a variant mode of mammalian olfaction
TRANSCRIPT
![Page 1: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/1.jpg)
A Variant Mode of Mammalian Olfaction
Permanent linkhttp://nrs.harvard.edu/urn-3:HUL.InstRepos:37944989
Terms of UseThis article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http://nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of-use#LAA
Share Your StoryThe Harvard community has made this article openly available.Please share how this access benefits you. Submit a story .
Accessibility
![Page 2: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/2.jpg)
A Variant Mode of Mammalian Olfaction
A dissertation presented
by
Daniel Marcus Bear
to
The Division of Medical Sciences
in partial fulfillment of the requirements
for the degree of
Doctor of Philosophy
in the subject of
Neurobiology
Harvard University
Cambridge, Massachusetts
November 2016
![Page 3: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/3.jpg)
© 2016 Daniel Marcus Bear All rights reserved.
![Page 4: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/4.jpg)
iii
Dissertation Advisor: Dr. Sandeep R. Datta Daniel Marcus Bear
A Variant Mode of Mammalian Olfaction
Abstract
Olfaction – the sense of smell – informs animals about food, mates, threats, and
other chemical signals. The odors most relevant to survival and reproduction vary
across species and ecology; for this reason, olfactory nervous systems have evolved to
perceive select stimuli and to elicit adaptive responses. The mammalian olfactory
system accomplishes this with families of olfactory receptors – proteins that bind
characteristic odor molecules and signal through parallel neural pathways. Each animal
expresses a diverse repertoire of receptors, geared to its chemical environment, in a
canonical mode of one receptor gene per olfactory sensory neuron. This arrangement
produces precise neural representations for individual odors, which are capable of
driving a range of behaviors. However, it is not known whether this conserved
architecture is suited for all aspects of odor sensation. Here I report that part of the
olfactory system breaks from this predominant organization. An atypical sensory
subsystem, the so-called olfactory “necklace,” does not express traditional olfactory
receptors, but instead detects several classes of chemical stimuli with the previously
unknown MS4A receptor family. MS4A proteins are unrelated to other olfactory
receptors, suggesting that they have evolved to detect distinct odors and to transduce
signals by a different mechanism. Moreover, multiple members of the Ms4a family are
![Page 5: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/5.jpg)
iv
expressed in each necklace neuron. The violation of the “one receptor per neuron” rule
endows this subsystem with broader sensory responses than granted by a single
receptor. By way of this variant organization, the necklace may play a unique role in
shaping odor perception.
![Page 6: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/6.jpg)
v
TABLE OF CONTENTS
Abstract iii
Acknowledgements vi
Chapter 1. General Introduction: Selective Sensation 1
References 5
Chapter 2. The Evolving Architecture of Vertebrate Olfaction 7
Summary 9
References 44
Chapter 3. A Family of non-GPCR Chemosensors Defines an Alternative Logic for Mammalian Olfaction
55
Summary 57
Introduction 58
Results 62
Discussion 106
Experimental Procedures 113
References 149
Chapter 4. General Discussion and Conclusion 157
General Discussion 158
Conclusion 172
References 175
![Page 7: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/7.jpg)
vi
Acknowledgments
The work presented here is the result of extraordinary mentorship and friendship.
It traces back to a sequence of extreme luck during my first year of college: I was forced
to find a research lab for summer work because I had missed the deadline for a fancy
trip. I don’t know where I would be now, a decade later, if I hadn’t first written Mike
Greenberg, or if Mike hadn’t suggested I work with Steve Flavell (then a graduate
student in his lab). My time working with Steve convinced me to become a scientist; and
it also introduced to two more of Mike’s former students, Paul Greer and Bob Datta,
whose roles in my life should be obvious to anyone who has spoken to me since then,
or to anyone who reads this work.
Mike and Steve are among the most rigorous, insightful, and imaginative
scientists I’ve known. However impressive their professional qualities were to a 19-year-
old, though, their strongest influences on me have come through their patience and
guru-like guidance. In ten years, neither has ever offered advice or answered my
millions of questions with anything less than the greatest care and sincerity. I did not
realize, in the beginning, how rare these traits are in professional scientists, in one of
the most competitive environments in the world no less. I still have plenty to learn from
their mentorship. Steve and Mike are something much more impressive than first-rate
scientists: they are wonderful people, and I hope lifelong friends.
Paul is a brilliant scientist and, to me, a unique combination of colleague, mentor,
and friend. I would not be able to express my joy and gratitude for our relationship
without doubling the length of this dissertation. Like Mike and Steve, he has been
endlessly patient and kind over the years in giving me advice about my work, my career,
![Page 8: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/8.jpg)
vii
and most importantly my life – which as for many scientists is all too inseparable from
work and career. But Paul has been consistent in his conviction that the relationships
one has with other people should always be the highest priority. He has said it and he
has lived it. I expect that after another decade of his friendship and wisdom, I will be
even more thankful.
Sandeep “Bob” Datta, my Ph.D. advisor, expresses more than anyone I’ve met
the excitement and wonder of being a researcher. He is open to new scientific ideas
and to the world. At the same time he demands only the highest quality work from
himself and from others. During the first few years of graduate school, when Bob, Paul,
and I were trying to start a research program from scratch, Bob’s uncompromising
nature seemed sometimes like more of a hindrance than an advantage. My feelings
have changed. I have a better sense, now, of how difficult research is under even the
best conditions; I have never met a graduate student, postdoctoral fellow, or young
investigator who did not at some point buckle under the stresses of science. Many days
begin with the thought of how long it’s been since you found something new and worth
your extreme effort to pursue; others end with the worry that you’ve missed something
simple, which would negate your prior work. Bob has always confronted these anxieties
head-on. I am impressed and proud that as his lab has matured, he has learned to allow
others to deal with the difficulties of research in their own lives and in their own ways,
while never wavering in his belief that we are all enormously privileged to be scientists.
He has passed this mindset on to me and my fellow students – Stan Pashkovski, Tari
Tan, Alex Wiltschko, and Maria Bloom – who, through our growing together, have
become permanent mentors and friends.
![Page 9: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/9.jpg)
viii
I could not have survived graduate school without the help of other members of
the Datta Lab and the Department of Neurobiology. This is true of all graduate students
– science is not a solo endeavor – but it is especially true of me. I apologize for my
many (though hopefully all minor) lapses in responsible behavior. In particular, thank
you to the Datta Lab managers – Alexandra Nowlan, Allison Petrosino, and Neha
Bhagat – for keeping our workplace away from the edge of Chaos. Similarly, thank you
to my dissertation advisory committee – Rachel Wilson, Josh Kaplan, and David Corey
– for keeping my work away from the edge of Chaos. I would also like to acknowledge
the outstanding and sometimes thankless guidance of Karen Harmin, the administrator
for the Program in Neuroscience: if not for her patient reminders, the happy missed
deadline that landed me in the department would have been undone by many more.
Finally, I have neither the space nor the words to truly thank the people who
know me best. Fortunately I have no plans to inflict this dissertation on them. They have
absorbed my worst torrents of frustration and self-doubt with their stoic support, and
they have given me what science cannot: the reassurance that their love depends not
on what I learn or what I accomplish, but only on who I am. I haven’t always made it
easy for them, but I hope they feel my respect and my love all the same. I think they do.
Andrew, Eric, Dann, Dan, Lisa, Adam, Dad, and Mom – thank you for being there
behind all of this.
![Page 10: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/10.jpg)
ix
“The Brain, within its Groove Runs evenly – and true – ”
Emily Dickinson (1863)
![Page 11: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/11.jpg)
Chapter 1
General Introduction: Selective Sensation
![Page 12: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/12.jpg)
2
General Introduction
Every animal has a unique view of the world. For each species, natural selection
has shaped the senses to detect, interpret, and remember critical features of the
physical environment that aid its survival and reproduction. The brain extracts, in
stages, progressively more complex information from sensory stimuli – about visual
edges, contours, shapes, and abstract objects, for instance (DiCarlo et al., 2012).
Neural representations magnify some facets of the external world to discern them more
carefully, while ignoring others that have less adaptive value.
The senses therefore detect and process a fraction of natural stimuli. Selective
perception originates in sensory neurons themselves. The limited scope of sensation is
easiest to illustrate in the case of vision: photoreceptor cells in the eye respond to only a
tiny segment of the electromagnetic spectrum, with photon wavelengths outside this
narrow span going undetected. Restricted interaction with the environment is a result of
both biophysical constraints – the thermal noise of retinal opsin photopigments makes
them poor sensors of infrared light – as well as the cost-to-benefit ratio of constructing a
functional sensory system (Laughlin, 2001; Luo et al., 2011). For example, many insects
use patterns of ultraviolet light for foraging and mating, but mammals do not; ultraviolet-
sensitive opsins were not advantageous enough to persist in mammalian lineages (Hunt
et al., 2001). More generally, individual opsin genes have often duplicated or acquired
mutations that shift their spectral sensitivity (Neitz et al., 1991; Yokoyama, 2002). The
resulting patterns of molecular and perceptual evolution show that many of these
changes were adaptive in the animal linages where they arose (Dominy and Lucas,
2001; Frentiu et al., 2007). Thus the genes that encode sensory receptors, molecules
![Page 13: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/13.jpg)
3
that transduce physical into neural signals, are primary sites of functional evolution. By
shaping the repertoire of receptors, natural selection hones the set of stimuli that can be
detected by sensory neurons.
Sensory systems are split into parallel pathways for processing different aspects
of the same physical phenomena, such as the vertebrate retinal rod system for dark
vision existing alongside the cone system for daytime color vision. Within each
subsystem important functions are divided even further, with some circuits specialized
for identifying edges, others for movement, and so on (Gollisch and Meister, 2010). This
is another way in which the nervous system has evolved for selective signal extraction:
computations necessary for detecting certain features are hardwired into the
transduction mechanisms and neuronal architectures of each subsystem; different types
of information remain segregated as they are sent through the central nervous system
and used to influence different behaviors (Do and Yau, 2010; Kim et al., 2008; Zhang et
al., 2012).
The structures of receptors and neural pathways therefore reflect the various
ways natural selection has solved problems of extracting sensory information and
interpreting the external world. Here I examine the genetic and neuronal modes of
chemoreception that have evolved for mammalian olfaction, the sense of smell.
Olfaction detects signals in the form of volatile or labile molecules, such as the odors
emitted by food, predators, and potential mates. In Chapter 2, I describe the structure of
the major vertebrate olfactory subsystems, which are responsible for sensing a wide
variety of odors and driving a range of innate and learned behaviors; I then review the
mechanisms through which olfactory chemoreceptors and the sensory neurons that
![Page 14: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/14.jpg)
4
express them have adapted to each species’ chemical environment. The main mode of
vertebrate olfaction includes multiple hardwired pathways that detect and interpret
different chemical cues; however, it develops flexibly enough that the repertoire of
olfactory receptors has shifted rapidly in response to selective pressures.
In Chapter 3, I report that one mammalian olfactory subsystem – dubbed the
olfactory “necklace” because of its necklace-shaped projections to the olfactory bulb –
represents a variant mode of chemoreception. Necklace sensory neurons employ a
distinct and previously unrecognized type of chemoreceptor protein, encoded by the
gene family Membrane-spanning, 4-pass A (Ms4a). The functional “logic” of the
necklace also breaks from the rest of olfactory system in that each necklace sensory
neuron expresses multiple types of receptor, rather than a single receptor (Axel, 1995;
Greer et al., 2016). This grants necklace cells with broader and more homogeneous
sensory tuning properties than conventional olfactory neurons. Finally, in Chapter 4, I
discuss how this atypical set of receptors and pattern of organization could be adapted
for conveying feeding-related chemical signals; this contrasts with the major olfactory
subsystems’ role in encoding precise odor identities. This work therefore opens a new
path to understanding how sensory receptors and subsystems have evolved to detect
different features of the physical world.
![Page 15: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/15.jpg)
5
References Axel, R. (1995). The molecular logic of smell. Sci Am 273, 154-159.
DiCarlo, J.J., Zoccolan, D., and Rust, N.C. (2012). How does the brain solve visual object recognition? Neuron 73, 415-434.
Do, M.T., and Yau, K.W. (2010). Intrinsically photosensitive retinal ganglion cells. Physiol Rev 90, 1547-1581.
Dominy, N.J., and Lucas, P.W. (2001). Ecological importance of trichromatic vision to primates. Nature 410, 363-366.
Frentiu, F.D., Bernard, G.D., Cuevas, C.I., Sison-Mangus, M.P., Prudic, K.L., and Briscoe, A.D. (2007). Adaptive evolution of color vision as seen through the eyes of butterflies. Proc Natl Acad Sci U S A 104 Suppl 1, 8634-8640.
Gollisch, T., and Meister, M. (2010). Eye smarter than scientists believed: neural computations in circuits of the retina. Neuron 65, 150-164.
Greer, P.L., Bear, D.M., Lassance, J.M., Bloom, M.L., Tsukahara, T., Pashkovski, S.L., Masuda, F.K., Nowlan, A.C., Kirchner, R., Hoekstra, H.E., et al. (2016). A Family of non-GPCR Chemosensors Defines an Alternative Logic for Mammalian Olfaction. Cell 165, 1734-1748.
Hunt, D.M., Wilkie, S.E., Bowmaker, J.K., and Poopalasundaram, S. (2001). Vision in the ultraviolet. Cell Mol Life Sci 58, 1583-1598.
Kim, I.J., Zhang, Y., Yamagata, M., Meister, M., and Sanes, J.R. (2008). Molecular identification of a retinal cell type that responds to upward motion. Nature 452, 478-482.
Laughlin, S.B. (2001). Energy as a constraint on the coding and processing of sensory information. Curr Opin Neurobiol 11, 475-480.
Luo, D.G., Yue, W.W., Ala-Laurila, P., and Yau, K.W. (2011). Activation of visual pigments by light and heat. Science 332, 1307-1312.
![Page 16: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/16.jpg)
6
Neitz, M., Neitz, J., and Jacobs, G.H. (1991). Spectral tuning of pigments underlying red-green color vision. Science 252, 971-974.
Yokoyama, S. (2002). Molecular evolution of color vision in vertebrates. Gene 300, 69-78.
Zhang, Y., Kim, I.J., Sanes, J.R., and Meister, M. (2012). The most numerous ganglion cell type of the mouse retina is a selective feature detector. Proc Natl Acad Sci U S A 109, E2391-2398.
![Page 17: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/17.jpg)
Chapter 2
The Evolving Architecture of Vertebrate Olfaction
![Page 18: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/18.jpg)
8
Attribution:
Chapter 2 has been formatted from the following published work, for which I am the
primary author:
Bear, D.M., Lassance, J.M., Hoekstra, H.E., Datta, S.R. (2016). Evolution of the genetic and neural architecture for vertebrate odor perception. Current Biology (in press). Author Contributions: DMB and SRD wrote the manuscript and made the figures, except for Figure 2.2. JML
and HEH commented on and edited the manuscript and made Figure 2.2. I would also
like to thank Taralyn Marie Tan for creating the design for Figure 2.1 and Hannah
Somhegyi for help editing the figures.
![Page 19: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/19.jpg)
9
Summary
Evolution sculpts the olfactory nervous system in response to the unique sensory
challenges facing each species. In vertebrates, dramatic and diverse adaptations to the
chemical environment are possible because of the hierarchical structure of the olfactory
receptor (OR) gene superfamily: expansion or contraction of the OR gene tree
accompanies major changes in habitat and lifestyle; independent selection on OR
subfamilies reflects local adaptation and conserved chemical communication; and
genetic variation in single OR genes among thousands alters odor percepts and
behaviors driven by precise chemical cues. However, this genetic flexibility contrasts
with the relatively fixed neural architecture of the vertebrate olfactory system, which
mandates that new olfactory receptors integrate into segregated and functionally distinct
neural pathways. This organization allows evolution to couple critical chemical signals
with selectively advantageous responses, but also constrains relationships between
olfactory receptors and behavior. The coevolution of the OR repertoire and the structure
of the olfactory system therefore reveals principles of how the brain solves specific
sensory problems and how it adapts to new ones.
![Page 20: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/20.jpg)
10
Introduction
Olfaction, the sense of smell, has evolved to detect signals from the chemical
environment, which contains clues about where to move, what to eat, when to
reproduce, and which stimuli to remember as rewarding or dangerous (Meister, 2015;
Wyatt, 2014). How an animal responds to chemical cues is in part learned and in part
innate, depending on how the olfactory nervous system has been shaped by both
experience across a lifetime and evolution across generations.
Interacting with the chemical world presents a challenge unlike other sensory
tasks. In contrast to light and sound waves, which vary continuously in wavelength and
amplitude, chemical compounds differ discretely in an enormous number of dimensions.
Compared to vision and audition, olfaction requires many more receptors – proteins
expressed in sensory organs that convert a physical event into an electrochemical
signal carried by neurons. A single photoreceptor pigment may interact with a range of
wavelengths that is sufficiently informative for an animal, as with our dark-vision
rhodopsin; however, biophysical constraints restrict chemoreceptor proteins to interact
with only subsets of chemical space. The high dimensionality of chemical space and the
diversity of the chemical stimuli an animal might encounter have therefore selected for
genomes that encode enormous receptor repertoires, containing hundreds to thousands
of olfactory receptor (OR) genes (Bargmann, 2006; Hansson and Stensmyr, 2011;
Touhara and Vosshall, 2009; Zhang and Firestein, 2002).
Here we examine how the olfactory receptor repertoire and the structure of the
olfactory nervous system evolve in concert to sense and interpret chemical information.
Adaptations in the genetic and neural architecture of olfaction reflect the unique
![Page 21: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/21.jpg)
11
chemosensory challenges faced along a species’ lineage — detecting novel odorants,
discerning especially critical odors with high acuity, and responding behaviorally to
molecules that acquire new meaning. We argue that the receptors underlying vertebrate
olfaction possess two properties essential for the range of adaptations seen in
vertebrate olfactory systems: a flexible and hierarchical pattern of evolution that allows
receptor adaptation to both dramatic and subtle changes in the chemical environment;
and access, through specific expression patterns, to a diverse array of neural pathways
that govern both hardwired, instinctual behaviors as well as more flexible odor learning.
In this way, OR families and subfamilies have evolved on larger scales to inform the
animal about wide swaths of chemical space, while at the same time some individual
receptors have become highly tuned to key odorants that elicit innate responses. We
speculate that the unique ability to incorporate new and evolving OR genes has
produced the substantial genetic and structural diversity of olfactory systems seen
across the vertebrate lineage (Finlay and Darlington, 1995; Meisami and Bhatnagar,
1998; Yopak et al., 2015).
The Molecular, Cellular and Neural Architecture of Vertebrate Olfaction
Smell begins when odor molecules bind to OR proteins on the endings of
sensory neurons. The set of odors an animal can detect therefore depends on the
expression pattern and the protein structure encoded by each of its OR genes. In
vertebrates, nearly all OR genes encode seven-pass transmembrane G-protein coupled
receptors (GPCRs) that, upon ligand binding, signal through G-proteins and intracellular
second messengers to ultimately open membrane ion channels; this depolarizes the
![Page 22: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/22.jpg)
12
sensory neuron to drive action potentials that are conducted along its axon into the
olfactory bulb of the brain (Figure 2.1) (Manzini and Korsching, 2011).
In vertebrates, most olfactory sensory neurons express a single olfactory
receptor gene from one of five major GPCR families (Dalton and Lomvardas, 2015).
The evolutionary history of each family relates roughly to the region of chemical space it
probes, as the odorant structures bound by family members are reminiscent of those
bound by the specific ancestral non-olfactory GPCR from which each family derived
(detailed below.) In the rodent olfactory system where they were first discovered,
members of each OR family are expressed in a Pointilistic pattern within spatially
restricted zones of the nasal epithelia. Most ciliated sensory neurons of the main
olfactory epithelium (MOE) express receptor genes of the largest family, the “classical”
mammalian olfactory receptors (mORs) (Buck and Axel, 1991; Ressler et al., 1993),
while a minority of neurons instead express members of the much smaller trace amino-
acid receptor (TAAR) family (Johnson et al., 2012). In the vomeronasal organ (VNO),
microvillar sensory neurons in the apical epithelial layer express Vomeronasal type 1
Receptors (V1Rs) (Dulac and Axel, 1995), but neurons in the basal layer each express
one Vomeronasal type 2 Receptor (V2R) plus a chaperone V2R in characteristic
combinations (Herrada and Dulac, 1997; Ryba and Tirindelli, 1997) (Silvotti et al., 2007).
Finally, some neurons in both layers of the VNO instead express members of the small
Formyl Peptide Receptor-related family (FPRs) (Liberles et al., 2009; Riviere et al.,
2009).
The one-receptor-per-neuron organization shapes how odor representations
propagate through the olfactory system. The axons of primary sensory neurons
![Page 23: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/23.jpg)
13
Figure 2.1
Organization of the mouse olfactory system (partially adapted from Dulac & Torello,
2003). Odors are blends of molecular compounds inhaled into the nasal cavity, where
they interact with olfactory receptor proteins expressed in the main olfactory epithelium
(medium gray), the vomeronasal organ (dark gray), or one of several smaller sensory
structures not pictured (upper). Each sensory neuron expresses a single olfactory
receptor denoted by its color, and neurons expressing the same receptor project to
insular structures in the olfactory bulb called glomeruli (lower). Glomeruli
corresponding to a given receptor have stereotyped spatial positions across animals.
Mitral cells in the olfactory bulb each send a dendrite into one glomerulus (main
olfactory bulb) or multiple glomeruli corresponding to the same olfactory receptor
(accessory olfactory bulb, not pictured), and project axons to a variety of central brain
regions that mediate odor learning and innate odor-driven behaviors. The targets of
main and accessory bulb mitral cell projections are largely distinct.
![Page 24: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/24.jpg)
14
Figure 2.1 (Continued)
![Page 25: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/25.jpg)
15
expressing the same receptor gene coalesce onto insular structures called glomeruli in
the outer layer of the olfactory bulb, with the positions of the glomeruli corresponding to
a given OR approximately fixed from one animal to the next (Mombaerts, 2004) (Figure
2.1). A given odorant binds to a stereotyped subset of olfactory receptors and thereby
activates a characteristic subset of glomeruli – like keys pressed together as a chord on
a piano – such that odors elicit unique spatiotemporal activity patterns across the
olfactory bulb (Lin da et al., 2006).
Odor responses in the olfactory bulb drive innate and learned behaviors via
neural projections to more central brain regions. The largest of these bulbar targets is
the piriform cortex, a three-layered paleocortical structure in which odor identity is
encoded in the patterned activity of distributed neuronal ensembles. Odor
representations are less well understood in other targets of the olfactory bulb, including
the cortical amygdala and the olfactory tubercle, a subdivision of the ventral striatum.
Mitral and tufted cells of the main olfactory bulb each send a single dendrite into one
glomerulus and extend parallel axon branches into each of these regions in
characteristic patterns, which is thought to underlie the distinct roles of each of these
areas in olfactory processing. Spatially diffuse projections to piriform cortex orchestrate
the generation of odor-specific neural ensembles that appear optimized for odor
learning. In contrast, the cortical amygdala receives stereotyped and spatially restricted
innervation from individual glomeruli and exhibits spatially biased responses to innately
relevant odors; consistent with this apparent hardwiring, the cortical amygdala mediates
instinctual responses to some predator odors (Figure 2.1) (Choi et al., 2011; Root et al.,
2014; Sosulski et al., 2011). In contrast, mitral cells in the accessory olfactory bulb each
![Page 26: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/26.jpg)
16
extend a dendrite into multiple glomeruli (often corresponding to the same vomeronasal
receptor) and project, by way of the medial amygdala, to hypothalamic nuclei involved in
reproductive and stress responses (Figure 2.1) (Mohedano-Moriano et al., 2007). The
targets of main and accessory bulb mitral cells are mostly distinct, and thus higher-order
olfactory brain regions have likely adapted to receive information about odors sensed by
different receptors that trigger distinct behaviors.
Olfactory brain regions, especially the olfactory bulb, vary tremendously in
relative size across vertebrate species; furthermore, in many species, the accessory
olfactory bulb and the vomeronasal organ are absent (Finlay and Darlington, 1995;
Meisami and Bhatnagar, 1998). We therefore focus primarily on the conserved genetic
architecture of vertebrate olfaction, which likely arose in the common ancestor of all ray-
fined fishes and tetrapods (lived ~460-430 MYA). The genome of the zebrafish contains
multiple members of four of the five major GPCR OR families (ORs, TAARs, V2Rs, and
several V1Rs) (Figure 2.2) (Hussain et al., 2009; Saraiva et al., 2015; Saraiva and
Korsching, 2007) and its sensory neurons generally express these receptors in the
same “one receptor, one sensory neuron” pattern as in mice (Oka et al., 2012; Sato et
al., 2007; Weth et al., 1996). Zebrafish sensory neurons project to insular glomeruli
within the olfactory bulb, where innervation from different sensory neuron types
(expressing distinct OR families) is at least partially segregated (Braubach et al., 2012;
Sato et al., 2005). Although the pattern of convergence from sensory neurons to
glomeruli has not been assessed for most species, this conservation across zebrafish
and rodents suggests that the neural organization of the olfactory system forms a stable
background on which to compare the changes in OR gene repertoire. The molecular
![Page 27: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/27.jpg)
17
Figure 2.2
Phylogenetic relationships of the vertebrate GPCR olfactory receptor repertoire. A
representative sample of ~2700 GPCR functional OR genes from fish (Danio rerio), frog
(Xenopus laevis), mouse (Mus musculus), and human (Homo sapiens) genomes was
used to construct a phylogenetic tree (cf. Manzini & Korsching 2011). Notable features
are visible, including large expansions of Class II ORs (red) in tetrapods, V2Rs (purple)
in amphibians, TAARs (blue) in fishes, and V1Rs (teal) in mammals; significant losses
of functional ORs in humans (blue dots) compared to mice (green dots); the monophyly
of Class I (orange) and Class II (red) tetrapod ORs; and the subfamily structure of the
“classical” ORs, with numeric labels corresponding to the subfamilies defined in Hayden
et al. (2010). A Class II OR subfamily (2,13) itself contains a smaller subfamily, the
“OR37” receptors, which has atypically expanded and been conserved at the protein
sequence level in humans. Note that all mammalian and some frog Class I ORs form a
monophyletic clade within the larger set of Class I ORs and other fish OR subfamilies
that are neither Class I nor Class II.
![Page 28: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/28.jpg)
18
Figure 2.2 (Continued)
![Page 29: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/29.jpg)
19
mechanism for choosing a single OR to be expressed in each sensory neuron – which
engages both cell type-specific transcription factors as well as stochastic DNA-DNA
interactions (Dalton and Lomvardas, 2015) – seems to have directly linked the genetic
evolution of OR families with the functional evolution of odor perception. This process
has allowed the olfactory system to flexibly incorporate or discard chemosensors, as
each OR gene stakes out its own population of sensory neurons in the olfactory
epithelium and its own glomerular territory in the olfactory bulb without disrupting the
expression or function of other receptors.
The Birth-and-Death Mechanism of Gene Family Evolution Allows Specific Adaptation to Chemical Space Singular OR expression potentially affords each newly arising OR gene a neural
pathway to inform the brain about the odorants it binds. Evolution of the OR gene
repertoire should therefore reflect the salient features of an animal’s chemical
environment. To test this hypothesis, genomic observations of OR evolution must be
combined with knowledge of what molecules individual receptors bind and how different
animals respond to these odors. Unfortunately, because of the enormous number of OR
proteins and the difficulty of measuring their molecular tuning in vitro, we know only a
small fraction of OR-odorant interactions (Saito et al., 2009).
Nevertheless, thanks to the mechanism of OR repertoire evolution, it is possible
to compare finer portions of the OR gene tree as they grow or die off on multiple
evolutionary timescales. The membership of olfactory receptor families evolves through
a characteristic birth-and-death process. Changes in the number of OR genes result
![Page 30: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/30.jpg)
20
from duplications of contiguous family members during unequal meiotic crossing over,
resulting in a redundancy and functional independence of the new genes that allows
them to mutate and acquire new ligand-binding properties (Nei and Rooney, 2005). A
side-effect of the relaxed selection pressure on recently duplicated genes is the
accumulation of nonsense or frameshift mutations that terminate receptor function,
producing pseudogenes embedded in rapidly duplicating OR gene clusters (Zhang and
Firestein, 2009). This birth-and-death process further explains the low proportion of
orthologous receptors found among species, as many new OR genes can arise in the
time since the divergence of even closely related lineages (Niimura et al., 2014). Other
modes of gene family evolution have occasionally homogenized the OR repertoire, such
as gene conversion between tightly-linked subfamily members and across-species
conservation of single ORs that function outside the olfactory system (Neuhaus et al.,
2009; Niimura et al., 2014; Sharon et al., 1999); however it is clear that birth-and-death
and relaxed selection are the dominant processes by which different species evolve
markedly different sets of olfactory receptors (Adipietro et al., 2012; Niimura and Nei,
2006).
The birth-and-death mechanism allows natural selection to act independently at
multiple levels of the OR gene tree, including each of the five olfactory GPCR families,
more recently diverged subfamilies within each OR family, and individual OR genes
(Figure 2.2). We argue below that progressively more subtle adaptations in the habitat,
lifestyle, and behavior of vertebrate lineages correspond to increasingly fine-scale
growth and death on branches of the OR tree. We then discuss how the olfactory
![Page 31: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/31.jpg)
21
nervous system might take advantage of these changes in the receptor repertoire to
generate new innate and learned olfactory behaviors.
Olfactory Overhaul: Widespread Reshaping of the OR Repertoire in New Sensory
Environments
As some vertebrates have adapted to new habitats or shifted to lifestyles that rely
less on smell, entire OR families and olfactory sensory organs have become
dispensable. For example, as its visual system has expanded dramatically, the old
world primate lineage has seen a massive loss of functional olfactory receptor genes, as
well as a near total loss of the vomeronasal receptor repertoire, accompanied by
pseudogenization of an important VNO chemotransduction channel gene TrpC2 (Figure
2.2) (Liman, 2012; Liman and Innan, 2003). Selection on primate OR genes may have
relaxed following the duplication of the opsin gene encoding the long-wavelength retinal
photopigment, as the genomes of trichromat primates – all old world monkeys and one
species of new world monkey, the howler monkey – have significantly higher ratios of
pseudogenized to intact OR genes than dichromat new world monkeys (Gilad et al.,
2004). Trichromacy may have allowed color vision to take over some olfactory tasks,
like discriminating the ripeness of leaves by their appearance along the red-green axis
(Dominy and Lucas, 2001; Lucas et al., 2003). This view is controversial, however,
because the proportion of OR pseudogenes in a mammalian genome does not correlate
with the number of intact ORs and thus poorly estimates olfactory function (Niimura et
al., 2014); moreover, loss of intact ORs in primates may have begun before the
divergence of new world monkeys and old world monkeys (Matsui et al., 2010).
![Page 32: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/32.jpg)
22
Nevertheless, the growth of the visual nervous system in old world primates likely
reduced reliance on olfaction for many social and foraging behaviors, which may
represent a general pattern: in multiple cases the enhancement of other senses like
vision, echolocation, and electroreception coincides with a smaller OR repertoire (Zhao
et al., 2011) (Niimura and Nei, 2007).
Changes in habitat that broadly alter chemical ecology appear to have also
resized and reshaped the OR families dramatically, though directly demonstrating
causal relationships remains a challenge. The divergence of the tetrapod lineage from
its aquatic relatives ~420 MYA was followed by an order-of-magnitude expansion in the
major vertebrate OR gene family (represented by the mORs in mammals), as hundreds
to thousands of these “classical” OR genes are found in individual amphibian and
terrestrial vertebrate genomes, whereas fish genomes have, at most, 150 (Figure 2.2)
(Niimura and Nei, 2005). The idea that having more OR genes is adaptive on land is
strengthened by converse evidence from multiple independent mammalian lineages that
returned to aquatic life. In these animals (e.g., whales, seals, and manatees), the
number of intact OR genes has dropped since they diverged from their terrestrial
relatives (e.g. cattle, dogs, and elephants) (Hayden et al., 2010).
