a word from the filmmakers - imax sydney · educational standards in biology and earth sciences,...

“‘Sea Rex: Journey to a PrehistoricWorld’ is the perfect symbiosis ofentertainment and scientific content.This film is very much my childhooddreams come true: I get to see theseanimals that I've studied for yearscome to life right before my eyes.They are not just incredibly realisticbut also entirely scientificallyaccurate in terms of their morphology and respectiveactions in the film. This Educators’ Guide is an invaluabletool not only for teachers but for everyone, and is a perfect complement to the screening of the film.”

“After intense research and discussionswith various specialists, we came to therealization five years ago that there wasastonishingly little information availableon the marine reptiles that lived, in part,at the same time as the dinosaurs. That is tremendously surprising given just how fascinating these animals are withtheir size, ability for predation, longevityand perfect adaptation to the marineenvironment. We very carefully selectedthe reptiles featured in the film and chosethe dominant marine reptile groups ofthe time to represent each of the periodsof the Mesozoic era: ichthyosaurs in theTriassic, plesiosaurs in the Jurassic andmosasaurs in the Cretaceous. We hopethat educators and students alike will beentertained while also learning about theprehistoric underwater world and itsinhabitants, which most people know solittle about in comparison with their terrestrial cousins, the dinosaurs.”

Pascal Vuong & Ronan ChapalainWriters and Directors

A WORD FROM THE FILMMAKERS

This Educators’ and Activities Guide was written byDrs. Stéphane Jouve and Peggy Vincent in collaboration with Dr. Nathalie Bardet, CNRS/National Museum of Natural History.

Edited by Julien Bollée and Alexandra Body.Illustrations by Karine Sampol & Stéphane Jouve for 3D Entertainment Distribution.

Scientific Advisors:Dr. Olivier C. Rieppel, Rowe Family Curator, The Field Museum, Chicago (IL)Dr. Ryosuke Motani, Professor, University of California, Davis (CA)Dr. Zulma Gasparini, Paleontologist, La Plata Museum/CONICET, La Plata (Argentina)Dr. Benjamin Kear, Paleontologist, La Trobe University, Melbourne (Australia)

Special Thanks to:François Mantello, Pascal Vuong, Ronan Chapalain,Catherine Vuong, Dr. Elisabeth Mantello and Sylvain Grain.

Designed by malderagraphistes.Produced and Published by 3D Entertainment Distribution.

“

”

Dr. Nathalie Bardet, Main Scientific AdvisorCNRS/National Museum of Natural History

very student instinctively believes in an unchanged Earth andlife in their current forms. The extreme length of geologicaltime and the transformation of species are difficult notions

to comprehend. The film “Sea Rex: Journey to a Prehistoric World”presents the opportunity to address, in accordance with the US nationaleducational standards in Biology and Earth Sciences, the history oflife and evolution through visually-stunning and compelling images.

The “Sea Rex: Journey to a Prehistoric World” Educators’ &Activities Guide is divided into three units which explore subjectsincluded in the Life and Earth Sciences curricula: “What are MarineReptiles?”, “What is Paleontology?” and “Biological Crisis!” Eachunit begins with key information on the particular topic to help you set a context for the activities, which are designed to be easily integrated into your lessons and are applicable for all student gradesfrom elementary age through to university (1-2; 3-5; 6-8; and 9-12).

The hands-on activities proposed in the guide can be undertaken at various times in relation to your students’ viewing of the film to provide strong interactivity. The activities included in Unit I are specifically designed to be completed prior to viewing the film as apreparation and to allow students to become familiar with the knowledgedeveloped while watching the film. The 2nd and 3rd unit activities can be carried out before or following the film screening.

Additional educational resources and activities are available onlinefrom the official film website www.SeaRex-theFilm.com, including acompanion booklet, “The Cast of ‘Sea Rex: Journey to a PrehistoricWorld’”. This 40-page PDF document provides information on each ofthe marine reptile, flying reptile and dinosaur species you will encounterin the film through some of its most salient characteristics, such asthe meaning of its name, classification, the period during which itlived, geographic distribution, size, diet and other interesting details.

UNIT I “What are Marine Reptiles?” includes activities involving morphology, characteristics, and adaptations. These activities provide the basis for teaching themechanism and logic of classification. They are a great way for students to see the evolution in classification and species relationships, in this case based on marine reptiles.

UNIT II “What is Paleontology?”touches on general knowledge of fossils and evolution. It focuses primarily on the techniques used in paleontology and the relationships between fossils and geological processes.

UNIT III “Biological Crisis!”deals with the evolution of species throughout time and the occurrence of biological crises.

E

“Sea Rex: Journey to a Prehistoric World” takes students200 million years back in time to the Mesozoic era for awondrous adventure across the Triassic, Jurassic andCretaceous periods with larger-than-life underwater creatures. With their daunting size and natural abilities,marine reptiles ruled the ancient depths before dinosaursconquered the earth. In the company of a young imaginativewoman and a scientist from the past, they will explore a little-known universe and meet fascinating animals such asthe powerful Liopleurodon, the long-necked Elasmosaurus,the “eye lizard” Ophthalmosaurus and the giganticShonisaurus. Thanks to state-of-the-art 3D CG images, seescience come alive in a unique and entertaining manner.

ABOUT THE FILM[ ]

Any questions and/or comments? Please contact us at [email protected]

3

© 2010 3D Entertainment Distribution Ltd. All rights reserved

SEA REX: JOURNEY TO A PREHISTORIC WORLD

NOTE TO EDUCATORS AND TEACHERS

This publication may be reproduced by teachers and educators for classroom use.

This publication may not be reproduced for storage in a retrieval system, or transmitted in any form by any means – electronic, mechanical, recording – without the prior permission of the publisher. Reproduction of these materials for commercial resale is strictly prohibited.

A poster featuring the various species seen in the film and a geologic time scale is included in each printed copy of the Educators’ & Activities Guide. It can also be downloaded from the official film website www.SeaRex-theFilm.com

You will find a glossary detailing the scientific terms used in the Educators & Activities Guide at the end of this document, following Unit III.

