). More recently,

lysosomes have been identified as another major source of intra-

cellular membrane required for particle uptake, particularly un-

der high load conditions, i.e., when large (>5 mm) and/or multiple

particles are ingested by a single phagocyte (Huynh et al., 2007).

Under such conditions, lysosomes are involved in the very early

steps of phagosome biogenesis/formation, prior to the closing of

the phagocytic cups (see Figure 6I) (Braun et al., 2004; Czibener

et al., 2006). Fusion of lysosomes with the plasma membrane

(lysosomal exocytosis) and the delivery of lysosomal mem-

branes/proteins to the surface of the newly formed phagosomes

are observed at the sites of particle ingestion (Swanson et al.,

1987; Tapper and Sundler, 1995), and manipulations blocking

lysosomal exocytosis significantly reduce particle uptake in

macrophages (Braun et al., 2004; Czibener et al., 2006).

opmental Cell 26, 1–14, September 16, 2013 ª2013 Elsevier Inc. 1

mailto:[email protected]


Developmental Cell

TRPML1 Channels Regulate Phagosome Formation


Ca2+ is the only known trigger that has been identified for

lysosomal exocytosis (Andrews, 2000), with Synaptotagmin VII

(Syt-VII) being the primary Ca2+ sensor in the lysosome (Czibener

et al., 2006). Vesicle-associated membrane protein 7 (VAMP7), a

SNARE protein in the late endosome and lysosome, is required

for lysosomal exocytosis (Braun et al., 2004). Consistent with

the role of lysosomal exocytosis in particle ingestion, macro-

phages lacking VAMP7 or Syt VII exhibit defects in both lyso-

somal exocytosis and particle uptake, but preferentially under

high particle loads (Braun et al., 2004; Czibener et al., 2006).

Intracellular Ca2+ ([Ca2+]i) elevation was observed in the vicinity

of the particle uptake sites in neutrophils (Theler et al., 1995;

Tapper et al., 2002), but not in macrophages (Nunes and

Demaurex, 2010). However, preloading cells with the fast

membrane-permeant Ca2+ chelator BAPTA-AM dramatically re-

duces lysosomal exocytosis and particle uptake inmacrophages

(Tapper et al., 2002; Czibener et al., 2006), suggesting that a

small amount of Ca2+ release from nonconventional internal

stores that might have escaped detection by using conventional

Ca2+ imaging methods may play a crucial role in macrophage

phagocytosis. Because the lysosomal lumen is believed to be

the main source of Ca2+ for Ca2+-dependent vesicular trafficking

in the late endocytic pathways (Pryor et al., 2000), it is possible

that lysosomes themselves provide the Ca2+ required for

particle-induced exocytosis. However, definitive evidence to

support this hypothesis is still lacking, and more importantly,

the ion channel(s) responsible for Ca2+ release from lysosomes

still remains elusive.

Transient receptor potential mucolipin-1 (TRPML1 or ML1) is a

member of the TRP cation channel superfamily and is primarily

localized on the lysosome membrane (Cheng et al., 2010).

Human mutations of TRPML1 cause mucolipidosis type IV

(MLIV), a childhood neurodegenerative disorder with lysosomal

trafficking defects at the cellular level (Sun et al., 2000; Cheng

et al., 2010). In aDrosophilamodel of MLIV, it has been proposed

that the defective clearance of late apoptotic neurons by phago-

cytes contributes significantly to neurodegeneration (Venkata-

chalam et al., 2008). By performing patch-clamp recordings

directly on lysosomal membranes and by measuring lysosomal

Ca2+ release using genetically encoded Ca2+ sensors, we have

characterized ML1 as a Ca2+-permeable channel on the lyso-

somal membrane (Dong et al., 2010; Shen et al., 2012). ML1

conducts Ca2+ from the lysosome lumen into the cytosol and is

specifically activated by phosphatidylinositol 3,5-bisphosphate

[PI(3,5)P2], a late endosome and lysosome-specific low-abun-

dance phosphoinositide (Dong et al., 2010). In the current study,

using mouse knockouts and synthetic agonists/antagonists of

ML1, we investigated the roles of ML1 in phagocytic particle

uptake in bone marrow-derived macrophages.

RESULTS

Expression of ML1 Is Necessary for Efficient Uptake ofLarge Particles in Mouse MacrophagesTo study particle uptake/ingestion, we isolated bone marrow

macrophages (BMMs) (Chow et al., 2004) from wild-type (WT)

and ML1 knockout (KO) mice (Venugopal et al., 2007). ML1 KO

BMMs contained no detectable level of full-length ML1 tran-

script, as shown by RT-PCR analysis (Figure 1A). Consistent

2 Developmental Cell 26, 1–14, September 16, 2013 ª2013 Elsevier I

with this, direct patch-clamping the endolysosomal membranes

(Dong et al., 2008) showed that ML-SA1, a membrane-perme-

able TRPML-specific synthetic agonist (Shen et al., 2012), and

PI(3,5)P2, an endogenous activator of ML1 (Cheng et al., 2010;

Dong et al., 2010), activated whole-endolysosome ML1-like cur-

rents (IML1) inWT, but not ML1 KOBMMs (Figure 1B). In contrast,

no significant differences were noted in cell morphology, cell

size, and CD11b (macrophage-specific surface receptor) immu-

noreactivity between WT and ML1 KO BMMs (Figure S1A avail-

able online). The use of animals was approved by the University

Committee on Use and Care for Animals (UCUCA) at the Univer-

sity of Michigan.

To investigate the role of ML1 in particle ingestion, WT and

ML1 KO BMMs were exposed to IgG-opsonized sheep red

blood cells (IgG-RBCs), all �5 mm in size, for different periods

of time (15–90 min; Figure 1C). IgG-RBC uptake was quantified

from at least 150 BMMs per time point for each genotype; unin-

gested IgG-RBCs were hypotonically lysed by briefly (1–2 min)

incubating the cells in 4�C water (Chow et al., 2004). Ingested

IgG-RBCs were counted individually by experimenters who

were blind to the genotypes and experimental conditions. Signif-

icantly fewer IgG-RBCs were internalized by ML1 KO BMMs

compared with WT controls at the latter three time points (30,

60, and 90 min; Figures 1C–1E). Based on distribution histo-

grams of the number of ingested particles per cell (Figure S1B),

thresholds were set (4 to 10 or more particles per cell) based on

the cell type and particle size to compare the phagocytic capa-

bility. Based on a threshold of 10 or more (10+) IgG-RBCs for

BMMs (Figure 1D), a significant difference in particle uptake

was noted betweenWT andML1 KO BMMs, with the uptake de-

fects being more severe as time progressed (Figure 1C–1E and

S1B). After 90 min, �50% of WT, but less than 20% of ML1

KO BMMs contained 10+ internalized IgG-RBCs (Figure 1D).

The progressive inhibition of uptake caused by ML1 deficiency

suggested that ML1 is necessary for the ongoing uptake of large

particles, which is consistent with the reported, preferential

requirement of lysosomal membrane delivery for large particle

uptake (Huynh et al., 2007). To further probe this possibility,

BMMs were tested for their ability to ingest different-sized IgG-

opsonized polystyrene beads. Interestingly, although the inter-

nalization of 3 mm beads (a threshold of 10+ 3 mm beads set

for BMMs) was similar for WT and ML1 KO BMMs, uptake of

6 mm beads (a threshold of 4+ 6 mm beads for BMMs) was signif-

icantly reduced in ML1 KO BMMs at all time points (Figures 1F

and S1C). Uptake of zymosan particles (diameter = 2–3 mm)

was also normal for ML1 KO BMMs (Figure S1D). These obser-

vations are reminiscent of the particle size-dependent uptake

defect seen in Syt VII�/� BMMs (Czibener et al., 2006). Taken

together, these results suggest that ML1 is required for efficient

uptake of large particles, i.e., when the need formembranes from

internal sources is high (Huynh et al., 2007).

The Channel Activity of ML1 Regulates Large ParticleUptake in MacrophagesNext, we investigated whether increasing the expression/

activity of ML1 can facilitate particle uptake in macrophages.

Incubating WT BMMs with a TRPML agonist, ML-SA1 (1–

10 mM), for 15 min caused more than a 2-fold increase in the

percentage of cells containing 10+ IgG-RBCs (Figure 2A). In

nc.

AML1 KOWT

L32

RT-PCR

B

C D

E F

BMMs

per 100 BMMs

WT

ML1 KO

15 min 30 min 60 min 90 min

sRBC/DAPI

BMMs

BMMs BMMs

Figure 1. TRPML1 Is Necessary for Optimal

Phagocytosis of Large Particles in Bone

Marrow Macrophages

(A) RT-PCR analysis of wild-type (WT) and

TRPML1 KO (ML1 KO) bone marrow-derived

macrophages (BMMs) using a primer pair target-

ing the deleted region (exons 3, 4, and 5) of

the TRPML1 gene (Venugopal et al., 2007). The

housekeeping gene L32 served as a loading

control.

(B) ML-SA1 robustly activated endogenous whole-

endolysosome ML1-like currents in WT, but not

ML1 KO BMMs.

(C) WT and ML1 KO BMMs were exposed to

IgG-opsonized red blood cells (IgG-RBCs; red

colored) at a ratio of 50 RBCs/BMM for time

periods indicated (15, 30, 60, and 90 min). Non-

ingested IgG-RBCs were lysed by briefly (1–2 min)

incubating the cells in water at 4�C. Samples

were then fixed and processed for confocal

microscopy.

(D) Average particle ingestion for WT and ML1 KO

BMMs. Ingested IgG-RBCs were quantified for

150–200 BMMs per experiment, by experimenters

who were blind to the genotype.

(E) ML1 KO BMMs had a lower uptake index

compared with WT BMMs. Uptake index was

calculated based on the total number of RBCs

ingested for 100 BMMs.

(F) Particle-size-dependent phagocytosis defect

of ML1 KO BMMs. BMMs were exposed to 3

or 6 mm IgG-coated polystyrene beads for

indicated periods of time. Samples were washed extensively and briefly trypsinized to dissociate noningested beads attached to the cell surface or

coverslips. The number of ingested particles was determined as described in (D).

For all panels, unless otherwise indicated, the data represent the mean ± SEM from at least three independent experiments. See also Figure S1.

Developmental Cell



contrast, the increase was negligible for ML1 KO BMMs (Fig-

ure 2A). Moreover, heterologous expression of ML1-GFP in

ML1 KO BMMs was sufficient to restore the uptake efficiency

to the same level of WT BMMs, whereas expression of ML1-

KK-GFP, a nonconducting pore mutant of ML1 (Dong et al.,

2010), had no effect (Figure 2B). These results established a

positive correlation between the channel activity of ML1 and

IgG-RBC uptake.

We also examined particle uptake in RAW 264.7 macrophage

cell line, as well as RAW cell lines stably expressing ML1

(ML1 overexpression or O/E) or ML1-specfic RNAi (ML1

knockdown or KD) (Thompson et al., 2007). ML1 expression

levels in these three cell lines were confirmed using whole-

endolysosome recordings (Figure 2C) and RT-PCR analysis

(Figure 2D). Interestingly, particle uptake efficiency in these

lines correlated with their respective expression levels of

ML1, with an even greater correlation in the presence of

ML-SA1 (Figures 2E and S2A). The threshold of 5+ ingested

IgG-RBCs was set to reflect the smaller size of RAW cells

compared to BMMs. Although �30% of the ML1 O/E cells

ingested 5+ IgG-RBCs, less than 10% of ML1 KD cells con-

tained 5+ IgG-RBCs (Figure 2E). Collectively, these data sug-

gest that the efficiency of particle uptake in macrophages is

positively correlated with the expression level and channel

activity of ML1.

Consistent with previous studies showing that uptake of large

particles is a Ca2+-dependent process in BMMs (Czibener et al.,

Devel

2006), and consistent with ML1 being a lysosomal Ca2+-perme-

able channel (Cheng et al., 2010), pretreatment of BMMs with a

membrane-permeable, fast Ca2+ chelator BAPTA-AM (Shen

et al., 2011) inhibited particle uptake in WT macrophages but

to a lower degree in ML1 KO cells (Figure 2F). In contrast, a

membrane-permeable, slow Ca2+ chelator EGTA-AM had little

or no effect (Figure S2B), suggesting a local source of Ca2+

(Shen et al., 2011).