The classical OR gene family has two major branches, the so-called Class I and
Class II ORs; however, only the Class II branch shows a massive increase in
membership as a possible result of adapting to land. This receptor subfamily is
expansive in the genomes of tetrapods (amphibians and terrestrial vertebrates) but is
essentially absent in fishes, including one more closely related to tetrapods than
teleosts – the coelacanth (Figure 2.2) (Freitag et al., 1998; Niimura, 2009). Why might a
![Page 33: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/33.jpg)
23
particular OR subfamily have expanded in a given vertebrate lineage? The simplest
hypothesis is that the ancestral family members were useful for sensing type of
chemical structure common or critical in that animal’s chemical environment. Having
more OR genes with somewhat diversified ligand-binding regions could have provided a
selective advantage – for instance by increasing perceptual range, sensitivity, or
discriminative power in this region of chemical space. The evolutionary history and
functional tests of the distinction between Class I and Class II ORs support this model.
First identified in the amphibian Xenopus laevis genome, Class I genes cluster
phylogenetically with fish ORs, while Class II genes cluster with the majority of
mammalian ORs (Figure 2.2) (Freitag et al., 1995). Furthermore, Class I genes are
expressed exclusively in the lateral diverticulum of the frog nasal cavity, which senses
waterborne but not airborne odorants from the outside world, while Class II genes are
expressed only in the medial diverticulum, which opens only when the frog is in air
(Freitag et al., 1995). Functional characterization supports the hypothesis that Xenopus
Class I genes are “fish-like”, as when expressed in heterologous cells they detect highly
water-soluble ligands like charged amino acids – important water-borne chemosignals
for fish. Conversely, Class II Xenopus ORs detect some airborne volatile compounds
like the aroma of coffee (Mezler et al., 2001). The ligands of mammalian Class I ORs
are also on average more polar (and thus more water-soluble) than Class II ligands
(Saito et al., 2009); but the relative size of the Class I repertoire has remained stable
across mammals, suggesting that even in purely terrestrial environments these
receptors bind odorants of ecological significance (Niimura et al., 2014).
![Page 34: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/34.jpg)
24
Skipping the Classics: Particular Habitats May Have Favored Expansion of Distinct OR
Families
The presence of smaller “classical” OR families in aquatic animals does not
necessarily mean that olfaction is less important in water than in air. Similar to the
above cases of Class I and Class II ORs, the aquatic environment may have instead
favored the use of other OR families because their ancestral ligand-binding properties
gave them a head-start in detecting more common aqueous odorants. For instance, the
TAAR family has expanded rapidly in teleost fishes (Figure 2.2). The zebrafish genome
encodes over 100 functional TAARs, almost an order of magnitude more than any
vertebrate outside the teleost clade. This expansion includes the derivation of an
entirely new TAAR subfamily under strong positive selection in the teleost lineage,
which was first thought not to encode amine receptors (like the other TAARs) because a
canonical amine-binding motif is lost in many subfamily members (Hussain et al., 2009).
It has now been shown, however, that these teleost TAARs initially evolved a second
amine-binding motif, changing their specificity to diamines over monoamines; later, a
subset of these secondarily lost the original motif, resulting in TAARs that use a distinct
mechanism for amine binding (Li et al., 2015). Together this pattern of TAAR duplication
and diversification suggests that the outsized importance of amine chemosensation
drove this particular OR family to prominence in the teleost lineage. This notion is
consistent with the important role known to be played by amino acids and their diamine
decarboxylation products in the chemical ecology of zebrafish (Hussain et al., 2013).
The ancestral TAAR was likely the orthologue of the mammalian TAAR1 and was
therefore probably a receptor for internally produced trace monoamines like TAAR1
![Page 35: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/35.jpg)
25
ligands tyramine, octopamine, and tryptamine (Liberles, 2015). Thus, the expansion of
the TAAR family in teleosts may have been biased from the start, since only a few
mutations in new TAAR genes would allow better sensing of amines, a region of
chemical space apparently important for the behavior of these fishes. For example,
cadaverine, a diamine signature of putrefaction, is detected by the zebrafish-specific
receptor TAAR13c (Hussain et al., 2013) and elicits innate aversion. This link between a
novel receptor and amine-driven behavior may be a lineage-specific adaptation, as
another teleost, the goldfish, is attracted to cadaverine (perhaps via the action of distinct
TAAR receptors) (Hussain et al., 2013; Li et al., 2015; Rolen et al., 2003).
The evolutionary trajectory of the TAARs raises the possibility that that along
different lineages, specific ancestral receptors have “gotten lucky” by binding chemical
structures similar to those with wider ecological significance. This line of reasoning
could explain why the V2R family expanded dramatically and reached its largest
membership in the amphibian lineage (Figure 2.2) (Nei et al., 2008). The V2Rs are
derived from an ancestral GPCR that senses the amino acid glutamate and have
diversified to allow broader detection of amino acids and longer polypeptides (Ryba and
Tirindelli, 1997). The amphibian V2R family is expressed in the amphibian vomeronasal
organ, which plays an essential role in sensing waterborne peptide sex signals and
coordinating complex mating behavior (Kikuyama et al., 2002; Syed et al., 2013).
Given these examples suggesting that the ecological importance of a given class
of chemicals is reflected by the size of the OR family that detects that chemical class, it
is intriguing to consider its converse: whether the apparent expansion of a specific OR
family can reveal the types of chemical cues that are most relevant to a given species.
![Page 36: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/36.jpg)
26
Consider the case of the semiaquatic platypus, one of only two extant members of the
monotreme lineage, which was initially thought not to rely on strong olfactory abilities
given the high proportion of pseudogenes in its classical OR family and its use of a
unique electroreceptive “bill sense” for locating prey in brackish water; however, it was
later found that the platypus genome contains more functional V1R family members
than any other vertebrate, reflecting an unparalleled expansion of this particular gene
family in the monotreme lineage (Grus et al., 2007). Indeed, the platypus possesses
one of the most complex vomeronasal organs described, suggesting that odor detection
through the “accessory” olfactory system has become its main mode of chemosensation.
Because V1Rs detect many steroid hormones that regulate reproductive and mating
behavior (Isogai et al., 2011), combing this region of chemical space may reveal cues
critical to the behavior of the platypus and ecological reasons that this particular
receptor family expanded.
The Finer Things in Life: Olfactory Specialization Through OR Subfamily Selection
OR birth and death operates locally within the genome, producing closely-related
receptor subfamilies (Figure 2.2) (Adipietro et al., 2012; Zhang and Firestein, 2002,
2009) that may evolve independently of one another. There is evidence that natural
selection can operate on the OR repertoire with this finer-scale flexibility to probe niche-
specific chemical cues with more precision. For example, Hayden et al. (2010) found
that the relative sizes of each mammalian OR subfamily were more representative of a
species’ ecotype – aquatic, semi-aquatic, terrestrial, or flying – than of its ancestry
![Page 37: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/37.jpg)
27
within the phylogenetic tree of mammals (Hayden et al., 2010). These results suggest
that particular receptor subfamilies are better suited to probe different environments.
Testing this hypothesis requires identifying the odors sensed by these receptors
and determining whether larger subfamilies actually confer a selective advantage in
discerning these cues. Observations of subfamily selection on shorter timescales,
correlated with even finer niche adaptation, may help hone in on the sensory demands
driving receptor evolution. For example, in an analysis of OR evolution in bats, the
relative sizes of two subfamilies correlate positively and negatively with independent
adaptations to a purely frugivorous diet (Hayden et al., 2014). A similar investigation of
bird and reptile OR repertoires identified a subfamily associated with carnivory and
several Class I and Class II subfamilies enlarged in aquatic and terrestrial feeders,
respectively (Khan et al., 2015). Members of these OR subfamilies may have become
tuned to volatile compounds found in the foods sought by individual species, and their
expression in the olfactory system may reveal how selective neural pathways adapt to
influence foraging and food selection.
Similarly, distinct subfamilies of the mouse V2R tree appear tuned to labile,
innate fear-producing chemosignals (“kairomones”) derived from different types of
mouse predators (e.g. snakes, birds, rats, and cats) (Isogai et al., 2011). The
observation that the family of Major Urinary Proteins (MUP) acts through V2Rs to
control both interspecies defensive behaviors and intraspecies aggressive behaviors
suggests that V2R-MUP pairing or binding affinities may be particular targets of lineage-
specific subfamily expansion and selection (Chamero et al., 2007; Papes et al., 2010;
Yang et al., 2005). Furthermore, if different V2R subfamilies are in fact tuned to the
![Page 38: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/38.jpg)
28
chemical signatures of particular predators, then their sensory signals could remain
segregated as they propagate through the nervous system – which might allow unique
defensive responses to evolve for each.
Finally, the modular nature of receptor gene evolution allows small subfamilies to
retain critical chemosensory roles, even against a backdrop of widespread receptor loss.
One peculiar mammalian subfamily, called “OR37”, is surprisingly conserved in both
mice and humans, even though humans have lost more than half of their functional OR
genes overall (Figure 2.2) (Hoppe et al., 2006; Niimura and Nei, 2007). Indeed, this
subfamily has expanded independently in the human lineage, suggesting it has not lost
its utility like other human subfamilies (Figure 2.2) (Hoppe et al., 2003). Together these
data suggest that humans may still detect a set of informative odors through the OR37
family, such as the long-chain fatty aldehyde ligands sensed by mouse OR37 members
(Bautze et al., 2012). Intriguingly, mouse mitral cell projections from OR37 glomeruli
target several hypothalamic nuclei rather than the cortical regions typical of most main
olfactory bulb projections (Bader et al., 2012; Strotmann et al., 2000). Thus the OR37
family may have evolved to link the sensation of a certain chemical class to regulation of
innate behaviors or internal state in a way that has remained crucial across species.
The overall pattern of birth-and-death OR evolution therefore demonstrates lineage-
specific adaptation to the chemical environment.
The Evolution of Single OR Genes: Direct Links Between Sensation and Action
Adaptation through change in the number of OR genes is only possible if the
olfactory nervous system has ways to employ the new receptor genes that emerge as
![Page 39: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/39.jpg)
29
particular subfamilies grow and diversify. Because natural odor blends activate only a
subset of receptors (Lin da et al., 2006), expressing newly duplicated and diversified
subfamily members may provide a more nuanced neural representation of the regions
of chemical space they sense. This could in turn allow finer resolution in discriminating
the makeup or concentrations of the odors sensed by the ancestral receptors.
What this model does not explain is how an animal’s interpretation of a given
odor may evolve. Many vertebrates exhibit innate patterns of behavior that can be
released by precise chemical stimuli, including even some monomolecular odorants
outside the context of their natural odor blends (Figure 2.3) (Dulac and Torello, 2003;
Hussain et al., 2013; Kikuyama et al., 2002; Lin et al., 2005). It is not obvious how
evolution could couple these blend constituents to appropriate innate behaviors via
changes in olfactory receptor number. Animals may instead interpret these
chemosignals through single, precisely- and sensitively-tuned olfactory receptors that
tap into hardwired, behavior-evoking neural circuits. This pattern of receptor tuning and
neural organization is prominent in insects, perhaps because their olfactory receptor
repertoires are much smaller (and likely less redundant) than in vertebrates. The
compounds that elicit innate responses in both insects and vertebrates are essential for
survival and reproduction – sex pheromones, attractive or aversive food odors, and
predator signatures – explaining why olfactory neurons have evolved to detect them
with high sensitivity and to couple directly to neural circuits that drive innate behaviors
(Figure 2.3) (Dekker et al., 2006; Kurtovic et al., 2007; Sakurai et al., 2015; Stensmyr et
al., 2012). For instance, the exocrine-secreted peptides ESP1 and ESP22 act
exclusively through V2Rp5 and an unknown V2R to promote female sexual receptivity
![Page 40: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/40.jpg)
30
Figure 2.3 A sample of monomolecular odorants that drive innate, species-specific behaviors
across vertebrates and insects. Instinctual reproductive, protective, and feeding
behaviors are released by a variety of chemical structures, including volatile airborne
small molecules in rodents (top row); waterborne acids, bases, and peptides in fishes
and amphibians (middle row); and volatile hydrocarbons in insects (bottom row).
Chemical structures (receptor responsible for behavior, if known), left to right: top row
2,4,5-trimethythiazoline, 2-sec-butyl-4,5- dihydrothiazole [SBT], 2,3-dehydro-exo-
brevicomin [DHB] (Dulac and Torello, 2003), phenethylamine (Mus musculus TAAR4)
(Dewan et al., 2013), trimethylamine (Mus musculus TAAR5) (Ferrero et al., 2011);
middle row 4-hydroxyphenylacetic acid (Danio rerio ORA1 [a V1R]) (Behrens et al.,
2014), cadaverine (Danio rerio TAAR13c) (Hussain et al., 2013), splendiferin (peptide
pheromone for Litoria splendida), sodefrin (peptide pheromone for Cynops
pyrrhogaster) (Kikuyama et al., 2002); bottom row methylhexanoate (D. sechellia
Or22a), octanoic acid (Dekker et al., 2006), cis-11-vaccenyl acetate (D. melanogaster
Or67d) (Kurtovic et al., 2007), (10E,12Z)-hexadeca-10,12-dien-1-al [upper] and
(10E,12Z)-hexadeca-10,12-dien-1-ol [lower] (aliases bombykal, receptor Bombyx mori
BmOr3, and bombykol, receptor B. mori BmOr1, respectively) (Sakurai et al., 2015).
Behavioral responses are sometimes enhanced by combinations of odorants, as with
SBT and DHB in mice and bombykal and bombykol in the silk moth. Moreover,
responses to the same compound(s) may differ drastically between species or between
sexes of the same species.
![Page 41: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/41.jpg)
31
Figure 2.3 (Continued)
![Page 42: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/42.jpg)
32
(the “lordosis” posture) and to block male sexual activity toward juveniles below
reproductive age, respectively (Ferrero et al., 2013; Haga et al., 2010). Similarly
phenethylamine found in the urine of carnivores, acts by binding to the receptor TAAR4
to promote avoidance behavior (Dewan et al., 2013; Ferrero et al., 2011). These
individual receptors therefore play non-redundant roles in shaping odor perception and
interpretation, suggesting that even in olfactory systems that use hundreds or
thousands of receptors, single members of these gene families may evolve outsized
ecological significance and privileged neural access to specific central circuits (Dewan
et al., 2013).
This model also predicts that, in animal lineages in which the role of olfaction in
driving stereotyped reproductive and defensive behaviors has waned, there will be few
cases where individual receptor genes are under strong selection pressure. This seems
to be borne out in humans, for whom there is almost no evidence for positive selection
in the coding sequences of single OR genes since the human-chimpanzee divergence
~7 MYA. It is therefore unlikely that particular OR genes have conferred a selective
advantage during human evolution (Gimelbrant et al., 2004).
That said, genetic variation in single human ORs – under selective pressure or
not – can produce large differences in odor perception. Detection thresholds and
(un)pleasantness ratings of many odors have been linked to common polymorphisms in
and around human OR genes, including a receptor coding mutation that alters
sensitivity to and valence of the male hormones androstenone and androstenedione
(Keller et al., 2007); a mutation that accounts for nearly all observed variation in the
perception of b-ionone and dramatically alters preference for foods emiting this odor
![Page 43: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/43.jpg)
33
(Jaeger et al., 2013); and a polymorphism closely linked to a cluster of OR genes that
tracks with the aversive “soapiness” of cilantro (Eriksson et al., 2012). Furthermore, as
in other mammals, gland secretions can in a laboratory setting can bias sexual
attraction and nipple-orienting behavior in adult and infant humans, respectively, raising
the possibility that we employ unidentified pheromones (Gelstein et al., 2011) (Varendi
and Porter, 2001). If these chemosignals follow the pattern of other social and suckling
pheromones, they are likely to include monomolecular odorants acting through high-
affinity, specialist receptors (Lin et al., 2005; Schaal et al., 2003). Even if they are not
under strong selection, then, it remains possible that single human ORs contribute
meaningfully to behavior through unknown mechanisms.
Segregated Olfactory Pathways As Substrates For Innate Olfactory Behaviors
Defined odorants can drive innate responses or preferences through a few
receptors, even against a background of hundreds or thousands – many of which may
be active simultaneously during typical sensation of complex odor blends (Rokni et al.,
2014). How, then, are particular chemical cues coupled precisely to appropriate odor-
driven behaviors? It appears that the olfactory system begins to sort odor information in
the peripheral sense organs. Several hardwired, parallel pathways – from sensory
neurons to subregions of the olfactory bulb to distinct central brain targets – arose early
in the evolution of vertebrates, using distinct receptor families and subfamilies to convey
different categories of chemical signal. Although zebrafish, unlike mice, have only a
single olfactory epithelium, the primary sensory neurons that express ORs and TAARs
are molecularly, morphologically, and anatomically distinct from those that express
![Page 44: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/44.jpg)
34
amino acid-sensing V2Rs; these two cell types (ciliated and microvillar sensory neurons,
respectively) are found in different layers of the olfactory epithelium and project to
separate regions of the olfactory bulb, presaging the separation of mammalian ciliated
neurons (in the MOE) and microvillar neurons (in the VNO) and their projections to
distinct main and accessory olfactory bulbs (Braubach et al., 2012; Sato et al., 2005).
The zebrafish epithelium also contains a third cell type (crypt neurons) that expresses
one of the few zebrafish V1R genes in most cells and projects to a unique glomerulus
(Ahuja et al., 2013; Oka et al., 2012; Saraiva and Korsching, 2007). In addition, a
closely related receptor has recently been found to detect a pheromone that releases
egg-laying behavior, reminiscent of the reproductive behaviors regulated by mammalian
V1Rs (Figure 2.3) (Behrens et al., 2014). This “ancestral” organization of the olfactory
periphery therefore suggests that discrete subsystems and the receptors they express
are hardwired to yield different behavioral responses to odor (Figure 2.4 top).
Consistent with this possibility, a major olfactory adaptation along the amphibian
and terrestrial branches of the vertebrate tree includes the establishment of segregated
neuroanatomical structures that express more recently-derived ORs. Unlike fish,
amphibians have evolved a separate vomeronasal organ that detects attractive peptide
sex pheromones (specific to amphibians) through unusually large and recently
expanded subfamilies of V2Rs, as well as an air-filled MOE compartment the expresses
the massively enlarged Class II OR repertoire described above; evolutionarily more
ancient V2Rs tuned to single amino acids remain expressed in the water-filled MOE
compartment along with V1Rs, Class I ORs, and TAARs (Date-Ito et al., 2008; Syed et
al., 2013; Syed et al., 2015) (Figure 2.4 middle). The observation that newer V2R genes
![Page 45: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/45.jpg)
35
Figure 2.4 Peripheral organization of OR family expression across vertebrates. Top: A horizontal
section of a quarter of one olfactory rosette from the zebrafish (Danio rerio). Sensory
neurons are embedded in a main olfactory epithelium (MOE) with a water-filled lumen.
Members of four of the five major GPCR OR families are expressed in different sensory
neuron types: TAARs and Class I “classical” ORs [here denoting also fish ORs that
belong to neither Class I nor Class II] are expressed in ciliated cells occupying the basal
layers of the epithelium; V2Rs in microvillar cells in the middle layer; and at least one
V1R in “crypt cells” of the upper layer. Axons of the three cell types project to different,
spatially segregated, and stereotyped glomeruli of the zebrafish olfactory bulb. Middle:
A coronal section of one half of the main olfactory epithelium and the vomeronasal
organ (VNO) of the western clawed frog (Xenopus laevis). An air-filled medial
diverticulum (MD) houses neurons expressing Class II “classical” ORs and several
V1Rs; a water-filled lateral diverticulum (LD), Class I “classical” ORs, several TAARs,
and ancestral V2Rs; the water-filled (VNO), newer members of the expanded V2R
family. Bottom: A coronal section of the MOE and VNO of the house mouse (Mus
musculus). Receptor family expression is segregated (several exceptions not pictured),
with Class I ORs and TAARs expressed in the dorsal MOE, Class II ORs in the ventral
MOE (and some in the dorsal MOE, not pictured), V1Rs in the apical VNO, V2Rs in the
basal VNO, and FPRs in both VNO layers. Some sensory neurons in the “cul-de-sacs”
of the MOE express the receptor guanylate cyclase GC-D and multiple members of a
non-GPCR family of four-pass transmembrane chemoreceptors, MS4A.
![Page 46: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/46.jpg)
36
Figure 2.4 (Continued)
![Page 47: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/47.jpg)
37
have acquired both a novel expression pattern and a novel role in innate reproductive
behaviors suggests that odor interpretation depends not only on what ligands are
detected, but also on the developmental identities and specialized sensory pathways of
the cells that detect them (Gliem et al., 2013).
The segregation of the olfactory periphery has proceeded even further in rodents.
Mice, for example, have separate epithelial layers for V1Rs and V2Rs within the VNO
(Figure 2.4 bottom); distinct dorsoventral zones and molecular machinery for the
expression of TAARs, Class I ORs, and Class II ORs in the MOE (Bozza et al., 2009); a
group of neurons at the tip of the nose, the Grueneberg ganglion, which is thought to
detect alarm pheromones and structurally related predator odorants (Brechbuhl et al.,
2008; Brechbuhl et al., 2013); a patch of olfactory neurons on the nasal septum (the
“septal organ”) that largely express a single broadly-tuned OR and may convey
information about breathing (Grosmaitre et al., 2009; Grosmaitre et al., 2007); and
within cul-de-sacs of the MOE, a set of neurons which are thought to mediate the social
acquisition of food preference and which express both the receptor guanylate cyclase
GC-D and a recently-described family of non-GPCR olfactory receptors (Figure 2.4
bottom) (Greer et al., 2016; Hu et al., 2007; Munger et al., 2010).
The olfactory bulb appears to organize this variety of incoming sensory
information into domains larger than a single glomerulus. For instance, the sensory
neurons that express class I OR-, class II OR-, TAAR-, or GC-D are developmentally
constrained to innervate circumscribed and nonintersecting regions of the olfactory bulb
(Figure 2.5) (Bozza et al., 2009) (Pacifico et al., 2012). Furthermore, there is substantial
evidence that activity in spatially and molecularly segregated glomeruli drives different
![Page 48: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/48.jpg)
38
Figure 2.5
Spatial and molecular organization of projection targets and behavioral responses
downstream of distinct mouse olfactory bulb glomeruli. Circumscribed zones of
glomeruli are innervated by sensory neurons expressing each of the four largest GPCR
OR families or the MS4As. In addition, Class I and Class II OR glomeruli occupy the
dorsal-most and more ventral zones, respectively; and projections from Grueneberg
Ganglion sensory neurons form their own “necklace” (light blue) anterior to the GC-
D/MS4A “necklace” (green). Dorsal Class II OR glomeruli form a molecularly defined
zone, which includes glomeruli necessary for innate aversion of some predator odorants.
Within the ventral zone of Class II OR glomeruli, some regions are enriched for the
glomeruli of TrpM5- or OR37 subfamily-expressing sensory neurons, which have
second-order projections to the “vomeronasal” amygdala and the hypothalamus,
respectively.
![Page 49: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/49.jpg)
39
Figure 2.5 (Continued)
![Page 50: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/50.jpg)
40
patterns of stereotyped behavior via hardwired projections to central brain regions. First,
an “innate aversion” domain for predator odor sensation can be found at the ventral
subdivision of the dorsal olfactory bulb, while the dorsal-most Class I-expressing
domain is instead required for aversive responses to spoiled food odorants
(Kobayakawa et al., 2007). Next, the ventral olfactory bulb houses the glomeruli of
molecularly distinct neurons (expressing components of an alternative, TrpM5-
dependent chemotransduction pathway) that preferentially respond to urine-derived
pheromones and project to the “vomeronasal amygdala”, as well as the cluster of OR37
glomeruli and their unusual mitral cell projections to the hypothalamus (Bader et al.,
2012; Lin et al., 2005; Lin et al., 2007; Thompson et al., 2012). Finally, the TAAR
domain of the olfactory bulb is required for innate behavioral responses to several
ecologically important amines, even though these same odorants can be detected by
receptors in the main olfactory system (Figure 2.5) (Dewan et al., 2013). Recent data
also suggest a global organization to the main olfactory bulb, in which glomeruli that
reside more rostrally evoke investigatory behaviors, while those that are more caudal
evoke aversion (Kermen et al., 2016). Characterizing the mitral cell projections
downstream of specific glomeruli may reveal different capacities to influence a variety of
central processing or behavioral centers. This “switchboard” organization could allow
each OR gene to adapt its chemosensory tuning according to its domain’s function
without altering the circuits downstream of the receptor.
However, the interpretation of an odor is not determined simply by whether it
recruits neural activity within a specific glomerular domain. For instance within the
TAAR domain, the TAAR4 glomerulus is required for aversion to phenethylamine, but
![Page 51: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/51.jpg)
41
the nearby TAAR5 glomerulus is highly tuned to the attractive mouse pheromone
trimethylamine (Dewan et al., 2013; Li et al., 2013). Thus even closely related receptors
and their closely apposed glomeruli — within a similar subdomain of the olfactory bulb –
may drive opposite behaviors. Combinatorial effects of multiple (TAAR and non-TAAR)
glomeruli may produce the different behavioral responses to high-affinity TAAR4 and
TAAR5 ligands. Consistent with this possibility, the effect of TAAR5 activation appears
to be inverted in rats, for which trimethylamine is aversive (Figure 2.3) (Li et al., 2013).
However it is also possible that, within the TAAR domain of the bulb, TAAR4 and
TAAR5 glomeruli are connected to distinct downstream circuits that drive fundamentally
different behaviors. Determining whether the differential effects of TAAR4 and TAAR5
ligands in mice relies upon glomerulus-specific projections to higher brain regions, the
coordinated activity of groups of glomeruli, or on circuit activity within the TAAR domain
will therefore reveal key principles of how odor representations in the olfactory bulb
govern perception and behavior.
The appeal of the “domain” hypothesis for coupling odors to behavior lies in its
relative developmental simplicity. In this model the olfactory system could take
advantage of developmentally-specific gradients of morphogenetic and axon guidance
molecules to build sub-circuits within the olfactory bulb that connect to distinct higher
brain regions. How might the olfactory system create a system in which individual
glomeruli within a given domain are differentially connected to higher brain regions?
One highly speculative possibility is that the olfactory bulb’s output layer of mitral cells is,
like the retinal ganglion cell layer of the retina, tiled with molecularly distinct cell types
that convey different types of information via their projection or spiking patterns.
![Page 52: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/52.jpg)
42
Hardwired synaptic connections to these mitral cell types might then be biased by the
complement of cell surface proteins on OSN axons, which are themselves determined
by both their developmental identity and the OR gene stochastically chosen for
expression (Serizawa et al., 2006). This sort of coupling between ORs and central
circuits could explain why many odors appear to have a stereotyped attractive or
aversive valence in mice and humans, even when the ORs responsible for their
detection are evolving neutrally (Haddad et al., 2010; Saraiva et al., 2016). In other
words, behavioral biases could be substrates for adaptation (e.g. through changes in
the expression of cell surface proteins given a particular OR choice) but would also
necessarily exist by chance. In this model, the multiglomerular domains of the olfactory
bulb may determine which downstream targets are available (e.g. medial amygdala
from the accessory bulb and cortical amygdala from the main bulb) but leave enough
flexibility for receptor-specific behaviors to evolve. The loss of several subsystems in
humans may explain why single OR genes are not under strong selective pressure in
our lineage, as a highly-tuned receptor would have no specialized circuitry to tap into to
generate an adaptive behavioral response.
Conclusion
How evolution sculpts the olfactory system is a response to both the general
problem of probing a wide swath of chemical space, as well as the unique sensory
challenges facing each animal species. In vertebrates, both dramatic and subtle
adaptations to the chemical environment are possible because of the vast, hierarchical
structure of the olfactory receptor (OR) gene families. First, rapid growth or pruning of
![Page 53: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/53.jpg)
43
large OR families accommodate major changes in habitat and lifestyle, as with ocean-
to-terrestrial shifts and derived primacy of the visual sense. Second, selection on
individual OR families or subfamilies permits niche adaptation or conserved chemical
communication between conspecifics. Third, genetic variation in single OR genes,
among thousands, can alter behaviors driven by precise chemical cues. We speculate
that the molecular logic and neuroanatomical architecture of the vertebrate olfactory
nervous system, in which newly arising olfactory receptor genes can tap into a number
of segregated pathways that influence both innate and learned behaviors, may have
favored this dramatic mode of olfactory receptor evolution. In this model OR genes form
the marble from which the vertebrate olfactory system is sculpted, specifying the ability
both to detect odors and to implement appropriate survival- and reproduction-promoting
responses. Peering into this dynamic process reveals a direct link between the evolution
of an animal’s genome and the specific tasks solved by its nervous system.
![Page 54: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/54.jpg)
44
References
Adipietro, K.A., Mainland, J.D., and Matsunami, H. (2012). Functional evolution of mammalian odorant receptors. PLoS Genet 8, e1002821.
Ahuja, G., Ivandic, I., Salturk, M., Oka, Y., Nadler, W., and Korsching, S.I. (2013). Zebrafish crypt neurons project to a single, identified mediodorsal glomerulus. Sci Rep 3, 2063.
Bader, A., Klein, B., Breer, H., and Strotmann, J. (2012). Connectivity from OR37 expressing olfactory sensory neurons to distinct cell types in the hypothalamus. Front Neural Circuits 6, 84.
Bargmann, C.I. (2006). Comparative chemosensation from receptors to ecology. Nature 444, 295-301.
Bautze, V., Bar, R., Fissler, B., Trapp, M., Schmidt, D., Beifuss, U., Bufe, B., Zufall, F., Breer, H., and Strotmann, J. (2012). Mammalian-specific OR37 receptors are differentially activated by distinct odorous fatty aldehydes. Chem Senses 37, 479-493.
Behrens, M., Frank, O., Rawel, H., Ahuja, G., Potting, C., Hofmann, T., Meyerhof, W., and Korsching, S. (2014). ORA1, a zebrafish olfactory receptor ancestral to all mammalian V1R genes, recognizes 4-hydroxyphenylacetic acid, a putative reproductive pheromone. J Biol Chem 289, 19778-19788.
Bozza, T., Vassalli, A., Fuss, S., Zhang, J.J., Weiland, B., Pacifico, R., Feinstein, P., and Mombaerts, P. (2009). Mapping of class I and class II odorant receptors to glomerular domains by two distinct types of olfactory sensory neurons in the mouse. Neuron 61, 220-233.
Braubach, O.R., Fine, A., and Croll, R.P. (2012). Distribution and functional organization of glomeruli in the olfactory bulbs of zebrafish (Danio rerio). J Comp Neurol 520, 2317-2339, Spc2311.
Brechbuhl, J., Klaey, M., and Broillet, M.C. (2008). Grueneberg ganglion cells mediate alarm pheromone detection in mice. Science 321, 1092-1095.
Brechbuhl, J., Moine, F., Klaey, M., Nenniger-Tosato, M., Hurni, N., Sporkert, F., Giroud, C., and Broillet, M.C. (2013). Mouse alarm pheromone shares structural similarity with predator scents. Proc Natl Acad Sci U S A 110, 4762-4767.
![Page 55: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/55.jpg)
45
Buck, L., and Axel, R. (1991). A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell 65, 175-187.
Chamero, P., Marton, T.F., Logan, D.W., Flanagan, K., Cruz, J.R., Saghatelian, A., Cravatt, B.F., and Stowers, L. (2007). Identification of protein pheromones that promote aggressive behaviour. Nature 450, 899-902.
Choi, G.B., Stettler, D.D., Kallman, B.R., Bhaskar, S.T., Fleischmann, A., and Axel, R. (2011). Driving opposing behaviors with ensembles of piriform neurons. Cell 146, 1004-1015.
Dalton, R.P., and Lomvardas, S. (2015). Chemosensory receptor specificity and regulation. Annu Rev Neurosci 38, 331-349.
Date-Ito, A., Ohara, H., Ichikawa, M., Mori, Y., and Hagino-Yamagishi, K. (2008). Xenopus V1R vomeronasal receptor family is expressed in the main olfactory system. Chem Senses 33, 339-346.
Dekker, T., Ibba, I., Siju, K.P., Stensmyr, M.C., and Hansson, B.S. (2006). Olfactory shifts parallel superspecialism for toxic fruit in Drosophila melanogaster sibling, D. sechellia. Curr Biol 16, 101-109.
Dewan, A., Pacifico, R., Zhan, R., Rinberg, D., and Bozza, T. (2013). Non-redundant coding of aversive odours in the main olfactory pathway. Nature 497, 486-489.