IN BRIEF[ ]

SEA [a large body of salt water]

REX [Latin word meaning King]

NATIONAL SCIENCE EDUCATION STANDARDS

Activity Grade Objectives Pages

Unit I - What are Marine Reptiles?Teeth and food 1-2 Students learn to infer what animals eat from the shape of their teeth. 20/21

A postcard from the Cretaceous 3-5 Students learn that some organisms have completely disappeared and others resembled those alive today. 22/23

What a fossil! 6-8 Students learn to establish a relationship with morphological characters. 24/25

Fossils and clocks! 9-12 Students learn how molecular clocks combined with fossil records are used to date the divergence between organisms. 26/27

Unit II - What is Paleontology?What is a fossil? 1-2 Students debate and propose experiments to answer this question: what is a fossil? 38

Sedimentation and fossils 3-5 Students learn moving water erodes landforms and the sediments bury dead organisms to become fossils. 39

How can fossils help date sediments? 6-8 Students learn how fossils help to date geologic layers. 40/41

What do you know about marine reptiles? 9-12 Students answer a quiz on marine reptiles and evolution. 42/43

Unit III - What a crisis!Which animal, which environment? 1-2 Students learn that different animals inhabit different types of environments and have external features related to these. 48/49

Paleo-food chain perturbation 3-5 Students learn that living organisms depend on one another and on their environment for survival. 50/51

Crisis? Did you say crisis? Not for everybody… 6-8 Students learn that the history of life has been disrupted by major catastrophic events. 52/53

Diversity in crisis... 9-12 Students learn how to analyze fossil evidence with regard to biological diversity and mass extinction. 54/55

4



CURRICULUM

Download this educational poster for classroom use featuring "The Cast of 'Sea Rex'" and Earth's Geological Time Scale at www.SeaRex-theFilm.comOne complimentary copy inside each printed guide.

POSTER

INSIDE

UNIT I - WHAT ARE MARINE REPTILES?1.1. What are Marine Reptiles? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6

1.1.1. Are marine reptiles dinosaurs? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61.1.2. How to classify marine reptiles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

1.1.2.a. How to classify the living world . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71.1.2.b. The history and classification of marine reptiles. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81.1.2.c. Some marine sauropsids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11

1.1.3. Their morphology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171.1.3.a. Diverse morphologies, diverse swimming styles. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171.1.3.b. Teeth, skulls and diets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181.1.3.c. Nares and breath . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181.1.3.d. Reproduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

1.2. Activities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20

UNIT II - WHAT IS PALEONTOLOGY?2.1. What is Paleontology? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28

2.1.1. What is a fossil? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 282.1.1.a. How old is the Earth?. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 282.1.1.b. Time in Geology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 282.1.1.c. From burial to excavation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 292.1.1.d. Various kinds of fossils . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 302.1.1.e. Tectonic plates and faunal distribution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30

2.1.2. Paleontology and evolution history . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 312.1.2.a. Ancient discoveries and the Middle Ages. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 312.1.2.b. 17th century and the beginning of the Natural Sciences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

2.1.3. What is evolution? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 342.1.3.a. Organisms renew themselves over time . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 342.1.3.b. How are characteristics transmitted? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 342.1.3.c. Natural selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34

2.1.4. The job of a paleontologist. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 362.1.4.a. What does it entail? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 362.1.4.b. Discovery, excavation and preparation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 362.1.4.c. Study . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 372.1.4.d. Knowledge transmission and curatorial work . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 372.1.4.e. How to become a paleontologist. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37

2.2. Activities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38

UNIT III - WHAT A CRISIS!3.1. What a crisis! . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44

3.1.1. What is a biological crisis? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 443.1.2. Has this happened before? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44

3.1.2.a. End Ordovician (445 MYA) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 443.1.2.b. End Devonian (360 MYA) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 443.1.2.c. Permo-Triassic crisis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 443.1.2.d. Triassic-Jurassic crisis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45

3.1.3. The Cretaceous-Tertiary crisis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 463.1.3.a. What happened? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 463.1.3.b. Who disappeared? Who survived? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47

3.1.4. And now? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47

3.2. Activities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

Table of Illustrations & Additional Online Resources . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56

Glossary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57

5



TABLE OF CONTENTS

6


1.1.1 ARE MARINE REPTILES DINOSAURS?


nlike the Cenozoic Era, which was dominated by mammals,the Mesozoic Era was the age of reptiles (or more scientifically,of sauropsids, see below). During this period, these animals

pervaded all environments, with pterosaurs in the air, dinosaurs onland, and several groups of marine reptiles in the seas. As all of thesecreatures often reached large sizes, they are frequently all considereddinosaurs. But nothing could be farther from the truth. Dinosaurs forma biological group identified by several unique morphological charac-teristics, such as the head of a femur with a distinct neck and ball.

They are exclusively terrestrial reptiles, and none were known to inhabitmarine or aquatic environments. Even if they were mainly found in thesame period of time as the dinosaurs, animals usually named “marinereptiles” belong to various groups, and thus do not form a homogeneousgroup in classification. All these groups are more or less distant relativesof dinosaurs. Today, reptiles are particularly scarce in marine environ-ments, being mostly represented by marine turtles and snakes, as wellas by less-strictly marine animals, such as the salt water crocodile(Crocodylus porosus), the marine iguana (Amblyrhynchus cristatus),and the water monitor lizard (Varanus salvator).

[fig. 1.a] A PARAPHYLETIC GROUP

1.1 WHAT ARE MARINE REPTILES?

Mam

mals

Turtle

s

Monito

r

l

izard

s

Croco

diles

Birds

"Reptiles"

Sauropsids

Synapsids

"Mam

mal-l

ike

reptil

es"

Amniotes

a

b

c

U

The paraphyletic group Reptilia includes an ancestor (a) and some of its descendants, whereas the monophyletic groups Amniota, Sauropsida and Synapsida (grey boxes), each includes an ancestor (a, b and c) and all of its descendants.

In early classifications, groups were defined on the basisof extant animals (e.g., mammals, reptiles, birds, fishes)and their anatomy. An animal could not belong to severalgroups. Reptiles, Reptilia, were originally described ascreeping animals and included lizards, turtles, and crocodiles,but did not include birds and mammals that formed distinctgroups. Subsequently, mammal-like reptiles (a fossil group)were included in Reptilia (Reptiles, Fig. 1.a). Even thoughcrocodiles, birds, turtles, mammals and mammal-like reptilesshare a common ancestor (Fig. 1.b), mammal-like reptiles aremore closely related to mammals, while crocodiles are moreclosely related to birds than to turtles.