To further investigate the role of ML1 in particle uptake, we

also employed pharmacological tools to acutely inhibit the

channel function of ML1. Using a Ca2+ imaging-based high-

throughput screening method (Shen et al., 2012), we identified

three synthetic small molecule inhibitors for ML1 (mucolipin

synthetic inhibitor 1-3 or ML-SI1-3; see Figures S2C and

S2F). Using whole-endolysosome patch-clamp recordings, we

confirmed that ML-SI1 strongly inhibited basal (Figure 2G),

ML-SA1, or PI(3,5)P2-activated IML1 (Figure S2D). In contrast,

ML-SI1 failed to inhibit PI(3,5)P2-activated whole-endolyso-

some TPC2 currents (Wang et al., 2012) (Figure S2E), demon-

strating a relative specificity. ML-SI1 (10 mM) treatment was

sufficient to reduce IgG-RBC uptake in WT BMMs to the

same level as ML1 KO BMMs, without significantly affecting

the uptake in ML1 KO cells (Figure 2H). Furthermore, all

three ML1 inhibitors significantly reduced the uptake of IgG-

opsonized 6 mm beads (Figure S2G). These results suggest

that the channel activity of ML1 is required for large particle

uptake in macrophages.


A B

C

D E

F GBMMs

HBMMs

Figure 2. The Expression Level and Channel

Activity of ML1 Regulate Particle Ingestion

in Macrophages

(A) Micromolar concentrations of ML-SA1 (0.1, 1,

and 10 mM; preincubation for 15 min) increased

particle uptake in WT, but not ML1 KO BMMs.

BMMswere exposed to IgG-RBCs in the presence

of ML-SA1 for 15 min.

(B) Transfection of ML1-GFP, but not ML1-KK-

GFP (nonconducting pore mutation) (Dong et al.,

2010), rescued the uptake defect in ML1 KO

BMMs. BMMs were exposed to IgG-RBCs for

30 min in the presence or absence of the small

molecule TRPML agonist, ML-SA1 (10 mM).

(C) ML-SA1-activated whole-endolysosome

TRPML-like currents in RAW 264.7 macrophage

cell lines, RAW cells stably expressing ML1-GFP

(ML1 overexpression or O/E), andRAWcells stably

expressing ML1-specific RNAi (ML1 knockdown

or KD) (Thompson et al., 2007).

(D) Real-time RT-PCR analysis of ML1 RNA

expression level (relative to L32) in RAW macro-

phages (n = 3 batches of independent experiments

for each cell type).

(E) Particle uptake in RAW 264.7, ML1 O/E, and

ML1 KD RAW macrophages.

(F) Particle uptake was sensitive to intracellular

Ca2+. BMMs were preincubated with the mem-

brane-permeable fast Ca2+ chelator BAPTA-AM

(1 mM; 15 min) prior to IgG-RBC exposure.

(G) ML-SI1 inhibited large basal whole-endolyso-

some IML1 that was seen in a subset of ML1-

expressing Cos1 cells.

(H) ML-SI1 (10 mM; preincubation for 15 min) in-

hibited particle ingestion in WT BMMs to a similar

level of that in ML1 KO BMMs. BMMs were

exposed to IgG-RBCs in the presence of ML-SI1

for 30 min.

For all panels, unless otherwise indicated, the data

represent the mean ± SEM from at least three

independent experiments; 150–200 BMMs were

analyzed for each experiment. See also Figure S2.

Developmental Cell



ML1 Is Rapidly Recruited to Phagocytic Cups andNascent PhagosomesTo investigate themechanisms by whichML1 contributes to par-

ticle uptake, we performed time-lapse confocal microscopy of

live RAW cells during the particle uptake process. Strikingly,

we observed that ML1-GFP was rapidly (within 1–3 min) re-

cruited to the sites of phagosome formation during uptake of

6 mm beads (Figure 3A; Movie S1) and IgG-RBCs (Figure S3A;

Movie S2). In contrast, ML1-GFP was not recruited to the sites

of phagosome formation during uptake of 3 mm beads (Fig-

ure S3B; see also Figure 3C).

Next, we compared the localization of ML1 with other endoso-

mal and lysosomal proteins that are known to be involved in

phagosome formation and maturation. Syt VII is a lysosomal

Ca2+ sensor, but has been shown to be recruited to the nascent

phagosomes upon particle binding (Czibener et al., 2006). BMMs

isolated from Syt VII KO mice exhibit a similar phenotype as

ML1 KO BMMs: the defect is proportional to the particle size

(Czibener et al., 2006). Both ML1-GFP and Syt VII-mCherry

were found to be colocalized at the tip of the pseudopods in

doubly transfected RAW cells (Figure S3C). Within 2–3 min after


exposing the RAW cells to IgG-RBCs, both ML1-GFP and Syt

VII-mCherry appeared on the membranes of nascent phago-

somes (Figure 3B; Movie S3). ML1-GFP and Syt VII-mCherry-

positive (lysosomal) tubules were then observed wrapping

themselves around the newly formed phagosomes (Figure 3B,

frame 3 min 53 s); the recruitment kinetics was similar for both

proteins (Movie S3).

Similar to ML1 and Syt-VII, lysosome-associated membrane

protein 1 (Lamp-1) was also rapidly recruited to newly formed

large-particle-containing phagosomes in RAW macrophages

BMMs (Figure 3C). However, rapid recruitment of ML1 and

Lamp1 were not seen in the presence of ML-SI1 (Figure S3E),

or for small particle uptake (Figure S3D). The recruitment of

ML1 and Lamp1 to forming phagosomes occurred prior to the

recruitment of Rab5, an early phagosome maturation marker

(Kitano et al., 2008; Guo et al., 2010), or Rab7, a late phagosome

maturation marker (Henry et al., 2004; Guo et al., 2010) (Figures

3C and 3D). Consistently, during large particle uptake, the newly

formed phagosomes (5 min after particle binding) in WT BMMs,

compared with ML1 KO BMMs, contained significantly more

Lamp1 proteins (Figure S3F). Phagosomes are still wrapped

nc.

Developmental Cell



with polymerized actin within 5–10min after particle binding (Fig-

ure S3G; see also Czibener et al., 2006). Collectively, these re-

sults suggest that during large particle uptake, recruitment of

ML1 and other lysosomal membrane proteins occurred in the

very early stages of phagosome formation, prior to Rab5-

mediated early phagosome maturation. The recruitment of

Lamp1 was significantly delayed in the ML1 KO BMMs, or in

the presence of ML1 inhibitors (Figure S3E), suggestive of a

crucial role of ML1 in delivering lysosomal proteins and mem-

branes to phagocytic cups.

To further separate phagosome formation from late phago-

some maturation, we monitored the ML1-GFP recruitment in

macrophages that were exposed to small particles. In contrast

to large particle uptake, ML1 was recruited to small particle-

containing phagosomes only after 15–20 min of phagocytosis

initiation (Figures 3C and 3D), which was after Rab5 recruitment,

but at a similar time course to Rab7 recruitment and phagosomal

acidification (Figures S3D and S3E). Hence, ML1 might also play

a role in late phagosome maturation.

To further confirm the presence of ML1 on the newly formed

phagosomes, we developed a patch-clamp method to directly

record from phagosomal membranes (Figures 4A and 4B).

Phagosomes were isolated from Lamp1-GFP or ML1-GFP-

transfected RAW cells after exposure to IgG-RBCs or beads

for 5 min. In Lamp1-GFP-transfected RAW cells, bath applica-

tion of PI(3,5)P2 (100 nM), or ML-SA1 (25 mM) readily activated

endogenous whole-phagosome ML1-like currents (Figure 4C).

Much larger whole-phagosome ML-SA1-activated currents

were seen in ML1-GFP-transfected RAW cells. In WT BMMs,

whole-phagosome IML1 was activated by ML-SA1 and inhibited

by ML-SI1 (Figure 4D). No significant whole-phagosome IML1

was seen in ML1 KO BMMs (Figure 4D). In contrast, PI(3,5)P2-

activated TPC currents (Wang et al., 2012) were present in a

subset of WT and ML1 KO BMMs (Figure 4D). These results

thus provide functional evidence that ML1 is recruited to nascent

phagosomes.

Particle Binding InducesML1-Mediated Lysosomal Ca2+

Release and Lysosomal Exocytosis in MacrophagesLysosome fusion with the plasma membrane (lysosomal exocy-

tosis) has been shown to be required for the uptake of large par-

ticles in macrophages (Czibener et al., 2006). Fibroblasts from

ML4 patients exhibit impaired lysosomal exocytosis induced

by ionomycin and increased expression levels of the TFEB lyso-

some biogenesis transcription factor (LaPlante et al., 2006;

Medina et al., 2011). To directly investigate the role of ML1 in

lysosomal exocytosis, we acutely activated ML1 using ML-SA1

and evaluated lysosomal exocytosis by using Lamp1 surface

immunostaining with the ML1 KO as the negative control. After

lysosomal exocytosis, luminal lysosomal membrane proteins

can be detected on the extracellular side of the plasma mem-

brane by measuring surface expression of Lamp1 with a mono-

clonal antibody (1D4B) against a luminal epitope of Lamp1

(Reddy et al., 2001). After incubation with the agonist ML-SA1

for 30 min, WT, but not ML1 KO BMMs, exhibited a marked in-

crease in Lamp1 staining (Figures 5A, S4A, and S4B). Pretreat-

ment with the fast Ca2+ chelator BAPTA-AM almost completely

abolished ML-SA1-induced Lamp1 surface staining in WT

BMMs (Figure S4A). Collectively, these results suggest that the

Devel

channel activity of ML1 is required for lysosomal exocytosis in

macrophages in a Ca2+-dependent manner.

Upon lysosomal exocytosis, lysosomal hydrolytic enzymes

such as acid phosphatases (APs) are released into the extracel-

lular medium (Reddy et al., 2001). Incubation with ML-SA1 (1 or

10 mM for 15 and 30 min) caused a significant increase in the AP

release/activity in WT, but not ML1 KO BMMs (Figures S4C and

S4D). Treating cells with Ca2+ ionophore ionomycin induced a

large AP release in ML1 KO BMMs, suggesting that the exocy-

tosis machinery was operative (Figure S4E). In RAW macro-

phage cell lines, the level of ML-SA1-induced AP release was

correlated with the expression level and channel activity of

ML1 (Figure S4C). ML-SA1-induced AP release in WT BMMs

was largely abolished by BAPTA-AM treatment, but not by

removing extracellular Ca2+ (Figure S4F).

Lysosomal membrane fusion events are presumed to be

dependent on [Ca2+]i increase in the close vicinity of fusion

spots, though direct evidence has not been reported (Pryor

et al., 2000; Piper and Luzio 2004; Shen et al., 2011). Because

ML1-GFPwas colocalized with Lamp1 in the tips of pseudopods

in RAW cells (Figure S3C), we used a lysosome-targeted genet-

ically encoded Ca2+ Indicator, GCaMP3-ML1, to specifically

measure lysosomal Ca2+ release in intact cells (Shen et al.,

2012). Transient and localized Ca2+ increases, measured with

GCaMP3 fluorescence changes, were observed preferentially

at the uptake sites of Syt VII-mCherry-positive lysosomes within

several minutes of particle binding for both IgG-RBCs (Figure 5B,

frames 45 s and 3 min and 15 s) and 6 mm beads (Figure S4G). In

contrast, little or no GCaMP3 fluorescence increase was seen in

other areas of the phagocytosing macrophages within the same

time course (Figures 5B, S4H, and S4I). These results suggest

that particle binding induces ML1-mediated lysosomal Ca2+

release, locally at the sites of uptake.

To investigate the role of ML1 in lysosomal exocytosis and

particle uptake, BMMs were exposed to IgG-RBCs for various

lengths of time, and acid phosphatase (AP) release was

measured. Compared with WT BMMs, ML1 KO cells exhibited

significantly less IgG-RBC-induced AP release (Figure 5C). Inter-

estingly, this difference was abolished by either BAPTA-AM or

inhibition of ML1 using ML-SI1 (Figure 5C).