Dominy, N.J., and Lucas, P.W. (2001). Ecological importance of trichromatic vision to primates. Nature 410, 363-366.
Dulac, C., and Axel, R. (1995). A novel family of genes encoding putative pheromone receptors in mammals. Cell 83, 195-206.
Dulac, C., and Torello, A.T. (2003). Molecular detection of pheromone signals in mammals: from genes to behaviour. Nat Rev Neurosci 4, 551-562.
Eriksson, N., Wu, S., Do, C.B., Kiefer, A.K., Tung, J.Y., Mountain, J.L., Hinds, D.A., and Francke, U. (2012). A genetic variant near olfactory receptor genes influences cilantro preference. Flavour 1, 1.
![Page 56: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/56.jpg)
46
Ferrero, D.M., Lemon, J.K., Fluegge, D., Pashkovski, S.L., Korzan, W.J., Datta, S.R., Spehr, M., Fendt, M., and Liberles, S.D. (2011). Detection and avoidance of a carnivore odor by prey. Proc Natl Acad Sci U S A 108, 11235-11240.
Ferrero, D.M., Moeller, L.M., Osakada, T., Horio, N., Li, Q., Roy, D.S., Cichy, A., Spehr, M., Touhara, K., and Liberles, S.D. (2013). A juvenile mouse pheromone inhibits sexual behaviour through the vomeronasal system. Nature 502, 368-371.
Finlay, B.L., and Darlington, R.B. (1995). Linked regularities in the development and evolution of mammalian brains. Science 268, 1578-1584.
Freitag, J., Krieger, J., Strotmann, J., and Breer, H. (1995). Two classes of olfactory receptors in Xenopus laevis. Neuron 15, 1383-1392.
Freitag, J., Ludwig, G., Andreini, I., Rossler, P., and Breer, H. (1998). Olfactory receptors in aquatic and terrestrial vertebrates. J Comp Physiol A 183, 635-650.
Gelstein, S., Yeshurun, Y., Rozenkrantz, L., Shushan, S., Frumin, I., Roth, Y., and Sobel, N. (2011). Human tears contain a chemosignal. Science 331, 226-230.
Gilad, Y., Przeworski, M., and Lancet, D. (2004). Loss of olfactory receptor genes coincides with the acquisition of full trichromatic vision in primates. PLoS Biol 2, E5.
Gimelbrant, A.A., Skaletsky, H., and Chess, A. (2004). Selective pressures on the olfactory receptor repertoire since the human-chimpanzee divergence. Proc Natl Acad Sci U S A 101, 9019-9022.
Gliem, S., Syed, A.S., Sansone, A., Kludt, E., Tantalaki, E., Hassenklover, T., Korsching, S.I., and Manzini, I. (2013). Bimodal processing of olfactory information in an amphibian nose: odor responses segregate into a medial and a lateral stream. Cell Mol Life Sci 70, 1965-1984.
Greer, P.L., Bear, D.M., Lassance, J.M., Bloom, M.L., Tsukahara, T., Pashkovski, S.L., Masuda, F.K., Nowlan, A.C., Kirchner, R., Hoekstra, H.E., et al. (2016). A Family of non-GPCR Chemosensors Defines an Alternative Logic for Mammalian Olfaction. Cell 165, 1734-1748.
![Page 57: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/57.jpg)
47
Grosmaitre, X., Fuss, S.H., Lee, A.C., Adipietro, K.A., Matsunami, H., Mombaerts, P., and Ma, M. (2009). SR1, a mouse odorant receptor with an unusually broad response profile. J Neurosci 29, 14545-14552.
Grosmaitre, X., Santarelli, L.C., Tan, J., Luo, M., and Ma, M. (2007). Dual functions of mammalian olfactory sensory neurons as odor detectors and mechanical sensors. Nat Neurosci 10, 348-354.
Grus, W.E., Shi, P., and Zhang, J. (2007). Largest vertebrate vomeronasal type 1 receptor gene repertoire in the semiaquatic platypus. Mol Biol Evol 24, 2153-2157.
Haddad, R., Medhanie, A., Roth, Y., Harel, D., and Sobel, N. (2010). Predicting odor pleasantness with an electronic nose. PLoS Comput Biol 6, e1000740.
Haga, S., Hattori, T., Sato, T., Sato, K., Matsuda, S., Kobayakawa, R., Sakano, H., Yoshihara, Y., Kikusui, T., and Touhara, K. (2010). The male mouse pheromone ESP1 enhances female sexual receptive behaviour through a specific vomeronasal receptor. Nature 466, 118-122.
Hansson, B.S., and Stensmyr, M.C. (2011). Evolution of insect olfaction. Neuron 72, 698-711.
Hayden, S., Bekaert, M., Crider, T.A., Mariani, S., Murphy, W.J., and Teeling, E.C. (2010). Ecological adaptation determines functional mammalian olfactory subgenomes. Genome Res 20, 1-9.
Hayden, S., Bekaert, M., Goodbla, A., Murphy, W.J., Davalos, L.M., and Teeling, E.C. (2014). A cluster of olfactory receptor genes linked to frugivory in bats. Mol Biol Evol 31, 917-927.
Herrada, G., and Dulac, C. (1997). A novel family of putative pheromone receptors in mammals with a topographically organized and sexually dimorphic distribution. Cell 90, 763-773.
Hoppe, R., Breer, H., and Strotmann, J. (2003). Organization and evolutionary relatedness of OR37 olfactory receptor genes in mouse and human. Genomics 82, 355-364.
![Page 58: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/58.jpg)
48
Hoppe, R., Lambert, T.D., Samollow, P.B., Breer, H., and Strotmann, J. (2006). Evolution of the "OR37" subfamily of olfactory receptors: a cross-species comparison. J Mol Evol 62, 460-472.
Hu, J., Zhong, C., Ding, C., Chi, Q., Walz, A., Mombaerts, P., Matsunami, H., and Luo, M. (2007). Detection of near-atmospheric concentrations of CO2 by an olfactory subsystem in the mouse. Science 317, 953-957.
Hussain, A., Saraiva, L.R., Ferrero, D.M., Ahuja, G., Krishna, V.S., Liberles, S.D., and Korsching, S.I. (2013). High-affinity olfactory receptor for the death-associated odor cadaverine. Proc Natl Acad Sci U S A 110, 19579-19584.
Hussain, A., Saraiva, L.R., and Korsching, S.I. (2009). Positive Darwinian selection and the birth of an olfactory receptor clade in teleosts. Proc Natl Acad Sci U S A 106, 4313-4318.
Isogai, Y., Si, S., Pont-Lezica, L., Tan, T., Kapoor, V., Murthy, V.N., and Dulac, C. (2011). Molecular organization of vomeronasal chemoreception. Nature 478, 241-245.
Jaeger, S.R., McRae, J.F., Bava, C.M., Beresford, M.K., Hunter, D., Jia, Y., Chheang, S.L., Jin, D., Peng, M., Gamble, J.C., et al. (2013). A Mendelian trait for olfactory sensitivity affects odor experience and food selection. Curr Biol 23, 1601-1605.
Johnson, M.A., Tsai, L., Roy, D.S., Valenzuela, D.H., Mosley, C., Magklara, A., Lomvardas, S., Liberles, S.D., and Barnea, G. (2012). Neurons expressing trace amine-associated receptors project to discrete glomeruli and constitute an olfactory subsystem. Proc Natl Acad Sci U S A 109, 13410-13415.
Keller, A., Zhuang, H., Chi, Q., Vosshall, L.B., and Matsunami, H. (2007). Genetic variation in a human odorant receptor alters odour perception. Nature 449, 468-472.
Kermen, F., Midroit, M., Kuczewski, N., Forest, J., Thevenet, M., Sacquet, J., Benetollo, C., Richard, M., Didier, A., and Mandairon, N. (2016). Topographical representation of odor hedonics in the olfactory bulb. Nat Neurosci 19, 876-878.
Khan, I., Yang, Z., Maldonado, E., Li, C., Zhang, G., Gilbert, M.T., Jarvis, E.D., O'Brien, S.J., Johnson, W.E., and Antunes, A. (2015). Olfactory Receptor Subgenomes Linked with Broad Ecological Adaptations in Sauropsida. Mol Biol Evol 32, 2832-2843.
![Page 59: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/59.jpg)
49
Kikuyama, S., Yamamoto, K., Iwata, T., and Toyoda, F. (2002). Peptide and protein pheromones in amphibians. Comp Biochem Physiol B Biochem Mol Biol 132, 69-74.
Kobayakawa, K., Kobayakawa, R., Matsumoto, H., Oka, Y., Imai, T., Ikawa, M., Okabe, M., Ikeda, T., Itohara, S., Kikusui, T., et al. (2007). Innate versus learned odour processing in the mouse olfactory bulb. Nature 450, 503-508.
Kurtovic, A., Widmer, A., and Dickson, B.J. (2007). A single class of olfactory neurons mediates behavioural responses to a Drosophila sex pheromone. Nature 446, 542-546.
Li, Q., Korzan, W.J., Ferrero, D.M., Chang, R.B., Roy, D.S., Buchi, M., Lemon, J.K., Kaur, A.W., Stowers, L., Fendt, M., et al. (2013). Synchronous evolution of an odor biosynthesis pathway and behavioral response. Curr Biol 23, 11-20.
Li, Q., Tachie-Baffour, Y., Liu, Z., Baldwin, M.W., Kruse, A.C., and Liberles, S.D. (2015). Non-classical amine recognition evolved in a large clade of olfactory receptors. Elife 4, e10441.
Liberles, S.D. (2015). Trace amine-associated receptors: ligands, neural circuits, and behaviors. Curr Opin Neurobiol 34, 1-7.
Liberles, S.D., Horowitz, L.F., Kuang, D., Contos, J.J., Wilson, K.L., Siltberg-Liberles, J., Liberles, D.A., and Buck, L.B. (2009). Formyl peptide receptors are candidate chemosensory receptors in the vomeronasal organ. Proc Natl Acad Sci U S A 106, 9842-9847.
Liman, E.R. (2012). Changing senses: chemosensory signaling and primate evolution. Adv Exp Med Biol 739, 206-217.
Liman, E.R., and Innan, H. (2003). Relaxed selective pressure on an essential component of pheromone transduction in primate evolution. Proc Natl Acad Sci U S A 100, 3328-3332.
Lin da, Y., Shea, S.D., and Katz, L.C. (2006). Representation of natural stimuli in the rodent main olfactory bulb. Neuron 50, 937-949.
Lin, D.Y., Zhang, S.Z., Block, E., and Katz, L.C. (2005). Encoding social signals in the mouse main olfactory bulb. Nature 434, 470-477.
![Page 60: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/60.jpg)
50
Lin, W., Margolskee, R., Donnert, G., Hell, S.W., and Restrepo, D. (2007). Olfactory neurons expressing transient receptor potential channel M5 (TRPM5) are involved in sensing semiochemicals. Proc Natl Acad Sci U S A 104, 2471-2476.
Lucas, P.W., Dominy, N.J., Riba-Hernandez, P., Stoner, K.E., Yamashita, N., Loria-Calderon, E., Petersen-Pereira, W., Rojas-Duran, Y., Salas-Pena, R., Solis-Madrigal, S., et al. (2003). Evolution and function of routine trichromatic vision in primates. Evolution 57, 2636-2643.
Manzini, I., and Korsching, S. (2011). The peripheral olfactory system of vertebrates: molecular, structural and functional basics of the sense of smell. e-Neuroforum 2, 68-77.
Matsui, A., Go, Y., and Niimura, Y. (2010). Degeneration of olfactory receptor gene repertories in primates: no direct link to full trichromatic vision. Mol Biol Evol 27, 1192-1200.
Meisami, E., and Bhatnagar, K.P. (1998). Structure and diversity in mammalian accessory olfactory bulb. Microsc Res Tech 43, 476-499.
Meister, M. (2015). On the dimensionality of odor space. Elife 4, e07865.
Mezler, M., Fleischer, J., and Breer, H. (2001). Characteristic features and ligand specificity of the two olfactory receptor classes from Xenopus laevis. J Exp Biol 204, 2987-2997.
Mohedano-Moriano, A., Pro-Sistiaga, P., Ubeda-Banon, I., Crespo, C., Insausti, R., and Martinez-Marcos, A. (2007). Segregated pathways to the vomeronasal amygdala: differential projections from the anterior and posterior divisions of the accessory olfactory bulb. Eur J Neurosci 25, 2065-2080.
Mombaerts, P. (2004). Genes and ligands for odorant, vomeronasal and taste receptors. Nat Rev Neurosci 5, 263-278.
Munger, S.D., Leinders-Zufall, T., McDougall, L.M., Cockerham, R.E., Schmid, A., Wandernoth, P., Wennemuth, G., Biel, M., Zufall, F., and Kelliher, K.R. (2010). An olfactory subsystem that detects carbon disulfide and mediates food-related social learning. Curr Biol 20, 1438-1444.
![Page 61: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/61.jpg)
51
Nei, M., Niimura, Y., and Nozawa, M. (2008). The evolution of animal chemosensory receptor gene repertoires: roles of chance and necessity. Nat Rev Genet 9, 951-963.
Nei, M., and Rooney, A.P. (2005). Concerted and birth-and-death evolution of multigene families. Annu Rev Genet 39, 121-152.
Neuhaus, E.M., Zhang, W., Gelis, L., Deng, Y., Noldus, J., and Hatt, H. (2009). Activation of an olfactory receptor inhibits proliferation of prostate cancer cells. J Biol Chem 284, 16218-16225.
Niimura, Y. (2009). Evolutionary dynamics of olfactory receptor genes in chordates: interaction between environments and genomic contents. Hum Genomics 4, 107-118.
Niimura, Y., Matsui, A., and Touhara, K. (2014). Extreme expansion of the olfactory receptor gene repertoire in African elephants and evolutionary dynamics of orthologous gene groups in 13 placental mammals. Genome Res 24, 1485-1496.
Niimura, Y., and Nei, M. (2005). Evolutionary dynamics of olfactory receptor genes in fishes and tetrapods. Proc Natl Acad Sci U S A 102, 6039-6044.
Niimura, Y., and Nei, M. (2006). Evolutionary dynamics of olfactory and other chemosensory receptor genes in vertebrates. J Hum Genet 51, 505-517.
Niimura, Y., and Nei, M. (2007). Extensive gains and losses of olfactory receptor genes in mammalian evolution. PLoS One 2, e708.
Oka, Y., Saraiva, L.R., and Korsching, S.I. (2012). Crypt neurons express a single V1R-related ora gene. Chem Senses 37, 219-227.
Pacifico, R., Dewan, A., Cawley, D., Guo, C., and Bozza, T. (2012). An olfactory subsystem that mediates high-sensitivity detection of volatile amines. Cell Rep 2, 76-88.
Papes, F., Logan, D.W., and Stowers, L. (2010). The vomeronasal organ mediates interspecies defensive behaviors through detection of protein pheromone homologs. Cell 141, 692-703.
Ressler, K.J., Sullivan, S.L., and Buck, L.B. (1993). A zonal organization of odorant receptor gene expression in the olfactory epithelium. Cell 73, 597-609.
![Page 62: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/62.jpg)
52
Riviere, S., Challet, L., Fluegge, D., Spehr, M., and Rodriguez, I. (2009). Formyl peptide receptor-like proteins are a novel family of vomeronasal chemosensors. Nature 459, 574-577.
Rokni, D., Hemmelder, V., Kapoor, V., and Murthy, V.N. (2014). An olfactory cocktail party: figure-ground segregation of odorants in rodents. Nat Neurosci 17, 1225-1232.
Rolen, S.H., Sorensen, P.W., Mattson, D., and Caprio, J. (2003). Polyamines as olfactory stimuli in the goldfish Carassius auratus. J Exp Biol 206, 1683-1696.
Root, C.M., Denny, C.A., Hen, R., and Axel, R. (2014). The participation of cortical amygdala in innate, odour-driven behaviour. Nature 515, 269-273.
Ryba, N.J., and Tirindelli, R. (1997). A new multigene family of putative pheromone receptors. Neuron 19, 371-379.
Saito, H., Chi, Q., Zhuang, H., Matsunami, H., and Mainland, J.D. (2009). Odor coding by a Mammalian receptor repertoire. Sci Signal 2, ra9.
Sakurai, T., Mitsuno, H., Mikami, A., Uchino, K., Tabuchi, M., Zhang, F., Sezutsu, H., and Kanzaki, R. (2015). Targeted disruption of a single sex pheromone receptor gene completely abolishes in vivo pheromone response in the silkmoth. Sci Rep 5, 11001.
Saraiva, L.R., Ahuja, G., Ivandic, I., Syed, A.S., Marioni, J.C., Korsching, S.I., and Logan, D.W. (2015). Molecular and neuronal homology between the olfactory systems of zebrafish and mouse. Sci Rep 5, 11487.
Saraiva, L.R., Kondoh, K., Ye, X., Yoon, K.H., Hernandez, M., and Buck, L.B. (2016). Combinatorial effects of odorants on mouse behavior. Proc Natl Acad Sci U S A 113, E3300-3306.
Saraiva, L.R., and Korsching, S.I. (2007). A novel olfactory receptor gene family in teleost fish. Genome Res 17, 1448-1457.
Sato, Y., Miyasaka, N., and Yoshihara, Y. (2005). Mutually exclusive glomerular innervation by two distinct types of olfactory sensory neurons revealed in transgenic zebrafish. J Neurosci 25, 4889-4897.
![Page 63: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/63.jpg)
53
Sato, Y., Miyasaka, N., and Yoshihara, Y. (2007). Hierarchical regulation of odorant receptor gene choice and subsequent axonal projection of olfactory sensory neurons in zebrafish. J Neurosci 27, 1606-1615.
Schaal, B., Coureaud, G., Langlois, D., Ginies, C., Semon, E., and Perrier, G. (2003). Chemical and behavioural characterization of the rabbit mammary pheromone. Nature 424, 68-72.
Serizawa, S., Miyamichi, K., Takeuchi, H., Yamagishi, Y., Suzuki, M., and Sakano, H. (2006). A neuronal identity code for the odorant receptor-specific and activity-dependent axon sorting. Cell 127, 1057-1069.
Sharon, D., Glusman, G., Pilpel, Y., Khen, M., Gruetzner, F., Haaf, T., and Lancet, D. (1999). Primate evolution of an olfactory receptor cluster: diversification by gene conversion and recent emergence of pseudogenes. Genomics 61, 24-36.
Silvotti, L., Moiani, A., Gatti, R., and Tirindelli, R. (2007). Combinatorial co-expression of pheromone receptors, V2Rs. J Neurochem 103, 1753-1763.
Sosulski, D.L., Bloom, M.L., Cutforth, T., Axel, R., and Datta, S.R. (2011). Distinct representations of olfactory information in different cortical centres. Nature 472, 213-216.
Stensmyr, M.C., Dweck, H.K., Farhan, A., Ibba, I., Strutz, A., Mukunda, L., Linz, J., Grabe, V., Steck, K., Lavista-Llanos, S., et al. (2012). A conserved dedicated olfactory circuit for detecting harmful microbes in Drosophila. Cell 151, 1345-1357.
Strotmann, J., Conzelmann, S., Beck, A., Feinstein, P., Breer, H., and Mombaerts, P. (2000). Local permutations in the glomerular array of the mouse olfactory bulb. J Neurosci 20, 6927-6938.
Syed, A.S., Sansone, A., Nadler, W., Manzini, I., and Korsching, S.I. (2013). Ancestral amphibian v2rs are expressed in the main olfactory epithelium. Proc Natl Acad Sci U S A 110, 7714-7719.
Syed, A.S., Sansone, A., Roner, S., Bozorg Nia, S., Manzini, I., and Korsching, S.I. (2015). Different expression domains for two closely related amphibian TAARs generate a bimodal distribution similar to neuronal responses to amine odors. Sci Rep 5, 13935.
![Page 64: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/64.jpg)
54
Thompson, J.A., Salcedo, E., Restrepo, D., and Finger, T.E. (2012). Second-order input to the medial amygdala from olfactory sensory neurons expressing the transduction channel TRPM5. J Comp Neurol 520, 1819-1830.
Touhara, K., and Vosshall, L.B. (2009). Sensing odorants and pheromones with chemosensory receptors. Annu Rev Physiol 71, 307-332.
Varendi, H., and Porter, R.H. (2001). Breast odour as the only maternal stimulus elicits crawling towards the odour source. Acta Paediatr 90, 372-375.
Weth, F., Nadler, W., and Korsching, S. (1996). Nested expression domains for odorant receptors in zebrafish olfactory epithelium. Proc Natl Acad Sci U S A 93, 13321-13326.
Wyatt, T.D. (2014). Introduction to Chemical Signaling in Vertebrates and Invertebrates. In Neurobiology of Chemical Communication, C. Mucignat-Caretta, ed. (Boca Raton (FL)).
Yang, H., Shi, P., Zhang, Y.P., and Zhang, J. (2005). Composition and evolution of the V2r vomeronasal receptor gene repertoire in mice and rats. Genomics 86, 306-315.
Yopak, K.E., Lisney, T.J., and Collin, S.P. (2015). Not all sharks are "swimming noses": variation in olfactory bulb size in cartilaginous fishes. Brain Struct Funct 220, 1127-1143.
Zhang, X., and Firestein, S. (2002). The olfactory receptor gene superfamily of the mouse. Nat Neurosci 5, 124-133.
Zhang, X., and Firestein, S. (2009). Genomics of olfactory receptors. Results Probl Cell Differ 47, 25-36.
Zhao, H., Xu, D., Zhang, S., and Zhang, J. (2011). Widespread losses of vomeronasal signal transduction in bats. Mol Biol Evol 28, 7-12.
![Page 65: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/65.jpg)
Chapter 3
A Family of non-GPCR Chemosensors Defines an Alternative Logic for Mammalian Olfaction
![Page 66: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/66.jpg)
56
Attribution
Chapter 3 has been formatted from the following published work, for which I am a
primary author:
Greer, P.L.*, Bear, D.M.*, Lassance, J.M., Bloom, M.L., Tsukahara, T., Pashkovski, S.L., Masuda, F.K., Nowlan, A.C., Kirchner, R., Hoekstra, H.E., et al. (2016). A Family of non-GPCR Chemosensors Defines an Alternative Logic for Mammalian Olfaction. Cell 165, 1734-1748.
*These authors contributed equally to this work.
Author Contributions DMB, PLG, and SRD conceived experiments and wrote the manuscript. DMB, PLG,
MLB, TT, SP, and ACN carried out all wet experiments; evolutionary analysis was
performed by JML, FKM, and HH. RK performed RNAseq read quality control and
alignment.
![Page 67: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/67.jpg)
57
Summary
Odor perception in mammals is mediated by parallel sensory pathways that
convey distinct information about the olfactory world. Multiple olfactory subsystems
express characteristic seven-transmembrane G-protein coupled receptors (GPCRs) in a
one-receptor-per-neuron pattern that facilitates odor discrimination. Sensory neurons of
the “necklace” subsystem are nestled within the recesses of the olfactory epithelium and
detect diverse odorants; however, they do not express known GPCR odor receptors.
Here we report that members of the four-pass transmembrane MS4A protein family are
chemosensors expressed within necklace sensory neurons. These receptors localize to
sensory endings and confer responses to ethologically-relevant ligands including
pheromones and fatty acids in vitro and in vivo. Individual necklace neurons co-express
many MS4A proteins and are activated by multiple MS4A ligands; this pooling of
information suggests that the necklace is organized more like subsystems for taste than
for smell. The MS4As therefore define a distinct mechanism and functional logic for
mammalian olfaction.
![Page 68: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/68.jpg)
58
Introduction
As animals navigate the natural world they encounter an unending variety of
small molecules, which are rich sources of information that signify the presence of
organisms and salient objects in the environment. The olfactory system detects many of
these molecules through odorant receptor proteins expressed by peripheral olfactory
sensory neurons (OSNs), which are coupled to higher brain circuits mediating odor
perception (Axel, 1995; Ihara et al., 2013). In mammals, the olfactory system is divided
into multiple, parallel processing streams made up of anatomically and molecularly
distinct sensory neuron populations. The largest subdivision, the main olfactory system,
is capable of detecting nearly all volatile odorants and plays key roles in odor
discrimination and learning. Smaller subsystems (such as the vomeronasal system) are
thought to play a more specialized role in odor perception, discriminating odors of innate
significance and releasing specific patterns of reproductive, agonistic, or defensive
behavior (Munger et al., 2009).
The main and vomeronasal olfactory systems each express characteristic
odorant receptor families that belong to the G-protein coupled receptor (GPCR)
superfamily; these receptor families define the specific receptive fields and therefore the
function of each subsystem (Buck and Axel, 1991; Dulac and Axel, 1995; Herrada and
Dulac, 1997; Liberles and Buck, 2006; Liberles et al., 2009; Matsunami and Buck, 1997;
Riviere et al., 2009; Ryba and Tirindelli, 1997). The identification of these receptor
genes (including the Odorant Receptors (ORs), Vomeronasal type 1 Receptors,
Vomeronasal type 2 Receptors (V2Rs), Formyl Peptide Receptors and the Trace
Amine-Associated Receptors) has revealed a key organizational principle: each mature
![Page 69: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/69.jpg)
59
olfactory sensory neuron (with the exception of those within the basal subdivision of the
vomeronasal system) expresses just a single receptor gene of the hundreds encoded in
the genome (Dalton et al., 2015). This pattern of expression defines specific information
channels in the olfactory system, as the axons of those sensory neurons that express
the same odorant receptor converge on a small number of insular structures within the
olfactory bulb called glomeruli; these glomeruli are differentially recruited as animals
sense distinct smells, enabling the brain to discriminate odors detected by the nose
(Mori and Sakano, 2011). Individual basal vomeronasal sensory neurons also target
specific bulb glomeruli, but express two V2Rs instead of a single receptor (Martini et al.,
2001).
While the identification of odorant receptor genes has led to deep insight into the
sensory tuning and functional architecture of the main and vomeronasal subsystems,
there are additional mammalian subsystems whose modes of odor detection — and
therefore function — are less clear. Particularly mysterious is the “necklace” subsystem,
which is distinguished by its unusual anatomy: OSNs within this subsystem are
concentrated in the recesses of the olfactory epithelium (the “cul-de-sac” regions), and
project axons to a ring of 12-40 apparently interconnected glomeruli that encircle the
caudal olfactory bulb like beads on a necklace (Juilfs et al., 1997; Shinoda et al., 1989).
Necklace sensory neurons and glomeruli respond to a diverse range of chemical stimuli,
including gases (such as carbon disulfide and carbon dioxide), pheromones (such as
2,5-dimethylpyrazine (2,5-DMP), 2-heptanone, and E-farnesene), plant-derived
odorants, and urinary peptides (Fulle et al., 1995; Hu et al., 2007; Juilfs et al., 1997;
Leinders-Zufall et al., 2007; Meyer et al., 2000; Munger et al., 2010; Sun et al., 2009).
![Page 70: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/70.jpg)
60
While many of these ligands have innate significance for the mouse, the specific role of
the necklace in mediating odor perception remains unclear.
Intriguingly, necklace OSNs do not express the signaling proteins known to
mediate GPCR-based chemotransduction in the rest of the main olfactory epithelium
(Juilfs et al., 1997; Meyer et al., 2000). While the ability of the necklace system to detect
and behaviorally respond to gases and peptides requires the single pass
transmembrane protein Guanylate Cyclase-D (GC-D), which is specifically expressed in
all necklace neurons, the remainder of the diverse sensory responses observed in this
system are unexplained (Guo et al., 2009; Leinders-Zufall et al., 2007; Sun et al., 2009).
These observations suggest that necklace OSNs harbor an as-yet unrecognized
receptor type, whose identification could reveal key features of the functional
organization and neural logic that governs the necklace system.
Here we show that necklace OSNs express a previously-unidentified class of
chemoreceptor encoded by the Ms4a gene family. Each MS4A protein detects a
specific subset of ethologically-relevant odorants — including fatty acids and the
putative mouse pheromone 2,5-DMP — that stimulate necklace sensory neurons in
vivo. Ectopic expression of MS4A proteins is sufficient to confer responses to MS4A
ligands upon conventional olfactory neurons. However, unlike all known mammalian
olfactory receptors, the Ms4a genes do not belong to the GPCR superfamily and are not
expressed in the conventional one-receptor-one-neuron pattern; instead, each Ms4a
gene encodes a four-pass transmembrane protein and many Ms4a family members are
expressed in every necklace sensory neuron. Taken together, this work defines a new
mechanism for mammalian olfaction and identifies a population of atypical olfactory
![Page 71: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/71.jpg)
61
sensory neurons that each express many members of a receptor gene family,
suggesting a distinct perceptual role for odor information coursing through the necklace
subsystem. Because MS4A proteins are also expressed in chemosensory cells that
reside outside the nasal epithelium, these findings suggest a broader role for the MS4A
proteins in the detection of chemical cues.
![Page 72: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/72.jpg)
62
Results
To identify candidate receptor gene families specific to the necklace olfactory
system, RNAseq was used to compare transcripts expressed by FACS-isolated GC-D-
expressing and conventional OSNs (Figures 3.1A, 3.1B, 3.2A, and 3.2B). This analysis
failed to reveal expression of known odorant receptor families or enrichment of other
GPCR subfamilies within necklace sensory neurons. Consistent with this and prior
reports, Golf, Adcy3, Cnga2, Cnga4, Trpc2, and Trpm5 — gene products required for
odor-related signal transduction in conventional OSNs — also were not expressed in
GC-D cells (Munger et al., 2009). To screen for potential non-GPCR odorant receptors,
the RNAseq data were filtered to identify transmembrane protein families that exhibit
sufficient molecular diversity to potentially interact with a wide range of ligands. As
detailed below, this screen identified the Membrane Spanning, 4-pass A (Ms4a) genes,
which encode a class of four-transmembrane (4TM) spanning proteins that are
structurally distinct from GPCRs (Eon Kuek et al., 2015).
RNAseq revealed transcripts for several Ms4a family members in GC-D-
expressing cells (Figure 3.1B). Because Ms4a transcripts had low RNAseq read counts,
the Nanostring single-molecule detection technique was used to unambiguously
determine the presence of every member of the Ms4a gene family in GC-D cells (Khan
et al., 2011). This analysis revealed the reproducible expression of 12 Ms4a family
members (of the 17 members annotated in the mouse genome), demonstrating that
GC-D cells express low levels of a specific subset of Ms4a genes (Figure 3.1C). None
of these 12 genes was detected in conventional OSNs above background (data not
shown). Notably absent from GC-D cells are the two best-studied Ms4a genes, Ms4a1
![Page 73: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/73.jpg)
63
Figure 3.1
Expression of Ms4a genes in necklace sensory neurons. A. (Left) The Gucy2d-IRES-
TauGFP allele marks necklace sensory neurons expressing PDE2A (blue) and GC-D
(red). Grayscale is nuclear counterstain (DAPI). (Right) Pde2a+ necklace sensory
neurons reside in epithelial “cul-de-sacs” and do not express the Omp-IRES-GFP allele
or the conventional OR signal transduction protein Adenylyl Cyclase3 (red). Scale bars
10 µM. B. Enrichment versus expression plot for every sequenced mRNA in GC-D+ and
OMP+ sensory neurons. Each point is a transcript with detectable RNAseq reads, with
marker genes associated with GC-D cells (Car2, Pde2a, and Cnga3) and OMP cells
(Golf, Cnga2, and Cnga4) labeled in red and green, respectively; reliably detected Ms4a
family members are highlighted in blue. C. Nanostring-based mRNA quantification of
GC-D cells relative to OMP cells. Marker genes for OMP and GC-D cells are shown in
green and red, respectively. Twelve of the 17 annotated Ms4a genes are significantly
enriched in GC-D cells relative to OMP cells (blue bars). * p < 0.05, paired t-test.
![Page 74: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/74.jpg)
64
Figure 3.1 (Continued)
![Page 75: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/75.jpg)
65
Figure 3.2
A. Scatter plots of FAC sorted, dissociated olfactory epithelial cells from wild type mice
(left), mice harboring the Gucy2d-IRES-TauGFP allele (middle), or mice expressing the
Omp-IRES-GFP allele (right). The gate used to isolate ~100% pure populations of
fluorescent necklace OSNs or canonical OSNs is indicated. B. Heat map of the
correlation of gene expression between RNAseq samples, with warmer colors
corresponding to more highly correlated gene expression.