As such, the group Reptilia includes the common ancestorof monitor lizards, turtles, crocodiles, and mammals, but only a few of its descendants, excluding birds andmammals (dashed line, Fig.1.a). Reptilia is thus considereda paraphyletic group. To form a monophyletic group (basedon an ancestor and all of its descendants), the only kind of group recognized in the phylogenetic classification,birds and mammals should be considered reptiles. Thisdoes not correspond to the original definition of Reptilia,and therefore, this term should be abandoned.

WHY IS “REPTILE” A PHYLOGENETICALLY INCORRECT GROUP?[ ]

7


1.1.2 HOW TO CLASSIFY MARINE REPTILES


he classification of organisms is based on the relationshipsthey have amongst themselves: this is known as phylogeneticclassification. These relationships are established by the

creation of a phylogenetic tree (a tree of relationships). To constructthis tree, the morphological characteristics of the organisms are compared. For example, the presence of an aperture on the ventral sideof the skull is observed in turtles, monitor lizards, crocodiles, and primitive birds; however, it is absent in mammals and mammal-like reptiles.The presence of this aperture is a shared characteristic inherited froma common ancestor in which this trait appeared for the first time.

This characteristic thus defines a monophyletic group – a group of organisms that descended from a common ancestor – namedSauropsida (Fig 1.b.). Other shared characteristics define more inclu-sive groups such as Diapsida (presence of dorsal and lateral apertures on the skull). The result is a tree, where the species are connected by their hypothetical common ancestors. In this classification, onlymonophyletic groups are considered. As a result, the classification traces and follows the history of life and its evolution along with the history of the transformation of morphological characteristics.

HOW TO CLASSIFY MARINE REPTILES

1.1.2.a HOW TO CLASSIFY THE LIVING WORLD

The fossilization of an animal is a rare event, which evento be possible requires many conditions be met. Theresulting fossil record provides a partial picture of thehistory of life. If we compare the tree of life to an actualtree, only some of its buds, leaves, and fragments of branches that have been scattered here and there are fossilized, and only a portion of them have been discove-red by paleontologists. There is low probability of findingfossils that would allow the reconstruction of a completebranch. As for the real tree, there is low probability offinding the direct ancestor of any one species.

Also see figure [fig. 2.b] "From Life to Fossil".

Scientifically, the placement of an identified ancestor on a lineage does not make any sense: how can we provethat one particular fossil species is really the directancestor of another, and not an extinct lineage closelyrelated to this ancestor? Thus, the phylogenetic classification does not trace the relationships betweenancestors and descendants, but relative relationships: allancestors remain hypothetical. Turtles are more closelyrelated to birds than to mammals because they possess a derived feature that they inherited from a close ancestor, which mammals do not bear. A species can beconsidered a sister species in relationship to another one.

ANCESTOR? DID YOU SAY ANCESTOR?[ ]

T

Liopleurodon - Plesiosaurs

8


UNIT 1 • WHAT ARE MARINE REPTILES?


1.1.2.b THE HISTORY AND CLASSIFICATION OF MARINE REPTILES

he classification of reptiles has greatly evolved since the firstattempts to reconstruct phylogenetic relationships among vertebrates. The word reptile (Reptilia), although still widely

used in popular language, is no longer used by scientists and has beenreplaced by the term sauropsid (Sauropsida) (Fig. 1.a).

The sauropsids are divided into three main groups: the testudines, thelepidosauromorphs, and the archosauromorphs (Fig. 1.b).

The testudines include all turtles (terrestrial and marine forms), whereas the lepidosauromorphs include the ichthyosaurs, squamates(mosasaurs, snakes, lizards), and sauropterygians (placodonts, nothosaurs,plesiosaurs). Prolacertiforms and archosaurs (crocodyliforms, pterosaursand dinosaurs) form the archosauromorphs group.

Marine reptiles (or marine sauropsids), unlike dinosaurs, do notform a homogeneous group. They are comprised of distantly relatedanimals that descended from terrestrial sauropsids and became independently adapted to marine environments. They include animalssuch as sea turtles, several crocodyliform groups (the crocodyliformsinclude the extant crocodiles), mosasaurs, ichthyosaurs, and sauropterygians (nothosaurs, placodonts, and plesiosaurs).

The first marine reptile was probably Mesosaurus, a small Permiananimal nearly 1 foot long (30 centimeters) found in South Africa andBrazil. It is a particularly significant animal as its presence on twocontinents, which are presently far from each other, presents a strongargument to support the continental drift theory (see section 2.1.1).

Apart from this Permian occurrence, most marine reptiles are foundin Mesozoic strata (251-65 mya). The Triassic, the first Mesozoic period,is a key period of tetrapod evolution, as numerous major groups appearedon land, such as dinosaurs, pterosaurs, turtles, crocodyliforms, andmammals; whereas marine reptiles began to rule the seas. Placodonts,nothosaurs and ichthyosaurs (three lepidosauromorphs) are the threemain groups to diversify during the Triassic.

Placodonts, whose name means “tablet teeth” due to their flat andtough teeth, were medium-sized animals (2 m / 6.5 ft) and are considered to be close relatives of nothosaurs and plesiosaurs. Themost primitive forms resemble the marine iguana, while the more recentforms, such as Placochelys, have more superficial similarities withmarine turtles (though they are not closely related), with dorsal andventral armor formed by bony plates and semi paddle-shaped limbs.

The nothosaurs were semiaquatic forms with elongated bodies andnecks and web-footed limbs; they were closely related to plesiosaurs.Like the placodont, they did not survive the end of the Triassic. A strange middle Triassic reptile, the prolacertiform Tanystropheus,still remains a mystery to paleontologists. It had a rigid neck longerthan its body and tail together, but its limbs were not particularlyadapted to a marine environment. While its lifestyle remains obscure, it has only been found in marine sediments, suggesting a marine habitat and a fish-eating preference.

The oldest ichthyosaurs are from the Lower Triassic. They had long, slender bodies and tails, and were highly dependent on nearshoreenvironments. The Middle Triassic forms were stockier, had fin-shapedlimbs, a dorsal fin and a shorter tail with a dorsal lobe like that of a fish, indicating increased adaptation to open-sea environments. The Late Triassic is characterized by strong disturbances of the marineenvironment. A huge marine regression reduced the nearshore environments, and led to a progressive extinction of many formsdependent on this ecosystem, such as nothosaurs and placodonts.Probably due to the adaptation to the open sea of numerous forms of the group, ichthyosaurs survived these environmental changes.Ichthyosaurs dominated marine environments throughout the Triassicand Early Jurassic, but their diversity drastically decreased during the Late Jurassic, becoming scarce during the Early Cretaceous. Thecause of their extinction at the beginning of the Upper Cretaceousabout 90 mya remains a mystery.