Next, we directly investigated the insertion of ML1 onto the

plasma membrane during particle uptake. Because current anti-

bodies are inadequate for detecting endogenous ML1 proteins,

we developed a whole-cell patch-clamp method to ‘‘detect’’

the plasma membrane insertion of ML1 during particle uptake.

This electrophysiology-based ‘‘exocytosis assay’’ provides tem-

poral resolution far superior to other exocytosis/secretion

assays. In order to facilitate detection (by decreasing the turn-

over time of ML1 at the plasma membrane), we used a cell-

permeable dynamin inhibitor, dynasore (Macia et al., 2006), to

block endocytosis that is presumed to be coupled with focal

exocytosis (Lee et al., 2007; Tam et al., 2010). Large ML-SA1-

inducedwhole-cell ML1-like currents were observed upon expo-

sure of WT BMMs to IgG-RBCs for 10 min in the presence of

dynasore (Figures 5D and 5E). In contrast, no significant ML-

SA1-induced whole-cell currents were observed in RBC-treated

ML1 KO BMMs, or WT BMMs treated with dynasore alone

(Figures 5D and 5E). IgG-RBC-induced whole-cell IML1 was

completely inhibited by BAPTA-AM pretreatment (Figure 5E),


A

B

C

ML

1G

FP

Syt-VIIyrre

hC

mde

gre

M

0:00 2:36 3:53 6:49

0:00 1:15 3:53 6:40

RBCML1-GFP

Adding RBCs

Imaging time zero

min0 5 10 15 20 25 30

ML1

Lamp1

Rab7

35

LysoTracker

Rab5

40

ML1

Large Particle

Small Particle

Phagocytosis initiation

Phagosome Formation/ Maturation

Syt-VII

D

Lyso

Trr ekca

Lam

pPF

G- 1yr eehC

m- 1LM

RPF

G- 5ba

0 5 10 20 30

PFG-1L

M

el citr aPegr aL

el ci tr aPll amS

Time (min)Phagocytosis initiation

* * * **

** * * *

* ** * *

* * * * *

* * * * *

yreehCm-1L

MR

PFG- 7ba

yr eehCm- 1L

M Lam

pPF

G- 1

35

Figure 3. Particle Binding to Macrophages Rapidly Recruits ML1-GFP to the Phagocytic Cups and Nascent Phagosomes(A) Rapid recruitment of ML1-GFP to the sites of particle ingestion (white arrow) and to expanding membrane extensions. Selected frames from time-lapse

confocal microscopy of aML1-GFP transfected RAW 264.7macrophage that was exposed to 6 mm IgG-coated polystyrene beads. Approximately 1 min after the

attachment of beads to the cell surface, ML1-GFP was recruited to the membrane extension surrounding the particle (Frame 1 min 15 s; Movie S1). Note that

phagocytosis may have been initiated before the imaging time zero due to a technical difficulty in identifying phagocytosing macrophages and capturing

phagocytosing events, which typically took 5–10 min after RBCs were added to the recording chamber. Scale bar represents 5 mm.(legend continued on next page)

Developmental Cell


6 Developmental Cell 26, 1–14, September 16, 2013 ª2013 Elsevier Inc.


A

BDIC DIC

Intact macrophage Phagosome isolationParticle ML1-GFP

Lamp1-GFP

Merged

DIC DIC Particle Merged

**

**

WT BMM ML1 KO BMMC

Whole-phagosome configuration

D

Nucleus Nucleus

Newly-formed phagosome

Pipette solution

Bath solution

Isolated phagosome

Lysosome

ML1

Macrophage

PipetteRBC

Lamp1

Slicing the cell membrane Release of the phagosome

Figure 4. Whole-Phagosome Recording of

ML1 Channels in the Isolated Nascent

Phagosomes

(A) Cartoon illustrations of whole-phagosome

recording procedures. Upon RBC uptake (left

panel), patch electrodes are used to slice open the

phagocytosing macrophage within 5 min of parti-

cle binding and ingestion. After RBC-containing

phagosomes are isolated, a patch pipette is used

to achieve the whole-phagosome configuration.

(B) An illustration of whole-phagosome configu-

ration. Cells were transfected with Lamp-1-GFP or

ML1-GFP and then exposed to IgG-coated beads

on ice for 20 min; after phagocytosis was induced

by transferring the cells to 37�C for 5 min, the

newly formed phagosomes were isolated for

electrophysiology.

(C) ML-SA1- or PI(3,5)P2-activated endogenous

whole-phagosome TRPML-like currents in RAW

264.7 cells.

(D) Whole-phagosome IML1 in WT, but not ML1 KO

BMMs. ML-SA1 (25 mM)-activated IML1 was in-

hibited by ML-SI1 (50 mM) in WT phagosomes (left

panel). No ML-SA1- activated IML1 was seen in

ML1 KO phagosomes, in which PI(3,5)P2 (1 mM)

robustly activated ITPC.

Developmental Cell



suggesting that membrane insertion during phagocytosis is a

Ca2+-dependent process.

ML1 Regulates Particle Ingestion via LysosomalExocytosisTo directly investigate whether the involvement of ML1 in large

particle uptake is mediated by lysosomal exocytosis, we

assessed particle uptake upon increasing the expression level

and channel activity of ML1 while simultaneously blocking lyso-

somal exocytosis. Three approaches were employed to block

lysosomal exocytosis. First, lysosomal exocytosis and particle

uptake are inhibited by dominant-negative (DN) forms of Syt-

VII (Reddy et al., 2001). We found that ML-SA1-induced large

particle uptake was significantly reduced in Syt-VII-DN-trans-

fectedML1O/E RAWcells (Figure 6A). Second, VAMP7 is a lyso-

somal SNARE protein required for lysosome-plasma membrane

fusion (Braun et al., 2004). VAMP7 belongs to the Longin family of

SNARE proteins, characterized by the presence of an autoinhibi-

(B) ML1-GFP and Syt VII-mCherry were simultaneously recruited to nascent phagosomes. Selected frames

showed a RAW cell doubly transfected withML1-GFP and Syt VII-mCherry that was exposed to IgG-RBCs. W

ML1-GFP and Syt VII-mCherry were concurrently recruited to the site of phagosome formation. Scale bar re

(C) The recruitment kinetics of different endolysosomal markers to the particle-containing phagosomes. RAW

molecular endosomal and lysosomal markers. Upon particle binding, the recruitment of thesemarkers to phag

the course of 40 min. For large particles, ML1-mCherry and Lamp1-GFP were recruited to the forming phag

Rab7-GFP and LysoTracker were observed in the phagosomes �20 min after phagocytosis initiation; Rab

phagocytosis initiation and then disappeared 10�15 min later. For small particles (bottom row), ML1-G

phagosomes 15–20 min after phagocytosis initiation. The center of the particle is indicated with an asterisk.

(D) Summary of recruitment kinetics of various endolysosomal markers to phagosomes.

See also Figure S3.

Developmental Cell 26, 1–14,

tory domain at their N terminus (Martinez-

Arca et al., 2003). Overexpression of the

Longin domain of VAMP7 alone in macro-

phages is known to exert a dominant

negative effect on both lysosomal exocytosis and particle uptake

(Braun et al., 2004). ML-SA1 treatment failed to enhance particle

uptake in cells transfected with Longin-GFP including ML1 O/E

RAW cells (Figure 6B) and WT BMMs (Figure S5A), whereas

overexpression of VAMP7-GFP had no inhibitory effect. Third,

lysosomal exocytosis can also be reduced by treating the cells

with colchicine, a known inhibitor of microtubule polymerization

(Lee et al., 2007). We found that colchicine treatment signifi-

cantly inhibited ML-SA1-induced large particle uptake (Fig-

ure 6C) and lysosomal AP release (Figure S5B) in ML1 O/E

RAW cells. Taken together, these data suggest that ML1 partic-

ipates in large particle uptake by regulating Ca2+-dependent

lysosomal exocytosis in macrophages. The residual particle up-

take in ML1 KO BMMs was further inhibited by tetanus toxin

(TeNT, an inhibitor of several VAMP proteins including VAMP3;

Figure S5C), which is consistent with an additional contribution

of membranes/exocytosis from recycling endosomes as re-

ported previously (Braun et al., 2004).

from time-lapse confocal microscopy (Movie S3)

hite box indicates the site of particle ingestion; both

presents 10 mm.

macrophage cells were transfected with various

osomeswasmonitored using live-cell imaging over

osomes within 5 min after phagocytosis initiation;

5-GFP appeared on the phagosomes 10 min after

FP was recruited to the small particle-containing

Scale bars represent 5 mm.

September 16, 2013 ª2013 Elsevier Inc. 7

A

C

D

B

BMMs

Syt-VIImCherry

GCaMP3Merged

0:00

0:45

3:15

6:15

phagocytic region

ML1WT BMMDMSO ML-SA1 DMSO ML-SA1WT BMMs ML1 KO BMMs

Lam

p1 (t

otal

)La

mp1

(s

urfa

ce)

Mer

ged

E

Figure 5. Particle Binding Induces ML1-

Dependent Lysosomal Ca2+ Release and

Lysosomal Exocytosis in Macrophages

(A)ML-SA1 (10 mM for 30min) treatment resulted in

localization of Lamp1 (red) on the plasma mem-

brane in nonpermeabilized WT, but not ML1 KO

BMMs. Lamp1 surface expression was detected

using an antibody recognizing a luminal epitope

(1D4B). After the cells were permeabilized, total

(cell surface + intracellular; green) Lamp1 proteins

were detected by using the same antibody. Scale

bar represents 5 mm.

(B) IgG-RBC binding triggered a localized Ca2+

increase at the site of uptake, shown with selected

image frames of a RAW cell doubly transfected

with GCaMP3-ML1 and Syt VII-mCherry. Upon

IgG-RBC binding, GCaMP3-ML1 fluorescence

increased rapidly (frame 0min 45 s) near the site of

uptake and around the Syt VII-mCherry-positive

compartments in the membrane extension and

then decreased after phagosome formation (frame

6 min 15 s). Lower panel shows the time-depen-

dent changes of GCaMP3-ML1 fluorescence upon

particle binding, at the site of uptake (phagocytic

region) and in the cell body (whole-cell region).

White arrow indicates the phagocytic cup. Scale

bar represents 10 mm.

(C) RBC-ingestion-induced lysosomal acid phos-

phatase (AP) release in WT BMMs was reduced by

treatment of BAPTA-AM (500 nM, preincubation

for 15 min) or ML-SI1 (10 mM, preincubation for

10 min).

(D) Whole-cell ML1-like currents in WT BMMs that

were exposed to IgG-RBCs for 10 min. Dynasore

(Dyn, 100 mM) was used to block Dynamin-

dependent endocytosis to facilitate the detection

of whole-cell IML1. No significant whole-cell IML1

was detected in ML1 KO BMMs (IgG-RBCs for

10 min).

(E) Summary of whole-cell IML1 under different

experimental conditions.


represent the mean ± SEM from at least three in-

dependent experiments. See also Figure S4.

Developmental Cell



ML1 Regulates Particle Ingestion in a PI(3,5)P2-Dependent MannerPI(3,5)P2 is the only known endogenous activator of ML1 (Dong

et al., 2010). PI(3,5)P2 is generated from PI(3)P by a protein com-

plex that contains PIKfyve/Fab1, a PI-5 kinase that is localized in

late endosomes and lysosomes. The activity of PIKfyve/Fab1 is

dependent on the FIG4 protein in the complex (Lenk et al.,

2011). Thus, macrophages isolated from FIG4 KO mice are pre-

dicted to have a reduced PI(3,5)P2 level compared with WT cells

(Chow et al., 2007). FIG4 KO BMMs contained enlarged Lamp1-

positive compartments (Figure S5D), as seen in other cells types

from FIG4KOmice (Chow et al., 2007; Lenk et al., 2011). Further-

more, FIG4 KO BMMs were defective in IgG-RBC uptake (Fig-

ure 6D) andML-SA1- or IgG-RBC-induced lysosomal AP release

(Figure S5E). Large (6 mm), but not small (3 mm) bead uptake, was

also defective in WT BMMs treated with YM201636 (1 mM; Fig-

ures 6E and 6F), a PIKfyve inhibitor (Jefferies et al., 2008).