![Page 76: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/76.jpg)
66
Figure 3.2 (Continued)
![Page 77: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/77.jpg)
67
and Ms4a2, which have been implicated in calcium signaling downstream of the B-cell
receptor and high-affinity Fc-Epsilon receptor, respectively, but whose precise function
remains unclear (Bubien et al., 1993; Dombrowicz et al., 1998; Koslowski et al., 2008;
Lin et al., 1996; Polyak et al., 2008).
To assess the molecular diversity of the MS4A family, Ms4a genes were
identified from representative species of all major mammalian lineages. We then asked
how different these genes were within a given species, as amino acid differences are a
prerequisite for individual MS4As to interact with distinct odors. Multiple sequence
alignments revealed substantial intraspecies diversity amongst the MS4As, particularly
within the extracellular domains of the protein, whose length is variable (Figures 3.3A
and 3.3B). This diversity is comparable to that observed in the third through seventh
transmembrane domains in conventional ORs, the regions thought to form ligand-
binding pockets that give rise to odorant specificity (Buck and Axel, 1991; Man et al.,
2004; Singer, 2000). These findings raise the possibility that each MS4A within a given
organism may interact with a distinct set of extracellular cues.
Ms4a genes are found in a single genomic cluster in all queried mammals; this
organization, suggestive of tandem duplication, is also found in known chemoreceptor
gene families and is thought to facilitate diversification of family members (Figure 3.4A)
(Nei et al., 2008). We therefore also assessed differences between Ms4a genes across
species, to identify those regions of the MS4A protein subject to diversifying or purifying
selection. MS4A proteins were significantly divergent across evolution (Figure 3.3C)
(Nei et al., 2008); the most rapidly evolving amino acid residues in the MS4A proteins
are highly enriched in the predicted extracellular loops, where contact with
![Page 78: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/78.jpg)
68
Figure 3.3
A. Multiple sequence alignment of the mouse MS4A proteins expressed in GC-D cells.
Residues that are more conserved are shown in warmer colors, whereas residues that
are less conserved are depicted in colder colors (conservation scores were determined
using PRALINE, see methods). The intracellular (IC), extracellular (EC), and
transmembrane (TM) regions of the proteins are indicated, and reveal the greatest
sequence diversity in the extracellular domains (with additional diversity in the
intracellular C-terminus). B. Multispecies alignments of MS4A proteins from either the
MS4A4 or MS4A6 subfamilies. Amino acid conservation was determined and heat-
mapped as in A. As with alignments of all GC-D-expressed MS4As, the extracellular
domains within these subfamilies are more diverse than other regions of the MS4As. C.
A phylogenetic tree of the mammalian Ms4a gene family was generated using every
Ms4a gene found in 37 representative taxa, which were selected to cover all major
mammalian lineages (Supplementary table 1). Every Ms4a gene was assigned to an
MS4A subfamily (see methods), and each subfamily is represented with a unique color
to facilitate visualization within the circular phylogenetic tree. Each Ms4a gene is
represented as a line within this plot where the length of the line corresponds to the
degree of evolutionary change within a lineage over time (the scale bar represents the
number of substitutions per site). The Ms4a gene family cluster diversified through
tandem duplication early in the evolution of mammals as illustrated by the presence of
10 homologs in the monotreme (platypus, light blue lines) and marsupial (Tasmanian
devil, red lines) representatives, which contrasts the single copy of MS4A15 found in
![Page 79: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/79.jpg)
69
Figure 3.3 (Continued) bird genomes (Zuccolo et al., 2010). Further extension of the family occurred during the
evolution of placental mammals, with human and mouse genomes harboring 16 and 17
genes, respectively. The majority of MS4A subfamilies exhibit one-to-one orthologous
pairs across species. By contrast, the MS4A4 and MS4A6 subfamilies, which are highly
enriched in GCD neurons, demonstrate complex one-to-many and many-to-many
paralogous relationships between species. It is noteworthy that 50% of the genes
present in the bovid representatives are either lost or pseudogenized in cetacean
lineages suggesting rapid gene turnover throughout evolution.
![Page 80: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/80.jpg)
70
Figure 3.3 (Continued)
![Page 81: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/81.jpg)
71
Figure 3.4
Genomic clustering and positive selection of the Ms4a gene family. A. Graphical
representation of Chromosome 19 of Mus musculus, including the entire Ms4a gene
family (red); immediately telomeric to the Ms4a gene cluster resides a large group of
conventional mammalian odorant receptor genes (blue). B. Topographical
representations of the primary sequences of Mus musculus MS4A4A (top, left),
MS4A6B (top, right), ORAI1 (bottom, left), and TAS2R1 (bottom, right). Amino acid
residues under strong purifying selection are shown in blue, whereas those under
positive selection are shown in red (posterior probability > 0.90, see Experimental
Procedures); residues under positive selection are enriched within extracellular loops of
MS4A proteins and bitter taste receptors (p = 5.06 X 10-16 and p = 6.76 X 10-7,
respectively, hypergeometric test).
![Page 82: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/82.jpg)
72
Figure 3.4 (Continued)
![Page 83: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/83.jpg)
73
environmental chemical stimuli could occur (Figure 3.4B). Bitter taste receptors, which
accommodate the specific diet of their host organism, exhibit a similar pattern of
diversifying selection (Figure 3.4B) (Hayakawa et al., 2014; Wooding, 2011). In contrast,
members of the Orai family, which encode 4TM proteins and are not thought to detect
environmental chemical stimuli, show no signs of diversifying selection (Figure 3.4B)
(Amcheslavsky et al., 2015). The MS4A family therefore exhibits a pattern of expansion
and divergence similar to other chemosensors, although the observation that both
within- and between-species MS4A sequence variability is enriched within extracellular
loops — rather than traditional hydrophobic binding pockets — suggests that if the
MS4As detect odors they do so through a distinct domain from conventional GPCR
ORs.
MS4A Proteins Confer Odor Responses In Vitro
Although no endogenous or natural ligands have been identified for any member
of the MS4A family, the specific expression of a molecularly diverse complement of
MS4As within olfactory sensory neurons — taken with prior evidence suggesting
involvement in calcium signaling — raised the possibility that Ms4a genes encode a
novel class of chemoreceptor (Bubien et al., 1993; Dombrowicz et al., 1998; Koslowski
et al., 2008; Lin et al., 1996; Polyak et al., 2008). To test whether specific interactions
between odors and MS4A proteins induce calcium influx in cells, we heterologously
expressed individual MS4A proteins together with the genetically-encoded fluorescent
calcium indicator GCaMP6s in HEK293 cells (Figures 3.5A and 3.5B); expression of
MS4A proteins did not increase the baseline rate of calcium transients (Figures 3.5C
![Page 84: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/84.jpg)
74
Figure 3.5
A. Representative confocal images of HEK293 cells transfected with plasmids encoding
GCaMP6S (green) and N-terminal mCherry-fusion proteins of the indicated MS4A
protein (red), revealing the presence of mCherry-MS4A fusions at the plasma
membrane. B. HEK293 cells transfected with GCaMP6S (green) and either mCherry
alone or mCherry-MS4A6C (red) were immunostained under non-permeablizing
conditons with an extracellularly-directed anti-MS4A6C antibody, revealing specific
labeling of MS4A6C proteins (blue) indicating that MS4A6C is efficiently trafficked to the
plasma membrane and adopts the predicted topology. C. The spontaneous activity rate
of HEK293 cells expressing MOR9-1 or the indicated MS4A was calculated and then
normalized to control cells that expressed GCaMP6s alone (see methods). Data are
presented as mean +/- SEM from 24 independent coverslips per condition. The
normalized spontaneous rate of 1 for GCaMP corresponds to a response percentage of
1.4%. No significant differences were observed amongst conditions (unpaired Student’s
T-test). D. As in C except HEK293 cells expressing any MS4A protein are considered
as a single group.
![Page 85: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/85.jpg)
75
Figure 3.5 (Continued)
![Page 86: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/86.jpg)
76
and 3.5D). Six MS4A proteins (selected for their structural diversity) were exposed to 11
compound mixtures, each of whose constituents shared similar chemical structure.
These mixes were designed to cover a broad swath of odor space, and included known
ligands for conventional and necklace glomeruli (Gao et al., 2010; Saito et al., 2009).
Increases in intracellular calcium were observed during odor exposure for specific
MS4A protein/odor mixture pairs, demonstrating that MS4A proteins transduce signals
reflecting the presence of extracellular small molecule ligands (Figures 3.6A and 3.6B,
Table 3.1).
MS4A sensory responses were specifically tuned to particular odor categories,
with responses enriched for long chain fatty acids, steroids, and heterocyclic
compounds. To identify individual MS4A ligands, the odorant mixture that evoked the
largest response for each MS4A was broken down into its monomolecular constituents
(Figure 3.6C). Individual MS4As conferred responses to a specific subset of odor
molecules within a functional class. For example, cells expressing MS4A6C responded
to a known ligand for necklace glomeruli, 2,5-dimethylpyrazine (2,5-DMP) as well as to
a molecule not previously known to activate the necklace, 2,3-dimethylpyrazine (2,3-
DMP) – but only weakly to 2,6-dimethylpyrazine, (2,6-DMP) and not at all to other
structurally similar molecules in the parent mixture (Figure 3.6C). Several additional
ligand-receptor relationships were identified, including MS4A4B/alpha-linolenic acid
(ALA), MS4A6D/oleic acid (OA), MS4A6D/arachidonic acid (AA), MS4A4D/4-pregnan-
11B,21-diol-3,20-dione 21-sulphate, MS4A7/5-pregnan-3A-ol-20-one sulphate, and
MS4A8A/4-pregnan-11B,21-diol-3,20-dione,21-sulphate (Figures 3.6C, 3.7A, and 3.7B).
![Page 87: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/87.jpg)
77
Figure 3.6
MS4A proteins confer responses to odorants. A. GCaMP6 fluorescence in response to
indicated chemical mixtures in representative HEK293 cells expressing either the
indicated MS4A protein or GPCR mOR + G-protein (odor delivery indicated by gray bars
after accounting for line and mixing delays, see Experimental Procedures). B.
Responses of expressed MS4A protein/odor mixture pairs performed as in A (10 µM per
odor, see Table 3.1 for mixture definitions, 97 total compounds). Color code indicates
percentage of cells responding (n=3, total cells in experiment > 50,000) after
thresholding statistically significant responses (see Experimental Procedures).
Deconvolved mixture-MS4A pairs indicated with red circles. C. Deconvolution identifies
monomolecular odors that activate each MS4A receptor. Individual odors delivered at
50 µM in liquid phase (n=3, total cells in experiment >68,000) to cells co-expressing
GCaMP6s and the indicated MS4A receptor (bottom) or GCaMP6s alone (top). The
aggregate percent of cells that responded to each chemical across three independent
experiments is color-mapped as in B. SFA: saturated fatty acids, UFA: unsaturated fatty
acids. D. Dose response curves reveal low micromolar EC50s for MS4A4B/ALA,
MS4A6C/2,3-DMP, and MS4A6D/OA, which are similar to the EC50 observed for
MOR9-1/vanillin and the reported EC50s for mammalian ORs reported in the literature
(Saito et al., 2009; Mainland et al., 2015). Each data point represents the mean +/- SEM
from at least four independent coverslips.
![Page 88: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/88.jpg)
78
Figure 3.6 (Continued)
![Page 89: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/89.jpg)
79
Table 3.1. Odorants used for functional imaging experiments
Alcohols 1-butanol, 2,5-dimethylphenol, eugenol, guaicol, 1-hexanol,
isoeugenol, 1-nonanol, 1-octanol, 2-phenylethanol, thymol
Ketones acetylanilone, acetophenone, 2-butanone, cyclohexanone, 3-
decanone, dodecanolactone, 4-heptanone, 2-octanone, 2-
pentanone, vanillin
Sulfurs 2,4,5-trimethyl thiazole, TMT, thiophene, tetrahydrothiophene
Acids formic acid, hexanoic acid, heptanoic acid, ocantoic acid, tiglic
acid, valeric acid, isovaleric acid
Esters allyl cinnamate, amyl acetate, benzyl acetate, cycohexyl
aceatate, ethyl benzoate, ethyl propionate, ethyl valerate,
ethyl tiglate, piperidine, propyl butyrate
Aldehydes p-anise aldehyde, butyl formate, butyraldehyde,
benzaldehyde, cinnamaldehyde, ethyl formate, heptanal,
octanal, propionaldehyde, heptaldehdye
![Page 90: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/90.jpg)
80
Table 3.1 (Continued). Odorants used for functional imaging experiments
Nitrogenous 2,5-dimethylpyrazine, 2,6-dimethylpyrazine, 2,3-
dimethylpyrazine, indole, nicotine, pyrrolidine, pyridine,
quinolone
Steroids 4-Androsten-17alpha-ol-3-one sulphate, 5-Androsten-3Beta
17Beta-diol disulphate, 1,3,5(10)-Estratrien-3 17Beta-diol
disulphate, 1,3,5(10)-Estratrien-3 17alpha-diol 3-sulphate,
5alpha-pregnen-3alpha-ol-20-one sulphate, 5beta-pregnen-
3beta-ol-20-one sulphate, 4-pregnan-11beta 21-diol-3 20-
dione 21-sulphate, 4-pregnen-21-ol-3 20-ione
glucosiduronate, 1,3,5(10)-Estratrien-3 17Beta-diol 3-
sulphate, 4-pregnen-11beta 17,21-triol3 20-dione 21-sulphate
PUFAs arachidonic acid, docosohexanoic acid, linoleic acid, linolenic
acid, nervonic acid, oleic acid, petroselenic acid
Saturated fatty
acids
decanoic acid, docosanoic acid, dodecanoic acid, eicosanoic
acid, hexanoic acid, myristic acid, octadecanoic acid, octanoic
acid, palmitic acid
Terpenes R-carvone, 1,4-cineole, citral, cintronellal, R-fenchone, E-beta
farnesene, geraniol, alpha-ionone, linalool, +-menthone,
gamma-terpinene, 1,3-minus-verbenone
![Page 91: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/91.jpg)
81
Figure 3.7
A. Deconvolution of selected odorant mixtures reveals monomolecular compounds that
specifically activate a conventional odorant receptor (MOR9-1) or MS4A4D. Individual
odors were delivered at 50 µM in liquid phase to cells co-expressing GCaMP6s and the
indicated MS4A receptor or mOR (bottom) or GCaMP6s alone (top). The aggregate
percent of cells that responded to each chemical across three independent experiments
is color-mapped as indicated, where only statistically significant responses are plotted
(see Experimental Procedures). B. Traces of dF/F averaged across all cells that
responded to the best monomolecular odorant for each MS4A/mixture pair. C. The
timing of responses of four specific MS4A/odor pairs was assessed by comparing time
of response onset (red), time to half-maximal response (green), and time to peak
response (blue) to the same parameters for cells expressing the control odorant
receptor MOR9-1 and its optimal ligand (vanillin). No statistically-significant differences
were observed between any of the MS4A/odor pairs and MOR9-1/vanillin (Student’s T-
test, Bonferroni corrected for multiple comparisons). Data are presented as mean +/-
SEM. The black and blue dashed lines indicate the estimated time when odor
concentration reaches 75% and 90% of maximum, respectively (determined by dye
experiments, see methods). Between 29 and 65 responding cells across three
independent coverslips were analyzed per condition. D. As in C except calcium was
reported using GCaMP6f, images were acquired at 2 Hz, and odorants were delivered
with a stimulus pencil that was positioned directly above the cells. Between 129 and 700
responding cells from at least 4 independent coverslips were analyzed per condition. * p
< 0.01, Student’s T-test. E. Traces of dF/F from individual cells that responded to
![Page 92: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/92.jpg)
82
Figure 3.7 (Continued) stimulus pencil-delivered odorant for each MS4A/ligand pair for which dose response
curves were generated. F. The requirement of extracellular calcium for MS4A ligand
responses was assessed by stimulating HEK293 cells expressing GCaMP6s alone or
co-expressing MS4A6C and GCaMP6s with 2,3-DMP in the presence or absence of
extracellular calcium. Data are presented as mean +/- SEM from at least 4 coverslips
per condition. * p < 0.01, Z-test of proportions.
![Page 93: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/93.jpg)
83
Figure 3.7 (Continued)
![Page 94: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/94.jpg)
84
We also asked whether the MS4As and conventional ORs responded to odors
with similar kinetics in vitro. No statistically significant differences were observed in time
to response onset, time to half-maximal response, or time to peak response either
between four queried MS4As or between these MS4As and MOR9-1 (Figure 3.7C).
However, because the bulk calcium imaging assay used to screen MS4A ligands is not
optimized for assessing response timing, we verified these results using GCaMP6f (a
more rapidly-responding calcium indicator than GCaMP6s), a faster imaging rate, and a
stimulus pencil to focally deliver odorants directly above the imaged cells. These
experiments revealed that MS4A responses occur seconds after odor presentation, with
similar or slightly faster response dynamics to those observed with MOR9-1 (Figures
3.7D and 3.7E, see Experimental Procedures). Dose-response curves revealed low
micromolar EC50s for three specific MS4A/odor pairs, similar to the EC50 observed for
MOR9-1/vanillin (Figure 3.6D), and well within the range of EC50s typically observed for
conventional odorant receptor/ligand pairs in vitro (Saito et al., 2009; Mainland et al.,
2015). Depleting extracellular calcium abolished MS4A ligand-dependent calcium
transients (Figure 3.7F). Taken together, these results demonstrate that individual
MS4A proteins enable calcium influx in response to specific monomolecular odorants in
heterologous cells, with different MS4A proteins conferring responses to different
ligands. The simplest explanation for this result is that the MS4A proteins are odorant
receptors.
![Page 95: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/95.jpg)
85
Many Ms4a Genes And Proteins Are Expressed In Each Necklace Sensory Neuron
The functional organization of the mammalian olfactory system depends on each
mature OSN expressing just one (or two) of the hundreds of possible olfactory receptor
genes (Dalton et al., 2015). We therefore asked whether the MS4As are expressed in a
one-receptor-per-neuron pattern within GC-D cells, which would suggest that the
necklace system follows a similar functional logic to the main and accessory olfactory
systems. Target Ms4a mRNA molecules within dissociated GC-D cells were labeled
using a single molecule detection approach (RNAScope), in which messages are
detected as diffraction-limited fluorescent puncta whose abundance reflects transcript
levels (Wang et al., 2012). RNAScope probes generated multiple puncta in individual
GC-D cells for each of the 12 Ms4a genes found by RNA profiling, consistent with the
presence of these Ms4a messages in GC-D cells (Figure 3.8A). Conversely, RNAScope
failed to identify Ms4a1, Ms4a2, and Ms4a5 puncta in GC-D cells above the background
detection rate, consistent with the absence of these specific Ms4a genes in our earlier
RNA profiling experiments (Figures 3.8B and 3.9A).
Using a stringent criterion (in which a cell is counted positive only if it harbors
two or more puncta), transcripts for each of the 12 Ms4a genes expressed in GC-D cells
were found in 5-30% of GC-D cells (Figure 3.8B). Moreover, employing a less stringent
criterion for Ms4a positivity — in which cells with any Ms4a puncta are considered
positive — reveals that individual Ms4a family members may be expressed in >50% of
GC-D cells (Figure 3.9B). Under both of these analyses, the proportions of cells
expressing each Ms4a message sum to significantly greater than 100%, raising the
surprising possibility that each GC-D cell expresses more than one Ms4a gene. To
![Page 96: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/96.jpg)
86
Figure 3.8 Multiple Ms4a genes are expressed in each necklace sensory neuron. A. RNAScope
single molecule fluorescent in situ hybridization of dissociated olfactory epithelial cells
detects Ms4a family members (red). Necklace cells identified via co-labeling with an
antibody against Car2 (blue), GFP from the Gucy2d-IRES-TauGFP allele (green, top
left) or an RNAScope probe against a necklace marker gene (green, all panels except
the top left). Necklace cells are not marked by a probe against the conventional OR
gene Olfr151 (top right). Nuclei marked by DAPI (grayscale); cytoplasmic anti-CAR2
signal was saturated to demarcate the entire volume of each GC-D cell. Scale bar 5 µM.
B. Proportion of Car2+ necklace OSNs with two or more detected puncta for each Ms4a
(blue bars) and Olfr probe (red bars, including Ms4a puncta in OR174-9-IRES-GFP
expressing cells; n=3 experiments, between 150-750 cells/probe, error bars are
standard error of the proportion). Dashed red line represents the average value of
negative controls. All Ms4a probes (other than negative controls Ms4a1, Ms4a2, Ms4a5)
give a significantly higher proportion of positive cells than negative controls (p < .01,
one-tailed Z test on population proportions). C. Representative images of Car2+ (blue)
cells labeled with probes against the indicated Ms4a family members (top panels). The
proportion and total number of cells with multiple puncta for neither, one, or both colors
was quantified (bottom panels, total cell number in parentheses). Each pair shows
significantly more double-positive cells (yellow) than expected (p < .05, Fisher’s Exact
Test on 2x2 table). Scale bar 2 µM.
![Page 97: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/97.jpg)
87
Figure 3.8 (Continued)
![Page 98: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/98.jpg)
88
Figure 3.9
A. Representative images from RNAscope assays of dissociated olfactory epithelial
cells. Necklace cells were identified with an antibody against Car2 (blue), and puncta
from probes against an Ms4a or Olfr family member are in red. DAPI stain is
represented as grayscale. Note that the Car2 signal was intentionally saturated to
identify the volumes of individual GC-D cells, enabling unambiguous assignment of red
puncta to individual GC-D cells. DAPI stain is represented as grayscale. Ms4a6c puncta
are not found in GFP+ cells from dissociated OR174-IRES-GFP epithelia (bottom
right). B. Proportion of necklace OSNs (identified as Car2+) with one or more
fluorescent puncta for each Ms4a and Olfr probe (n=3 experiments, between 150-750
cells/probe, error bars are standard error of the proportion). Dashed red line represents
the average value of negative controls (Ms4a1, Ms4a2, Ms4a5, and the Olfr genes). C.
Representative images of Car2+ (blue) cells co-labeled with additional Ms4a probe
pairs.
![Page 99: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/99.jpg)
89
Figure 3.9 (Continued)
![Page 100: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/100.jpg)
90
directly test whether Ms4a genes are co-expressed, we simultaneously labeled cells in
two different colors with RNAScope probes recognizing distinct Ms4a genes. Every
tested pair revealed a significant rate of cells that were positive for more than one Ms4a
gene, demonstrating that unlike conventional ORs, multiple Ms4a genes are co-
expressed in individual necklace sensory neurons (Figures 3.8C, 3.9C and data not
shown). These data are consistent with a model in which each GC-D cell expresses
multiple Ms4a genes.
Because different probes could have distinct false negative rates (and because
Ms4a transcript levels are low), RNAScope could not be used to definitively determine
the number of unique Ms4a genes expressed per necklace OSN (Kim et al., 2015). We
therefore asked whether the Ms4a expression pattern was more apparent at the protein
level. Peptide antibodies were raised against several MS4As and used to stain the
olfactory epithelium. Consistent with every necklace cell expressing all members of the
MS4A family (of the subset expressed in GC-D cells), each of five different anti-MS4A
antibodies labeled > 95% of GC-D neurons (Figures 3.10A and 3.10B). As expected,
these antibodies did not label conventional OMP+ OSNs (Figure 3.10A), and control
antibodies against MS4As not detected in necklace neurons by RNA profiling —
MS4A1, MS4A2, and MS4A5 — did not label GC-D cells (Figure 3.10B and data not
shown). Purified anti-MS4A antibodies were specific in vivo as assessed by peptide
competition, and in vitro as assessed by staining HEK 293T cells overexpressing
individual MS4A proteins, although minor cross-reactivity was observed between pairs
of highly homologous MS4A proteins (e.g., MS4A6B/MS4A6C and MS4A4B/MS4A4C)
(Figures 3.11A and 3.11B).
![Page 101: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/101.jpg)
91
Figure 3.10
Multiple MS4A proteins are expressed within necklace sensory endings and glomeruli.
A. Anti-MS4A4B antibody stains every anti-PDE2A+ cell but no OMP-IRES-GFP+ cells
in sections of the olfactory epithelium. Scale bar 10 µM. B. Representative images of
immunostaining with antibodies against five different MS4A family members, each of
which stains >95% of anti-PDE2A+ necklace cells in epithelial cul-de-sacs; control
antibody against MS4A5, which is not detected at the mRNA level in GC-D cells, does
not label necklace cells (bottom right). Scale bars 10 µM. C. Anti-MS4A antibodies
label dendritic knobs. Many MS4A antibodies also appear to stain perinuclear and
nuclear regions; although the origin of this staining, which is eliminated by peptide
competition (Figure 3.11B), is unknown, it may represent MS4A protein trapped within
the endoplasmic reticulum or MS4A protein fragments (Cruse et al., 2013). Scale bars 5
µM. D. Anti-MS4A6D staining overlaps with all GCD-IRES-TauGFP+ necklace glomeruli
in sections of the olfactory bulb (left). Blue arrows mark non-necklace glomeruli, which
are not stained by anti-MS4A6D antibody. Similarly, anti-MS4A4B and anti-MS4A7
antibodies label each necklace glomerulus (right panels). Scale bars 20 µM.
![Page 102: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/102.jpg)
92
Figure 3.10 (Continued)
![Page 103: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/103.jpg)
93
Figure 3.11
A. Representative images of HEK293T cells transfected with a plasmid encoding a
single mCherry-MS4A fusion protein and stained with the indicated anti-MS4A antibody;
antibodies are specific, although under conditions of overexpression anti-MS4A4B
cross-reacts modestly with the closely related MS4A4C, as does anti-MS4A6C with
MS4A6B. anti-Ms4A immunofluorescence (red) overlaps almost completely with
appropriate mCherry fluorescence (blue) and is not seen in cells that do not express the
plasmid at appreciable levels, visible by nuclear counterstain (grayscale.) B.
Representative images of cul-de-sac tissue sections immunostained in the presence of
peptide competitor (~1000-fold molar excess, see Experimental Procedures). Only the
antigenic peptide, and not a peptide from a different MS4A protein, blocks staining of
necklace cells by a given antibody.
![Page 104: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/104.jpg)
94
Figure 3.11 (Continued)
![Page 105: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/105.jpg)
95
If MS4As function as necklace chemoreceptors they must be present at sensory
endings where transduction of odorant binding occurs (Barnea et al., 2004). Consistent
with this possibility, high resolution imaging demonstrated that each MS4A antibody
strongly labeled the dendritic knobs of GC-D cells, with some staining apparent in the
cilia as well (Figure 3.10C). Sensory neurons in the main olfactory epithelium also traffic
receptors to their axonal endings, which terminate in glomeruli in the olfactory bulb. To
test whether MS4A proteins are similarly localized to axonal endings, olfactory bulb
tissue sections were probed with anti-MS4A antibodies, which revealed that each MS4A
antibody labeled every necklace glomerulus — but failed to label any conventional
glomeruli — within the olfactory bulb (Figure 3.10D). Taken together, these data
demonstrate that MS4A proteins are appropriately positioned within sensory endings to
detect chemical cues in the environment, and that every glomerulus in the necklace
system receives input from sensory afferents potentially representing information pooled
from all the MS4As expressed in the necklace system; this pattern of organization
differs sharply from that apparent in the rest of the olfactory system, where individual
receptors (or pairs of receptors) define specific glomerular information channels.
Necklace Olfactory Neurons Respond to MS4A Ligands In Vivo
The expression of multiple MS4A family members in GC-D cells predicts that the
chemoreceptive fields of individual necklace olfactory neurons in vivo should include the
ligands identified for different MS4A proteins in vitro. To address this possibility, the
intact olfactory epithelium was explanted and functional responses were assessed by
multiphoton microscopy as odorants were delivered in liquid phase. Necklace neurons
![Page 106: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/106.jpg)
96
were labeled with the fluorescent calcium reporter molecule GCaMP3 using the Emx1-
Cre driver line; the Emx1 gene was enriched in RNASeq and Nanostring analyses of
GC-D neurons, and distinguishes necklace cells from conventional OSNs, which
express the related protein EMX2 (Figure 3.12A and data not shown) (Hirota and
Mombaerts 2004). Because Emx1 labels a number of non-GC-D cells in the nasal
epithelium (whose identity is unclear), we specifically imaged cul-de-sac regions, where
nearly all GCaMP3-positive cells belong to the necklace (Figure 3.12B), and
heuristically identified necklace neurons as those that responded to carbon disulfide, a
known necklace ligand whose detection requires the GC-D protein (Munger et al.,
2010).
Necklace neurons were activated by a mixture of the unsaturated fatty acids oleic
acid and alpha-linolenic acid (UFAs), and by a mixture of 2,3- and 2,5-dimethylpyrazine
(DMPs) — two chemical classes that stimulated MS4A proteins in vitro — but rarely by
mixtures of ketones, esters, or alcohols, which were not identified as MS4A ligands
(Figures 3.13A, 3.13B, and 3.6B). Importantly, UFAs and DMPs do not activate adjacent
conventional OSNs, (i.e., those that responded to the control odor mixtures but not to
CS2 (data not shown)); necklace cells are therefore specifically tuned to MS4A-
activating compounds. These data also demonstrate that single necklace cells respond
to multiple compounds that individually activate different MS4A proteins in vitro as oleic
acid and alpha-linolenic acid are ligands for MS4A6D and MS4A4B, respectively, and
the dimethylpyrazines are ligands for MS4A6C (Figures 3.13A, 3.13B, and 3.6C).
Because MS4A proteins exhibit partially overlapping tuning properties to mixtures in
vitro, we confirmed that individual necklace cells responded to multiple monomolecular
![Page 107: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/107.jpg)
97
Figure 3.12
A. Quantification of mRNA expression in GC-D cells relative to OMP cells using the
single-molecule detection method Nanostring. Marker genes for OMP cells such as
Adcy3 (green bars) and GC-D cells like Car2 (red) are enriched in the appropriate
populations. This analysis revealed that whereas OMP cells express the transcription
factor Emx2, GC-D sensory cells exclusively express Emx1 * p < 0.05, paired t-test. B.
Immunohistochemical analysis of sections prepared from the nasal epithelium of mice
co-expressing an Emx1-cre allele and a Cre-dependent GCaMP3 reporter using
antibodies against GCaMP (green) and the necklace marker CAR2 (red) reveals that a
large fraction of GCaMP-expressing cells are necklace cells; note that CAR2 staining
tends to be enriched in nuclei whereas GCaMP is enriched in cytoplasm.
![Page 108: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/108.jpg)
98
Figure 3.12 (Continued)
![Page 109: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/109.jpg)
99
Figure 3.13 Multiple in vitro MS4A ligands activate single necklace cells in vivo. A. Functional
responses of individual necklace cells (labeled with Emx1-cre/GCaMP3) to the indicated
odorants were heat-mapped (top row) and dF/F traces for six cells (drawn from the
heatmapped image) were plotted (bottom rows). Colored bars represent the 10-second
odor delivery period (after accounting for line and mixing delays, see Experimental
Procedures). All mixtures were at 100 µM total odorant concentration (DMP: 2,3-DMP
and 2,5-DMP, UFA: oleic acid and alpha-linolenic acid, ketones, esters, and alcohols as
in Table 3.1); based on testing with fluorescent dye, stimuli are diluted approximately
1:10 in the cul-de-sac lumen (see Experimental Procedures). Scale bar 10 µM. B. The
odor tuning properties of 74 CS2-responsive cells (columns) across eight experiments
were quantified, with color coding as in the top panel. DMPs and UFAs each activated
significantly more cells (response > 25% dF/F) than each negative control (P < 0.0001,
Fisher’s Exact Test, corrected for multiple comparisons). Significantly more cells
responded to both UFAs and DMPs than expected by chance (P < 0.01, Fisher’s Exact
Test).
![Page 110: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/110.jpg)
100
Figure 3.13 (Continued)
![Page 111: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/111.jpg)
101
MS4A ligands (data not shown). These results strongly suggest that co-expression of
Ms4a genes confers upon each GC-D cell a tuning profile that is broader than that
associated with any single MS4A protein.
Given that MS4A ligands posess a range of volatilities, we wished to directly
demonstrate that these odorants can activate necklace sensory neurons in intact mice.