The first known plesiosaurs are from the Latest Triassic. Togetherwith thalattosuchian crocodyliforms, they became dominant marinepredators during the Middle Jurassic. Plesiosaurs had a massive body,short tail and large paddle-shaped limbs. They were large animals,whose size ranged from 7 to 65 ft, and are divided into two groups:the plesiosauroids, with a long neck and small head, and the pliosaurs, with a short neck and long head. The pliosaur group included animals of various shapes that probably had different diets.Pliosaurs with long snouts and sharp elongated teeth were presumablyfish-eaters, while those with short, robust snouts and massive teeth,such as Liopleurodon, possibly ate other marine vertebrates.Plesiosauroids, such as Elasmosaurus, with their long, thin teeth, ate fish and cephalopods. Plesiosaurs completely disappeared during the Cretaceous-Tertiary (K/T) crisis.

T

Shonisaurus - Ichthyosaurs

9



Phylogenetic tree of the sauropsids, showing postulated phylogenetic relationships of the main groups.

Marine reptile names are in bold, their known fossil record is depicted horizontally, whereas their relative abundance through time is represented by the thickness of this line. The crosses represent the extinction of the group.

[fig. 1.b] HISTORY AND RELATIONSHIPS OF MARINE REPTILES


10




rocodyliforms form a large group that includes modern-daycrocodiles and many fossil forms with diverse morphologies.They appeared at the end of the Triassic and, while modern

species are all semiaquatic animals, they have inhabited many kindsof environments throughout their history.

At the beginning of the Jurassic, a group of marine crocodyliforms, the thalattosuchians, appeared. The first thalattosuchians were likelynearshore animals, but a fully aquatic group of thalattosuchians, themetriorhynchids, appeared during the Middle Jurassic (170-160 mya).Their morphology, with paddle-like limbs, fish-shaped tip of the tailand an absence of armor scutes, is strongly adapted to marine life.Most were likely piscivorous, but one of the last members of thisgroup, Dakosaurus (nicknamed “Godzilla”), with its strong crenulatedteeth, apparently preyed on large vertebrates.

Two groups of crocodyliforms, the dyrosaurids and crocodilians,appeared during the Late Cretaceous. Even though the dyrosauridswere much less morphologically adapted to marine environments thanmetriorhynchids, most are found in marine sediments. Some crocodilians,and in particular the forms closely related to the extant garial, are alsopresent in marine environments. Even though they were poorly repre-sented during the Late Cretaceous, dyrosaurids and crocodylians didnot seem to suffer from the K/T crisis. Rather, they benefited from the disappearance of large marine reptiles, such as plesiosaurs and mosasaurs, to disperse and diversify.

Mosasaurs form a group of marine reptiles that appeared during the Late Cretaceous (90 mya). They are closely related to the extantsnakes and varanid lizards, and possessed an anguilliform body shapewith paddle-shaped limbs. Mosasaurs and sharks were the dominantpredators of the end of the Cretaceous. Mosasaurs, including small nearshore piscivorous animals, large-sized predators such asPrognathodon, and shell-crushers such as Globidens, conquered theseas and all ecological niches. They disappeared during the K/T crisis,together with plesiosaurs, non-avian dinosaurs and pterosaurs.

Marine turtles originated, like all marine reptiles, from terrestrialforms. The oldest and most primitive turtle known is Odontochelys,from the beginning of the Late Triassic of China. It had a reduced dorsal carapace, a strong ventral plastron, and numerous teeth. WhileOdontochelys had limbs that resemble those of extant freshwater turtles,it appears to have lived in marine or deltaic environments. Other marine turtles appeared during the Late Jurassic and Early Cretaceous.Turtles are divided into two groups: the cryptodires (their neck retractsin a vertical plane) and the pleurodires (their neck retracts in ahorizontal plane). Among them, three groups adapted independentlyto marine environments during the Mesozoic.

Plesiochelyidae and Chelonioidea (the group including all living marineturtles), which are both cryptodire, adapted to marine environmentsduring the Late Jurassic and Early Cretaceous, respectively. In addition,a few species of Podocnemidoidae, a group of pleurodire, invaded theseas during the Early Cretaceous. Their shell, as those of extant marinespecies, was often lighter than that of terrestrial forms.

Chelonioidea was the only group that developed true paddle-shapedlimbs and invaded the pelagic realm. The extant leatherback turtle isrelated to this group. The largest known species is the LateCretaceous (75-65 mya) species Archelon, which reached a size of 4-4.5 m / 13-14.7 ft and weighed 2.2 tons / 4500 lbs.

Marine turtles were particularly diversified during the Late Cretaceous.Their high diversity during the Paleocene suggests that, as crocodyliforms,marine turtles were little impacted by the K/T crisis.

Dakosaurus - Crocodyliforms

C

Download the companion booklet, "The Cast of Sea Rex", at: www.SeaRex-theFilm.com. The 40-page document providesinformation on each of the marine reptile-, flying reptile- and dinosaur species you will encounter in the film and details their most salient characteristics, such as the meaning of its name, classification, the period during which it lived, geographicdistribution, size, diet and other interesting details.

11



1.1.2.c SOME MARINE SAUROPSIDS

Name meaning: “different pleural plates.”Classification: Anapsida, Testudines, Cryptodira, Cheloniidae.Age: Late Cretaceous (Maastrichtian, 71-65 MYA).Geographic distribution: Belgium, The Netherlands.Total length: more than 2.5 m / 8 ft.Weight: estimated up to 500 kg / 1100 lbs.Diet: marine plants.

Details: Allopleuron is a large turtle whose size is comparable to the leatherback turtle (2.5-2.7 m, 500-800 kg; 8-9 ft, 1100-1760 lbs). It appears frequently in sediments of the Late Cretaceous near Maastricht, The Netherlands. Some carapaces exhibit characteristic bite marks, which were likely produced by mosasaurs.

[ALLOPLEURON]


Premaxillary bones

Naris Orbit

The reconstructed skull of Allopleuronin dorsal and lateral view.