To directly test the possibility that an elevation of PI(3,5)P2 is

locally triggered by large particle binding, we have generated a

PI(3,5)P2-specific probe, ML1-2N-GFP, made by the fusion of

GFP to the phosphoinositide-binding domain of ML1 (X.L.,

X.W., X.Z., M. Zhao, Y. Zhang, R. Yau, L.S.W., and H.X., unpub-

lished data). The probe was mainly localized to Lamp1-positive

compartments, and this localization can be altered by mutations

in the probe, or by genetically or pharmacologically manipulating

the PI(3,5)P2 level, suggestive of the specificity of the probe.

Strikingly, ML1-2N-GFP was rapidly recruited to the forming

phagosomes (Figure 6G) in RAW cells that were doubly trans-

fected with ML1-2N-GFP and Syt-VII-mCherry. A transient and

localized increase in ML1-2N-GFP fluorescent intensity was

observed preferentially at the uptake sites of Syt-VII-mCherry-

positive lysosomes within 3 min of particle binding (Figure 6G,

frame 2 min and 54 s; Movie S4). In contrast, no increase

in GFP fluorescence was observed in cells transfected with

nc.

Developmental Cell



ML1-7Q-2N-GFP (a PI(3,5)P2 unbinding control probe; X.L.,

X.W., X.Z., M. Zhao, Y. Zhang, R. Yau, L.S.W., and H.X., unpub-

lished data) (Figure S5F). We also analyzed the kinetics of two

other phosphoinositides that are known to accumulate at the

site of phagocytosis. PI(3)P was detected using the 2X-FYVE-

GFP probe, and PI(3,4)P2/PI(3,4,5)P3 was detected using the

AKT-PH-GFP probe (Yeung et al., 2006). The AKT-PH-GFP

probe accumulated rapidly on forming phagosomes, but quickly

disappeared upon closing of phagocytic cups (Figure S5H), sug-

gesting that the time course of PI(3,4)P2/PI(3,4,5)P3 transient

matches phagosome formation and closure as shown previously

(Yeung et al., 2006). In contrast, the PI(3)P probe accumulated on

the early phagosomes �10 min after phagosome initiation (Fig-

ures S5G and S5H; see also Yeung et al., 2006), which was

similar to Rab5 recruitment to early phagosomes. Note that

PI(3)P increase occurred after Syt-VII recruitment (Figure S5G).

Because PI(3,5)P2 accumulates at the phagocytic site in a time

course similar to PI(3,4)P2/PI(3,4,5)P3, but prior to PI(3)P, it is

very likely that PI(3,5)P2 increase occurs during phagosome

formation.

We also measured the radio-labeled phosphoinositides using

high-performance liquid chromatography (HPLC) (Zolov et al.,

2012). We found that PI(3,5)P2 levels increased significantly dur-

ing the first 5 min of phagocytosis upon particle binding, which

corresponds to the time necessary for phagosomes formation

(Figure 6H). These results suggest that localized PI(3,5)P2 gener-

ation may be one of the initial steps during large particle inges-

tion (Figure 6H).

ML1 Deficiency Results in Defective Clearance ofSenescent and Apoptotic Cells In VivoSenescent RBCs are normally phagocytosed by macrophages

in the red pulp region of the spleen, followed by the degradation

of their hemoglobin and recycling of iron into the circulating

blood (Bratosin et al., 1998). Considering that ML1 KO BMMs

were defective in the uptake of large cellular particles, we

investigated RBC clearance in the spleens of ML1 KO mice.

In ML1 KO spleens, although Lamp1 expression was elevated

(Figures S6A and S6B), immunoreactivity of the control macro-

phage marker CD11b was normal (Figures S6C). ML1 KO mice

exhibited enlarged spleens, but had normal kidney size,

compared with WT controls (Figures S6D and S6E), suggestive

of compensatory changes secondary to defective clearance of

senescent RBCs (Kohyama et al., 2009). Consistently, hema-

toxylin and eosin (H&E) staining of spleen sections revealed

an accumulation of RBCs in both white and red pulps of ML1

KO but not WT spleens (Figure 7A). In addition, ML1 KO mice

had a higher level of RBCs in the blood compared with WT con-

trols, which had a red blood cell count within the normal range

(Figure S6F).

Accumulation of RBCs in the spleen reportedly leads to a

buildup of splenic iron stores (Kohyama et al., 2009). Indeed,

Perl’s Prussian blue staining (for ferric iron) revealed an accumu-

lation of iron stores in the spleens of ML1 KO mice, which was

largely confined to the red pulp region (Figure 7B). Consistently,

inductively coupled plasma mass spectrometry (ICP-MS) anal-

ysis revealed that iron content was selectively increased in the

ML1 KO spleens (Figure 7C). Taken together, these results sug-

gest that RBC clearance is defective in ML1 KO mice.

Devel

Defective phagocytosis in the brain may lead to inflammation

and microglia (macrophage-like cells in the brain) activation

(Venkatachalam et al., 2008; Vitner et al., 2010). Consistently,

Iba1, a 17 kDa EF hand protein that is specifically expressed in

activated macrophage/microglia (Ferguson et al., 2009), was

upregulated in the brain of ML1 and FIG4 KO mice (Figures 7D

and 7E). Further, massive cell death was observed in the brains

of ML1 and FIG4 KO mice (Figure 7F).

DISCUSSION

Using pharmacological, genetic, and biochemical approaches,

we demonstrate that the channel activity of ML1 is necessary

for efficient uptake of large particles in macrophages. Live imag-

ing and electrophysiological recordings reveal thatML1 is rapidly

activated and recruited to the membrane extensions surround-

ing the particles in the process of phagocytic internalization.

Our results are compatible with the following working model:

large particle binding to macrophages triggers PI(3,5)P2 eleva-

tion, which induces ML1-mediated lysosomal Ca2+ release and

lysosomal exocytosis at the sites of uptake (see Figure 6I).

The activation of IgG Fc receptors during phagocytosis has

been known to induce a transient increase in [Ca2+]i in neutro-

phils (Myers and Swanson 2002; Nunes and Demaurex 2010).

This was not seen in macrophages (Nunes and Demaurex

2010). Using our recently established lysosome-specific Ca2+

imaging method with lysosome-targeted genetically encoded

Ca2+ sensor GCaMP3, which is more sensitive in detecting

lysosomal Ca2+ release than conventional methods, we indeed

found that particle binding to macrophages also induces Ca2+

increase, but exclusively at the site of the particle uptake.

Furthermore, the present study has extended the earlier obser-

vations by demonstrating that transient Ca2+ release from the

lysosomes through ML1 is responsible for triggering lysosomal

exocytosis during the uptake of large particles. Additionally,

acidic granules in neutrophils (equivalent to lysosomes inmacro-

phages) have been shown to redistribute toward the site of

particle uptake, suggesting a source of membrane (Stendahl

et al., 1994; Tapper et al., 2002). Using time-lapse live imaging,

we have demonstrated that lysosomes and their resident pro-

teins are also redistributed toward the site of uptake in macro-

phages. Thus, lysosomes serve uniquely as sources not only

for membranes, but also for Ca2+ that is required for Syt-VII

activation/recruitment.

What differentiates the uptake of large versus small particles is

not clear. A small increase in the diameter of particlemay result in

a much larger demand for membranes, receptors, signaling

molecules, and cytoskeleton machinery. It is known that the

uptake of large (>4.5 mm) IgG-coated particles depends on phos-

phatidylinositol 3-kinase (PI3K) activity, whereas the uptake of

smaller (<3 mm) particles does not require PI3K activity (Cox

et al., 1999). For example, Wortmannin and LY294002, two

nonspecific type I and II PI3K inhibitors, preferentially inhibit

the uptake of large particles (Cox et al., 1999; Hoppe and Swan-

son 2004). Although type I PI3K has been linked to an effect on

cytoskeleton rearrangement during large particle uptake (Cox

et al., 1999; Hoppe and Swanson 2004), type II PI3K could

contribute to large particle uptake via the production of PI(3)P,

the precursor of PI(3,5)P2, which in turn is the endogenous


Figure 6. ML1-Mediated Facilitation of Particle Ingestion Is Dependent on Lysosomal Exocytosis

(A) ML-SA1 (10 mM) failed to increase particle ingestion in ML1 O/E RAW cells transfected with a Syt VII dominant-negative (DN) construct. Cells were pre-

incubated with DMSO or ML-SA1 for 15 min before they were exposed to IgG-RBCs for 30 min.

(B) ML-SA1 (10 mM) failed to increase particle ingestion in ML1 O/E RAW cells transfected with a VAMP7 dominant-negative (VAMP7-DN) construct.

(C) A microtubule-disrupting agent colchicine (10 mM) inhibited ML-SA1-enhanced particle ingestion in WT BMMs.

(D) FIG4 KO macrophages were defective in IgG-RBC ingestion. WT and FIG4 KO BMMs were exposed to IgG-RBCs for time periods indicated.

(E) YM0201636 (1 mM for 2 hr) treatment inhibited uptake of 6 mm beads, but not 3 mm beads in WT BMMs.

(F) Differential effects of YM201636 on large and small particle uptake.

(legend continued on next page)

Developmental Cell


10 Developmental Cell 26, 1–14, September 16, 2013 ª2013 Elsevier Inc.


Figure 7. ML1 Deficiency Results in Defec-

tive Clearance of Senescent Red Blood

Cells in the Spleen and Microglia Activation

in the Brain

(A) Accumulation of RBCs in the red (RP) and white

(WP) pulps of a ML1 KO spleen revealed by H&E

staining.

(B) Perl’s (Prussian blue) staining for ferric iron in

the splenic red pulp (RP) from 4-month-old mice.

Scale bar represents 200 mm.

(C) ICP-MS analysis of the splenic iron content

using digested whole spleens from WT and ML1

KO mice. Data were presented as ratios of

different ions.

(D) Propidium iodide (PI, 20 mg/ml)-labeled cells in

the cerebral cortex and hippocampus of WT, ML1

KO, and FIG4 KO mouse brain sections.

(E) Iba1 was upregulated in the whole-brain

lysates of ML1 and FIG4 KO mice.

(F) Iba1-positive cells were upregulated in the

sections of the brain cortex of ML1 KO mice.


represent the mean ± SEM from at least three

independent experiments. See also Figure S6.

Developmental Cell



activator of ML1 (Shen et al., 2012). BMMs with reduced

PI(3,5)P2 levels also exhibit the size-dependent uptake pheno-

type. It is possible that PI(3,5)P2 production, as detected using

our genetically encoded PI(3,5)P2 sensor, may be the key

signaling event that leads to ML1 activation and subsequent

lysosomal exocytosis (Figures 6H and 6G).

We have shown that during large particle uptake, ML1, Syt-VII,

and Lamp1 are rapidly delivered to forming phagosomes. The

early recruitment of Syt-VII and Lamp1 within 5 min of phagocy-

tosis initiation is impaired when the activity of ML1 is inhibited

and is not seen for small particle uptake. In late phagosome

maturation, lysosomal membrane proteins are also expected

to appear on the phagosomal membranes through phago-

some-lysosome fusion (Flannagan et al., 2012). Indeed, in

contrast to large particle uptake, ML1-GFP was recruited only

(G) Upon particle binding, ML1-2N-GFP and Syt VII-mCherry accumulated at the site of uptake within minute

may have occurred before the imaging time zero due to a technical difficulty in identifying macrophages und

(H) HPLC analysis of the levels of PI(3,5)P2 and PI(4,5)P2 during phagosome formation. Myo-[2-3H] inositol-lab

(6 mm) for 0, 1, 2, 5, and 10 min at 37�C. At each time point, cells were centrifuged at 4�C and prepared for

experiments.

(I) Particle binding activates lysosomal ML1 to initiate Ca2+-dependent lysosomal exocytosis. Upon particle (

shown) is stimulated at the site of particle uptake. The subsequent increase of PI(3,5)P2 level can then activate

Juxtaorganellar Ca2+ can then bind the Ca2+ sensor Syt VII to trigger lysosome-plasma membrane fusion

membranes for the pseudopod extension around IgG-RBCs. As a result, lysosomal membrane proteins, suc

membrane. Pseudopod extension continues until the IgG-RBCs are completely internalized. Phagocytic cu

formed. Newly formed phagosomes then undergo a series of membrane fusion and fission processes, collect

phagosomes. Lysosomes are also delivered to the late phagosomes through late phagosomematuration (pha

degradation of phagocytic materials. ML1 may also play a role in phagosome-lysosome fusion, but this req

For all panels, unless otherwise indicated, the data represent the mean ± SEM from at least three indep

analyzed for each experiment. For all panels, scale bars represent 10 mm. See also Figure S5.