Freely behaving mice were exposed to MS4A ligands in gas phase, and then activation
of GC-D cells was measured using an antibody against phosphorylated ribosomal S6
protein, an established marker of prior OSN activity (Jiang et al., 2015). These
experiments revealed that the MS4A6C ligands 2,5-DMP and 2,3-DMP, the MS4A4B
ligand alpha-linolenic acid, and the MS4A6D ligands oleic acid and arachidonic acid
reliably activated GC-D cells in vivo to a similar extent as the positive control carbon
disulfide (Figure 3.14A). Conversely, general odorants (including acetophenone and
eugenol) and compounds that only weakly activated MS4A-expressing HEK293 cells
(such as 2,6-DMP) did not activate necklace cells above the background rate of plain air
(Figure 3.14A). While prior work had implicated 2,5-DMP as a necklace ligand, 2,3-
DMP, arachidonic acid and the fatty acids had not been previously shown to activate
this olfactory subsystem. These experiments demonstrate that, in the context of active
exploration, necklace sensory neurons respond to ligands for MS4A receptors.
It is not clear how soluble ligands such as urinary peptides gain access to
necklace sensory neurons within the olfactory epithelium; nevertheless, one highly
soluble class of MS4A ligand — the sulfated steroids — also activated the necklace,
albeit more weakly than observed for other odorants (control DMSO = 8.7 ± .6 vs.
sulfated steroids 1,3,5(10)-estratrien-3,17-beta-diol disulphate/1,3,5(10)-estratrien-
![Page 112: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/112.jpg)
102
Figure 3.14
MS4A ligands activate necklace sensory neurons, and MS4A proteins confer MS4A
ligand responses to conventional olfactory sensory neurons in awake, behaving mice.
A. Example images of cul-de-sacs from mice exposed to the indicated odorant,
immunostained for the necklace cell marker PDE2A (blue) and the neuronal activity
marker phospho-S6 (pSerine240/244) (red) (left panels). Quantification of the
proportion of pS6+ necklace cells in odor-exposed mice (right panel, mean +/- SEM, n
>= 3 independent experiments, * indicates p < 0.05, ** indicates p < 0.01, and ***
indicates p < 0.0001, unpaired t-test compared to null exposure). Scale bar 10 µM. B.
Olfactory epithelial sections of mice infected with adenovirus carrying an Ms4a6c-IRES-
Gfp expression cassette reveal a subset of virally infected cells (green) that also
express MS4A6C protein (red). Scale bars 5 µM. C. Representative images (left
panels) and quantification (right panel) of phospho-S6 positive, OSNs infected with
Ms4a6c-IRES-Gfp or Ms4a6d-IRES-Gfp-expressing adenovirus and exposed to the
indicated odorant (DMP = dimethylpyrizine, OA = oleic acid). Gray bars: GFP-positive/
MS4A6C-negative, red bars: GFP-positive/ MS4A6C or MS4A6D-positive cells (n >= 3
animals per odor, ** indicates p < .001, *** p < .0001, Fisher’s Exact Test comparing
MS4A-positive to MS4A-negative cells for each odorant). Scale bars 5 µM.
![Page 113: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/113.jpg)
103
Figure 3.14 (Continued)
![Page 114: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/114.jpg)
104
3,17alpha-diol 3-sulphate 12.9 ± 1.5 percent cells positive, n=4, p<.05 unpaired T test).
It is notable that both in explants and in vivo the MS4A ligands and the control ligand
carbon disulfide activated a fraction of the necklace sensory neurons. While these
partial responses (also previously observed for urinary peptides) (Leinders-Zufall et al.,
2007) may reflect specific technical features of these experiments, the consistency of
this observation across ligands and preparations raises the possibility that cellular
responses in the intact necklace system may be context- or state-dependent.
Altogether these results support a model in which MS4A receptors bind inhaled
odorants and induce calcium influx into necklace OSNs. This model predicts that
ectopically expressed MS4A protein will confer its in vitro chemosensitivity onto the
receptive fields of conventional olfactory neurons. To test this hypothesis directly,
mouse nares were irrigated with adenovirus encoding bicistronic Ms4a6c-IRES-GFP
transcript, yielding sparse populations of GFP+ OSNs. This approach generated
neurons that expressed MS4A6C protein as well as a subset of cells that were infected
but did not express MS4A6C, which served as an internal control (Figure 3.14B); the
failure of MS4A6C protein expression in some GFP positive cells may reflect stochastic
(and potentially cell type-specific) effects related to ectopic chemosensor expression
within mature OSNs (Tsai and Barnea, 2014). Ectopic MS4A6C protein was localized to
dendritic endings in infected neurons, suggesting that MS4A proteins associate
intrinsically with sensory structures even outside the molecular milieu of the necklace
(Figure 3.14B and data not shown). Quantitative analysis of neural activity (assessed by
phosphorylated S6 protein levels, Figure 3.14C, blue channel) after exposing awake,
behaving animals to odors in gas phase revealed that ectopic MS4A6C confers
![Page 115: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/115.jpg)
105
responses to its in vitro ligands 2,3-DMP and 2,5-DMP, but not to the control odorants
eugenol and acetophenone (Figure 3.14C). Similarly, adenovirally-mediated ectopic
expression resulted in effective targeting of MS4A6D to sensory endings in conventional
olfactory sensory neurons, and conferred specific responses to the MS4A6D ligand
oleic acid, but not to the control odorant eugenol (Figure 3.14C). These results
demonstrate that an MS4A protein can directly impart its chemoreceptive properties to
generic olfactory neurons in vivo, and furthermore that signaling downstream of MS4A
proteins does not require necklace-specific molecular components such as GC-D,
PDE2A or CNGA3. The concordance of necklace cell responses with the
chemoreceptive fields of MS4A proteins expressed ectopically — both in vitro and in
vivo — implies that the necklace subsystem uses the Ms4a family to sense odors.
![Page 116: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/116.jpg)
106
Discussion
Insects and mammals use similar molecular mechanisms to detect light, heat and
several gases, suggesting that solutions to common sensory problems are often
conserved (Caterina, 2007; DeLuca et al., 2012; Dhaka et al., 2006; Terakita, 2005).
However, peripheral mechanisms for odor detection differ amongst phyla — insects like
Drosophila melanogaster deploy several structurally-distinct ionotropic odorant receptor
classes to interrogate the chemical world, whereas mammals were thought to detect
smells exclusively through metabotropic GPCRs (Silbering and Benton, 2010). Our
identification of a non-GPCR family of odorant receptor reveals an unexpected similarity
between the mammalian olfactory system and that of insects: both use multiple
unrelated receptor types to transduce chemosensory cues into intracellular signals.
Multiple lines of evidence indicate that Ms4a genes encode a novel family of
chemoreceptors. Mammalian MS4A proteins are localized to the dendritic endings of
olfactory sensory neurons, the site of odorant chemotransduction, and contain
hypervariable regions that can potentially interact with diverse extracellular cues.
Expression of MS4As in both HEK293 cells in vitro and conventional OSNs in vivo
confers specific responses to odorants, indicating that MS4A proteins are sufficient to
transduce the binding of extracellular ligands into intracellular signals. Furthermore,
individual necklace sensory neurons, which co-express multiple MS4A proteins, each
respond in vivo to multiple MS4A ligands identified in vitro. These data demonstrate that
the MS4As define a new mechanism and logic for mammalian chemosensation, and are
likely responsible for endowing the necklace olfactory subsystem with specific sensory
odor tuning properties.
![Page 117: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/117.jpg)
107
An Alternative Logic Organizes the Necklace Olfactory System
We find that MS4A ligands are enriched for molecules with innate significance for
the mouse, including the aversive pheromone 2,5-DMP and several appetitive long
chain fatty acids; interestingly, seeds and nuts, which are a major food source for mice
in the wild, have high concentrations of those specific fatty acids detected by the MS4As
(Sabir et al., 2012). Like the MS4A ligands, many of the molecules previously shown to
trigger activity within the necklace olfactory system also have innate meaning for mice;
these include carbon dioxide, which mice robustly avoid, and carbon disulfide and the
peptides guanylin and uroguanlyin, each of which promotes the social transmission of
food preferences (STFP) between mice (Arakawa et al., 2013; Hu et al., 2007; Munger
et al., 2010).
The tuning properties of the necklace are determined, in part, by the co-
expression of genes encoding multiple MS4A receptors within individual necklace
sensory neurons. This pattern of odor receptor gene expression stands in stark contrast
to the canonical one-receptor-per-neuron rule that (to a first approximation) organizes
the remainder of the mammalian and the entirety of the Drosophila olfactory systems. In
those systems, each OR is associated with one or a small number of glomeruli in the
brain; in the necklace system, each sensory neuron and glomerulus is, in principle,
capable of conveying odor information detected by all of the MS4A receptors expressed
in the nose.
The ability of individual necklace neurons to detect multiple innately relevant
signals (including gases, peptides, and volatile odors) of widely differing valences
suggests two broad models for the perceptual function of the necklace subsystem. First,
![Page 118: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/118.jpg)
108
the necklace could discriminate between odors, albeit through distinct mechanisms from
the conventional olfactory system. Odor-evoked differences in activity in individual
necklace glomeruli could be generated by subtle differences in MS4A expression within
subsets of sensory neurons (but see Figure 3.10); such differences could also be
caused by conventional OSN axons, which may co-mingle with necklace sensory axons
in necklace glomeruli (Cockerham et al., 2009; Secundo et al., 2014). Stimulus
discrimination could alternatively be achieved through linear or non-linear interactions
between intracellular signals downstream of individual MS4A receptors, which could
allow the integration or gating of signals arising from distinct odorants and gases
detected by single necklace neurons (van Giesen et al., 2016); this process could
generate a range of firing rates (depending, for example, on the specific odor
components present in a blend) that could then be differentially read-out by the brain.
Second, the main function of the necklace system could be odor detection rather
than discrimination. In this model, the necklace system may be organized in a similar
manner to the mammalian bitter taste and C. elegans olfactory systems, which co-
express receptors with widely-divergent receptive fields in sensory neurons coupled to
circuits mediating stereotypical behavioral outputs, such as attraction or aversion (Adler
et al., 2000; McCarroll et al., 2005; Troemel et al., 1995). In the case of the necklace
system, this singular behavioral output could be aversion, as many of the MS4A ligands
have been shown to be contextually aversive, including (despite their nutritional value)
fatty acids at high concentrations (Galindo et al., 2012). Alternatively, the necklace
could act as an alert system, signaling the presence of salient cues in the environment
(whose identity would be disentangled by other sensory systems); such a notification
![Page 119: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/119.jpg)
109
system could be useful for modulating the internal state of the animal in response to
particularly relevant external cues, thereby facilitating both innate responses to odors
and odor-related learning processes (potentially including STFP).
In either the discrimination or detection model, the physiological function of the
necklace could depend upon interactions between intracellular signals downstream of
the MS4A receptors and GC-D. Although the MS4As do not obligately require GC-D to
promote calcium influx, GC-D enzymatic activity is sensitive to calcium levels in vitro
(Duda and Sharma, 2008). This observation raises the possibility that the MS4A and
GC-D pathways intersect in some manner, perhaps facilitating coincidence detection
between gases and peptides on the one hand, and volatile odors on the other.
Dissecting MS4A Function
The availability of ligands for the MS4As now renders accessible key questions
about the biophysics and biochemistry of MS4A function. Previous biochemical studies
relied upon clustering antibodies to trigger MS4A1-mediated calcium flux (Janas et al.,
2005); this and related work found that the MS4As facilitate increases in intracellular
calcium by acting as co-receptors for associated ligand-binding proteins such as the B-
cell receptors (Dombrowicz et al., 1998; Eon Kuek et al., 2015). Interpreting these
experiments has been difficult in light of possible gains-of-function imposed by the use
of clustering reagents; here we show that small molecule ligands can cause an MS4A-
dependent influx of extracellular calcium, demonstrating that the MS4A molecules
themselves have a receptor function. It is not clear, however, whether the MS4A
proteins themselves form a calcium-permeable channel (similar to the Drosophila IR
![Page 120: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/120.jpg)
110
odorant receptors), or whether the MS4As act as ligand-binding co-receptors for an ion
channel that is expressed in many cell types (Abuin et al., 2011; Benton et al., 2009).
The underlying molecular mechanisms through which the MS4A proteins interact
with ligands are not known. The observation that the molecular diversity within the
MS4A family is largely found within extracellular domains — rather than transmembrane
domains — suggests that the MS4As interact with odor ligands through biophysical
mechanisms that are distinct from those used by conventional ORs. These mechanisms
may be similar to those used by mammalian bitter taste receptors, whose diversity is
also found largely in extracellular domains (Hayakawa et al., 2014; Woodling, 2011). It
is also unclear whether the MS4As, despite being co-expressed in single cells, primarily
interact with odorants as homomers (like the bitter taste receptors) or whether they
heteromerize in a manner that alters their tuning properties (Howie et al., 2009).
The Four-Pass Transmembrane MS4As: Chemical Detectors Across Cell Types and
Species?
Although a number of cellular roles have been suggested for individual MS4A
proteins (largely in the context of the immune system), no clear picture has emerged of
the core function of the MS4A family across cell types. The finding that multiple MS4As
encode olfactory receptors suggests that they act as chemosensors in a range of
tissues; this role may be both exteroceptive, serving to detect small molecules from the
outside world, and interoceptive, as several of the ligands for MS4A proteins (e.g., oleic
acid and arachidonic acid) are used as signaling molecules physiologically. Consistent
with this hypothesis, members of the MS4A6/7 subfamily are expressed in microglia,
![Page 121: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/121.jpg)
111
neuroimmune cells responsible for sensing and responding to a variety of endogenous
protein and lipid chemosignals in the mammalian brain; human MS4A8B and MS4A12
are expressed in epithelial cells at the lumenal surface of the small and large intestine,
tissues that both sense dietary lipids; human MS4A8B is localized specifically in
chemosensory cilia in lung cells tasked with probing the sensory environment; and
MS4A5 is expressed in mammalian spermatocytes, which chemotax to oocytes (Eon
Kuek et al., 2015; Koslowski et al., 2008; Wang et al., 2015).
MS4A homologs are present in all mammalian lineages and in many sequenced
deuterostomes including echinoderms (Figure 3.3C and data not shown), implying that
the evolution of the Ms4a genes antedates the advent of the mammalian receptors for
taste and for pheromones (Grus and Zhang, 2009). Taken with the finding that the
MS4As detect a variety of innately-relevant cues, these observations invite the
speculation that the MS4A molecules represent an ancient mechanism for sensing
ethologically-salient small molecules in the environment. Testing this hypothesis will
require establishing chemosensory roles for Ms4a genes in other species and better
definition of those natural ligands that optimally activate the MS4As (given the limits of
the synthetic odor panel explored here). It is important to note that all MS4A ligands
thus far identified are also detected by other receptor molecules in the smell and taste
systems (Isogai et al., 2011; Mamasuew et al., 2011; Oberland et al., 2015).
Nevertheless, the maintenance of the MS4A receptor repertoire for more than 500
million years, especially given the evolutionary success of G-protein coupled odor
receptors, argues that MS4As play an important — and non-redundant — role in
sensory physiology (Zuccolo et al., 2010).
![Page 122: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/122.jpg)
112
Although the Ms4a genes are conserved across vertebrates, Gucy2d is itself
pseudogenized in most primates (Young et al., 2007). It is unclear if the absence of GC-
D reflects a disappearance of the necklace system in primates or merely that GC-D
became unnecessary for the tasks required of the primate necklace, given the
persistence of the Ms4a genes (Young et al., 2007). Similarly, the vomeronasal organ,
the sensory epithelium thought to mediate the majority of pheromone responses in
rodents, became vestigial approximately 25 million years ago (Zhang and Webb, 2003).
Future investigation of the functional role of Ms4a gene families across chordates —
and the relevance of interactions between MS4A proteins and ethologically-relevant
cues like pheromones and fatty acids — will reveal both common and species-specific
roles of the MS4As in processing information from the chemical environment.
![Page 123: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/123.jpg)
113
Experimental Procedures Summary Graphical representations of the data are presented as the mean +/- standard
error of the mean unless otherwise noted. All mice were obtained from the Jackson
Laboratory with the exception of OR174-9-IRES-tauGFP, which was obtained from the
Axel lab. For deep sequencing, olfactory epithelia were dissociated using papain and
individual cells were FAC sorted; RNA was then isolated using Trizol (Invitrogen) before
SmartSeq2-based amplification and Illumina-based sequencing. Nanostring-based RNA
quantitation was performed using a modified protocol to optimize for recovery of low-
abundance transcripts. MS4A sequences were extracted from the Ensembl and NCBI
databases. MS4A proteins were expressed in HEK293 cells using a Tet-regulatable
system to control protein expression (Invitrogen); odor delivery was either achieved via
bulk exchange or through a focal stimulus pencil placed over specific fields of view, and
odor delays were determined using Rhodamine B dye as a surrogate. Odor responses
were imaged in both configurations using an Andor Neo sCMOS camera mounted on an
Olympus IX83. Single molecule in situ RNA detection was perfomed using RNAScope
(Advanced Cell Diagnostics); this protocol was adapted to simultaneously immunostain
with either anti-CAR2 or anti-GFP antibodies. Custom antibodies against the MS4A
proteins were developed in rabbits (Covance) and purified using protein A-sepharose
and bead-conjugated peptides. Multiphoton-based functional imaging (Prairie
Technologies) of explanted olfactory epithelia was performed in superfused
carboygenated modified Ringer’s solution, with odor delivery in liquid phase controlled
by a solenoid valve system (Warner Instruments); image alignment was achieved using
![Page 124: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/124.jpg)
114
custom feature-tracking and homography algorithms. Human adenoviruses were
generated by the UNC Viral Core facility. See supplementary information for details
regarding experimental methods, reagent sources, and statistical procedures.
Mice:
GCD-IRES-tauGFP and OMP-IRES-GFP mice were obtained from the Jackson
Laboratory (strain B6;129P2-Gucy2dtm2Mom/MomJ, stock number 006704 and strain
B6;129P2-Omptm3Mom/MomJ, stock number 006667, respectively). OR174-9-IRES-
tauGFP mice were obtained from the Axel Laboratory (Sosulski et al., 2011). Emx1-
IRES-Cre and GCaMP3 mice were obtained from the Jackson Laboratory (strain
B6.129S2-Emx1tm1(cre)Krj/J, stock number 005628 and strain B6;129S-
Gt(ROSA)26Sortm38(CAG-GCaMP3)Hze/J and stock number 014538, respectively). Unless
otherwise noted, all experiments on wild type mice were performed on 6-8 week old
C57/BL6 male mice (Jackson Laboratory). All mouse husbandry and experiments were
performed following institutional and federal guidelines and approved by Harvard
Medical School’s Institutional Animal Care and Use Committee.
Epithelial single cell dissociation:
Mice were euthanized with a lethal dose of Xylazine (~50 mg/mouse, Lloyd).
Using 1X phosphate-buffered saline (PBS, VWR) to keep the epithelium moist during
dissection, the head of the mouse was severed and the olfactory epithelium was rapidly
dissected and placed in PBS. The epithelium was then transferred to a round-bottomed
glass dish containing 1 mL of papain solution (one vial of Papain, (Worthington)
![Page 125: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/125.jpg)
115
dissolved in 5 mL of Earle’s Balanced Salt Solution (Worthington) and then equilibrated
10 minutes at 37 °C, 5% CO2) and 100 µL of DNAse solution (one vial of DNAse
(Worthington) dissolved in 1 mL of Earle’s Balanced Salt Solution (Worthington)). Bone
was removed from the epithelium under a dissecting microscope (Leica MZ75) and the
resultant tissue was placed in a 5 mL Falcon tube (Becton Dickinson) with an additional
1 mL of Papain solution and 100 µL of DNA solution and rocked gently for 30 minutes at
37 °C. The tissue was then gently triturated with a 5 mL stripette 10-15 times and the
non-dissociated pieces of tissue were allowed to sediment by gravity for approximately
3 minutes. The supernatant was transferred to a fresh 5 mL Falcon tube and
centrifuged 5 minutes at 300 x g. The supernatant was decanted, the cells were
washed twice with 5 mL DMEM, high glucose, minus glutamine (Life Technologies)/10%
heat inactivated Fetal Bovine Serum (FBS, Life Technologies) and resuspended in 1 mL
DMEM/10% FBS to use for experimentation.
FACS:
Olfactory epithelial cells were dissociated as described above. To label
hematopoetic cells, cell suspensions were incubated with PE-Cy5-conjugated rat anti-
mouse CD45 antibody (1:2000, BD Pharmingen) for one hour at room temperature and
then were washed twice with 1 mL DMEM/10% FBS. The cells were then incubated
with Hoescht to allow the differential labeling of dead cells, before being placed on ice
until they were sorted. Cells were sorted using either an Astrios EQ (Beckman Coulter,
Fort Collins, CO) or a FACSAriaII (Becton Dickinson, San Jose, CA). Following the
exclusion of dead cells and CD45 positive immune cells, GFP positive cells were then
![Page 126: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/126.jpg)
116
sorted to >99% purity by setting gates based on the fluorescent profile of cells derived
from wild type, non-fluorescent mice. Cells were sorted directly into Trizol (Invitrogen)
prior to RNA extraction (see below).
RNA isolation:
Fluorescent cells were sorted directly into 750 ul Trizol (Invitrogen) and samples
were then vortexed to homogeneity before being placed on ice for the duration of the
FACS session. All subsequent RNA work was performed in a RNA-dedicated PCR
workstation (Air Clean Systems) that was UV-irradiated for 20 minutes prior to use and
then was subsequently decontaminated with RNAseZap wipes (Ambion). Samples were
passed through a 1 mL insulin syringe (Westnet) four times and the samples were
allowed to sit for 5 minutes at room temperature. 200 µL of chloroform (Sigma) was
then added to each sample, and the tubes were shaken vigorously by hand for 15
seconds and then placed at room temperature for 3 minutes. Samples were centrifuged
at 12,000 x g for 15 minutes at 4 °C. The aqueous phase was removed to a nuclease
free microcentrifuge tube (Ambion) and 10 ug of RNAse-free glycogen (Life
Technologies) was added as a carrier along with 500 ul of 100% 2-propanol (Sigma).
The samples were inverted several times to homogenize and incubated for 10 minutes
at room temperature. The samples were then centrifuged at 12,000 x g for 10 minutes
at 4 °C and the supernatant was removed with a pipette. The RNA pellet was washed
with 1 mL of 75% ethanol and then centrifuged for five minutes at 4 °C at 7,500 x g. The
supernatant was pipetted off, the pellet was allowed to air dry for five minutes and was
![Page 127: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/127.jpg)
117
resuspended in 5-10 µL of nuclease free water (Ambion) and stored at -80 °C until
further use.
cDNA library generation:
cDNA libraries were generated from isolated RNA using a modified version of the
Smart-Seq2 protocol that was optimized for reliability and sensitivity using “spike” RNAs
(Ambion) (Picelli et al., 2014). Briefly, 0.6 µL of RNA was added to 8 µL lysis buffer (1.6
mM dNTPs, 2.5 µM oligo(dT)-VN primer (5’-
AAGCAGTGGTATCAACGCAGAGTACT30VN-3’, where ‘N’ is any base and ‘V’ is A, C,
or G), 0.2 ul RNAse inhibitor (Ambion), 0.1% TX-100 v/v) in a nuclease free PCR tube
and the samples were incubated in a Master Cycler ProS thermocycler (Eppendorf) for
3 minutes at 72 °C before being held at 4 °C for > 1 minute. Next, 11.4 µL of reverse
transcriptase mix (10 µL Superscript II (Invitrogen), 5 µL RNAse inhibitor (Ambion), 40
µL 5X first strand buffer (Invitrogen), 10 µL 0.1M DTT (Invitrogen), 8 µL 5 M Betaine,
37.8 µL nuclease free water (Ambion), 1.2 µL 1M MgCl2, 2 µL of TSO (5’-
AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-3’, which contains two
riboguanisines (rG) and one LNA-modified guanisine (+G) to facilitate template
switching) was added to each sample and mixed by pipetting. The samples were
incubated in the thermocycler for 90 minutes at 42 °C and then were subjected to 10
cycles of 2 minutes at 50 °C followed by 2 minutes at 42 °C, one 15 minute incubation
at 70 °C, and a final hold at 4 °C lasting at least 1 minute. Next the samples were
amplified by adding 30 µL of PCR reaction mix (300 µL Kappa HiFi HotStart ReadyMix
(2X KAPA Biosystems), 6 µL ISPCR primer (5’-AAGCAGTGGTATCAACGCAGAGT-3’),
![Page 128: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/128.jpg)
118
and 54 µL nuclease free water). The reactions were mixed by pipetting and incubated at
98 °C for 4 minutes followed by 24 cycles of 98 °C for 20 seconds, 67 °C for 15
seconds, and 72 °C for 6 minutes. A final incubation was performed at 72 °C for 5
minutes before the samples were placed at 4 °C for > 1 minute. The resultant cDNA
was isolated using an Agencourt Ampure XP kit (Beckman Coulter) following the
manufacturer’s instructions and was subsequently stored at -80 °C until further use.
RNA sequencing:
cDNA libraries were sheared to a size of approximately 250 bases using a
Covaris S2. The sheared cDNA was run on a Wafergen Apollo machine using the Kapa
Genomic Library Construction Kit (Kapa Biosystems, KK8234). Ten cycles of PCR were
run after the samples were removed from the robot and the reactions were cleaned
using magnetic beads. Quality control was performed using an Agilent 2200 Tape
Station with a D1000 High Sensitivity Tape with ladder provided. The morphology and
overall concentration of the samples were assessed and those samples that passed a
concentration cutoff were subjected to qPCR to more accurately determine
concentration. qPCR was run with SYBR green using the KAPA SYBR FAST Universal
2X qPCR Master Mix reagent (Kapa Biosystems, KK4602) and primers complementary
to the P5 and P7 regions of the adapter sequences. Serial dilutions of PhiX were used
to generate a standard curve, which was, in turn, used to determine the concentration of
cDNA in each sample prior to sequencing. Samples were sequenced on an Illumina
2500 in rapid mode on a single lane of SR50.
![Page 129: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/129.jpg)
119
Alignment and differential expression:
RNA-sequencing reads were processed using the RNA-seq pipeline
implemented in version 0.8.3a-9483413 of the bcbio-nextgen analysis project. Briefly,
poor quality bases with PHRED scores less than five (Macmanes, 2014), contaminant
adapter sequences, and polyA tails were trimmed from the ends of reads with cutadapt
version 1.4.2, discarding reads shorter than twenty bases. A STAR (Dobin et al., 2013)
index was created from a combination of the Mus musculus version 10 (mm10) build of
the mouse genome and the Ensembl release 75 gene annotation. Trimmed reads were
aligned to the STAR index, discarding reads with ten or more multiple matches to the
genome. Quality metrics including mapping percentage, rRNA contamination, average
coverage across the length of the genes, read quality, adapter contamination and others
were calculated using a combination of FastQC, RNA-SeQC (DeLuca et al., 2012), and
custom functions from bcbio-nextgen and bcbio.rnaseq (available upon request). Read
mapping to genes were counted using featureCounts (Liao et al., 2014) version 1.4.4,
excluding reads mapping multiple times to the genome and reads that could not be
uniquely assigned to a gene. Counts were normalized and differential expression
between cell types was called at the level of the gene using DESeq2 (Love et al., 2014)
version 1.6.3. To identify gene families that were expressed in GC-D cells, the data set
was filtered to identify transmembrane protein-encoding genes that were at least ten-
fold enriched in GC-D cells with an adjusted p-value of < 0.05 after correcting for
multiple comparisons using the methods described by Benjamini and colleagues
(Benjamini et al., 2001). Despite using these stringent filtering criteria, with very large
gene families one might still observe the expression of an occasional family member by
![Page 130: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/130.jpg)
120
chance and thus the data were filtered further to only consider gene families in which at
least three members were ten-fold enriched with an adjusted p-value of < 0.05. From
this list of gene families, the Ms4a genes were selected for further study as they
exhibited significant molecular diversity to encode chemoreceptors (see Figure 3.4) and
had relatively uncharacterized function.
Nanostring:
10,000 GFP positive cells from Gucy2d-IRES-GFP or Omp-GFP mice were
sorted into Trizol and the RNA was isolated as described above. Three biological
replicate RNA samples were hybridized to Nanostring probes using nCounter Elements
reagents according to the manufacturer’s specifications. The protocol was modified to
perform the hybridization step at 67 °C for 48 hours to maximize the detection of low
abundance transcripts. RNA molecules that hybridized to probe were captured and
quantified using an automated Nanostring prep station following the manufacturer’s
instructions. The resultant data were analyzed using nSolver software. Briefly, the
average number of detected molecules for six internal negative control probes (whose
complementary sequences are not present in the mouse genome) was used to
calculate a rate of non-specific hybridization. After subtracting the amount of binding
resulting from non-specific interactions, the number of molecules of each RNA transcript
found in GC-D samples and OMP samples was compared using Student’s t-test. See
Table 3.2 for probe sequences used in these experiments.