[fig. 1.d] ALLOPLEURON - SKULL

[fig. 1.c] ALLOPLEURON - SKELETON

Apertures

Pectoral girdle

The reconstructed skeleton of Allopleuron in ventral view.

12




[MOSASAURUS]

Name meaning: “the Meuse River lizard”.Classification: Squamata, Mosasauridae, Mosasaurinae.Age: Late Cretaceous (Campanian-Maastrichtian, 84-65 MYA).Geographic distribution: North America, Europe, Middle East, North Africa.Skull length: up to about 1 m / 3 ft.Total length: about 15 m / 49 ft.Diet: cephalopods, fishes, marine reptiles.

Details: Mosasaurus is the first mosasaur described and one of the largest representatives of the group. The first near complete Mosasaurus skull was found between 1770 and 1774 near Maastricht, The Netherlands. These remains were first considered to be of a crocodile. Historically, these fossils played an important role in the emergence of Paleontology and the development of the concept of extinction by the French anatomist Georges Cuvier.

The reconstructed skull of Mosasaurus in ventral, dorsal and lateral view. Note that the premaxillary bones are fused (only one premaxillary bone).

[fig. 1.f] MOSASAURUS - SKULL

Premaxillary bone

Teeth on the palate

Pineal foramen

Naris Orbit

Supratemporal fenestra

The reconstructed skeleton of Mosasaurus in lateral view.

Pectoral girdle Pelvic girdle

[fig. 1.e] MOSASAURUS - SKELETON

Premaxillary bone

13



Name meaning: “eye lizard.”Classification: Ichthyopterygia, Ophthalmosauria, Ophthalmosauridae.Age: Late Middle Jurassic-Upper Jurassic (Callovian-Tithonian, 165-145 MYA).Geographic distribution: Wyoming, USA; United Kingdom, France, Russia.Total Length: About 5 m / 16 ft. Diet: fishes, squid and mollusks.

Details: Ophthalmosaurus possessed unusually large eyes relative to their head size (10 cm / 4 in. in diameter). These enormous eyes suggest that Ophthalmosaurus was adapted for low-light environments and likely used its eyes to locate prey in the darkness of the ocean’s depths.

[OPHTHALMOSAURUS]


The reconstructed skull of Ophthalmosaurusin dorsal and lateral view.

Premaxillary bones

Naris Orbit


Pineal foramen

[fig. 1.h] OPHTHALMOSAURUS - SKULL

The reconstructed skeleton of Ophthalmosaurus in lateral view.

[fig. 1.g] OPHTHALMOSAURUS - SKELETON


14




[PLACOCHELYS]

Name meaning:“flat-plate turtle.”Classification: Sauropterygia, Placodontia, Cyamodontoidea, Placochelyidae.Age: Upper Triassic (Carnian, 229-216 MYA).Geographic distribution: Hungary.Skull length: 15 cm / 0.5 ft.Total length: 90 cm / 3 ft.Weight: unknown.Diet: shellfish.

Details: contrary to most other placodonts, Placochelys do not have teeth on the anterior part of their jaws. It probably used its sharp rostrum to probe the muddy substrate and seize invertebrate prey in shallow marine environments.

[fig. 1.j] PLACOCHELYS - SKULL

Premaxillary bones Orbit

Naris Supratemporal

fenestra

Pineal foramen

The reconstructed skull of Placochelys in dorsal and lateral view.

[fig. 1.i] PLACOCHELYS - SKELETON

The reconstructed skeleton of Placochelys in dorsal view. The pectoral and pelvic girdles cannot be seen on the figure, but they are thin and elongated bones.

15



Name meaning: “false lizard.”Classification: Sauropterygia, Eosauropterygia, Nothosauroidea, Nothosauridae.Age: Middle to Upper Triassic (Anisian-Carnian, 246–216 MYA).Geographic distribution: China, Israel, Italy, Germany, Romania, Spain, Switzerland, The Netherlands, Tunisia.Skull length: 12 to 75 cm / 5 to 30 in.Total length: up to 3 m / 10 ft. Diet: fishes.

Details: the Nothosaurus skeleton seems much more suited for locomotion in water than on land, so it probably spent most ofits time in water though terrestrial locomotion was possible.

[NOTHOSAURUS]


The reconstructed skull of Nothosaurusin dorsal and lateral view.

[fig. 1.l] NOTHOSAURUS - SKULL

Premaxillary bones Naris Orbit


Pineal foramen

The reconstructed skeleton of a nothosaurid in ventral view.

[fig. 1.k] NOTHOSAURUS - SKELETON


16




[ELASMOSAURUS]

Name meaning: “plate lizard.”Classification: Sauropterygia, Eosauropterygia, Plesiosauroidea, Elasmosauridae.Age: Upper Cretaceous (Lower Campanian, 84-80 MYA).Geographic distribution: Kansas, USA.Skull length: about 60 cm / 2 ft.Total length: up to 14m / 46 ft.Diet: soft-bodied prey: crustaceans, cephalopods and small fishes.

Details: Elasmosaurus has the longest neck of all plesiosaurs and is also the vertebrate with the highest number of cervical vertebrae with 72. However, paleontologists do not know how exactly it used its very long neck. Elasmosaurids were the last members of the plesiosaurs and disappeared during the K/T biological crisis, with dinosaurs and mosasaurs.

The reconstructed skull of an elasmosaurid in dorsal and lateral view.

[fig. 1.m] ELASMOSAURUS - SKULL

Premaxillary bones

Naris Orbit


Pineal foramen

The reconstructed skeleton of Elasmosaurus in ventral view.

Pectoral girdle

Gastralia

Pelvic girdle

[fig. 1.n] ELASMOSAURUS - SKELETON

THEIR MORPHOLOGY

17© 2010 3D Entertainment Distribution Ltd. All rights reserved


1.1.3 THEIR MORPHOLOGY

quatic adaptation of terrestrial animals requires strongmorphological and physiological modifications. Examples ofthese changes include: an increase or decrease in bone density,

transformation of the limbs and sense organs, and even a total modificationof the general body shape to facilitate movement in water.

These adaptations are generally more limited in nearshore forms, andmore prominent in open-sea forms, as can be observed today in variousmarine mammals (seals and whales). The nothosaurs had strong limbsand were capable of living both on land and in the sea, whereas themore transformed ichthyosaurs, with their fish-like tails and paddle-shaped limbs, were fully marine forms.