Developmental Cell 26, 1–14, S

after 20 min of phagocytosis initiation in

small particle uptake. Therefore, lyso-

somes play dual roles sequentially in

(nascent) phagosome formation and

(late) phagosome formation and are deliv-

ered to the phagosomes at two different

stages. First, for large particles, lysosomes fuse with the plasma

membrane at the phagocytic cup, which provides the mem-

branes necessary for phagosome formation. As a result, lyso-

somalmembrane proteins such asML1 and Lamp1 are delivered

to the newly formed phagosomes, prior to or during phagocytic

cup closing. This is a path via lysosomal exocytosis that occurs

early during phagosome formation. Second, for both large and

small particles, lysosomes are also delivered to the late phago-

somes through late phagosome maturation (phagosome-lyso-

some fusion), which is required for the degradation of phagocytic

materials. This second stage is accompanied by Rab7 recruit-

ment and phagosomal acidification, as well as further recruit-

ment of lysosomal membrane proteins including ML1 and

Lamp1. This is a path that occurs late during phagosome-lyso-

some fusion. As discussed in a previous study (Czibener et al.,

s (see Movie S4). Note that phagocytosis initiation

ergoing phagocytosis.

eled RAW cells were exposed to IgG-coated beads

HPLC analysis. Data were from three independent

IgG-RBC) binding, the activity of PIKfyve/Fab1 (not

lysosomal ML1 to induce lysosomal Ca2+ release.

, which provides substantial amount of lysosomal

h as ML1 and Syt-VII, are inserted into the plasma

ps are then closed, and nascent phagosomes are

ively called phagosome maturation, to become late

gosome-lysosome fusion), which is required for the

uires further investigation.

endent experiments; 150–200 macrophages were

eptember 16, 2013 ª2013 Elsevier Inc. 11

Developmental Cell



2006), the early recruitment of lysosomal membrane proteins

may serve as a rather early preparation for phagosome matura-

tion, especially for large particle uptake, but is not completely

essential for phagosome maturation.

Our results in the present study are consistent with previous

reports showing that the clearance of late apoptotic neurons is

impaired in the Drosophila TRPML mutant (Venkatachalam

et al., 2008), suggesting that TRPML channels play a role in

eliminating pathogenic extracellular particles. Extracellular

accumulation of large particles such as apoptotic cells may

cause brain inflammation and microglia activation, which are

common features in most neurodegenerative lysosome storage

diseases (LSDs) (Vitner et al., 2010). It is possible that defective

phagocytosis of large particle is a general pathogenic factor for

many LSDs, with ML1 channel deregulation in phagocytes being

a primary cause.

EXPERIMENTAL PROCEDURES

Phagocytosis Assay

Sheep RBCs (Lampire Biological Laboratories) were washed twice with

PBS and then fixed with 4% paraformaldehyde (PFA) overnight at 4�Cin an end-over-end rotator. Free aldehyde groups were quenched by

resuspension in PBS containing 100 mM glycine for 30 min at 4�C; RBCswere opsonized with rabbit IgG antibody (Equitech-Bio) at 37�C for

1 hr. Phagocytosis was initiated by adding IgG-RBCs onto adherent

BMMs at a ratio of 50:1 (RBC: BMM). To synchronize binding and inter-

nalization, IgG-RBCs were centrifuged at 300 rpm for 3 min together

with adherent BMMs. BMMs were placed at 37�C and 5% CO2 for

various time points (15–90 min). Noningested IgG-RBCs were lysed by

incubating the cells with water (1 ml) for 2–3 min at 4�C (Chow et al.,

2004). RBC-containing BMMs were fixed in 2% PFA and stained with

goat-anti-rabbit IgG AlexaFluor488 (1:500 dilution, Invitrogen). Approximately

150–200 BMMs were typically analyzed for each experiment. Ingested RBCs

were counted by experimenters who were blinded to the genotype and

treatment.

Whole-Phagosome Electrophysiology

RAW macrophages and BMMs were transfected with Lamp1-GFP or

ML1-GFP using the Neon electroporation system (Invitrogen, MPK 5000).

IgG-RBCs were first incubated with macrophages at 4�C for 20 min to

synchronize the binding of IgG-RBCs to cells. After several gentle washes,

cells were placed at 37�C and 5% CO2 for 5 min to initiate the phagocytosis,

and then transferred to room temperature to slow down the phagocytosis

(Holevinsky and Nelson 1998). Within 5 min of phagocytosis initiation, the

phagosomes formed at this stage were not fused with lysosomes (Vieira

et al., 2002) and were considered as newly formed or nascent phagosomes.

Because the majority of RBC-containing phagosomes (�5 mm, roughly as

the size of RBCs) were also Lamp1-GFP or ML1-GFP-positive (see Figure 4),

the GFP-positive vesicles (�5 mm) were identified as nascent phagosomes.

Patch-clamp recordings were performed on the isolated newly formed

phagosomes (see Figure 4). To isolate phagosomes, a patch pipette was

used to open the cell by slicing the cell membrane. Then phagosomes

were released into the dish and recognized by GFP fluorescence. The bath

(cytoplasmic) solution contained 140 mM K-gluconate, 4 mM NaCl, 1 mM

EGTA, 2 mM MgCl2, 0.39 mM CaCl2, and 10 mM HEPES (pH adjusted

with KOH to 7.2; free [Ca2+] �100 nM). The pipette (luminal) solution con-

tained 145 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10 mM HEPES,

10 mM MES, and 10 mM glucose (pH 6.5, adjusted with NaOH). Data were

collected and analyzed as described in the Supplemental Experimental

Procedures.

GCaMP3 and Fura-2 Ca2+ Imaging

Ca2+ imaging was performed as described in Supplemental Experimental

Procedures.

12 Developmental Cell 26, 1–14, September 16, 2013 ª2013 Elsevier

Lysosomal Enzyme Release/Activity

Lysosomal enzyme release was measured as described in Supplemental

Experimental Procedures.

HPLC Measurement of Phosphoinositide Levels

Phosphoinositides are radio-labeled and measured as described in Supple-

mental Experimental Procedures.

Data Analysis

Data are presented as the mean ± SEM. Statistical comparisons were made

using ANOVA. A p value < 0.05 was considered statistically significant.

SUPPLEMENTAL INFORMATION

Supplemental Information includes Supplemental Experimental Procedures,

six figures, and four movies and can be found with this article online at

http://dx.doi.org/10.1016/j.devcel.2013.08.003.

ACKNOWLEDGMENTS

This work was supported by National Institutes of Health (NIH) (NS062792,

MH096595, AR060837 to H.X, GM24872 to M. Meisler, and NS064015 to

L.S.W). We are grateful to Dr. Loren Looger for the GCaMP3 construct, Drs.

Norma Andrews and Thomas Sudhof for the Syt-VII construct, Florence Nie-

dergang and Robert Edwards for VAMP7 constructs, Ed Stuenkel for the

TeNT construct, Johnny Fares for ML1-overexpressing or knockdown RAW

macrophages, Gregg Sobocinski for assistance in confocal imaging, and

Richard Hume and Miriam Meisler for comments on an earlier version of the

manuscript. We appreciate the encouragement and helpful comments from

other members of the Xu laboratory.

Received: February 6, 2013

Revised: May 22, 2013

Accepted: August 5, 2013

Published: August 29, 2013

REFERENCES

Aderem, A., and Underhill, D.M. (1999). Mechanisms of phagocytosis in mac-

rophages. Annu. Rev. Immunol. 17, 593–623.

Andrews, N.W. (2000). Regulated secretion of conventional lysosomes. Trends

Cell Biol. 10, 316–321.

Bajno, L., Peng, X.R., Schreiber, A.D., Moore, H.P., Trimble, W.S., and

Grinstein, S. (2000). Focal exocytosis of VAMP3-containing vesicles at sites

of phagosome formation. J. Cell Biol. 149, 697–706.

Bratosin, D., Mazurier, J., Tissier, J.P., Estaquier, J., Huart, J.J., Ameisen, J.C.,

Aminoff, D., and Montreuil, J. (1998). Cellular and molecular mechanisms of

senescent erythrocyte phagocytosis by macrophages. A review. Biochimie

80, 173–195.

Braun, V., and Niedergang, F. (2006). Linking exocytosis and endocytosis

during phagocytosis. Biol. Cell 98, 195–201.

Braun, V., Fraisier, V., Raposo, G., Hurbain, I., Sibarita, J.B., Chavrier, P., Galli,

T., and Niedergang, F. (2004). TI-VAMP/VAMP7 is required for optimal phago-

cytosis of opsonised particles in macrophages. EMBO J. 23, 4166–4176.

Cheng, X., Shen, D., Samie, M., and Xu, H. (2010). Mucolipins: intracellular

TRPML1-3 channels. FEBS Lett. 584, 2013–2021.

Chow, C.W., Downey, G.P., and Grinstein, S. (2004). Measurements of phago-

cytosis and phagosomal maturation. Curr. Protoc. Cell Biol. 15, Unit 15.7.

Chow, C.Y., Zhang, Y., Dowling, J.J., Jin, N., Adamska, M., Shiga, K., Szigeti,

K., Shy, M.E., Li, J., Zhang, X., et al. (2007). Mutation of FIG4 causes neurode-

generation in the pale tremor mouse and patients with CMT4J. Nature 448,

68–72.

Cox, D., Tseng, C.C., Bjekic, G., and Greenberg, S. (1999). A requirement for

phosphatidylinositol 3-kinase in pseudopod extension. J. Biol. Chem. 274,

1240–1247.

Inc.


Developmental Cell



Czibener, C., Sherer, N.M., Becker, S.M., Pypaert, M., Hui, E., Chapman, E.R.,

Mothes, W., and Andrews, N.W. (2006). Ca2+ and synaptotagmin VII-depen-

dent delivery of lysosomal membrane to nascent phagosomes. J. Cell Biol.

174, 997–1007.

Dong, X.P., Cheng, X., Mills, E., Delling, M., Wang, F., Kurz, T., and Xu, H.

(2008). The type IV mucolipidosis-associated protein TRPML1 is an endolyso-

somal iron release channel. Nature 455, 992–996.

Dong, X.P., Shen, D., Wang, X., Dawson, T., Li, X., Zhang, Q., Cheng, X.,

Zhang, Y., Weisman, L.S., Delling, M., and Xu, H. (2010). PI(3,5)P(2) controls

membrane trafficking by direct activation of mucolipin Ca(2+) release channels

in the endolysosome. Nat Commun 1, 38.

Ferguson, C.J., Lenk, G.M., and Meisler, M.H. (2009). Defective autophagy in

neurons and astrocytes frommice deficient in PI(3,5)P2. Hum. Mol. Genet. 18,

4868–4878.

Flannagan, R.S., Jaumouille, V., and Grinstein, S. (2012). The cell biology of

phagocytosis. Annu. Rev. Pathol. 7, 61–98.

Guo, P., Hu, T., Zhang, J., Jiang, S., and Wang, X. (2010). Sequential action of

Caenorhabditis elegans Rab GTPases regulates phagolysosome formation

during apoptotic cell degradation. Proc. Natl. Acad. Sci. USA 107, 18016–

18021.

Hackam, D.J., Rotstein, O.D., Sjolin, C., Schreiber, A.D., Trimble, W.S., and

Grinstein, S. (1998). v-SNARE-dependent secretion is required for phagocy-

tosis. Proc. Natl. Acad. Sci. USA 95, 11691–11696.

Henry, R.M., Hoppe, A.D., Joshi, N., and Swanson, J.A. (2004). The uniformity

of phagosome maturation in macrophages. J. Cell Biol. 164, 185–194.

Holevinsky, K.O., and Nelson, D.J. (1998). Membrane capacitance changes

associated with particle uptake during phagocytosis in macrophages.

Biophys. J. 75, 2577–2586.