![Page 131: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/131.jpg)
121
Table 3.2. Probe sequences used in Nanostring experiments
Ms4a1 GCAACCTGCTCCAAAAGTGAACCTCAAAAGGACATCTTCACT
GGTGGGCCCCACACAAAGCTTCTTCATGAGGGAATCAAAGG
CTTTGGGGGCTGTCCAA
Ms4a2 ACAGAAAATAGGAGCAGAGCAGATCTTGCTCTCCCAAATCCA
CAAGAATCCTCCAGTGCACCTGACATTGAACTCTTGGAAGCA
TCTCCTGCCAAAGCAG
Ms4a3 CCAGGCTTTCAAGGGTTGCCAATCTTCACCGTCACCTGATGT
CTGCATTTCCCTGGGTTCCTCATCAGATGGCCTGGTGTCTTT
AATGCTGATTCTCACC
Ms4a4a AACCCAAAATCCTTGGGATTGTGCAGATTGTAATCGCCATCA
TGAACCTCAGCATAGGAATTATGATGATAATTGCCACTGTGT
CGACCGGTGAAATACC
Ms4a4b CCTAGGATATTAACACTTCATTGCACTGGCTTTTGAGGTGAA
TATTAGATTTACTGTAAGTATGTAAGTCAAGCACTTATTAGGT
CAACAACACTTCAAC
Ms4a4c TGGCAAATCTATCTTCTGAACCACTCATTTCTGTGGTCTTAAT
GGCTCCAATTTGGGGACCAATAATGTTCATTGTCTCAGGATC
CCTGTCAATTGCAGC
![Page 132: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/132.jpg)
122
Table 3.2 (Continued). Probe sequences used in Nanostring experiments
Ms4a4d ACAACTGGCACTACCATCGTGGTGAAAACCCAGCTCAAGCAT
ACCCACAAATAGAGTCCCACATCGAAACTCCACCACATTACT
CAAGGATACTGTTTCT
Ms4a5 TGAATTTACTTAGTGCTCTGGGAGCAGCAGCTGGAATCATTC
TCCTCATATTTGGCTTCCTTCTAGATGGGGAATTCATCTGTG
GCTATTCTCCAGATGG
Ms4a6b AAACAAAACTAAATACCACAAAAACAAATGGAACTATACCGC
AGAAGATATGTCTTCATGATAATGCAGAAATTCCAACCATCAC
AGGGTAGCAATGCTT
Ms4a6c CATGATTCCACAGGTAGTGACCAATGAGACCATCACAACGAT
TTCACCAAATGGAATCAACTTTCCCCAAAAAGACGAGTCCCA
GCCTACCCAACAGAGG
Ms4a6d AGTTTGGCTGCTTTAGAGCCTGCCTTGCAGCAATGTAAGCTG
GCTTTCACACAACTAGACACAACCCAAGATGCTTATCATTTCT
TTAGCCCTGAGCCAT
Ms4a7 GCCTCCAATGTAGCAAGCTCTGTTGTTGCCGTCATTGGCCTC
TTCCTCTTCACCTATTGTCTGATAGCCCTGGGGAGTGCTTTC
CCACACTGTAACTCAG
Ms4a8a TGTCACTACAACAATCCAGGTGTGGTCATTCCAAATGTCTAT
GCAGCAAACCCAGTGGTCATCCCAGAACCACCAAACCCAAT
ACCAAGTTATTCCGAAG
![Page 133: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/133.jpg)
123
Table 3.2 (Continued). Probe sequences used in Nanostring experiments
Ms4a10 CCTAAGACCTCTCTGAAGGTTCTCTGTGTGATAGCCAACGTT
ATCAGCTTGTTCTGCGCACTGGCCGGCTTCTTTGTCATTGCC
AAGGACCTCTTCCTGG
Ms4a13 TTTCATGGCTGCTAACACCTGATGTAGGTGCCCATGAGATTC
CCATATAACAAGGCACACCTCATGCATTTTGTGCAAAAGGAA
ATTCACAACAAGGTGA
Ms4a15 GTGGGAAATCTTGGCTTCGCAGAGGTTTCGGAGGTTTGTCTT
CAAGATCATTAAGCACGGAGAACTCAGAATGTTCCAGAATAG
ACTGGCATTTCAGAGG
Ms4a18 GAATTCATCCTCACCTGCATAGCCTCACATTTTGGATGCCAG
GCTGTCTGCTGCGCCCATTTTCAGAACATGACAATGTTCCCA
ACCATATTTGGTGGCA
Pde1c GCTGTAATCGATGCATTGAAGGATGTGGATACGTGGTCCTTC
GATGTCTTTTCCCTCAATGAGGCCAGTGGAGATCATGCACTG
AAGTTCATTTTCTATG
Adcy3 CAACAACGGCGGCATCGAGTGTCTACGCTTCCTCAATGAGA
TCATCTCTGATTTTGACTCTCTCCTGGACAATCCCAAATTCCG
GGTCATCACCAAGATC
![Page 134: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/134.jpg)
124
Table 3.2 (Continued). Probe sequences used in Nanostring experiments
Cnga2 GCTTGTGGATAATGGAGATCATGTGGGTTGAATTTCTAAGAG
CGTGACCTCCTAAGTCTCACAAGGAATCAGAGAATAGCTAAA
TTGTCCTTCCTGAGGC
Actb CAGGTCATCACTATTGGCAACGAGCGGTTCCGATGCCCTGA
GGCTCTTTTCCAGCCTTCCTTCTTGGGTATGGAATCCTGTGG
CATCCATGAAACTACAT
Gapdh AGGTTGTCTCCTGCGACTTCAACAGCAACTCCCACTCTTCCA
CCTTCGATGCCGGGGCTGGCATTGCTCTCAATGACAACTTTG
TCAAGCTCATTTCCTG
Pde2a CCACTAGCTTCTCTTCTGTTTTGTTCCCTATGTGTCGTGGGT
GGGGGAGGGGGCCACCTGCCTTACCTACTCTGAGTTGCCTT
TAGAGAGATGCATTTTT
Car2 TGCCCAGCATGACCCTGCCCTACAGCCTCTGCTCATATCTTA
TGATAAAGCTGCGTCCAAGAGCATTGTCAACAACGGCCACTC
CTTTAACGTTGAGTTT
Golf ATCGAAGACTATTTCCCGGAGTATGCCAATTATACTGTCCCT
GAAGATGCAACACCAGATGCGGGAGAAGATCCCAAAGTTAC
AAGAGCAAAGTTCTTTA
Emx1 CAGGCAAGCGACGTTCCCCAGGACGGGCTGCTTTTGCACGG
GCCCTTCGCACGCAAGCCCAAGCGGATTCGCACAGCCTTCT
CGCCCTCGCAGCTGCTGC
![Page 135: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/135.jpg)
125
Multi species alignment of Mus musculus MS4A proteins:
FASTA format sequences of the indicated Mus musculus MS4A proteins were
downloaded from the NCBI protein database and aligned using the PRALINE sequence
alignment program on the Centre for Integrative Bioinformatics VU website using the
default settings. Amino acid conservation across family members was scored using the
PRALINE default settings where the least conserved amino acids were given a 0 score
and the most conserved amino acids were assigned a 10 (Simossis and Heringa, 2005).
TOPCONS was used to determine the predicted topology of the MS4A family member
that was used on the top line of the alignment. All topographical representations were
generated using the Protter program and manually entering the topographical
orientation of the MS4A protein as predicted by TOPCONS.
Phylogenetic and selection analyses with MS4A genes:
MS4A sequences were retrieved from both Ensembl and NCBI databases and
imported into Geneious v8 (Biomatters Ltd). We chose 37 representative taxa from all
the major mammalian lineages (see Table 3.3 for full list). When a gene had more than
one predicted isoform, the sequence that contained the longest open-reading frame was
selected. Coding DNA sequences were translated, aligned with MAFFT v7.017 (Katoh
and Standley, b) using the E-INS-i algorithm, the BLOSUM80 scoring matrix, and a gap-
opening penalty of 1. Sequences were then back-translated into codons. For
phylogenetic reconstruction of the multigene family tree, the OpenMPI version of
MrBayes v3.2.1 (Ronquist et al., 2012) and the GTR+I+G model as determined by
jModelTest 2.1.7 (Darriba et al., 2012) were used. The final dataset consisted of 411
![Page 136: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/136.jpg)
126
Table 3.3. List of taxa used for phylogenetic reconstructions
Group Order Family Species Common name
Monotremata Ornithorhynchidae
Ornithorhynchus
anatinus platypus
Marsupalia Dasyuridae Sarcophilus harrisii Tasmanian devil
Placentalia
Soricomorpha Soricidae Sorex araneus common shrew
Carnivora
Mustelidae Mustela putorius furo ferret
Ursidae
Ailuropoda
melanoleuca giant panda
Canidae Canis lupus familiaris dog
Chiroptera Vespertilionidae Myotis lucifugus little brown bat
Perissodactyla Equidae Equus ferus caballus horse
Artiodactyla
Suidae Sus scrofa domesticus pig
Bovidae Bos taurus cow
Ovis aries sheep
Cetacea Delphinidae Tursiops truncatus bottlenose dolphin
Lipotidae Lipotes vexillifer baiji
Macroscelidea Macroscelididae Elephantulus edwardii elephant shrew
Afrosoricida Tenrecidae Echinops telfairi
lesser hedgehog
tenrec
Hyracoidea Procaviidae Procavia capensis rock hyrax
Cingulata Dasypodidae
Dasypus
novemcinctus
nine-banded
armadillo
![Page 137: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/137.jpg)
127
Table 3.3 (Continued) List of taxa used for phylogenetic reconstructions
Primates
Galagidae Otolemur garnetti
northern greater
galago
Callitrichidae Callithrix jacchus
common
marmoset
Hominidae
Gorilla gorilla gorilla
Pan troglodytes chimpanzee
Homo sapiens human
Scandentia Tupaiidae Tupaia chinensis tree shrew
Lagomorpha Ochotonidae Ochotona princeps American pika
Leporidae Oryctolagus cuniculus rabbit
Rodentia
Heteromyidae Dipodomys ordii kangaroo rat
Dipodidae Jaculus jaculus jerboa
Muridae Mus musculus mouse
Rattus norvegicus rat
Cricetidae
Cricetulus griseus Chinese hamster
Mesocricetus auratus golden hamster
Microtus ochrogaster prairie vole
Sciuridae Spermophilus
tridecemlineatus
thirteen-lined
ground squirrel
Bathyergidae Heterocephalus glaber naked mole-rat
Chinchillidae Chinchilla lanigera chinchilla
Octodontidae Octodon degus degu
Caviidae Cavia porcellus guinea pig
![Page 138: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/138.jpg)
128
sequences and 447 characters corresponding to sites present in at least 75 percent of
the aligned sequences. For individual gene tree reconstructions and evolutionary
analyses, sequence subsets were extracted based on their group membership as
predicted based on the multigene family tree. Sequences were then realigned
corresponding to each subset as above, the resulting alignments were trimmed to
remove positions that contained gaps in the majority of sequences. The phylogenetic
reconstruction was carried out using the OpenMPI version of RAxML v8 (Stamatakis,
2014).
To identify branches under episodic positive selection, the random-effects
likelihood branch-site method (BS-REL) (Kosakovsky Pond et al., 2011) was used as
implemented in the HyPhy package (Pond et al., 2005). The branch-site models allow
the nonsynonymous to synonymous substitution rate ratio ω (dN/dS) to vary both among
amino acid sites in the protein and across branches on the tree to detect positive
selection affecting specific sites along particular lineages (Anisimova and Yang, 2007).
We identified evidence for site-specific positive selection in MS4A homologs using the
codeml program in the PAML v4.8 software package (Anisimova and Yang, 2007). In
brief, we compared different site models, in which the evolutionary rate ω is allowed to
vary among sites. Here, we focused on comparison of model pairs: M1a (neutral; codon
values of ω fitted into two discrete site classes between 0 and 1) versus M2a (positive
selection; similar to M1a but with one additional class allowing ω>1); M7 (neutral; values
of ω following a beta distribution with ω=1 maximum) versus M8 (positive selection;
similar to M7 but with one additional class allowing ω>1); and M8a (neutral; similar to
M7 but with one fixed class with ω=1) versus M8. Multiple starting values of ω were
![Page 139: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/139.jpg)
129
used, and either the F3x4 or F61 model of codon frequencies. To evaluate whether the
models allowing positive selection provided a significantly better fit to the data,
likelihood ratio tests were used. Notably, the M1a-M2a comparison is more stringent
and can lack power to detect signatures of diversifying selection compared to the M7-
M8 models, which impose less constraints on the distribution of ω. Finally, the M8a vs.
M8 comparison can be used to contrast the potential role of reduced purifying selection
(or relaxation) versus positive selection. When the null model is rejected, the empirical
Bayes procedure was implemented under model M8 to identify sites under positive
selection (posterior probability ≥ 0.90). To identify sites that have experienced purifying
selection (posterior probability ≥ 0.90), the Fast Unconstrained Bayesian
AppRoximation (FUBAR) (Murrell et al., 2013) was used as implemented in the HyPhy
package. Consensus topology predictions were made using a standalone version of
TOPCONS2.0 (Tsirigos et al., 2015). All computational analyses were run on the
Odyssey cluster supported by the FAS Division of Science, Research Computing Group
at Harvard University.
Plasmids:
pCI-MOR9-1 was a gift from Hiroaki Matsunami (Addgene plasmid # 22331)
(Saito et al., 2009). pGP-CMV-GCaMP6s was a gift from Douglas Kim (Addgene
plasmid # 40753) (Chen et al., 2013). The GNAI15 expression plasmid was kindly
provided by Steve Liberles. DNA sequences encoding mCherry-MS4A were cloned
into the tetracycline inducible mammalian expression plasmid, pcDNA5-FRT-TO using
standard molecular biology methods.
![Page 140: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/140.jpg)
130
Heterologous expression of MS4A proteins:
Flp-In-T-Rex HEK293 cells (Invitrogen R78007) were maintained in complete
media (DMEM, high glucose, no glutamine (Life Technologies) supplemented with 10%
tetracycline free Fetal Bovine Serum (Clontech), penicillin, streptomycin, and glutamine
(Life Technologies)) with 5% CO2 in a 37 °C humidified tissue culture incubator
(NuAire) on 10 cm tissue culture plates (BD #430167). Approximately four hours prior to
transfection, cells were washed once with 10 mL plain DMEM and then incubated with 2
mL of Trypsin-EDTA solution (ATCC) for approximately 3 minutes at 37 °C. 10 mL of
complete media was then added to the plate and the cells were triturated 5-10 times
vigorously to generate single cell suspensions. After centrifugation at 300 x g for 5
minutes, the supernatant was aspirated and the cells were resuspended in complete
media before they were plated on Round German Glass 15 mm coverslips (Bellco
Biotechnology) in 12 well plates, which had been incubated for at least 24 hours with
0.2 mg/mL poly-d-lysine hydrobomide (Sigma) before being washed twice with ddH20.
After four hours, cells were transfected with calcium phosphate. For each coverslip, a
50ul reaction mix consisting of 250 mM CaCl2, approximately 2.5 ug GCaMP6s
encoding plasmid, and 1 µg MS4A encoding plasmid. This mix was homogenized by
pipetting 4 times. To this reaction mix, 50 µL of 2X HeBs (274 mM NaCl, 10 mM KCl,
1.4 mM Na2PO4.7H20, 15 mM D-glucose, 42 mM Hepes (free acid)) pH 7.04-7.10 was
added in a swirling motion from the bottom of the tube and bubbled briefly with air. This
mixture was incubated for five minutes at room temperature, pipetted once to mix, and
added to the well in a drop-wise manner. The 12 well plate was then shaken 5 times
![Page 141: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/141.jpg)
131
along each major axis before being placed in the incubator. Approximately one hour
later tetracycline (Sigma #T7760) was added to a final concentration of 1 µg /mL and
cells were allowed to express MS4A proteins overnight.
MS4A6C surface expression:
HEK293 cells were transfected with a plasmid encoding GCaMP6s and either a
control plasmid or a plasmid encoding a mCherry-MS4A6C fusion protein as described
above. 16 hours following transfection, 1 µg of purified anti-MS4A6C antibody was
added to the cells. The cells were incubated with antibody for 1 hour at room
temperature in the dark, and then washed 3X with complete media. Cells were
subsequently fixed with 4% paraformaldehyde/1X PBS for ten minutes and then washed
three times with 1X PBS. Cells were re-blocked with PBS/0.3% Triton X-100/5%
donkey serum for 30 minutes and then incubated with Alexa633 goat anti-rabbit
secondary antibody (1:300) for 45 minutes. The fixed and stained cells were washed
three times with block, and the coverslips were mounted on slides using VECTASHIELD
Mounting Medicum with DAPI (Vector laboratories).
Odors:
Steroids were purchased from Steraloids (Newport, Rhode Island). Additional
compounds were purchased from Sigma and were obtained at the highest purity
possible.
![Page 142: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/142.jpg)
132
In vitro odor screen:
HEK293 cells were co-transfected as described above with a plasmid encoding
GCaMP6s and either a plasmid encoding one of the MS4A proteins or plasmids
encoding the odorant receptor MOR9-1 and the G protein GNAI15 (which couples the
exogenous GPCR to intracellular calcium stores, see Ukhanov et al., 2014). Coverslips
were washed with Ringers solution and then secured in a perfusion/imaging chamber
(Warner Instruments) using High Vacuum Grease, Dow Corning (VWR). Ringers
solution was constantly perfused over the cells at a rate of ~10 mL/minute using an 8-
channel valve-controlled gravity-driven perfusion system (Warner Instruments) and
images were acquired using the MetaFluor software package using an Olympus IX83
microscope, a Sutter Lambda DG4 Light System with a Xenon arc lamp, and an Andor
Neo 5.5 sCMOS camera. A 20X NA 0.45 air objective (Olympus) was used to acquire
images at ~ 0.67 Hz at 3 x 3 pixel binning to reduce the exposure times required to
obtain images thereby limiting photobleaching and phototoxicity. Each imaging epoch
consisted of 900 seconds. For the first 300 seconds images were acquired but not
saved as a significant amount of GCaMP6s signal decay occurred within this window.
Subsequently the experiment consisted of 150 seconds of Ringers, valve switch and 75
seconds of Ringers (from a separate reservoir to mimic odor stimulation), valve switch
and 150 seconds of Ringers, valve switch and 75 seconds of odorant, followed by a
final valve switch and 150 seconds of Ringers. Odorants were delivered as mixtures of
chemicals diluted in Ringers solution such that each individual constituent was present
at 10 µM final concentration. Each coverslip was exposed to a single imaging epoch to
control for response adaptation. To assess the time required to clear dead volumes and
![Page 143: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/143.jpg)
133
to estimate mixing delays, 100 nM RhodamineB dye was flowed instead of odor and
dye saturation kinetics were determined. In Figures 3.6A and S4B stimulus bars begin
when odor is estimated to reach 90% saturation.
To identify monomolecular compounds that activate HEK293 cells expressing
individual MS4A family members, several odorant mixes that elicited statistically
significant responses in cells expressing a particular MS4A protein were selected for
deconvolution analysis. The final concentration of each odorant in the deconvolution
analysis was 50 µM except for the polyunsaturated fatty acid constituents, which were
delivered at 10 µM, as at higher concentrations some of these molecules non-
specifically activated HEK293 cells.
Analysis of in vitro screen data:
Analysis was performed using fully automated custom scripts in iPython that
employed NumPy, SciPy, Pymorph, Pandas, and Mahotas source code packages. Each
fluorescent image of the time series was locally smoothed and downsampled 3-fold in
both dimensions to facilitate subsequent processing. The downsampled image stack
was segmented into cell areas using a watershed transform, which were then used to
extract the fluorescence values of individual cell areas over time. The resulting traces
were baseline-corrected using a wide (100 frames) moving median filter to remove long-
timescale drifts such as fluorescence decay due to photobleaching and smoothed using
a local (9 frames) moving average filter. A total of seven coverslips from the mixture
screen and five coverslips from the deconvolution screen were removed from the
analysis for failing to meet quality control.
![Page 144: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/144.jpg)
134
Processed traces were normalized by calculating an average fluorescence value
across the period prior to odor stimulation and then dividing the entire trace by this
value (thereby generating a dF/F trace). Responses were identified as fluorescent
peaks within a twenty frame window centered at the time point at which maximal odor
concentration occurred (determined empirically using RhodamineB dye) that were five
standard deviations above the noise observed in the baseline period. The spontaneous
activity response rate (determined as responses observed during twenty frames of the
Ringers only period) was subtracted from the odor-evoked response rate; this rate did
not change based upon the specific position of the window chosen in the trace (as long
as it did not overlap with odor delivery). The proportion of cells co-expressing a
chemoreceptor and GCaMP6s that responded to a given stimulus was compared by Z-
test to the proportion of cells expressing only GCaMP6s that responded to the same
stimulus. Only response tallies with a P-value of < 0.05 following FDR correction for
multiple comparisons are depicted.
In vitro functional experiments with focal stimulus delivery pencil:
To characterize ligand-induced response kinetics with greater temporal precision
than in the bulk calcium assay, HEK293 cells were transfected with a plasmid encoding
the fast version of GCaMP6 (GCaMP6f) and plasmids encoding either an MS4A or
MOR9-1/GNAI15. The cells were perfused with Ringer’s solution and odorants were
delivered in liquid phase with a six channel gravity-controlled perfusion manifold
(Warner Instruments) through a custom-made “stimulus pencil” made of quartz tubing
focally positioned relative to the field of view. Images were acquired as described for the
![Page 145: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/145.jpg)
135
in vitro odor screen with an imaging rate of 2 Hz. The delay between valve switch and
odor delivery was determining using RhodamineB dye as in the bulk calcium assay.
Dose response curves and EC50 calculations:
Dose response curves were determined as in (Mainland 2015). HEK293 cells co-
expressing GCaMP6f and MOR9-1/GNAI15 or an MS4A were odor stimulated with a
focal stimulus delivery pencil as described earlier. Each field of view was stimulated
using the stimulus pencil with odorant spanning six log orders of odorant (from 10 nM to
1 mM) starting with the lowest concentration. Fluorescent traces were extracted and
normalized as described above for the in vitro odor screen. Because of the tighter
stimulus control afforded by this configuration, cells were considered to have responded
if they exhibited fluorescent peaks greater than 4 standard deviations above baseline
within a 15 second window centered around the time of maximal odor responses. A
delay of 150 seconds was included between stimulus presentations. The cumulative
fraction of cells that had responded by each odor concentration was determined for both
receptor-expressing and control cells. To account for non-specific activation that might
occur at higher concentrations of odorant the fraction of control cells (expressing
GCaMP only) that was activated was subtracted from the fraction of receptor-
expressing cells and sigmoidal dose response curves were then fit to the receptor data.
Between four and twenty coverslips for both control and receptor-expressing cells were
imaged to construct each dose response curve and each data point represents the
mean +/- SEM of the relative cumulative fraction of cells that responded to that odor
concentration.
![Page 146: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/146.jpg)
136
Analysis of calcium transient temporal dynamics:
Analysis was performed by applying fully automated custom iPython scripts to
extracted fluorescence traces. Response onset, half-rise time and peak time were
identified using a peak and trough finding package in SciPy
(SciPy.signalfind_peaks_cwt) (Du et al., 2006). Only cells that had response peaks
greater than 4 standard deviations above baseline were included for analysis. Two-
tailed Student’s T-tests were run on the distributions of data and were Bonferroni
corrected for multiple comparisons.
Requirement of extracellular calcium for MS4A ligand responses:
Experiments were performed similarly to those described using the stimulus
pencil delivery system. Cells were either perfused with Ringers supplemented with 1
mM calcium chloride (plus calcium) or 1 mM EGTA (minus calcium) to chelate calcium.
The percent of cells that responded was determined as described above.
RNAscope Fluorescent In Situ Hybridization:
Fluorescent in situ hybridization was performed on dissociated olfactory epithelial
cells adhered to glass coverslips. Nasal epithelia from 8-12 week old C57/BL6 male
mice, OR174-9-IRES-tauGFP mice, or GC-D-IRES-tauGFP mice were dissociated with
the same method used for FACS, except that they were incubated in papain + DNAse I
for 90 minutes. The final cell pellet from a single mouse epithelium was resuspended in
900 µL of DMEM + 10% FBS, and 75 µL was placed on each of twelve 12 mm #1 glass
![Page 147: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/147.jpg)
137
coverslips (Bellco Biotechnology #1943-10012) that had been coated with 30 µL of 5
mg/mL poly-D-lysine (Sigma Aldrich #P6407), dried, and washed three times with
deionized water. Cells were allowed to settle on coverslips for 30 minutes at room
temperature, rinsed once with 1X PBS, and fixed with 4% paraformaldehyde (PFA)/1X
PBS (diluted from 20% PFA, Electron Microscopy Sciences #15713) for 30 minutes at
room temperature. Coverslips were washed three times with 1X PBS and passed
through a dehydration series of 50%, 70%, and 100% ethanol (v/v in water) for 5
minutes each. The last wash was replaced with fresh 100% ethanol and cells were
stored at -20 °C overnight.
On the second day, coverslips were stained for specific mRNA targets by the
RNAscope protocol (Advanced Cell Diagnostics, RNAscope Multiplex Fluorescent
Assay For Fresh Frozen Tissues User Manual rev. 20121003). Several modifications to
the RNAscope protocol were made to combine FISH for low abundance targets with
immunohistochemistry: after rehydration, coverslips were treated with protease
(“Pretreat 4”) diluted 1:30 in 1X PBS; RNAscope target probes, which are supplied at
50X concentration, were diluted to final 2X concentration in blank probe solution;
hybridization lasted for 4 hrs at 40 °C in the HybEZ oven (Advanced Cell Diagnostics
#310010); and for experiments using type C1 and C2 probes (see below) the
fluorescent reagent Amp4-altB was used, whereas for experiments using C1 and C3
probes we used Amp4-altC (Advanced Cell Diagnostics #320850).
To combine FISH with immunostaining, at the end of the RNAscope protocol,
instead of being counterstained and mounted, the coverslips were rinsed in 1X PBS
twice and blocked in 1X DAKO Serum-Free Protein Block (DAKO X0909) in PBS for 20
![Page 148: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/148.jpg)
138
minutes at room temperature. Coverslips were then incubated with primary antibody
(rabbit anti-Car2 or chicken anti-GFP as below) in blocking solution for 1 hour at room
temperature, washed three times for 5 minutes in PBS, and stained with secondary
antibody in PBS for 30 minutes at room temperature. After three final washes in PBS
the coverslips were counterstained with ProLong Diamond Antifade Mountant + DAPI
(Life Technologies #P36961), fixed to slides with nail polish, and imaged by
epifluorescent or confocal microscopy as described below.
To quantify RNAscope signal, coverslips were viewed under epifluorescence with
a 63X/NA1.4 oil immersion objective lens (Zeiss Plan-Apochromat 63X/1.40 OIL DIC
440762-9904-000) and fluorescent puncta visible by eye were counted for each
immunopositive cell. In initial experiments puncta in random immunonegative cells were
also quantified and the background levels for MS4A probes were found to be ~ 1
punctum/5-10 cells (data not shown). In approximately 10% of experiments much higher
background (3+ puncta/cell) was observed, possibly due to sample drying. These
coverslips were discarded from the analysis. For the remainder of the analysis puncta
were quantified only in identifiable cells (i.e., GC-D/CAR2 or OR174-9 expressing cells.)
The target probes used in this assay are custom reagents designed by Advanced
Cell Diagnostics and are currently available in the ACD catalog. Mouse target probes
used are as follows: Ms4a1-c1 #318671, Ms4a2-c1 #438171, Ms4a3-c1 #438181,
Ms4a4A-c1 #427391, Ms4a4B-c1 #314611, Ms4a4C-c1 #426371, Ms4a4D-c1 #427401,
Ms4a5-c1 #318641, Ms4a6B-c1 #313801, Ms4a6C-c1 #314581, Ms4a6D-c1 #314591,
Ms4a7-c1 #314601, Ms4a8A-c1 #426361, Ms4a10-c1 #438151, Ms4a15-c1 #427381,
Olfr173-c1 #313771, Olfr151-c1 #431161, Olfr66-c1 #431171, Ms4a6C-c3 314581-C3,
![Page 149: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/149.jpg)
139
Ms4a4B-c3 #314611-C3, Car2-c2 #313781-C2, Gucy2d-c2 #425451-C2, Pde2a-c3
#426381-C3.
MS4A Antisera:
Peptides derived from mouse MS4A protein sequences were synthesized by
Covance, Inc. (Denver, PA) as follows: 6C-pep: CKQSKELSLIEHDYYQ; 6D-pep:
SQNSKNKSSVSSESLC; 7-pep: HKREKTGHTYEKEDD; 4B-pep:
HQGTNVPGNVYKNHPC; 8A-pep: TAKSWEPEQERLTWC; 5-pep:
TTQEYQTTELTATAYNC. These peptides were coupled by terminal cysteine residues
to KLH and used to raise an immunoglobulin response in rabbits and guinea pig (6C-
pep only). Sera collected by Covance, Inc. from rabbits and guinea pig were tested for
ability to stain 293T cells expressing MS4A protein and GC-D cells (guinea pig anti-6C
and rabbit anti-6C antibodies yielded the same pattern of staining in vitro and in vivo);
the best lots of serum were purified by passing over protein A/sepharose (Life
Technologies #10-1042) and eluted with 100 mM Glycine, pH 2.7 to collect
immunoglobulin. A subset of these (anti-6C, 6D, and 7) were further affinity purified by
passing over resin cysteine-coupled to the respective antigenic peptides (Thermo
Scientific #44999) and fractions eluted with 100 mM glycine, pH 2.7 were tested for
greatest specificity on 293T cells. We also raised antisera against GC-D protein with the
peptide (Ac-QRIRTDGKGRRLAC), which was purified by passing over protein
A/sepharose and a peptide affinity column as above. For peptide competition
experiments, antibody concentration was estimated by reacting with protein assay dye
reagent (Bio-Rad #5000006) and measuring 595 nm absorbance with a Cary 60 UV-Vis
![Page 150: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/150.jpg)
140
spectrophotometer (Agilent Technologies). Sample concentrations were estimated by
fitting to a line generated with IgG standards; most purified antibodies were between 1.0
and 5.0 mg/mL. Peptides were resuspended in 1X TBS at 1 mg/mL and mixed with
diluted antibodies in block at a 10 µg peptide: 1 µg antibody ratio; as the peptides are
~15 amino acid residues and IgGs are ~1500 residues total, it was estimated that this
gives ~1000-fold molar excess of peptide. Similar results were obtained with lower
peptide concentration (data not shown).
Primary antibodies/concentrations used were as follows: goat anti-Pde2a (1:50,
Santa Cruz Biotechnology sc-17227), chicken anti-GFP (1:1000, Abcam #ab13970),
rabbit anti-AC3 (1:100, Santa Cruz Biotechnology sc-588), rabbit anti-GC-D (serum
7444, affinity fraction 2, 1:1000), rabbit anti-Car2 (1:500, Abcam #191343), goat anti-
CD20 (1:50, Santa Cruz Biotechnology #sc-7735), rabbit anti-MS4A4B (serum 7512,
PAS fraction, 1:2000), rabbit anti-MS4A6C (serum 7277, affinity fraction 3, 1:500), anti-
MS4A6D (serum 7284, affinity fraction 3, 1:500), anti-MS4A7 (serum 7286, affinity
fraction 2, 1:500), anti-MS4A8A (serum 7508, PAS fraction, 1:2000), anti-MS4A5
(serum 7503, PAS fraction, 1:2000), guinea pig anti-MS4A6C (serum 7630, PAS
fraction, 1:1000), anti-S6 phosphoSerine240/244 (1:200, Cell Signaling Technologies
#22155).
Secondary antibodies/concentrations used were as follows: donkey anti-rabbit-
Cy3 (1:300, Jackson Immunoresearch, #711-167-003), donkey anti-rabbit-CF633
(1:300, Biotium #20125), donkey anti-goat-Alexa633 (1:300, Invitrogen #A21082),
donkey anti-goat-Alexa488 (1:300, Jackson Immunoresearch #705-546-147), donkey
![Page 151: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/151.jpg)
141
anti-guinea pig-Alexa647 (1:300, Jackson Immunoresearch #706-606-148), donkey
anti-chicken-Alexa488 (1:300, Jackson Immunoresearch #703-545-155).
Cultured Cell Preparation for Immunostaining:
293T cells adhered to 12 mm coverslips and transfected with mCherry-MS4A
expression plasmids (see above) were fixed 24-48 hours post-transfection with 4%
PFA/1X PBS (Electron Microscopy Sciences) for 10 minutes at room temperature.
Coverslips were washed three times with 1X PBS and stored at 4 °C in 1X PBS until
immunostaining as described below.
Tissue Preparation for Immunostaining:
All preparation of nasal epithelia and olfactory bulbs was performed as follows,
except for assays involving phospho-S6: animals were euthanized as above and
olfactory epithelia were dissected out from the skull with olfactory bulbs attached and
fixed overnight in 4% PFA/1X PBS at RT. After washing 5 minutes with 1X PBS three
times, noses were decalcified overnight in 0.45M EDTA/1X PBS at 4 °C. Noses were
washed once more with 1X PBS, then sunk in 20% sucrose for 3 hrs at 4 °C, and finally
embedded in Tissue Freezing Medium (VWR #15146-025). 15 micron cryosections
were cut onto Superfrost Plus glass slides (VWR #48311703) and stored at -80 °C until
staining. For experiments involving anti-phosphoS6 staining, nasal epithelia were
instead fixed overnight in 4% PFA/1X PBS at 4 °C.
![Page 152: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/152.jpg)
142
Immunostaining:
For experiments without anti-phosphoS6, cryosections on slides were removed
from the freezer, air dried for 10 minutes, and antigen retrieved by immersion for 10
minutes in a 98 °C solution of 10 mM Sodium Citrate, 0.1% Tween-20, pH 6.5. Slides
were rinsed in 1X Tris-buffered Saline (TBS: 50 mM Tris-Cl, 150 mM NaCl, pH 7.5) at
room temperature and blocked in 5% Normal Donkey Serum (Jackson Immunoresearch
#017-000-121)/0.1% Triton-X100/1XTBS for 30 minutes at room temperature. All
immunostaining was done at 4 °C overnight with antisera diluted in blocking solution.
On the following day, slides were washed three times for 10 minutes in 1X
TBS/0.1% TritonX100 at room temperature, and then incubated in secondary antibody
solution (antibodies listed above in blocking solution) for 45 minutes at room
temperature. Finally, slides were washed three times for 10 minutes in 1X TBS/0.1%
TritonX100, counterstained with Vectashield + DAPI (VWR #101098-044), and
coverslipped before confocal microscopic imaging.
For experiments involving anti-phosphoS6, staining was performed as above with
the following changes: there was no antigen retrieval step before blocking; blocking
solution was 1X PBS/0.1% TritonX100/3% Normal Donkey Serum/3% BSA; all washes
were done in 1X PBS/0.1% TritonX100; and the primary antibody solution included 50
nM of a phosphopeptide (“3P”) derived from the S6 sequence (Knight et al., 2012). This
peptide, which contains phosphorylated Serine235/236/240, is meant to compete away
nonspecific antibody binding to S6 protein not phosphorylated at its neuronal activity-
dependent sites.