Many marine reptiles used their tail to swim, and several styles aredefined according to the relative stability of their body. Anguilliformswimmers undulate their entire body, while thunniform swimmersmove only the posterior part of their tail; the subcarangiform andcarangiform swimmers are intermediate styles (Fig 1.o). Mosasaurs,nothosaurs, most crocodyliforms, as well as early forms of ichthyosaurs(such as Mixosaurus) possess long, slender bodies and tails and were thus probably anguilliform or subcarangiform swimmers.

The last forms of ichthyosaurs, such as Ophthalmosaurus, with theircompact bodies and fish-shaped tails resembling living tuna, wereprobably fast swimmers. Their shape allowed for energy-efficientswimming at a steady speed, well suited to an open-sea lifestyle.

Placodonts, turtles, and plesiosaurs used their limbs to swim.Placodonts, with their incomplete paddle shaped limbs, foraged formollusks and crustaceans near the sea floor, and were not powerfulswimmers. Even though all groups of sea turtles used their limbs toswim, only the Chelonioidea had completely paddle-shaped limbs,which allowed them to live in open seas. Plesiosaurs used both theirforelimbs and hindlimbs, which were approximately the same size, to swim. Whether these hindlimbs and forelimbs moved alternately or in synchrony when swimming is still debated by paleontologists.

All marine reptiles have limbs that are more or less transformed. Likemodern dolphins, ichthyosaurs used their limbs only to maneuverwhen swimming. Ichthyosaurs’ limbs underwent dramatic changesthroughout their evolution to become truly paddle-shaped: the arm/leg,manus/pes, and the finger bones became shorter and shorter, eventuallydisk-shaped, and the number of fingers and finger bones increased. In most mosasaurs, metriorhynchid crocodyliforms and turtles, the digits are long and the bones of the manus are disk-shaped. In plesiosaurs, as the limbs are the main locomotors, the bones of themanus are flat, and the number of phalanxes in each digit is high.

As of the Cretaceous, the chelonioidean marine turtles have elongatedphalanxes in their forelimbs, their articulations having been lost andreplaced by rigid and true paddles. They swim with powerful wing-likebeats of their fore-flippers, while their rear flippers do the steering.

1.1.3.a DIVERSE MORPHOLOGIES, DIVERSE SWIMMING STYLES.

[fig. 1.o] SWIMMING STYLES

The arrows indicate the movement of the body while swimming

A

THUNNIFORM :

Only the tail fin moves

CARANGIFORM :

Undulation of the tail

SUBCARANGIFORM :

Undulation of the entire body,

head more stable

The classification of swimming styles in fishes.The four categories are based on the degree ofmovement of the body: anguilliform swimmersundulate their entire body, whereas thunniformswimmers move only the posterior part of theirbody with the anterior part remaining steady.These various categories apply to marine reptiles.

ANGUILLIFORM :

Undulation of the entire body

18




he stomach contents, predatory traces and shape of the teeth and skull of all known Mesozoic marine reptiles indicate that most were probably predators. They preyed

upon various animals such as cephalopods, belemnites, ammonites,fishes, sharks, and other marine reptiles.

Four main predator types have been defined according to four tooth morphologies: 1) the ichthyophageous have long, thin teeth; 2) large prey- and other reptile-eaters have strong, cutting teeth; 3) those with blunt teeth eat thick-shell ammonoids and clams; and 4) generalists have medium-sized sharp teeth (Fig.1.p).

During each period, each type was represented by marine reptiles. The skull shape is also related to the type of diet. Ichthyophageous formshave long, slender skulls; whereas crushers and predators of large preyhave more compact skulls that increase the pressure and resistance oftheir jaws. The skull of mosasaurs has several particularities. Mosasaurs’palates were endowed with numerous posterior curved teeth, whichmaintained the prey in the mouth. As in extant snakes, most bones intheir skull and jaw were not fused, but rather joined together withstrong ligaments, facilitating the complete ingestion of large prey.

1.1.3.b TEETH, SKULLS AND DIETS

T

[fig. 1.p] TOOTH MORPHOLOGY AND PREY PREFERENCE

Prey preference from top to bottom: soft cephalopod,belemnoid, fish, armored fish and thin-shell ammonoid,thick-shell ammonoid and clams, large fish and reptiles.

In marine environments, animals need to regulate their body’s salt balance. In extant marine sauropsids, their kidneys are not efficient enough to excrete all excess salt. In extant crocodiles, salt is excreted through the tongue (alligators cannot do this), whereas extant and fossil marine turtles have modified lachrymal glands, each being somewhat larger than the brain. In metriorhynchid crocodyliforms, the presence of salt glands anterior to the eyes has been noted. Though they necessarily existed in plesiosaurs, mosasaurs and ichthyosaurs, the location of these glands remains unknown.

OSMOREGULATION AND SALT GLANDS[ ]

Triangular diagram illustrating the range of tooth morphology corresponding to the triangular diagram of prey preference.

As in terrestrial mammals, sauropsids’ external nostril is located at thetip of the snout. In marine mammals (cetaceans), it is much more posterior,being located on the top or back of the skull, along with the blowholes.This facilitates their ability to breathe on the surface of the water.

The nostril is also located more posteriorly in several marine sauropsids:mosasaurs, plesiosaurs, and ichthyosaurs. This kind of feature is a developedcharacteristic strongly related to marine environments. It is thus not surprising to find it in distant animals: this is called convergence (a commonfeature not inherited from a common ancestor).

1.1.3.c NARES AND BREATH

THEIR MORPHOLOGY

19



The tongue is a soft organ that is not preserved in fossils, which makes reconstructing its shape in extinct forms a challenge. In extant squamates, the tongue has various morphologies, fromlarge and unforked to thin and strongly forked shapes. In modern-day squamatesthe tongue participates in chemical reception. The same was likely also thecase in mosasaurs and, as they are closelyrelated to varanids and snakes, it is assumed that they bore forked tongues,not like snakes, but more like modernHeloderma which includes the extant venomous lizards Gila monster andMexican beaded lizard.

DID MOSASAURS HAVE A FORKED TONGUE? [ ]

A mosasaur palate and a gila monster’s tongue, which is thought to have the same shape as that seen in mosasaurs.