Hoppe, A.D., and Swanson, J.A. (2004). Cdc42, Rac1, and Rac2 display

distinct patterns of activation during phagocytosis. Mol. Biol. Cell 15, 3509–

3519.

Huynh, K.K., Kay, J.G., Stow, J.L., and Grinstein, S. (2007). Fusion, fission, and

secretion during phagocytosis. Physiology (Bethesda) 22, 366–372.

Jefferies, H.B., Cooke, F.T., Jat, P., Boucheron, C., Koizumi, T., Hayakawa,M.,

Kaizawa, H., Ohishi, T., Workman, P., Waterfield, M.D., and Parker, P.J. (2008).

A selective PIKfyve inhibitor blocks PtdIns(3,5)P(2) production and disrupts

endomembrane transport and retroviral budding. EMBO Rep. 9, 164–170.

Kitano, M., Nakaya, M., Nakamura, T., Nagata, S., and Matsuda, M. (2008).

Imaging of Rab5 activity identifies essential regulators for phagosomematura-

tion. Nature 453, 241–245.

Kohyama, M., Ise, W., Edelson, B.T., Wilker, P.R., Hildner, K., Mejia, C.,

Frazier, W.A., Murphy, T.L., and Murphy, K.M. (2009). Role for Spi-C in the

development of red pulp macrophages and splenic iron homeostasis.

Nature 457, 318–321.

LaPlante, J.M., Sun, M., Falardeau, J., Dai, D., Brown, E.M., Slaugenhaupt,

S.A., and Vassilev, P.M. (2006). Lysosomal exocytosis is impaired in mucolipi-

dosis type IV. Mol. Genet. Metab. 89, 339–348.

Lee, W.L., Mason, D., Schreiber, A.D., and Grinstein, S. (2007). Quantitative

analysis of membrane remodeling at the phagocytic cup. Mol. Biol. Cell 18,

2883–2892.

Lenk, G.M., Ferguson, C.J., Chow, C.Y., Jin, N., Jones, J.M., Grant, A.E.,

Zolov, S.N., Winters, J.J., Giger, R.J., Dowling, J.J., et al. (2011). Pathogenic

mechanism of the FIG4mutation responsible for Charcot-Marie-Tooth disease

CMT4J. PLoS Genet. 7, e1002104.

Macia, E., Ehrlich, M., Massol, R., Boucrot, E., Brunner, C., and Kirchhausen,

T. (2006). Dynasore, a cell-permeable inhibitor of dynamin. Dev. Cell 10,

839–850.

Martinez-Arca, S., Rudge, R., Vacca, M., Raposo, G., Camonis, J., Proux-

Gillardeaux, V., Daviet, L., Formstecher, E., Hamburger, A., Filippini, F., et al.

(2003). A dual mechanism controlling the localization and function of exocytic

v-SNAREs. Proc. Natl. Acad. Sci. USA 100, 9011–9016.

Medina, D.L., Fraldi, A., Bouche, V., Annunziata, F., Mansueto, G.,

Spampanato, C., Puri, C., Pignata, A., Martina, J.A., Sardiello, M., et al.

Develo

(2011). Transcriptional activation of lysosomal exocytosis promotes cellular

clearance. Dev. Cell 21, 421–430.

Myers, J.T., and Swanson, J.A. (2002). Calcium spikes in activated macro-

phages during Fcgamma receptor-mediated phagocytosis. J. Leukoc. Biol.

72, 677–684.

Niedergang, F., and Chavrier, P. (2004). Signaling and membrane dynamics

during phagocytosis: many roads lead to the phagos(R)ome. Curr. Opin. Cell

Biol. 16, 422–428.

Nunes, P., and Demaurex, N. (2010). The role of calcium signaling in phagocy-

tosis. J. Leukoc. Biol. 88, 57–68.

Piper, R.C., and Luzio, J.P. (2004). CUPpling calcium to lysosomal biogenesis.

Trends Cell Biol. 14, 471–473.

Pryor, P.R., Mullock, B.M., Bright, N.A., Gray, S.R., and Luzio, J.P. (2000). The

role of intraorganellar Ca(2+) in late endosome-lysosome heterotypic fusion

and in the reformation of lysosomes from hybrid organelles. J. Cell Biol. 149,

1053–1062.

Reddy, A., Caler, E.V., and Andrews, N.W. (2001). Plasma membrane repair is

mediated by Ca(2+)-regulated exocytosis of lysosomes. Cell 106, 157–169.

Shen, D., Wang, X., and Xu, H. (2011). Pairing phosphoinositides with calcium

ions in endolysosomal dynamics: phosphoinositides control the direction and

specificity of membrane trafficking by regulating the activity of calcium chan-

nels in the endolysosomes. Bioessays 33, 448–457.

Shen, D., Wang, X., Li, X., Zhang, X., Yao, Z., Dibble, S., Dong, X.P., Yu, T.,

Lieberman, A.P., Showalter, H.D., and Xu, H. (2012). Lipid storage disorders

block lysosomal trafficking by inhibiting a TRP channel and lysosomal calcium

release. Nat Commun 3, 731.

Stendahl, O., Krause, K.H., Krischer, J., Jerstrom, P., Theler, J.M., Clark,

R.A., Carpentier, J.L., and Lew, D.P. (1994). Redistribution of intracellular

Ca2+ stores during phagocytosis in human neutrophils. Science 265,

1439–1441.

Sun, M., Goldin, E., Stahl, S., Falardeau, J.L., Kennedy, J.C., Acierno, J.S., Jr.,

Bove, C., Kaneski, C.R., Nagle, J., Bromley, M.C., et al. (2000). Mucolipidosis

type IV is caused by mutations in a gene encoding a novel transient receptor

potential channel. Hum. Mol. Genet. 9, 2471–2478.

Swanson, J., Bushnell, A., and Silverstein, S.C. (1987). Tubular lysosome

morphology and distribution within macrophages depend on the integrity of

cytoplasmic microtubules. Proc. Natl. Acad. Sci. USA 84, 1921–1925.

Tam, C., Idone, V., Devlin, C., Fernandes, M.C., Flannery, A., He, X.,

Schuchman, E., Tabas, I., and Andrews, N.W. (2010). Exocytosis of acid sphin-

gomyelinase by wounded cells promotes endocytosis and plasma membrane

repair. J. Cell Biol. 189, 1027–1038.

Tapper, H., and Sundler, R. (1995). Glucan receptor and zymosan-induced

lysosomal enzyme secretion in macrophages. Biochem. J. 306, 829–835.

Tapper, H., Furuya, W., and Grinstein, S. (2002). Localized exocytosis of pri-

mary (lysosomal) granules during phagocytosis: role of Ca2+-dependent tyro-

sine phosphorylation and microtubules. J. Immunol. 168, 5287–5296.

Theler, J.M., Lew, D.P., Jaconi, M.E., Krause, K.H., Wollheim, C.B., and

Schlegel, W. (1995). Intracellular pattern of cytosolic Ca2+ changes during

adhesion and multiple phagocytosis in human neutrophils. Dynamics of intra-

cellular Ca2+ stores. Blood 85, 2194–2201.

Thompson, E.G., Schaheen, L., Dang, H., and Fares, H. (2007). Lysosomal

trafficking functions of mucolipin-1 in murine macrophages. BMC Cell Biol.

8, 54.

Touret, N., Paroutis, P., Terebiznik, M., Harrison, R.E., Trombetta, S., Pypaert,

M., Chow, A., Jiang, A., Shaw, J., Yip, C., et al. (2005). Quantitative and

dynamic assessment of the contribution of the ER to phagosome formation.

Cell 123, 157–170.

Venkatachalam, K., Long, A.A., Elsaesser, R., Nikolaeva, D., Broadie, K., and

Montell, C. (2008). Motor deficit in a Drosophila model of mucolipidosis type IV

due to defective clearance of apoptotic cells. Cell 135, 838–851.

Venugopal, B., Browning, M.F., Curcio-Morelli, C., Varro, A., Michaud, N.,

Nanthakumar, N., Walkley, S.U., Pickel, J., and Slaugenhaupt, S.A. (2007).

Neurologic, gastric, and opthalmologic pathologies in a murine model of

mucolipidosis type IV. Am. J. Hum. Genet. 81, 1070–1083.

pmental Cell 26, 1–14, September 16, 2013 ª2013 Elsevier Inc. 13

Developmental Cell



Vieira, O.V., Botelho, R.J., and Grinstein, S. (2002). Phagosome maturation:

aging gracefully. Biochem. J. 366, 689–704.

Vitner, E.B., Platt, F.M., and Futerman, A.H. (2010). Common and uncommon

pathogenic cascades in lysosomal storage diseases. J. Biol. Chem. 285,

20423–20427.

Wang, X., Zhang, X., Dong, X.P., Samie, M., Li, X., Cheng, X., Goschka, A.,

Shen, D., Zhou, Y., Harlow, J., et al. (2012). TPCproteins are phosphoinositide-

14 Developmental Cell 26, 1–14, September 16, 2013 ª2013 Elsevier

activated sodium-selective ion channels in endosomes and lysosomes. Cell

151, 372–383.

Yeung, T., Ozdamar, B., Paroutis, P., and Grinstein, S. (2006). Lipid meta-

bolism and dynamics during phagocytosis. Curr. Opin. Cell Biol. 18, 429–437.

Zolov, S.N., Bridges, D., Zhang, Y., Lee, W.W., Riehle, E., Verma, R., Lenk,

G.M., Converso-Baran, K., Weide, T., Albin, R.L., et al. (2012). In vivo,

Pikfyve generates PI(3,5)P2, which serves as both a signaling lipid and the

major precursor for PI5P. Proc. Natl. Acad. Sci. USA 109, 17472–17477.

Inc.

Developmental Cell, Volume 26

Supplemental Information

A TRP Channel in the Lysosome Regulates

Large Particle Phagocytosis via Focal Exocytosis

Mohammad Samie, Xiang Wang, Xiaoli Zhang, Andrew Goschka, Xinran Li, Xiping

Cheng, Evan Gregg, Marlene Azar, Yue Zhuo, Abigail G. Garrity, Qiong Gao, Susan

Slaugenhaupt, Jim Pickel, Sergey N. Zolov, Lois S. Weisman, Guy M. Lenk,

Steve Titus, Marthe Bryant-Genevier, Noel Southall, Marugan Juan, Marc Ferrer, and

Haoxing Xu

Inventory of Supplemental Information

Supplemental Figures and Legends

Figure S1. Related to Figure 1. Uptake of large particles is reduced in ML1-null macrophages.

Figure S2. Related to Figure 2. Phagocytosis of large particles in macrophages is inhibited by

ML1 antagonists.

Figure S3. Related to Figure 3. Rapid particle-size-dependent recruitment of lysosomal

membrane proteins to the pseudopods of phagocytosing macrophages.

Figure S4. Related to Figure 5. Lysosomal Ca2+

release and lysosomal exocytosis in the

phagocytic sites upon particle binding.

Figure S5. Related to Figure 6. Requirement of PI(3,5)P2 and lysosomal exocytosis in particle

uptake.

Figure S6. Related to Figure 7. Defective clearance of senescent red blood cells in the spleen of

ML1 KO mice.

Supplemental Movie Legends

Movie S1. A time-lapse video of a ML1-GFP-transfected RAW cells that were exposed to IgG-

opsonized 6 μm beads (experiments conditions and snapshot images see Fig. 3A and figure

legends).

Movie S2. A time-lapse video of a ML1-GFP-transfected RAW cells that were exposed to IgG-

RBCs (experiments conditions and snapshot images see Suppl. Fig. S3A and figure legends).

Movie S3. Simultaneous recruitment of ML1-GFP and Syt-VII-mCherry to the IgG-RBC uptake

sites (experiments conditions and snapshot images see Fig. 3B and figure legends).

Movie S4. Transient accumulation of ML1-2N-GFP to the phagocytic cups (experiments

conditions and snapshot images see Fig. 6G and figure legends).