![Page 153: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/153.jpg)
143
Finally, assaying Ms4a6d-IRES-GFP-infected noses required costaining with two
rabbit primary antisera, one to MS4A6D and the other to phosphorylated S6. To prevent
cross-reactivity with secondary antibodies, phospho-S6 staining was performed first as
described above; after application of fluorescent secondary antibody, remaining sites on
the rabbit primary antibody were blocked by incubation with 5 ug/mL unconjugated
donkey anti-rabbit Fab fragments (Jackson Immunoresearch) in washing solution at
room temperature for 1 hour. After washing out unbound Fab fragments three times with
wash solution, tissue sections were stained with anti-MS4A6D overnight as described
above and detected with a CF633-conjugated secondary antibody (Biotium). No
fluorescence to indicate cross-reactivity was observed, and control experiments without
anti-MS4A6D antiserum showed that the later secondary antibody did not interact with
the Fab-blocked phospho-S6 primary antibody.
Explant calcium imaging:
Adult offspring of Emx1-IRES-Cre and ROSA-GCaMP3 mice were sacrificed and
dissected to expose the lateral olfactory epithelium, adjacent to the olfactory bulb. The
epithelium and adjacent skull (including the adjacent olfactory bulb) was embedded in a
custom-made perfusion chamber with 5% low-melt agarose (Invitrogen) made from
modified Ringer’s solution (115 mM NaCl, 5 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 25 mM
NaHCO3, 10 mM HEPES, pH 7.4). Small slits were cut anterior to the cul-de-sac regions
of exposed olfactory epithelium to allow fluid flow, and for the remainder of the
experiment the tissue was superfused with carboxygenated modified Ringer’s solution
(95% O2, 5% CO2). Odorants were delivered to the tissue in liquid phase via an 8-to-1
![Page 154: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/154.jpg)
144
perfusion manifold controlled by solenoid valves (Warner Instruments) through a
custom-made “stimulus pencil” positioned near the olfactory epithelium. Each odorant or
mixture was diluted in 0.1% DMSO in modified Ringer’s solution to a concentration of
100 µM.
Cul-de-sac regions of the tissue containing GCaMP3+ cells were imaged through
the epithelial cartilage by standard multiphoton microscopy (Prairie Technologies) with a
Ti-sapphire laser (Coherent) at 965 nm through a 25X/NA1.05 water-immersion
objective lens (Olympus XL Plan N). 512x512 fluorescent images were acquired at 1
Hz, with each odor trial consisting of 20 seconds of Ringers, 10 seconds of odorant, and
finally 50 more seconds of Ringers. After imaging, a high resolution image of the field of
view was acquired to aid cell identification. As was done for the in vitro assays, the
delay time for odor delivery was assessed using RhodamineB dye; these experiments
revealed that the maximal lumenal concentration of dye at equilibrium was
approximately 10 percent of the initial dye concentration (as assessed via fluorescence
intensity). Image registration was accomplished using custom code, and publicly
available Python image processing and OpenCV packages. Time-series images were
aligned using a feature-based approach that is robust to regional fluorescence intensity
fluctuations over the course of the experiment. Images (for alignment purposes) were
first contrast enhanced to enable feature detection, and then all frames from a single
experiment were registered to a manually chosen target frame in a pairwise manner.
For each frame-target pair, positional features, typically corresponding to cell bodies
and blood vessels, were then automatically identified using Harris corner detection.
Corresponding features were then used to obtain an optimal homography (i.e.,
![Page 155: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/155.jpg)
145
projective transformation) between frame and target, and this transform was then
applied to the raw images.
Cells from aligned movies of the raw images were identified using a semi-
automated approach. First, the centroids of putative cells (i.e., rounded and convex
GCaMP3+ objects, sometimes with nuclear exclusion of GCaMP3) in a time-series
average projection were manually specified. Cell masks were then generated using a
combination of morphological filtering and region-growing. Each cell mask was further
refined based on co-fluctuations in the fluorescence of pixels in the cell’s vicinity.
Independently covarying groups of pixels were first identified using nonnegative matrix
factorization. Pixels associated with the cell of interest were then assigned to the current
mask; pixels that correspond to adjacent cells were excluded. In the resultant binary
mask, each connected component therefore corresponded to a cell; fluorescence time-
courses for each cell were then obtained by averaging the pixels in each connected
component on a frame-by-frame basis.
Putative necklace cells were defined as cells within the cul-de-sacs that
responded to carbon disulfide with at least a 25% increase in average fluorescence and
did not respond to DMSO alone. A cell was then categorized as responding to an odor
stimulus if its average fluorescence increased at least 25% relative to the previous 10
frames and reached a peak after odor presentation, but not before. For display, plotted
traces were smoothed by convolution with a 3-frame rectangular window. For
generating the top panels of Figure 3.13A, the fluorescent signal following vehicle
stimulation was subtracted from the fluorescent signal following odorant stimulation, and
the resultant image was heat-mapped and overlaid onto a reference image using a
![Page 156: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/156.jpg)
146
custom Python script. For the purposes of data representation these heatmaps are
shown as raw change in fluorescence; 100% on this fluorescence scale corresponds to
the full dynamic range of image intensity in this acquisition.
Confocal Microscopy and Image Processing:
Slides were imaged under a 63X/NA1.4 oil immersion planar apochromatic
objective lens (Zeiss). Digital images were acquired on a Zeiss LSM 510 Meta confocal
microscope (Harvard Neurodiscovery Imaging Center). Cyanine and Alexa fluorophores
were excited in sequence with an argon laser (488 nm line), a HeNe laser (543 nm),
and a second HeNe laser (633 nm). DAPI was imaged with a tuneable Coherent
Chameleon Laser at 740 nm in two-photon excitation mode. Emission was detected
with standard dichroic mirrors and filter sets. Using Imaris 8.1 software (Bitplane Inc.),
multi-channel z-stacks were maximum-intensity-projected into two dimensions and
passed through a median filter to remove debris much smaller than structures being
assayed.
Adenoviral Infection:
Six week old male mice (Jackson) were anesthetized with 100 mg/kg of
Ketamine, 10 mg/kg of Xylazine, and 3 mg/kg of Acepromazine. Infusions of 3~6 x 108
FFU of human adenovirus serotype 5 encoding Ms4a6c-IRES-hrGFP or Ms4a6d-IRES-
hrGFP in the right nostril of mice were performed as previously described (Holtmaat et
al., 1996). Mice were subjected to the odor exposure 6-8 days after injections.
![Page 157: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/157.jpg)
147
Odor Exposure for Phospho-S6 Immunostaining and Quantification of Positive Cells:
8-10 week old C57/BL6 male mice (Jackson Laboratory) were group housed
overnight on a reverse light-dark cycle with 3-5 mice/cage. On the day of the
experiment, single mice were habituated in fresh cages for 3 hours in the dark. The odor
stimulus was then introduced into each cage as 100 µL of neat odorant blotted onto
Whatman paper in 10 cm petri dishes with slits cut into the lid. After 4 hours of odor
exposure, animals were sacrificed and their nasal epithelia were dissected and fixed as
described above.
To quantify phospho-S6 immunopositive cells, 10-15 images of Pde2a-positive
cell enriched cul-de-sacs were acquired with a confocal microscope (see above) for
each slide of odor-exposed olfactory epithelial sections. Laser and acquisition
parameters were held constant across each experiment. pS6 immunopositive cells were
counted manually from the resulting images; a cell was called positive if it showed
smooth pS6 fluorescent signal filling up the soma at levels visibly above adjacent tissue
and Pde2a-negative cells. Counts from each image were summed to give an estimate
of the proportion of activated necklace cells for each animal. In initial experiments with
each odorant, the person imaging and counting cells was blind to the identity of the
odorant. Because only sulfated steroids have a vehicle control (DMSO alone) these
data were analyzed separately from the data in Figure 3.14A.
The same method was used to quantify MS4A6C-ires-GFP and MS4A6D-ires-
GFP virus-infected cells, except that GFP+ cells were sparse and therefore called
positive for pS6 and MS4A6C (guinea pig antibody) by finding a GFP+ cell, imaging it
under laser excitation, and recording the cell as positive or negative manually. 20 or
![Page 158: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/158.jpg)
148
more GFP+ cells were counted for 3-5 epithelia per odorant, and images of
representative cells were acquired and processed as described above.
![Page 159: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/159.jpg)
149
References
Abuin, L., Bargeton, B., Ulbrich, M.H., Isacoff, E.Y., Kellenberger, S., and Benton, R. (2011). Functional architecture of olfactory ionotropic glutamate receptors. Neuron 69, 44-60.
Adler, E., Hoon, M.A., Mueller, K.L., Chandrashekar, J., Ryba, N.J., and Zuker, C.S. (2000). A novel family of mammalian taste receptors. Cell 100, 693-702.
Amcheslavsky, A., Wood, M.L., Yeromin, A.V., Parker, I., Freites, J.A., Tobias, D.J., and Cahalan, M.D. (2015). Molecular biophysics of Orai store-operated Ca2+ channels. Biophys J 108, 237-246.
Anisimova, M., and Yang, Z. (2007). Multiple Hypothesis Testing to Detect Lineages under Positive Selection that Affects Only a Few Sites. Molecular Biology and Evolution 24, 1219-1228.
Arakawa, H., Kelliher, K.R., Zufall, F., and Munger, S.D. (2013). The receptor guanylyl cyclase type D (GC-D) ligand uroguanylin promotes the acquisition of food preferences in mice. Chem Senses 38, 391-397.
Axel, R. (1995). The molecular logic of smell. Sci Am 273, 154-159.
Benjamini, Y., Drai, D., Elmer, G., Kafkafi, N., and Golani, I. (2001). Controlling the false discovery rate in behavior genetics research. Behav Brain Res 125, 279-284.
Benton, R., Vannice, K.S., Gomez-Diaz, C., and Vosshall, L.B. (2009). Variant ionotropic glutamate receptors as chemosensory receptors in Drosophila. Cell 136, 149-162.
Bubien, J.K., Zhou, L.J., Bell, P.D., Frizzell, R.A., and Tedder, T.F. (1993). Transfection of the CD20 cell surface molecule into ectopic cell types generates a Ca2+ conductance found constitutively in B lymphocytes. J Cell Biol 121, 1121-1132.
Buck, L., and Axel, R. (1991). A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell 65, 175-187.
![Page 160: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/160.jpg)
150
Caterina, M.J. (2007). Transient receptor potential ion channels as participants in thermosensation and thermoregulation. Am J Physiol Regul Integr Comp Physiol 292, R64-76.
Chen, T.W., Wardill, T.J., Sun, Y., Pulver, S.R., Renninger, S.L., Baohan, A., Schreiter, E.R., Kerr, R.A., Orger, M.B., Jayaraman, V., et al. (2013). Ultrasensitive fluorescent proteins for imaging neuronal activity. Nature 499, 295-300.
Cockerham, R.E., Puche, A.C., and Munger, S.D. (2009). Heterogeneous sensory innervation and extensive intrabulbar connections of olfactory necklace glomeruli. PLoS One 4, e4657.
Cruse, G., Beaven, M.A., Ashmole, I., Bradding, P., Gilfillan, A.M., and Metcalfe, D.D. (2013). A truncated splice-variant of the FcepsilonRIbeta receptor subunit is critical for microtubule formation and degranulation in mast cells. Immunity 38, 906-917.
Darriba, D., Taboada, G.L., Doallo, R., and Posada, D. (2012). jModelTest 2: more models, new heuristics and parallel computing. Nat Meth 9, 772-772.
DeLuca, D.S., Levin, J.Z., Sivachenko, A., Fennell, T., Nazaire, M.D., Williams, C., Reich, M., Winckler, W., and Getz, G. (2012). RNA-SeQC: RNA-seq metrics for quality control and process optimization. Bioinformatics 28, 1530-1532.
Dhaka, A., Viswanath, V., and Patapoutian, A. (2006). Trp ion channels and temperature sensation. Annu Rev Neurosci 29, 135-161.
Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21.
Dombrowicz, D., Lin, S., Flamand, V., Brini, A.T., Koller, B.H., and Kinet, J.P. (1998). Allergy-associated FcRbeta is a molecular amplifier of IgE- and IgG-mediated in vivo responses. Immunity 8, 517-529.
Dulac, C., and Axel, R. (1995). A novel family of genes encoding putative pheromone receptors in mammals. Cell 83, 195-206.
Eon Kuek, L., Leffler, M., Mackay, G.A., and Hulett, M.D. (2015). The MS4A family: counting past 1, 2 and 3. Immunol Cell Biol.
![Page 161: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/161.jpg)
151
Fulle, H.J., Vassar, R., Foster, D.C., Yang, R.B., Axel, R., and Garbers, D.L. (1995). A receptor guanylyl cyclase expressed specifically in olfactory sensory neurons. Proc Natl Acad Sci U S A 92, 3571-3575.
Galindo, M.M., Voigt, N., Stein, J., van Lengerich, J., Raguse, J.D., Hofmann, T., Meyerhof, W., and Behrens, M. (2012). G protein-coupled receptors in human fat taste perception. Chem Senses 37, 123-139.
Gao, L., Hu, J., Zhong, C., and Luo, M. (2010). Integration of CO2 and odorant signals in the mouse olfactory bulb. Neuroscience 170, 881-892.
Grus, W.E., and Zhang, J. (2009). Origin of the genetic components of the vomeronasal system in the common ancestor of all extant vertebrates. Mol Biol Evol 26, 407-419.
Guo, D., Zhang, J.J., and Huang, X.Y. (2009). Stimulation of guanylyl cyclase-D by bicarbonate. Biochemistry 48, 4417-4422.
Hayakawa, T., Suzuki-Hashido, N., Matsui, A., and Go, Y. (2014). Frequent expansions of the bitter taste receptor gene repertoire during evolution of mammals in the Euarchontoglires clade. Mol Biol Evol 31, 2018-2031.
Herrada, G., and Dulac, C. (1997). A novel family of putative pheromone receptors in mammals with a topographically organized and sexually dimorphic distribution. Cell 90, 763-773.
Holtmaat, A.J., Hermens, W.T., Oestreicher, A.B., Gispen, W.H., Kaplitt, M.G., and Verhaagen, J. (1996). Efficient adenoviral vector-directed expression of a foreign gene to neurons and sustentacular cells in the mouse olfactory neuroepithelium. Brain Res Mol Brain Res 41, 148-156.
Hu, J., Zhong, C., Ding, C., Chi, Q., Walz, A., Mombaerts, P., Matsunami, H., and Luo, M. (2007). Detection of near-atmospheric concentrations of CO2 by an olfactory subsystem in the mouse. Science 317, 953-957.
Ihara, S., Yoshikawa, K., and Touhara, K. (2013). Chemosensory signals and their receptors in the olfactory neural system. Neuroscience 254, 45-60.
Isogai, Y., Si, S., Pont-Lezica, L., Tan, T., Kapoor, V., Murthy, V.N., and Dulac, C. (2011). Molecular organization of vomeronasal chemoreception. Nature 478, 241-245.
![Page 162: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/162.jpg)
152
Janas, E., Priest, R., Wilde, J.I., White, J.H., and Malhotra, R. (2005). Rituxan (anti-CD20 antibody)-induced translocation of CD20 into lipid rafts is crucial for calcium influx and apoptosis. Clin Exp Immunol 139, 439-446.
Jiang, Y., Gong, N.N., Hu, X.S., Ni, M.J., Pasi, R., and Matsunami, H. (2015). Molecular profiling of activated olfactory neurons identifies odorant receptors for odors in vivo. Nat Neurosci 18, 1446-1454.
Juilfs, D.M., Fulle, H.J., Zhao, A.Z., Houslay, M.D., Garbers, D.L., and Beavo, J.A. (1997). A subset of olfactory neurons that selectively express cGMP-stimulated phosphodiesterase (PDE2) and guanylyl cyclase-D define a unique olfactory signal transduction pathway. Proc Natl Acad Sci U S A 94, 3388-3395.
Katoh, K., and Standley, D.M. (2013a). MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Molecular Biology and Evolution 30, 772-780.
Katoh, K., and Standley, D.M. (2013b). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30, 772-780.
Knight, Z.A., Tan, K., Birsoy, K., Schmidt, S., Garrison, J.L., Wysocki, R.W., Emiliano, A., Ekstrand, M.I., and Friedman, J.M. (2012). Molecular profiling of activated neurons by phosphorylated ribosome capture. Cell 151, 1126-1137.
Kosakovsky Pond, S.L., Murrell, B., Fourment, M., Frost, S.D.W., Delport, W., and Scheffler, K. (2011). A Random Effects Branch-Site Model for Detecting Episodic Diversifying Selection. Molecular Biology and Evolution 28, 3033-3043.
Koslowski, M., Sahin, U., Dhaene, K., Huber, C., and Tureci, O. (2008). MS4A12 is a colon-selective store-operated calcium channel promoting malignant cell processes. Cancer Res 68, 3458-3466.
Leinders-Zufall, T., Cockerham, R.E., Michalakis, S., Biel, M., Garbers, D.L., Reed, R.R., Zufall, F., and Munger, S.D. (2007). Contribution of the receptor guanylyl cyclase GC-D to chemosensory function in the olfactory epithelium. Proc Natl Acad Sci U S A 104, 14507-14512.
Liao, Y., Smyth, G.K., and Shi, W. (2014). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930.
![Page 163: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/163.jpg)
153
Liberles, S.D., and Buck, L.B. (2006). A second class of chemosensory receptors in the olfactory epithelium. Nature 442, 645-650.
Liberles, S.D., Horowitz, L.F., Kuang, D., Contos, J.J., Wilson, K.L., Siltberg-Liberles, J., Liberles, D.A., and Buck, L.B. (2009). Formyl peptide receptors are candidate chemosensory receptors in the vomeronasal organ. Proc Natl Acad Sci U S A 106, 9842-9847.
Lin, S., Cicala, C., Scharenberg, A.M., and Kinet, J.P. (1996). The Fc(epsilon)RIbeta subunit functions as an amplifier of Fc(epsilon)RIgamma-mediated cell activation signals. Cell 85, 985-995.
Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550.
Macmanes, M.D. (2014). On the optimal trimming of high-throughput mRNA sequence data. Front Genet 5, 13.
Mamasuew, K., Hofmann, N., Breer, H., and Fleischer, J. (2011). Grueneberg ganglion neurons are activated by a defined set of odorants. Chem Senses 36, 271-282.
Man, O., Gilad, Y., and Lancet, D. (2004). Prediction of the odorant binding site of olfactory receptor proteins by human-mouse comparisons. Protein Sci 13, 240-254.
Matsunami, H., and Buck, L.B. (1997). A multigene family encoding a diverse array of putative pheromone receptors in mammals. Cell 90, 775-784.
McCarroll, S.A., Li, H., and Bargmann, C.I. (2005). Identification of transcriptional regulatory elements in chemosensory receptor genes by probabilistic segmentation. Curr Biol 15, 347-352.
Meyer, M.R., Angele, A., Kremmer, E., Kaupp, U.B., and Muller, F. (2000). A cGMP-signaling pathway in a subset of olfactory sensory neurons. Proc Natl Acad Sci U S A 97, 10595-10600.
Munger, S.D., Leinders-Zufall, T., McDougall, L.M., Cockerham, R.E., Schmid, A., Wandernoth, P., Wennemuth, G., Biel, M., Zufall, F., and Kelliher, K.R. (2010). An olfactory subsystem that detects carbon disulfide and mediates food-related social learning. Curr Biol 20, 1438-1444.
![Page 164: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/164.jpg)
154
Munger, S.D., Leinders-Zufall, T., and Zufall, F. (2009). Subsystem organization of the mammalian sense of smell. Annu Rev Physiol 71, 115-140.
Murrell, B., Moola, S., Mabona, A., Weighill, T., Sheward, D., Kosakovsky Pond, S.L., and Scheffler, K. (2013). FUBAR: A Fast, Unconstrained Bayesian AppRoximation for Inferring Selection. Molecular Biology and Evolution 30, 1196-1205.
Nei, M., Niimura, Y., and Nozawa, M. (2008). The evolution of animal chemosensory receptor gene repertoires: roles of chance and necessity. Nat Rev Genet 9, 951-963.
Oberland, S., Ackels, T., Gaab, S., Pelz, T., Spehr, J., Spehr, M., and Neuhaus, E.M. (2015). CD36 is involved in oleic acid detection by the murine olfactory system. Front Cell Neurosci 9, 366.
Picelli, S., Faridani, O.R., Bjorklund, A.K., Winberg, G., Sagasser, S., and Sandberg, R. (2014). Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc 9, 171-181.
Polyak, M.J., Li, H., Shariat, N., and Deans, J.P. (2008). CD20 homo-oligomers physically associate with the B cell antigen receptor. Dissociation upon receptor engagement and recruitment of phosphoproteins and calmodulin-binding proteins. J Biol Chem 283, 18545-18552.
Pond, S.L.K., Frost, S.D.W., and Muse, S.V. (2005). HyPhy: hypothesis testing using phylogenies. Bioinformatics 21, 676-679.
Riviere, S., Challet, L., Fluegge, D., Spehr, M., and Rodriguez, I. (2009). Formyl peptide receptor-like proteins are a novel family of vomeronasal chemosensors. Nature 459, 574-577.
Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M.A., and Huelsenbeck, J.P. (2012). MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice across a Large Model Space. Systematic Biology.
Ryba, N.J., and Tirindelli, R. (1997). A new multigene family of putative pheromone receptors. Neuron 19, 371-379.
Saito, H., Chi, Q., Zhuang, H., Matsunami, H., and Mainland, J.D. (2009). Odor coding by a Mammalian receptor repertoire. Sci Signal 2, ra9.
![Page 165: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/165.jpg)
155
Secundo, L., Snitz, K., and Sobel, N. (2014). The perceptual logic of smell. Curr Opin Neurobiol 25, 107-115.
Shinoda, K., Shiotani, Y., and Osawa, Y. (1989). "Necklace olfactory glomeruli" form unique components of the rat primary olfactory system. J Comp Neurol 284, 362-373.
Simossis, V.A., and Heringa, J. (2005). PRALINE: a multiple sequence alignment toolbox that integrates homology-extended and secondary structure information. Nucleic Acids Res 33, W289-294.
Singer, M.S. (2000). Analysis of the molecular basis for octanal interactions in the expressed rat 17 olfactory receptor. Chem Senses 25, 155-165.
Sosulski, D.L., Bloom, M.L., Cutforth, T., Axel, R., and Datta, S.R. (2011). Distinct representations of olfactory information in different cortical centres. Nature 472, 213-216.
Sun, L., Wang, H., Hu, J., Han, J., Matsunami, H., and Luo, M. (2009). Guanylyl cyclase-D in the olfactory CO2 neurons is activated by bicarbonate. Proc Natl Acad Sci U S A 106, 2041-2046.
Terakita, A. (2005). The opsins. Genome Biol 6, 213.
Troemel, E.R., Chou, J.H., Dwyer, N.D., Colbert, H.A., and Bargmann, C.I. (1995). Divergent seven transmembrane receptors are candidate chemosensory receptors in C. elegans. Cell 83, 207-218.
Tsai, L., and Barnea, G. (2014). A critical period defined by axon-targeting mechanisms in the murine olfactory bulb. Science 344, 197-200.
Tsirigos, K.D., Peters, C., Shu, N., Käll, L., and Elofsson, A. (2015). The TOPCONS web server for consensus prediction of membrane protein topology and signal peptides. Nucleic Acids Research 43, W401-W407.
van Giesen, L., Hernandez-Nunez, L., Delasoie-Baranek, S., Colombo, M., Renaud, P., Bruggmann, R., Benton, R., Samuel, A.D., and Sprecher, S.G. (2016). Multimodal stimulus coding by a gustatory sensory neuron in Drosophila larvae. Nat Commun 7, 10687.
![Page 166: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/166.jpg)
156
Wang, F., Flanagan, J., Su, N., Wang, L.C., Bui, S., Nielson, A., Wu, X., Vo, H.T., Ma, X.J., and Luo, Y. (2012). RNAscope: a novel in situ RNA analysis platform for formalin-fixed, paraffin-embedded tissues. J Mol Diagn 14, 22-29.
Wooding, S. (2011). Signatures of natural selection in a primate bitter taste receptor. J Mol Evol 73, 257-265.
Young, J.M., Waters, H., Dong, C., Fulle, H.J., and Liman, E.R. (2007). Degeneration of the olfactory guanylyl cyclase D gene during primate evolution. PLoS One 2, e884.
Zhang, J., and Webb, D.M. (2003). Evolutionary deterioration of the vomeronasal pheromone transduction pathway in catarrhine primates. Proc Natl Acad Sci U S A 100, 8337-8341.
Zuccolo, J., Bau, J., Childs, S.J., Goss, G.G., Sensen, C.W., and Deans, J.P. (2010). Phylogenetic analysis of the MS4A and TMEM176 gene families. PLoS One 5, e9369.
![Page 167: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/167.jpg)
Chapter 4
General Discussion and Conclusion
![Page 168: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/168.jpg)
158
General Discussion
Does The OR Expression Pattern Matter?
Most of the mammalian olfactory system obeys a “one receptor per neuron”
organization that arose in the common ancestor of jawed vertebrates. Why has the
necklace subsystem broken from this predominant molecular logic? Possible answers
depend, first, on considering why singular GPCR OR expression is so widespread.
While this pattern could reflect a developmental convenience or constraint, several
observations suggest that maintaining separate neuronal and glomerular populations for
each receptor has additional adaptive value for shaping odor perception and guiding
behavior.
The main reason to think the “one receptor per neuron” pattern is critical for
mammalian odor perception is that a variety of mechanisms have evolved to maintain it.
The biochemical process for selecting and maintaining OR choice has coopted at least
two pathways that tightly shut off the expression of hundreds or thousands of unchosen
genes (Dalton and Lomvardas, 2015). First, clusters of OR genes are packed into
constitutive heterochromatin that normally silences centromeric DNA; release from this
state requires DNA enhancers acting stochastically to remove the chosen OR locus to a
region of active transcription (Clowney et al., 2012; Magklara et al., 2011; Markenscoff-
Papadimitriou et al., 2014). This method differs markedly from singular OR expression
in insects, which is orchestrated by deterministic, cell-specific combinations of cis-acting
transcription factors (Ray et al., 2008). Second, nascent OR proteins in the endoplasmic
reticulum engage the unfolded protein response to block further protein expression and
sensory neuron development until the cells are capable of OR signaling; this culminates
![Page 169: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/169.jpg)
159
in locking the chosen OR into permanent transcription and shutting off the choice
process, ensuring that one and only one functional receptor is expressed per cell
(Dalton et al., 2013).
Again, no signs of these processes have been found in insects, whose smaller
OR repertoires may achieve singular expression purely through cell identity
determinants. In contrast, complex mechanisms for regulating OR choice may be
essential in mammals express as many as tenfold more OR genes than insect and fish.
Comparing a hypothetical species with 100 OR genes to one with 1000 genes illustrates
the problem: if inadvertent OR expression were fixed at some low rate – say, an
expression probability of .001 per gene per cell – the sensory neurons of the 100-gene
species would express an extra receptor less than 10% of the time; however, the
neurons of the 1000-gene species would do so nearly two thirds of the time. In this case
the majority of the cells that chose a given receptor and innervated a given glomerulus
would have a random component to their sensory tuning due to unintentional receptor
expression. The precision of odor coding would drop dramatically with larger OR
repertoires, and innate behaviors gated, for example, by pheromone ligation of single
receptors might also be triggered by higher concentrations of unrelated odors. Thus
additional mechanisms for repressing OR expression seem to be required for precise
odor representation in animals that use both large receptor repertoires and a “one
receptor per neuron” organization. The fact that they have evolved in mammals, along
with the expansion of GPCR OR families to contain hundreds or thousands of genes,
strongly suggests that the predominant OR expression pattern carries fundamental
![Page 170: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/170.jpg)
160
adaptive value to vertebrate olfaction, and cannot be discarded without sacrificing
important properties of odor perception.
Consistent with this explanation, OR choice appears to be less precise in
vertebrates with smaller receptor repertoires. As described in Chapter 2, the zebrafish
olfactory system uses the same families of GPCR ORs and the same glomerular
organization in its olfactory bulb as mammals; however, its genome contains ~250
functional receptors and its bulb only ~140 glomeruli, suggesting that many sensory
neurons and glomeruli receive odor signals through multiple ORs (Braubach et al.,
2012; Saraiva et al., 2015). Zebrafish cells expressing two ORs from the same gene
cluster have been observed directly (Sato et al., 2007). Together these data raise the
possibility that fish have not evolved the most stringent mechanisms for ensuring
singular OR expression. With smaller OR gene families, a low rate of aberrant
expression may be more tolerable in fish than in mammals.
There is further circumstantial evidence that extraneous OR expression would
disrupt odor coding: the mechanisms that repress unchosen ORs in sensory neurons
also target additional gene families. The first report that OR clusters are confined to
constitutive heterochromatin also showed this silencing chromatin signature affects
other types of chemoreceptors, such as bitter taste receptors, receptors for internal
signaling molecules, and non-GPCR immune cell receptors; the set of marked families
also includes the Ms4a genes, an observation that I confirmed is not due to chromatin
repression spilling over from an adjacent OR cluster (Magklara et al., 2011) (data not
shown.)
![Page 171: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/171.jpg)
161
Why would the mammalian singular choice process repress genes that are not
normally expressed in typical olfactory sensory neurons? The simplest explanation is
that these gene families would, like ORs, scramble odor coding if expressed even at low
levels in the same cells as a chosen OR. This underscores that the widespread use of
GPCR ORs in vertebrate olfaction may be an evolutionary accident: other receptors with
enough structural diversity to bind a wide range of molecular structures could, in
principle, detect odors to drive neuronal chemotransduction. The treatment of the MS4A
family as a “threat” to odor coding in typical sensory neurons supports my finding that
these proteins can act as chemoreceptors in a range of cell types, outside the context of
necklace neurons.
In summary, the “one receptor per neuron” logic is not merely a developmental
convenience in mammals. Rather, this organization appears to be an adaptation for
odor perception that enhanced the survival and reproduction of mammalian species; the
most restrictive molecular pathways for repressing chemoreceptor expression may have
evolved when vertebrate genomes began to encode more olfactory receptors, for
example as tetrapods transitioned from water to land (Niimura and Nei, 2005).
How Does Singular OR Expression Aid Odor Perception?
What does the “one receptor per neuron” organization contribute to olfaction that
makes it such a widespread adaptation? As discussed in Chapter 2 the presence of a
“private line” into the brain for each olfactory receptor gene allows precise chemical
cues, such as pheromones that bind only a single receptor at their natural
concentrations, to elicit patterns of neural activity distinct from any other odorant or odor
![Page 172: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/172.jpg)
162
blend. These unique single-receptor representations may drive equally precise
behaviors, such as the “lordosis” mating posture triggered in mice by ESP1 ligation of
the vomeronasal receptor V2Rp5. Given this organization, the olfactory system cannot
be “tricked” into driving a particular behavior through the activity of unrelated receptors.
This interpretation is supported by the independent evolution of the “one receptor
per neuron” expression pattern in insects. Olfactory sensory neurons of the fruit fly
Drosophila melanogaster generally each express a single functional olfactory receptor
from a repertoire of about 75, and their axons converge in a “one receptor per
glomerulus” pattern onto the antennal lobe of the brain (Hansson and Stensmyr, 2011;
Rytz et al., 2013). This initial odor processing structure has therefore evolved a
neuroanatomy similar to the olfactory bulb (Vosshall et al., 1999). A number of single
Drosophila receptors sense monomolecular odorants that drive feeding, reproductive,
and defensive behaviors (Dekker et al., 2006; Kurtovic et al., 2007; Stensmyr et al.,
2012); at the same time, natural odor blends are distinguished by more complex
multiglomerular activity patterns, and the recruitment of new glomeruli as odors or
concentrations shift can alter the intrinsic attractive or aversive valence of a stimulus
(Bell and Wilson, 2016; Hallem et al., 2004; Semmelhack and Wang, 2009). Thus
Drosophila olfactory behavior makes use of precise odor representations that include
anywhere from a single to a larger specified set of glomeruli, illustrating an advantage of
the “one receptor per neuron and glomerulus” organization: if each sensory neuron
expressed multiple receptors, animals might not develop or learn unique responses to
the activation of a particular receptor.
![Page 173: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/173.jpg)
163
In insects like Drosophila that use fewer than 100 receptors and glomeruli, some
patterns of innate behavior may be driven only by the action of a particular receptor
channel. In vertebrates, understanding in general the relationship between odor activity
in the olfactory bulb and resulting changes in behavior may reveal specific cases where
a single receptor is both necessary and sufficient for an instinctual response (Dewan et
al., 2013). Thus the “one receptor per neuron” logic allows single receptors to play
innate and non-redundant roles in olfaction.