[fig. 1.r] A MOSASAUR PALATE AND A GILA MONSTER’S TONGUE

Two holes for the

Jacobson's organ

(receptors for the odor

particles collected

by the tongue)

Gila monster

he extant marine sauropsids such as marine turtles are oviparousand thus return to land, sometimes painstakingly, to lay theireggs. It is difficult to determine whether fossil marine reptiles

were oviparous, viviparous, or ovoviviparous, since the reproductivebehavior of extinct species cannot be observed directly. Fortunately,certain findings are of help. The ichthyosaurs’ reproductive method isthe best documented of all marine reptiles. Numerous fossils of femalesof various species have been found with embryos in their bodies sotheir ovoviviparity is a certainty, at least for forms from the Middle Jurassic.

Besides, it is hard to imagine these animals, which are highly adaptedto marine environments, returning to land to lay their eggs. Severalfossils show females with a baby positioned tail first in their pelvis.

This proves that ichthyosaurs gave birth to their young tail-first, just likeextant cetaceans and sirenians (Fig.1.q), with the nostrils emerging last to reduce the possibility of drowning . A mosasaur specimen fromSlovenia which shows several embryos indicates that mosasaurs werealso ovoviviparous and gave birth to their young tail first.

Unfortunately, no pregnant plesiosaur female has ever been discoveredso their ovoviviparity can only be inferred from their body morphology.Their rigid body and weight probably did not enable them to move onland. A nothosaur specimen with embryos was found, however, whichsuggests that these close relatives of the plesiosaurs were ovoviviparous.Though this discovery strongly suggests that plesiosaurs were ovoviviparous, further discoveries are required to determine theirreproduction mode with total certainty.

1.1.3.d REPRODUCTION

Note that its young is born tail first.

[fig. 1.q] A 185-MILLION YEAR OLD FOSSIL OF AN ICHTHYOSAUR GIVING BIRTH

T

20



1.2 ACTIVITIES

TEETH AND FOOD

☛

OBJECTIVES: Students learn to deduce what animals eat from the shape of their teeth.

DURATION: 1 x 30 min. + 1 x 45 min.

MATERIAL REQUIRED: Pictures of animals/skulls from section 1.1.2.c: Mosasaurus, Ophthalmosaurus,Placochelys, Nothosaurus and Elasmosaurus; and pictures of their possible diets.

ACTIVITY: Students should associate the picture of an animal and its teeth with its diet. This activity should be done in two parts: the first prior to viewing the film, and the secondafter viewing the film. This will help students to gather more information during the film.

PREPARATION: 1/ Before viewing the film, the teacher should ask students questions about the shape of their own teeth,and their different shapes in relation to their function.

2/ The teacher distributes a copy of the identification file for each species cited above to each student.

3/ The teacher discusses with the students what each animal could eat with its type of teeth. The studentstake notes on each file, with different arguments supporting their hypothesis.

4/ After viewing the film, the teacher gives the students the picture opposite of the possible diet for eachanimal. Students correct their sheet based on what they saw in the film. The teacher discusses and posesarguments for or against the students’ corrections. The discussion may be extended to include a compari-son with extant marine animals whose photographs are provided on the film website (section:Educators/Resources/Activities/Grade1-2/Teeth and Food).

NOTE TO TEACHERS: Remind the students that these animals are found in marine environments, and cannot eat anything other than what is found in the sea. Long, thin teeth are too fragile to eat animals with strong bones (see the “Teeth, skull, and diet” section in this guide). This activity can easily be adapted forhigher-level students, who can determine the animals’ diets using the triangles of “Tooth function” and “Prey preference” presented in Fig.1.p.

21



TEETH AND FOOD

22



1.2 ACTIVITIES

A POSTCARD FROM THE CRETACEOUS

☛

OBJECTIVES: Students learn that some kinds of organisms that lived on Earth have completely disappeared, and that some of those resembled other animals that are alive today.

DURATION: 2 x 30 min.

MATERIAL REQUIRED: A copy of “A postcard from the Cretaceous” for each student.

ACTIVITY: Students try to identify groups of animals in a picture, and determine if these groups still exist today. They will individually reconsider their initial assumptions following the film screening.

PREPARATION: 1/ Before viewing the film, a copy of a “Postcard from the Cretaceous” is distributed.2/ Students try to identify the animals (their groups), and write a caption for the image. They should determine which one is still a living group.3/ After the film, the activity is corrected and discussed by the students.

NOTE TO TEACHERS:The “postcard” comes from the WesternInterior Sea that covered the center of NorthAmerica (see section 2.1.1.e). All the animalsdepicted were found in the Smoky Hill Chalk of Kansas from the Late Cretaceous (Coniacian-Campanian, 87-82 mya).

The “postcard” gives a good idea of the faunaliving in the same place at the same time. Bearin mind that all the species presented herehave disappeared, but several belong to groupswhich still exist today. Students should notethat the bird depicted has teeth.

You can find more information on this field at: www.oceansofkansas.com

North America and the Western Interior Sea during the Late Cretaceous.

23



A POSTCARD FROM THE CRETACEOUS

24



1.2 ACTIVITIES

OBJECTIVES: Students learn to establish relationships based on morphological characteristics.

DURATION: 1 x 30 min. + 1 x 45 min.

MATERIAL REQUIRED: The unidentified fossil on the following page; the identification files for the following species: Allopleuron, Ophthalmosaurus, Mosasaurus, Placochelys, Nothosaurus, Elasmosaurus; and the following table.

ACTIVITY: Students mimic the work done by paleontologists upon finding a new fossil. This activity can be done before or after activity 2.2.c.

PREPARATION: 1/ Before the film, ask students what a paleontologist should do when he finds a new fossil.2/ Distribute the image of the unidentified fossil, as well as the instructions and anatomical glossary included below.3/ Students answer question 1 below.4/ After the film, distribute a copy of the table and the identification files of the species indicated in “materials required,” above. 5/ Discuss the different morphological characteristics of the species with the students.6/ Students complete the table and answer questions 2 and 3 below.7/ The teacher discusses why shared characteristics exist.8/ Students try to develop a tree diagram below the boxes, and state the characteristics shared by the animals on the tree.