Supplemental Experimental Procedures

Supplemental References

Supplemental Figures

Suppl. Fig. S1. Uptake of large particles is reduced in ML1-null macrophages-- Related to Figure 1. (A) Mature monocytes isolated from WT and ML1 KO mouse bone marrow had similar morphological characteristics as revealed by CD11b (mature macrophage-specific surface receptor) staining. Scale bar = 30 µm. Isolated monocytes were cultured in DMEM/F12 and recombinant colony stimulating factor for 5-7 days, and then fixed and stained with anti-CD11b antibody. (B) ML1 KO BMMs were defective in large particle uptake. Histograms represent the distribution (in percentage) of WT and ML1 KO BMMs containing different numbers of ingested RBCs (x-axis) for each time point. (C) ML1 KO BMMs had a lower uptake index for large, but not small beads compared with WT BMMs. Uptake index was calculated based on the total number of particles ingested for 100 BMMs. (D) Zymosan particle uptake was normal in ML1 KO BMMs. BMMs were exposed to Zymosan particles at 1:50 ratio for time periods indicated. For all panels, unless otherwise indicated, the data represent the mean ± the standard error of the mean (SEM) from at least three independent experiments.

Suppl. Fig. S2. Phagocytosis of large particles in macrophages is inhibited by ML1 antagonists-- Related to Figure 2. (A) Particle uptake index in RAW 264.7, ML1 O/E, and ML1 KD RAW macrophages. (B) Dose-dependent inhibition of bead (6 m) uptake in WT BMMs by BAPTA-AM, but not EGTA-AM at 30 min upon particle binding. (C) ML-SI1 (20 M) inhibited ML-SA1-induced lysosomal Ca2+ increase in HEK293 cells stably expressing GCaMP3-ML1 (left panel). ML-SA1 induced rapid increases in GCaMP3 fluorescence (measured as change of GCaMP3 fluorescence ΔF over basal fluorescence F0; ΔF/F0) under low (<10 nM) external Ca2+ in GCaMP3-ML1 stable cell lines. Co-application of ML-SI1 abolished the ML-SA1-induced lysosomal Ca2+ release. Right panel shows the dose-dependent inhibition of Ca2+ increase by ML1-SI1 in the micromolar range. (D) ML-SI1 inhibited ML-SA1 or PI(3,5)P2-activated whole-endolysosome IML1. (E) Insensitivity of whole-endolysosome ITPC2 and sensitivity of whole-cell ITRPML3 to ML-SI1. ITPC2 and ITRPML3 were activated by PI(3,5)P2 and ML-SA1, respectively. (F) ML-SI2 and ML-SI3 (20 M each) inhibited ML-SA1-induced lysosomal Ca2+ increase in HEK293 cells stably expressing GCaMP3-ML1. (G) ML-SI1, ML-SI2, and ML-SI3 (10 M each) inhibited the uptake of large IgG-beads (6 m) in WT BMMs. For all panels, unless otherwise indicated, the data represent the mean ± the standard error of the mean (SEM) from at least three independent experiments.

Suppl. Fig. S3. Rapid particle-size-dependent recruitment of lysosomal membrane proteins to the pseudopods of phagocytosing BMMs-- Related to Figure 3. (A) Rapid recruitment of ML1-GFP to the sites of particle ingestion and to expanding membrane extensions. Selected frames from time-lapse confocal microscopy of a ML1-GFP transfected RAW 264.7 macrophage that was exposed to IgG-RBCs. Approximately one min after the attachment of RBCs to the cell surface, ML1-GFP was recruited to the membrane extension surrounding the particle

(Frame 1 min 12 sec; Video 2). Scale bar = 10 µm. (B). Particle-size-dependent recruitment of ML1-GFP to the uptake site. Time-lapse imaging of a ML1-GFP-transfected RAW 264.7 macrophage that was exposed to both large (6 m) and small (3 m) IgG-coated beads simultaneously. Approximately 5 min after the attachment of large beads to the cell surface (phagocytosis initiation), ML1-GFP was present at the membrane extensions surrounding a newly formed phagosome (red arrow, frame 5 min 40 sec). In contrast, for small beads, no significant ML1-GFP accumulation was seen surrounding the forming phagosome (blue arrow, frame 6 min 33 sec). The center of the particle is indicated with an *. Bottom panel showed the time-dependent changes of ML1-GFP fluorescence at the site of phagosome formation upon particle binding. N=3 for both large and small particles. Scale bar = 10 µm. (C) In RAW 264.7 cells doubly-transfected with ML1-GFP and Lamp1-mCherry, both ML1 and Lamp1 were co-localized at the tip of the pseudopods (arrows). (D) The effect of ML-SI1 on recruitment kinetics of different endolysosomal markers to the small particle-containing phagosomes. RAW macrophage cells were electroporated or labeled with various endosomal and lysosomal markers. Cells were pre-incubated with 20 µM ML-SI1 for 30 min, and then exposed to small (3 m) IgG-coated beads in the continued presence of ML-SI1. Upon particle binding, the recruitment of molecular markers to phagosomes was monitored using live-cell imaging over the course of 40 min. The center of the particle is indicated with an *. Scale bars = 5 µm. Low panel summarizes the recruitment kinetics of various markers. (E) The effect of ML-SI1 on recruitment kinetics of different endolysosomal markers to the large particle-containing phagosomes. Compared with DMSO control, ML-SI1 prevented the early localization of Lamp1 to the forming early phagosomes, delayed the appearance of Rab7-GFP and LysoTracker in the late phagosomes, but without significantly affecting the recruitment of Rab5-GFP. The center of the particle is indicated with an *. Low panel summarizes the recruitment kinetics of various markers. Scale bars = 5 µm. (F) Early recruitment of Lamp1 to nascent phagosomes was defective in ML1 KO BMMs. BMMs were exposed to IgG-RBCs for 5 min, fixed, and stained with an anti-Lamp1 antibody (ID4B). Left panels: images represent the morphological criteria used to determine phagosome formation. Scale bar = 10 µm. Right panel: percentage of newly-formed phagosomes (5 min after particle binding) in WT and ML1 KO BMMs that were Lamp1-positive. Scale bar = 10 µm. (G). Actin polymerization of newly formed phagosomes, shown with phalloidin staining, was comparable in WT and ML1 KO BMMs. WT and ML1 KO BMMs were exposed to IgG-RBCs for 5 min, fixed, and labeled with phalloidin- Alexa-Fluor633 for 30 min. Left panel images represent the morphological criteria that were used to determine phagosome formation. The arrows point to RBC-containing phagosomes surrounded by phalloidin-stained polymerized actin. Right panel showed that about 60% of newly-formed phagosomes (5 min after particle binding) were Phalloidin positive in both WT and ML1 KO BMMs. For all panels, unless otherwise indicated, the data represent the mean ± the standard error of the mean (SEM) from at least three independent experiments.

Suppl. Fig. S4. Lysosomal Ca2+ release and lysosomal exocytosis in the phagocytic sites upon particle binding--- Related to Figure 5. (A) Flow cytometric analysis of ML-SA1-induced Lamp1 surface expression in WT and ML1 KO BMMs. Pre-treatment with BAPTA-AM (1 µM for 30 min) completely abolished Lamp1 surface staining in WT BMMs. Lower panels: histograms showing the flow cytometric analysis of Lamp1 surface staining. (B) Lamp1 surface staining was co-localized with the plasma membrane marker Dil-C18 (Dong, Wang et al. 2009). Scale bar = 5 µm. (C) ML-SA1 (0.1-10 µM for 15 or 30 min) treatment increased the release of lysosomal enzymes into the culture medium in BMMs and RAW cells. The activity of lysosomal enzyme acid phosphatase (AP) was determined using an AP activity colorimetric assay kit. The data are presented as the percentage of the activity of the released vs. total (released + cell-associated) enzymes. Left panels: lysosomal AP release in WT and ML1 KO BMMs. Right panels: lysosomal AP release in RAW 264.7, ML1 O/E, and ML1 KD RAW macrophages. (D) Lack of an effect of ML-SA1 on the release of cytosolic enzyme LDH. (E) Ionomycin-induced lysosomal enzyme acid phosphatase (AP) release/activity was comparable but slightly reduced in ML1 KO BMMs. The data are presented as the percentage of the activity of the released enzymes versus total (released + cell-associated) enzymes. (F) The effects of intracellular and extracellular Ca2+ on ML-SA1 (10 M for 30 min) -induced lysosomal AP release. BAPTA-AM (500 nM) and EGTA (2 mM with no added extracellular Ca2+) were used to chelate intracellular and extracellular Ca2+, respectively. (G) An increase in GCaMP3 fluorescence was observed at the uptake site of large beads (6 m). (H) Selected image frames of a RAW cell doubly-transfected with GCaMP3-ML1-KK and Syt VII-mCherry. No significant GCaMP3 fluorescence increase was observed at the site of IgG-RBC uptake and cell body (whole-cell region). (I) Time-dependent change of the GCaMP3-ML1-KK fluorescence signal upon particle binding. For all panels, scale bars = 10 µm. For all panels, unless otherwise indicated, the data represent the mean ± the standard error of the mean (SEM) from at least three independent experiments.

Suppl. Fig. S5. Requirement of PI(3,5)P2 and lysosomal exocytosis in particle uptake--- Related to Figure 6. (A) ML-SA1 (10 µM) failed to increase particle ingestion in BMMs transfected with a VAMP7 dominant-negative (VAMP7-DN) construct. (B) Colchicine (10 µM) inhibited ML-SA1-induced acid phosphatase (AP) release in WT BMMs. (C) TeNT toxin reduced particle uptake in both WT and ML1 KO BMMs. (D) Enlargement of Lamp1-positive compartments in FIG4 KO BMMs. Scale bar = 5 µm. (E) ML-SA1 (10 µM; left panel)-induced and IgG-RBC (30 min; right panel)-induced lysosomal AP release was reduced in BMMs from FIG4 KO mice. (F) Lack of ML1-7Q-2N-GFP accumulation at the site of uptake. Scale bar = 5 µm. (G) While Syt-VII-mCherry appeared on the forming phagosomes within 3-5 min of phagocytosis initiation, 2X-FYVE-GFP (PI(3)P probe) appeared on phagosomal membranes several minutes later (9 min 40 sec). The center of the particle is indicated with an *. (H) Distinct recruitment kinetics of AKT-PH-GFP (PI(3,4,5)P3/PI(3,4)P2 probe ) and 2X-FYVE-GFP (PI(3)P probe) to forming phagosomes. Scale bars = 10 µm. For all panels, unless otherwise indicated, the data represent the mean ± the standard error of the mean (SEM) from at least three independent experiments.

Suppl. Fig. S6. Defective clearance of senescent red blood cells in the spleen of ML1 KO mice--- Related to Figure 7. (A) An increased expression of Lamp1 proteins in ML1 KO spleens. (B, C) Immunofluorescence staining of Lamp1 and CD11b in the spleen sections of WT and ML1 KO mice. While Lamp1 immunefluorescence was elevated in the red pulp (RP) region of the ML1 KO spleen sections (B), the CD11b staining was comparable between WT and ML1 KO mice (C). DAPI: nucleus staining. (D) Representative images of spleens from 4-month-old WT and ML1 KO mice. (E) Normalized weight of spleens and kidneys from 4-month-old mice (N=5 animals for each). (F) ML1 KO mice have an elevated level of total red blood cell count compared with WT controls. Blood samples (100 µl) were collected from the mouse tails, and then placed into EDTA-containing tubes before counting (N=5 animals for each genotype). For all panels, scale bars = 200 µm. For all panels, unless otherwise indicated, the data represent the mean ± the standard error of the mean (SEM) from at least three independent experiments.

Supplemental Movie Legends Video 1. A time-lapse video of a ML1-GFP-transfected RAW cells that were exposed to IgG-opsonized 6 µm beads (experiments conditions and snapshot images see Fig. 3A and figure legends). Video 2. A time-lapse video of a ML1-GFP-transfected RAW cells that were exposed to IgG-RBCs (experiments conditions and snapshot images see Suppl. Fig. S3A and figure legends). Video 3. Simultaneous recruitment of ML1-GFP and Syt-VII-mCherry to the IgG-RBC uptake sites (experiments conditions and snapshot images see Fig. 3B and figure legends). Video 4. Transient accumulation of ML1-2N-GFP to the phagocytic cups (experiments conditions and snapshot images see Fig. 6G and figure legends).

Supplemental Experimental Procedures

Mouse lines. The generation and characterization of ML1 (Venugopal, Browning et al. 2007) and FIG4 KO mice (Chow, Zhang et al. 2007) have been described previously. Animals were used under approved animal protocols and Institutional Animal Care Guidelines at the University of Michigan.