This organization may also help in discriminating complex multimolecular odors,
such as the volatile signatures of natural foods or other animals. The evoked patterns of
neural activity are probably unique for any given odor blend at a particular
concentration, determined by the binding affinities of its constituents with each of
hundreds of ORs (Lin da et al., 2006). Some mammals can discern extremely fine odor
features, such as the inclusion of one enantiomer or another within an odor blend
(Uchida and Mainen, 2003); odor discrimination ability may correlate with number of
functional olfactory receptors (Niimura et al., 2014). Fine-scale odor sensing is
important for inferring the value or threat of natural stimuli, such as the chemical
characteristics of fruit odors as they change with ripening (Hayden et al., 2014;
Hodgkison et al., 2007). In an extreme case, the African Elephant, which encodes more
identified ORs than any other mammal, can discriminate the garments worn by two
Kenyan ethnic groups: through hardwiring or learning, only the scent of the group that
hunts elephants provokes a flight and hiding response (Bates et al., 2007). Although
there are other OR expression patterns through which the brain could distinguish similar
odors, an array of single-receptor channels may have been the simplest and most
![Page 174: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/174.jpg)
164
flexible way for this olfactory function to evolve and develop. As discussed in Chapter 2,
the “one receptor per neuron” organization abets the dramatic evolution of vertebrate
OR repertoires. The genetic and functional independence of different ORs may have
allowed adaptations for finer odor detection or discernment only in the regions of
chemical space most relevant to a given species (Hayden et al., 2010). It may be
possible to test this model directly using current genetic methods, for example by
demonstrating that mutant animals with fewer ORs or scrambled receptor expression
cannot discriminate natural odors as readily. Together these observations suggest that
the standard mode of mammalian olfaction has evolved because it produces precise
odor representations in the sensory periphery and the olfactory bulb. The distinct activity
patterns evoked by different odors are then available to drive unique responses.
What Does The Variant Necklace System Provide For Olfaction?
If the main and accessory olfactory systems mediate both innate and learned
behaviors with a standard OR repertoire and organization, why do mammals have a
necklace system with variant receptors and molecular logic? GC-D sensory neurons
could detect odors not sensed by the rest of the olfactory system or could, like
specialized retinal ganglion cell types in the visual system, extract distinct features of
the environment important for particular physiological responses or behaviors (Do and
Yau, 2010; Kim et al., 2008; Zhang et al., 2012).
Previous research suggests both of these roles for GC-D cells. These are the
only olfactory sensory neurons known to detect the volatile liquid carbon disulfide (CS2)
and the water-soluble peptides guanylin (G) and uroguanylin (UG) at their natural
![Page 175: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/175.jpg)
165
concentrations in rodent breath, urine, and feces, respectively (Arakawa et al., 2013;
Leinders-Zufall et al., 2007; Munger et al., 2010). Electrophysiological responses to
these ligands require the transduction channel subunit CNGA3 and GC-D itself, which is
a receptor for G and UG; binding of these peptides directly stimulates the guanylate
cyclase catalytic activity to elevate intracellular cGMP, which gates CNGA3-containing
cation channels (Leinders-Zufall et al., 2007). These properties may represent a
molecular specialization for detecting ligands that do not bind GPCR ORs, which in the
rest of the main olfactory system signal through CNGA2-containing, cAMP-regulated
transduction channels (Touhara and Vosshall, 2009). Along these lines, dissociated
GC-D cells in vitro and necklace glomerulus-innervating olfactory bulb neurons in vivo
also respond to near-atmospheric levels of carbon dioxide (Hu et al., 2007); this likely
proceeds through its intracellular conversion to bicarbonate by the highly expressed
enzyme Carbonic Anhydrase II (CAR2) (Sun et al., 2009). Bicarbonate has been shown
to directly stimulate the catalytic activity of GC-D (Guo et al., 2009). Finally, cells that
innervate Pde2a+ necklace glomeruli were previously found to respond to 2,5-
dimethylpyrazine (2,5-DMP) and a surprisingly broad range of other molecular
structures characterized as “plant volatiles;” however, these compounds had not been
generally tested for their ability to stimulate GC-D sensory neurons directly (Gao et al.,
2010; Lin et al., 2004). Because these odors were known to activate conventional
OMP+ sensory neurons, some of which may co-innervate necklace glomeruli, it
remained unclear whether GC-D cells detected a wider set of volatile organic
compounds (Cockerham et al., 2009). Overall, the chemical tuning of GC-D cells
![Page 176: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/176.jpg)
166
suggested that the necklace has a non-redundant role in sensing some stimuli but also
responds to chemicals that activate other olfactory subsystems.
Consistent with its sensory responses, the necklace appears to play perceptual
and behavioral roles distinct from the major GPCR-expressing systems. Innate
avoidance of elevated carbon dioxide concentrations has been suggested to require
GC-D cells because it is lost in CAR2-null mutant mice; CAR2 is expressed in other
non-olfactory neurons, though, so it is not certain that this phenotype results from
disrupting the necklace (Hu et al., 2007). Furthermore, trigeminal sensory fibers and
some amygdalar neurons respond to carbon dioxide and promote aversive and fear
responses, respectively (Komai and Bryant, 1993; Ziemann et al., 2009).
A better-established and more circumscribed role for the necklace is mediating a
specific form of olfactory learning, the social transmission of food preference (STFP)
(Munger et al., 2010). “Observer” mice in the presence of a “demonstrator” mouse that
has recently eaten food scented with some odor (such as cocoa or cinnamon) will, when
given a later choice, prefer food scented with the same odor. This effect, found in both
mice and rats, is thought to be an adaptation for avoiding unsafe food that would have
killed conspecifics (Galef et al., 1988). Carbon disulfide and uroguanylin at the
concentrations found in rodent breath and feces, respectively, can substitute for a
demonstrator mouse in this paradigm; but in GC-D-null mice the effect is lost (Arakawa
et al., 2013; Munger et al., 2010). Furthermore, STFP requires the activity of cholinergic
forebrain nuclei that are direct downstream targets of GC-D necklace glomeruli (Ross et
al., 2005; Tari Tan, unpublished data.) It is therefore possible that the STFP is
controlled by GC-D cell-gated cholinergic modulation, which both feeds back onto the
![Page 177: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/177.jpg)
167
olfactory bulb to reshape sensory responses and also targets central brain regions
involved in general learning (Fletcher and Wilson, 2002; Ross and Eichenbaum, 2006).
Together these data suggest that GC-D neurons convey the unconditioned stimulus in
this form of classical conditioning: necklace activation is sufficient and necessary to
form a preference for a simultaneously sensed food odor. This is distinct from forms of
odor learning that proceed through the main olfactory system and one of its major
targets, the piriform cortex. In those paradigms, the unconditioned stimuli (foot shocks,
water rewards) are not olfactory and must converge on odor representations by other
pathways (Choi et al., 2011). Thus the role of GC-D cells in altering food-odor
preference may be unique and essential within the olfactory system, explaining their
presence alongside conventional sensory neurons.
How Is MS4A Chemoreception Suited For Necklace Function?
In the context of necklace-driven behavior, what are the possible reasons that
GC-D cells express a family of non-GPCR ORs in a “many receptors, every neuron”
pattern? The use of non-GPCRs and the pattern of expressing multiple receptors per
cell may serve independent purposes. The one-per-neuron expression of non-GPCR
ORs in insects demonstrates that this organizing mode does not depend completely on
receptor protein structure (Silbering and Benton, 2010); and the coexpression of dozens
or hundreds of GPCRs in other sensory cell types, ranging from C. elegans olfactory
neurons to mammalian bitter taste cells, demonstrates that “one receptor per neuron” is
not the only useful pattern of chemoreceptor expression (Chandrashekar et al., 2000;
Sengupta et al., 1996; Troemel et al., 1995). These other chemosensory neurons
![Page 178: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/178.jpg)
168
illustrate a functional reason for expressing many receptors: because they relay signals
that trigger innate aversive responses, any ligand that signifies immediate danger will
set off the same “alarm” without having to be decoded by central neural circuits
(Bargmann et al., 1993; Mueller et al., 2005; Troemel et al., 1997). The same principle
defines another atypical olfactory subsystem, the Gruneberg Ganglion of the mouse.
These neurons at the tip of the nose detect both predator odorants and alarm
pheromones released by stressed mice to elicit innate fear behavior (Brechbuhl et al.,
2008; Brechbuhl et al., 2013). While it is not known which receptors bind these various
compounds, the Grueneberg Ganglion appears to pool several distinct, danger-related
odor signals.
The coexpression of multiple MS4A proteins may similarly integrate a variety of
stimuli in each GC-D neuron. Our data suggest that individual GC-D cells have broader
tuning than what is granted by any single MS4A in vitro, responding for example to the
MS4A6C ligands 2,3- and 2,5-DMP, the MS4A6D ligand oleic acid, and the MS4A4B
ligand alpha-linolenic acid (Greer et al., 2016). Three chemical classes in particular –
heteroaromatic compounds, steroid derivatives, and long-chain fatty acids – appear to
bind different MS4A proteins in vitro. However, the relationship between the tuning of
the MS4As and the tuning of GC-D cells remains unclear for several reasons. First, only
a limited variety of compounds were screened against a partial set of heterologously
expressed MS4As (see Chapter 3.) Broader screening may reveal some other chemical
class, such as one that combines a ring-shaped head group with a long-chain fatty acid
tail, that binds all MS4A proteins with high affinity. This scenario would still be consistent
with GC-D cells having adapted to detect a large range of ligands; however it would
![Page 179: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/179.jpg)
169
argue against multiple MS4As having evolved to integrate different chemical classes.
On the other hand, it is already clear that multiple atypical receptors function in single
necklace cells – GC-D, CAR2 (a “receptor” for carbon dioxide), and MS4A proteins –
setting these cells apart from all other mammalian olfactory neurons.
It is also unknown whether distinct MS4A proteins form functional heteromers in
vivo. Although our data imply that single MS4As form chemoreceptors in both 293 cells
and virally-infected olfactory neurons, other reports have shown that overexpressed
members of the MS4A family can interact both with the same and with other MS4A
proteins (e.g., MS4A6B with MS4A4B) (Howie et al., 2009). Moreover, while some
family members are expressed alone in chemosensory but non-olfactory tissue (MS4A5
in testes; MS4A8A in small intestine epithelium; MS4A12 in colon epithelium), others
are routinely coexpressed (all the MS4A6 and MS4A7 proteins, along with MS4A4A, in
microglia) (Eon Kuek et al., 2015; Koslowski et al., 2008; PLG and DMB, unpublished
data). Thus different proteins could interact to form a wider variety of chemoreceptors
than those made from only one MS4A. One intriguing possibility is that GC-D cells
coexpress a large subset of MS4As in order to form a diverse range of heteromeric
receptors, which could give GC-D cells broader tuning than is currently appreciated.
Additional screening for MS4A ligands in vitro and GC-D cell ligands in vivo, along with
further characterization of MS4A receptor biochemistry, will provide evidence for or
against this hypothesis.
Finally, the coexpression of multiple MS4As in each necklace cell raises the
question of how MS4A signaling interacts, biochemically and perceptually, with the
other sensory functions of GC-D cells. Specifically, does the activation of these neurons
![Page 180: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/180.jpg)
170
by MS4A ligands require or cooperate with the signaling pathways for sensing carbon
dioxide, carbon disulfide, and G/UG? Examining necklace neuron responses in the
context of GC-D and CNGA3-null mutations, compared with Ms4a deletions, may reveal
which components are needed to obtain an electrophysiological response or the large
calcium influx observed in the in vivo explant imaging assay. Is there a plausible
pathway through which MS4A-ligand binding could feed into the GC-D/cGMP/CNGA3
signaling mechanism? This is difficult to answer without a better understanding of MS4A
receptor structure and function, for example knowing whether MS4A proteins form
ligand-gated ion channels; however, the observation of MS4A-dependent, odorant-
evoked extracellular calcium entry in a 293 cell-based assay suggests that MS4A
ligands could produce a local calcium signal in GC-D cell dendrites. Minor elevations of
intracellular calcium produce large increases in purified GC-D catalytic activity, a unique
feature of this receptor guanylate cyclase (Duda and Sharma, 2008). This represents a
speculative route from MS4A-ligand binding to cGMP production and an
electrophysiological response. It is also possible that MS4A receptors activate the
necklace by a completely independent mechanism. As circumstantial evidence favoring
this model, MS4A ligands induce S6 phosphorylation in virally-infected conventional
sensory neurons that lack GC-D, and other tissues that express MS4A family members
are not known to express this particular calcium-sensitive enzyme – though they could
respond to ligand-gated calcium transients by other signaling pathways (Greer et al.,
2016).
It is harder to hypothesize about perceptual interactions between MS4A and GC-
D or CAR2 chemoreception. The MS4A ligands identified here have not been tested for
![Page 181: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/181.jpg)
171
behavioral effects in either valence assays or the STFP paradigm; however it is not
difficult to imagine long chain fatty acids, for instance, providing an unconditioned
stimulus for food preference in the same way as carbon disulfide or uroguanylin. A
future set of experiments will address this possibility and test its dependence on
necklace function, compared to other olfactory neurons capable of detecting the same
ligands through conventional receptors. These results may also suggest whether MS4A
proteins have evolved specifically to bind food- or feeding-related molecular structures.
![Page 182: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/182.jpg)
172
Conclusion
In identifying a variant mode of chemoreception, I have tried to explore the
evolutionary reasons that an atypical sensory subsystem has evolved alongside the rest
of the mammalian olfactory system. As described in Chapter 2, the partitioning of the
olfactory system into parallel pathways may have arisen in the ancestor of all
vertebrates as a way of extracting and separating distinct features of the chemical
environment. Signals passing along different pathways reach different regions of the
deeper brain, conveying different types of chemical information and regulating a variety
of innate and learned behaviors. Prior to this work, however, it was thought that all
vertebrate olfactory subsystems sensed odors through GPCR families expressed in a
characteristic “one receptor per neuron” pattern. The discovery of MS4A
chemoreceptors appearing to combine chemical signals, both across different MS4A
proteins and with the receptor guanylate cyclase GC-D, implies that an alternative
olfactory organization provided a selective advantage during the evolution of some
mammals. Finding a family of chemoreceptors that governs the tuning of GC-D cells will
aid in understanding the particular role of the necklace subsystem in the overall context
of olfaction.
The coexpression of chemoreceptors in GC-D cells is reminiscent of C. elegans
olfactory sensory neurons, several of which detect structurally distinct odorants through
multiple GPCR ORs to modulate chemotaxis (Bargmann et al., 1993; Sengupta et al.,
1996; Troemel et al., 1997). In converting a variety of chemical signals into a smaller
number of innate behavioral responses, these C. elegans cells may provide a partial
model for the function of the mammalian necklace subsystem. Previous work on the
![Page 183: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/183.jpg)
173
GC-D cells suggests that they too produce an innately relevant signal, likely one that
gives context for feeding behavior. Thus it may have been adaptive for these cells to
express a variety of chemoreceptors that could detect stimuli related to food quality, like
carbon disulfide and uroguanylin. Since this function does not require decoding the
precise identity of an odor or influencing a large set of behaviors, the “one receptor per
neuron” pattern could have been abandoned in the necklace subsystem. This model of
necklace evolution does not require that STFP is its only major function; it explains the
integration of multiple, atypical receptor signals as long as all necklace odorants play a
common role in odor perception and this role is distinct from that of the main and
accessory olfactory systems.
The use of GPCR olfactory receptors is “canonical” within vertebrate olfaction,
but not from a wider view of animal chemosensation. Known insect olfactory receptors
belong to two families of ligand-gated ion channel, one an evolutionary offshoot of the
ionotropic glutamate receptors (Croset et al., 2010; Silbering and Benton, 2010). The
mammalian receptors for salty and acidic taste are likely ion-sensitive ion channels, and
TRP channels involved in nociception and other sensory modalities are selectively
modulated by chemical compounds like capsaicin and menthol (Clapham, 2003; Huang
et al., 2006). The general pattern that emerges, then, is not of GPCRs playing an
exclusive role in chemosensation, but of particular protein structures being co-opted by
natural selection when their ligand-binding properties are useful. In animal olfaction,
where a wide range of chemical structures must be detected and interpreted, the result
of this co-opting was the expansion of ancestral genes into large and diverse
chemoreceptor gene families. This signature of expansion and diversifying selection
![Page 184: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/184.jpg)
174
provided a major clue that MS4A proteins might form chemoreceptors, as their structure
is not similar enough to any other proteins to indicate their function. Combining
molecular evolution and tissue expression patterns could be a generally useful way to
identify new types of chemoreceptor. For example, a new branch of the ionotropic
acetylcholine receptor family was recently found in the chemosensory tentacles of the
octopus, an invertebrate with an unknown receptor repertoire (Albertin et al., 2015).
These proteins have lost their acetylcholine binding residues, suggesting that they have
expanded beyond their ancestral function; if they are expressed in chemosensory
neurons and have diversified enough to bind a wide range of environmental odors, it
would suggest that they too have been co-opted as another form of olfactory receptor.
The chemical world holds innumerable signs for animals to use to their
advantage. Like other senses, mammalian olfaction employs multiple strategies to
extract this information and to enact the right response. The findings presented here
show that distinct modes of chemoreception arose in separate olfactory pathways; they
follow a general pattern in which diverse neural arrangements have evolved to detect
different features of the environment. Across species and sensory system, varied ways
to depict the world are carved within the brain.
![Page 185: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/185.jpg)
175
References Albertin, C.B., Simakov, O., Mitros, T., Wang, Z.Y., Pungor, J.R., Edsinger-Gonzales, E., Brenner, S., Ragsdale, C.W., and Rokhsar, D.S. (2015). The octopus genome and the evolution of cephalopod neural and morphological novelties. Nature 524, 220-224.
Arakawa, H., Kelliher, K.R., Zufall, F., and Munger, S.D. (2013). The receptor guanylyl cyclase type D (GC-D) ligand uroguanylin promotes the acquisition of food preferences in mice. Chem Senses 38, 391-397.
Bargmann, C.I., Hartwieg, E., and Horvitz, H.R. (1993). Odorant-selective genes and neurons mediate olfaction in C. elegans. Cell 74, 515-527.
Bates, L.A., Sayialel, K.N., Njiraini, N.W., Moss, C.J., Poole, J.H., and Byrne, R.W. (2007). Elephants classify human ethnic groups by odor and garment color. Curr Biol 17, 1938-1942.
Bell, J.S., and Wilson, R.I. (2016). Behavior Reveals Selective Summation and Max Pooling among Olfactory Processing Channels. Neuron 91, 425-438.
Braubach, O.R., Fine, A., and Croll, R.P. (2012). Distribution and functional organization of glomeruli in the olfactory bulbs of zebrafish (Danio rerio). J Comp Neurol 520, 2317-2339, Spc2311.
Brechbuhl, J., Klaey, M., and Broillet, M.C. (2008). Grueneberg ganglion cells mediate alarm pheromone detection in mice. Science 321, 1092-1095.
Brechbuhl, J., Moine, F., Klaey, M., Nenniger-Tosato, M., Hurni, N., Sporkert, F., Giroud, C., and Broillet, M.C. (2013). Mouse alarm pheromone shares structural similarity with predator scents. Proc Natl Acad Sci U S A 110, 4762-4767.
Chandrashekar, J., Mueller, K.L., Hoon, M.A., Adler, E., Feng, L., Guo, W., Zuker, C.S., and Ryba, N.J. (2000). T2Rs function as bitter taste receptors. Cell 100, 703-711.
Choi, G.B., Stettler, D.D., Kallman, B.R., Bhaskar, S.T., Fleischmann, A., and Axel, R. (2011). Driving opposing behaviors with ensembles of piriform neurons. Cell 146, 1004-1015.
Clapham, D.E. (2003). TRP channels as cellular sensors. Nature 426, 517-524.
![Page 186: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/186.jpg)
176
Clowney, E.J., LeGros, M.A., Mosley, C.P., Clowney, F.G., Markenskoff-Papadimitriou, E.C., Myllys, M., Barnea, G., Larabell, C.A., and Lomvardas, S. (2012). Nuclear aggregation of olfactory receptor genes governs their monogenic expression. Cell 151, 724-737.
Cockerham, R.E., Puche, A.C., and Munger, S.D. (2009). Heterogeneous sensory innervation and extensive intrabulbar connections of olfactory necklace glomeruli. PLoS One 4, e4657.
Croset, V., Rytz, R., Cummins, S.F., Budd, A., Brawand, D., Kaessmann, H., Gibson, T.J., and Benton, R. (2010). Ancient protostome origin of chemosensory ionotropic glutamate receptors and the evolution of insect taste and olfaction. PLoS Genet 6, e1001064.
Dalton, R.P., and Lomvardas, S. (2015). Chemosensory receptor specificity and regulation. Annu Rev Neurosci 38, 331-349.
Dalton, R.P., Lyons, D.B., and Lomvardas, S. (2013). Co-opting the unfolded protein response to elicit olfactory receptor feedback. Cell 155, 321-332.
Dekker, T., Ibba, I., Siju, K.P., Stensmyr, M.C., and Hansson, B.S. (2006). Olfactory shifts parallel superspecialism for toxic fruit in Drosophila melanogaster sibling, D. sechellia. Curr Biol 16, 101-109.
Dewan, A., Pacifico, R., Zhan, R., Rinberg, D., and Bozza, T. (2013). Non-redundant coding of aversive odours in the main olfactory pathway. Nature 497, 486-489.
Do, M.T., and Yau, K.W. (2010). Intrinsically photosensitive retinal ganglion cells. Physiol Rev 90, 1547-1581.
Duda, T., and Sharma, R.K. (2008). ONE-GC membrane guanylate cyclase, a trimodal odorant signal transducer. Biochem Biophys Res Commun 367, 440-445.
Eon Kuek, L., Leffler, M., Mackay, G.A., and Hulett, M.D. (2015). The MS4A family: counting past 1, 2 and 3. Immunol Cell Biol.
Fletcher, M.L., and Wilson, D.A. (2002). Experience modifies olfactory acuity: acetylcholine-dependent learning decreases behavioral generalization between similar odorants. J Neurosci 22, RC201.
![Page 187: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/187.jpg)
177
Galef, B.G., Jr., Mason, J.R., Preti, G., and Bean, N.J. (1988). Carbon disulfide: a semiochemical mediating socially-induced diet choice in rats. Physiol Behav 42, 119-124.
Gao, L., Hu, J., Zhong, C., and Luo, M. (2010). Integration of CO2 and odorant signals in the mouse olfactory bulb. Neuroscience 170, 881-892.
Greer, P.L., Bear, D.M., Lassance, J.M., Bloom, M.L., Tsukahara, T., Pashkovski, S.L., Masuda, F.K., Nowlan, A.C., Kirchner, R., Hoekstra, H.E., et al. (2016). A Family of non-GPCR Chemosensors Defines an Alternative Logic for Mammalian Olfaction. Cell 165, 1734-1748.
Guo, D., Zhang, J.J., and Huang, X.Y. (2009). Stimulation of guanylyl cyclase-D by bicarbonate. Biochemistry 48, 4417-4422.
Hallem, E.A., Ho, M.G., and Carlson, J.R. (2004). The molecular basis of odor coding in the Drosophila antenna. Cell 117, 965-979.
Hansson, B.S., and Stensmyr, M.C. (2011). Evolution of insect olfaction. Neuron 72, 698-711.
Hayden, S., Bekaert, M., Crider, T.A., Mariani, S., Murphy, W.J., and Teeling, E.C. (2010). Ecological adaptation determines functional mammalian olfactory subgenomes. Genome Res 20, 1-9.
Hayden, S., Bekaert, M., Goodbla, A., Murphy, W.J., Davalos, L.M., and Teeling, E.C. (2014). A cluster of olfactory receptor genes linked to frugivory in bats. Mol Biol Evol 31, 917-927.
Hodgkison, R., Ayasse, M., Kalko, E.K., Haberlein, C., Schulz, S., Mustapha, W.A., Zubaid, A., and Kunz, T.H. (2007). Chemical ecology of fruit bat foraging behavior in relation to the fruit odors of two species of paleotropical bat-dispersed figs (Ficus hispida and Ficus scortechinii). J Chem Ecol 33, 2097-2110.
Howie, D., Nolan, K.F., Daley, S., Butterfield, E., Adams, E., Garcia-Rueda, H., Thompson, C., Saunders, N.J., Cobbold, S.P., Tone, Y., et al. (2009). MS4A4B is a GITR-associated membrane adapter, expressed by regulatory T cells, which modulates T cell activation. J Immunol 183, 4197-4204.
![Page 188: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/188.jpg)
178
Hu, J., Zhong, C., Ding, C., Chi, Q., Walz, A., Mombaerts, P., Matsunami, H., and Luo, M. (2007). Detection of near-atmospheric concentrations of CO2 by an olfactory subsystem in the mouse. Science 317, 953-957.
Huang, A.L., Chen, X., Hoon, M.A., Chandrashekar, J., Guo, W., Trankner, D., Ryba, N.J., and Zuker, C.S. (2006). The cells and logic for mammalian sour taste detection. Nature 442, 934-938.
Kim, I.J., Zhang, Y., Yamagata, M., Meister, M., and Sanes, J.R. (2008). Molecular identification of a retinal cell type that responds to upward motion. Nature 452, 478-482.
Komai, M., and Bryant, B.P. (1993). Acetazolamide specifically inhibits lingual trigeminal nerve responses to carbon dioxide. Brain Res 612, 122-129.
Koslowski, M., Sahin, U., Dhaene, K., Huber, C., and Tureci, O. (2008). MS4A12 is a colon-selective store-operated calcium channel promoting malignant cell processes. Cancer Res 68, 3458-3466.
Kurtovic, A., Widmer, A., and Dickson, B.J. (2007). A single class of olfactory neurons mediates behavioural responses to a Drosophila sex pheromone. Nature 446, 542-546.
Leinders-Zufall, T., Cockerham, R.E., Michalakis, S., Biel, M., Garbers, D.L., Reed, R.R., Zufall, F., and Munger, S.D. (2007). Contribution of the receptor guanylyl cyclase GC-D to chemosensory function in the olfactory epithelium. Proc Natl Acad Sci U S A 104, 14507-14512.
Lin da, Y., Shea, S.D., and Katz, L.C. (2006). Representation of natural stimuli in the rodent main olfactory bulb. Neuron 50, 937-949.
Lin, W., Arellano, J., Slotnick, B., and Restrepo, D. (2004). Odors detected by mice deficient in cyclic nucleotide-gated channel subunit A2 stimulate the main olfactory system. J Neurosci 24, 3703-3710.
Magklara, A., Yen, A., Colquitt, B.M., Clowney, E.J., Allen, W., Markenscoff-Papadimitriou, E., Evans, Z.A., Kheradpour, P., Mountoufaris, G., Carey, C., et al. (2011). An epigenetic signature for monoallelic olfactory receptor expression. Cell 145, 555-570.
![Page 189: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/189.jpg)
179
Markenscoff-Papadimitriou, E., Allen, W.E., Colquitt, B.M., Goh, T., Murphy, K.K., Monahan, K., Mosley, C.P., Ahituv, N., and Lomvardas, S. (2014). Enhancer interaction networks as a means for singular olfactory receptor expression. Cell 159, 543-557.
Mueller, K.L., Hoon, M.A., Erlenbach, I., Chandrashekar, J., Zuker, C.S., and Ryba, N.J. (2005). The receptors and coding logic for bitter taste. Nature 434, 225-229.
Munger, S.D., Leinders-Zufall, T., McDougall, L.M., Cockerham, R.E., Schmid, A., Wandernoth, P., Wennemuth, G., Biel, M., Zufall, F., and Kelliher, K.R. (2010). An olfactory subsystem that detects carbon disulfide and mediates food-related social learning. Curr Biol 20, 1438-1444.
Niimura, Y., Matsui, A., and Touhara, K. (2014). Extreme expansion of the olfactory receptor gene repertoire in African elephants and evolutionary dynamics of orthologous gene groups in 13 placental mammals. Genome Res 24, 1485-1496.
Niimura, Y., and Nei, M. (2005). Evolutionary dynamics of olfactory receptor genes in fishes and tetrapods. Proc Natl Acad Sci U S A 102, 6039-6044.
Ray, A., van der Goes van Naters, W., and Carlson, J.R. (2008). A regulatory code for neuron-specific odor receptor expression. PLoS Biol 6, e125.
Ross, R.S., and Eichenbaum, H. (2006). Dynamics of hippocampal and cortical activation during consolidation of a nonspatial memory. J Neurosci 26, 4852-4859.
Ross, R.S., McGaughy, J., and Eichenbaum, H. (2005). Acetylcholine in the orbitofrontal cortex is necessary for the acquisition of a socially transmitted food preference. Learn Mem 12, 302-306.
Rytz, R., Croset, V., and Benton, R. (2013). Ionotropic receptors (IRs): chemosensory ionotropic glutamate receptors in Drosophila and beyond. Insect Biochem Mol Biol 43, 888-897.
Saraiva, L.R., Ahuja, G., Ivandic, I., Syed, A.S., Marioni, J.C., Korsching, S.I., and Logan, D.W. (2015). Molecular and neuronal homology between the olfactory systems of zebrafish and mouse. Sci Rep 5, 11487.
![Page 190: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/190.jpg)
180
Sato, Y., Miyasaka, N., and Yoshihara, Y. (2007). Hierarchical regulation of odorant receptor gene choice and subsequent axonal projection of olfactory sensory neurons in zebrafish. J Neurosci 27, 1606-1615.
Semmelhack, J.L., and Wang, J.W. (2009). Select Drosophila glomeruli mediate innate olfactory attraction and aversion. Nature 459, 218-223.
Sengupta, P., Chou, J.H., and Bargmann, C.I. (1996). odr-10 encodes a seven transmembrane domain olfactory receptor required for responses to the odorant diacetyl. Cell 84, 899-909.
Silbering, A.F., and Benton, R. (2010). Ionotropic and metabotropic mechanisms in chemoreception: 'chance or design'? EMBO Rep 11, 173-179.
Stensmyr, M.C., Dweck, H.K., Farhan, A., Ibba, I., Strutz, A., Mukunda, L., Linz, J., Grabe, V., Steck, K., Lavista-Llanos, S., et al. (2012). A conserved dedicated olfactory circuit for detecting harmful microbes in Drosophila. Cell 151, 1345-1357.
Sun, L., Wang, H., Hu, J., Han, J., Matsunami, H., and Luo, M. (2009). Guanylyl cyclase-D in the olfactory CO2 neurons is activated by bicarbonate. Proc Natl Acad Sci U S A 106, 2041-2046.
Touhara, K., and Vosshall, L.B. (2009). Sensing odorants and pheromones with chemosensory receptors. Annu Rev Physiol 71, 307-332.
Troemel, E.R., Chou, J.H., Dwyer, N.D., Colbert, H.A., and Bargmann, C.I. (1995). Divergent seven transmembrane receptors are candidate chemosensory receptors in C. elegans. Cell 83, 207-218.
Troemel, E.R., Kimmel, B.E., and Bargmann, C.I. (1997). Reprogramming chemotaxis responses: sensory neurons define olfactory preferences in C. elegans. Cell 91, 161-169.
Uchida, N., and Mainen, Z.F. (2003). Speed and accuracy of olfactory discrimination in the rat. Nat Neurosci 6, 1224-1229.
Vosshall, L.B., Amrein, H., Morozov, P.S., Rzhetsky, A., and Axel, R. (1999). A spatial map of olfactory receptor expression in the Drosophila antenna. Cell 96, 725-736.
![Page 191: A Variant Mode of Mammalian Olfaction](https://reader033.vdocuments.net/reader033/viewer/2022050407/627060a02260a20077557f80/html5/thumbnails/191.jpg)
181
Zhang, Y., Kim, I.J., Sanes, J.R., and Meister, M. (2012). The most numerous ganglion cell type of the mouse retina is a selective feature detector. Proc Natl Acad Sci U S A 109, E2391-2398.
Ziemann, A.E., Allen, J.E., Dahdaleh, N.S., Drebot, II, Coryell, M.W., Wunsch, A.M., Lynch, C.M., Faraci, F.M., Howard, M.A., 3rd, Welsh, M.J., et al. (2009). The amygdala is a chemosensor that detects carbon dioxide and acidosis to elicit fear behavior. Cell 139, 1012-1021.