Real-Time Semi-quantitative PCR. Total RNA was extracted from bone marrow-derived macrophages (BMMs) dissolved in TRIzol (Invitrogen). First strand cDNA, synthesized using Superscript III RT (Invitrogen), was used for Semi-quantitative PCR (Bio-Rad iQ iCycler) analysis of ML1 expression based on the following intron-spanning primer pair: Forward: AAACACCCCAGTGTCTCCAG; Reverse: GAATGACACCGACCCAGACT

Macrophage cell culture. Murine BMMs were prepared and cultured as described previously (Link, Park et al. 2010). Briefly, bone marrow cells from mouse femurs and tibias were harvested and cultured in macrophage differentiation medium (RPMI-1640 medium with 10% fetal bovine serum (FBS) and 100 unit/ml recombinant colony stimulating factor (PeproTech, Rocky Hill, NJ). After 7 days in culture at 37 °C with 5% CO2, the adherent cells (> 95% are expected to be macrophages) were harvested for assays. RAW 264.7, RAW cells stably-expressing ML1 (ML1 overexpression or O/E), and RAW cells stably-expressing ML1-specific RNAi (ML1 knockdown or KD) (Thompson, Schaheen et al. 2007) were kindly provided by Dr. Hanna Fares (University of Arizona), and cultured in DMEM/F12 media supplemented with 10% FBS at 37°C and 5% CO2. BMM and RAW macrophages were transfected using electroporation (Invitrogen Neon Transfection System) according to the manufacture procedures. Briefly, cells were harvested and washed with PBS (Ca2+ and Mg2+-free) once to remove DMEM. Cells were then centrifuged and the pellets were re-suspended in the R buffer. 2 µg of DNA per well was add to the cells, which were gently mixed and placed in the Neon System pipette. The electroporation was performed using program # 6 for RAW cells and program # 18 for BMMs, respectively. Transfected cells were then recovered with 500 µl of culture media in each plate.

Whole-endolysosome electrophysiology. Endolysosomal electrophysiology was performed in isolated endolysosomes using a modified patch-clamp method as described previously (Dong, Cheng

et al. 2008; Dong, Shen et al. 2010). Briefly, cells were treated with 1 μM vacuolin-1 for 2-5h to increase the size of endosomes and lysosomes. Whole-endolysosome recordings were performed on isolated enlarged endolysosomes. The bath (internal/cytoplasmic) solution contained 140 mM K-gluconate, 4 mM NaCl, 1 mM EGTA, 2 mM Na2-ATP, 2 mM MgCl2, 0.39 mM CaCl2, 0.2 mM GTP, and 10 mM HEPES (pH adjusted with KOH to 7.2; free [Ca2+]i was estimated to be ~ 100 nM using the Maxchelator software (http://maxchelator.stanford.edu/)). The pipette (luminal) solution consisted of a ‘Low pH Tyrode’s solution’ with 145 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10 m M HEPES,10 mM MES, and 10 mM glucose (pH 4.6). All bath solutions were applied via a perfusion system to achieve a complete solution exchange within a few seconds. Data were collected using an Axopatch 2A patch clamp amplifier, Digidata 1440, and pClamp 10.0 software (Axon Instruments). Currents were digitized at 10 kHz and filtered at 2 kHz. All experiments were conducted at room temperature (21-23 ºC), and all recordings were analyzed with pClamp 10.0, and Origin 8.0 (OriginLab, Northampton, MA).

Whole-cell electrophysiology. Whole-cell recordings were performed as described previously (Shen, Wang et al. 2012; Wang, Zhang et al. 2012). The pipette solution contained 147 mM Cs, 120 mM methane-sulfonate, 4 mM NaCl, 10 mM EGTA, 2 mM Na2-ATP, 2 mM MgCl2, and 20 mM HEPES (pH 7.2; free [Ca2+]i < 10 nM). The standard extracellular bath solution (modified Tyrode’s solution) contained 153 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 20 mM HEPES, and 10 mM glucose (pH 7.4). BMMs were incubated with IgG-RBCs at 4 °C for 20 min and then were placed at 37°C and 5% CO2 for 5~10 min before whole-cell recordings. Dynasore (100 M) was added when the RBCs were applied to BMMs.

Fura-2 Ca2+ imaging. Cellswere loaded with 5 M Fura-2 AM in the culture medium at 37 °C for 60 min. Fluorescence was recorded at different excitation wavelengths using an EasyRatioPro system (PTI). Fura-2 ratios (F340/F380) were used to monitor changes in intracellular [Ca2+] upon stimulation. Ionomycin (1 M) was added at the conclusion of all experiments to induce a maximal response for comparison.

GCaMP3 Ca2+ imaging. Lysosome-targeted Ca2+ imaging was performed in BMMs or RAW cells that were transfected with GCaMP3-ML1 or GCaMP3-ML1-KK constructs (Shen, Wang et al. 2012). The fluorescence intensity at 470 nm (F470) was monitored using an EasyRatioPro system. Flow cytometry. BMMs were trypsinized and washed with PBS before incubation with ML-SA1 (10 µM) at 37°C for 30 min. Cells were then washed, re-suspended in 1% BSA with anti-mouse Lamp1 (1D4B) antibody on ice for 45 min, and fixed in 2% PFA for 30 min, and were then incubated with Alexa-546 conjugated anti–mouse secondary antibody (Invitrogen) at room temperature for 1h. Macrophages were then re-suspended in 0.5 ml PBS, and analyzed on a FACS Flow Cytometer (MoFlo Astrios, Beckman Coulter). At least 10,000 cells per experiment were analyzed for the forward angle scatter, the right angle scatter, and the fluorescence intensity.

Lysosomal enzyme release/activity. After incubation with ML-SA1 or IgG-RBCs, the culture medium was collected for acid phosphatase (AP) activity measurement. AP activity was measured using an AP colorimetric assay kit (Sigma), which uses p-nitrophenyl phosphate (pNPP) as a phosphatase substrate which turns yellow at a wavelength of 405 nm when dephosphorylated by AP. Lactate de-hydrogenase (LDH) activity was measured using a LDH-Cytotoxicity Assay Kit (Abcam).

Fluorescence and time-lapse imaging. Live imaging of RBC uptake by BMMs was performed on a heated stage using a Spinning Disk confocal imaging system, which consists of an Olympus IX81 inverted microscope, a 100X Oil objective NA 1.49 (Olympus, UAPON100XOTIRF), a CSU-X1 scanner (Yokogawa), an iXon EM-CCD camera (Andor), and MetaMorph Advanced Imaging acquisition software v.7.7.8.0 (Molecular Devices). For Lamp1 detection, BMMs were fixed with 4% PFA and permeabilized with 0.03% Triton X-100, and then stained with 1D4B anti–mouse Lamp1 monoclonal antibody (Iowa Hybridoma Bank). The surface expression of Lamp1 was detected in non-permeabilized macrophages using the same antibody that recognizes a luminal epitope of mouse Lamp1 (Reddy, Caler et al. 2001; Dong, Wang et al. 2009). For phalloidin staining of phagosomes, BMMs were incubated for 10 min with IgG-RBCs, fixed with 4% PFA, permeabilized with 0.03% Triton X-100 for 5 min, and labeled with phalloidin- Alexa-Fluor633 (Invitrogen) for 30 min. The PI(3,5)P2 probe was generated with the tandem repeats of the ML1 N-terminal segment (residues 1–68) fused with GFP tags (Li et al.). All images were taken with the 100X objective of a Leica (TCS SP5) confocal microscope. H&E Staining. Hematoxylin and eosin (H&E) staining was performed in 5 µm slice sections prepared from paraffin-embedded spleen tissues using microtome. The tissues were fixed with 4% PFA upon heart perfusion in 10 -12 week old WT and ML1 KO mice.

HPLC measurement of phosphoinositide levels. Raw macrophage cell lines were grown in 6 well plates to 20-30% confluence. Cells were then rinsed twice with PBS and were incubated for 48 h with the inositol labeling medium, which contained inositol-free DMEM, 10 μCi/mL of myo-[2-3H] inositol (GE Healthcare), 10% (vol/vol) dialyzed FBS, 20 mM Hepes, 5 μg/mL transferrin, and 5 μg/mL insulin (Zolov, Bridges et al. 2012). Afterwards, a solution (pre-warmed to 37°C) of IgG-coated 6 µM polystyrene beads was prepared in a 1:50 ratio (macrophage:beads). After RAW cells were rinsed with PBS once, 4 ml of beads were added to each well. The plates were centrifuged briefly for 1 min at 3,000 RPM and then placed at the 37°C incubator for 1, 2, 5, and 10 min. After each time point, the un-ingested beads were removed; RAW cells were treated with 500 µl of ice-cold 4.5% (vol/vol) perchloric acid for 15 min at room temperature; plates were rotated gently every 2 min to prevent cells from drying. RAW cells were scraped off, spun at 12,000 × g for 10 min at 4 °C, and then processed for HPLC measurement. The data were analyzed as described previously (Zolov, Bridges et al. 2012).

Cell death analysis in brain slice. Brain slices were stained with propidium iodide (PI; membrane impermeant dye only enters the dying cells) and analyzed with confocal microscopy. Briefly, fresh mouse brains were sectioned into 300 m thick slices with a vibratome sectioning system. Immediately after cutting the sections, slices were washed with cold (4°C) HBSS solution, and then incubated with PI (20 g/ml) at 37°C for 15 min, fixed in 4% paraformaldehyde for another 30 min, and then mounted on the glass slides. To avoid damage cause by tissue preparation, images were taken 100 m underneath the slice sections.

Measurement of splenic iron content. Spleens were completely digested in 3M hydrocholoric acid/10% trichoroacetic acid at 65°C overnight. Samples were then centrifuged to precipitate any non-digested materials. The ionic composition of the supernatant was analyzed using a Thermo Scientific Finnigan Element inductively coupled with a plasma-high resolution mass spectrometer (ICP-HRMS) (Wang, Zhang et al. 2012).

References

Chow, C. Y., Y. Zhang, et al. (2007). "Mutation of FIG4 causes neurodegeneration in the pale tremor mouse and patients with CMT4J." Nature 448(7149): 68-72.

Dong, X. P., X. Cheng, et al. (2008). "The type IV mucolipidosis-associated protein TRPML1 is an endolysosomal iron release channel." Nature 455(7215): 992-996.

Dong, X. P., D. Shen, et al. (2010). "PI(3,5)P(2) Controls Membrane Traffic by Direct Activation of Mucolipin Ca Release Channels in the Endolysosome." Nat Commun 1(4).

Dong, X. P., X. Wang, et al. (2009). "Activating mutations of the TRPML1 channel revealed by proline-scanning mutagenesis." J Biol Chem 284(46): 32040-32052.

Link, T. M., U. Park, et al. (2010). "TRPV2 has a pivotal role in macrophage particle binding and phagocytosis." Nat Immunol 11(3): 232-239.

Reddy, A., E. V. Caler, et al. (2001). "Plasma membrane repair is mediated by Ca(2+)-regulated exocytosis of lysosomes." Cell 106(2): 157-169.

Shen, D., X. Wang, et al. (2012). "Lipid storage disorders block lysosomal trafficking by inhibiting a TRP channel and lysosomal calcium release." Nat Commun 3: 731.

Thompson, E. G., L. Schaheen, et al. (2007). "Lysosomal trafficking functions of mucolipin-1 in murine macrophages." BMC Cell Biol 8: 54.

Venugopal, B., M. F. Browning, et al. (2007). "Neurologic, gastric, and opthalmologic pathologies in a murine model of mucolipidosis type IV." Am J Hum Genet 81(5): 1070-1083.

Wang, X., X. Zhang, et al. (2012). "TPC Proteins Are Phosphoinositide- Activated Sodium-Selective Ion Channels in Endosomes and Lysosomes." Cell 151(2): 372-383.

Zolov, S. N., D. Bridges, et al. (2012). "In vivo, Pikfyve generates PI(3,5)P2, which serves as both a signaling lipid and the major precursor for PI5P." Proc Natl Acad Sci U S A 109(43): 17472-17477.

a trp channel in the lysosome regulates large particle...

Documents