FOR STUDENTS: Instructions1/ Write and add captions to the fossil image. Describe it: the shape of its limbs, its body, etc. What animal could it be? Why?2/ After the film, complete the table, checking each feature on the list to see if it is present in the corresponding species.3/ Complete the boxes, and draw conclusions on the relationships of the new fossil. To which group did the new fossil belong? Develop the tree below the boxes, and state the characteristics shared by the animals on the tree.

Anatomical glossaryPineal foramen: a single small hole in the center of the skull, beneath the orbits. Supratemporal fenestra: two apertures on each side of the skull, posterior to the orbits.Premaxillary bone: the anterior-most bone of the skull, forming the tip of the snout. There are two premaxillary bones forming each side of the tip snout.Pectoral and pelvic girdles: the bones that join the limbs in bodies; in humans, the pectoral girdle is formed by the collarbone and the shoulder blade (scapula), while the pelvic girdle is formed by the pelvis. Gastralia: the bones in the belly area (also called “abdominal ribs”).

NOTE TO TEACHERS:Students should discuss the criteria for classification (e.g. animals behaving in the same way, living in thesame place, lacking specific elements such as invertebrates, etc.) in order to finally classify the animals in relation to what they have (morphological characteristics). The teacher should guide the conversationtoward the concept of nest-boxes (students spontaneously form independent boxes) and to discoveringwhy some characteristics are shared by different animals.

WHAT A FOSSIL!

☛

25



WHAT A FOSSIL!

��

One coronoid

Only one coronoid bone on the mandible

Nares located posteriorly, and not at the tip of the snout

Presence of a pineal foramen

Presence of supratemporal fenestrae

Supratemporal fenestra longer than the orbit

Supratemporal fenestra at least twice as long as the orbit

5 teeth on the premaxillary bone

Long neck with more than 10 cervical vertebrae

Very long anterior and posterior paddle-shaped limbs and of nearly the same length

Pectoral and pelvic girdles in form of large plates

Allople

uron

Ophtha

lmos

aurus

Mosasa

urus

New fo

ssil

Placoc

helys

Nothos

aurus

Elasm

osau

rus

1

2

3

4

5

6

7

8

9

10

1

2

3

WRITE AND ADD CAPTIONS

COMPLETE THE TABLE

COMPLETE THE BOXES

26



1.2 ACTIVITIES

OBJECTIVES: Students learn how molecular clocks, combined with evidence from fossil records, can helpdetermine how long ago various groups of organisms diverged evolutionarily from others.

DURATION: 60 min

MATERIAL REQUIRED: The tables on the following page.

ACTIVITY: Students work in groups, provide a report to their teacher, and present their work to the whole class. Each group is given an unknown fossil, which they are asked to identify andpropose a classification for along with several other species and groups, including living species.The molecular clocks are calculated by the students from DNA sequences, and they should usethese to estimate how long ago the groups diverged as a result. All the information, such as the morphological characteristics they may use to build tree relationships and anatomical comparisons, is provided in the educational section of the film website.

PREPARATION: 1/ Students work in groups.2/ Distribute the instructions (provided below) for the exercise.3/ Discuss with students what molecular clocks are, and how they can be used with fossils.4/ Students will find all the necessary information on the film website.5/ Students have at least three weeks to draft a short report on fossil classification, and to provide a tree diagram calibrated with molecular clocks.

FOSSILS AND CLOCKS!

☛

INSTRUCTIONS FOR STUDENTS:Phylogenetic analysis1/ Download images of the fossils to be studied at www.SeaRex-theFilm.com2/ Choose a fossil from the “New Fossil” list.3/ Write and add captions to the figure of the fossil.4/ Complete the Features/Species Tables. Download "The Cast ofSea Rex" at www.SeaRex-theFilm.com which provides you all necessary information to help you complete the table5/ Using this completed table, develop the phylogenetic relationships.Insert the names of the groups at the level of divergences. Which groupdoes the new fossil belong to?

Calibration1/ To calibrate a molecular clock, the rate of divergence for a periodof time for common DNA sequences should be calculated. To do this,short sequences are provided below. Count the number of differencesbetween the sequences for these pairs of species: Emydura/Lepidochelys,Varanus/Iguana, Alligator/Corvus, Varanus/Alligator, Varanus/Emydura;and reproduce them in the table. Calculate the percentage of divergencebetween each pair of species, and complete the table.

2/ The fossils allow you to know the age of divergence between severalgroups (see table). For example, the existence of fossils more closelyrelated to Varanus, 125 million years in age, suggests a divergence withIguana groups previous to this date, i.e. 130 million years ago. With these ages, calculate the ratio of the sequence divergence with theknown age for Emydura/Lepidochelys, Varanus/Iguana, and Alligator/Corvus,and complete the table. This is the calibration of that particular molecularclock (you will have obtained the rate of sequence change in both lineages; assuming that these rates of evolution are equal for both lineages, divide this rate by two to obtain the rate for one lineage). 3/ Assuming that the rate of evolution is equal in all sauropsid lineages, calculate the estimated age of divergence betweenVaranus/Alligator and Varanus/Emydura.4/ Draw the phylogenetic tree diagram you obtained in the first partcalibrated with the result of the molecular clocks on a geologic scale. 5/ Collect information on the group your new fossil belongs to, suchas its history, evolution, etc., and write the results of your work in ashort report that you will present to the class.

NOTE TO TEACHERS:Phylogenetic analysis: Note that the left and right premaxillary bonesare fused in mosasaurs (Mosasaurus) and birds (Corvus). This morphologic characteristic, which has been acquired independently in both groups, is known as convergence.

Calibration: Number of differences: 20, 18, 30, 34, 39; Sequencedivergence: 25% (20 x 100/80), 22.5%, 37.5%, 42.5%, 48.75%; Ratio: 0.17 (Sequence divergence/Age of divergence=25/150), 0.17,0.15; Age of divergence: Varanus/Alligator: 265.6 mya (42.5/0.16),Varanus/Emydura: 304.7 mya.

27



FOSSILS AND CLOCKS!

Emyd

ura

Lepido

chely

s

Mosasa

urus

Alligato

r

Allosau

rus

Corvus

New fo

ssil

Varanus

Iguan

aTe

leosau

rus

SPECIES TABLE

Number of Sequence Age of divergence Ratio differences divergence

Emydura/Lepidochelys % 150 million years

Varanus/Iguana % 130 million years

Alligator/Corvus % 252 million years

Varanus/Alligator % million years

Varanus/Emydura % million years

DNA SEQUENCE ALIGNMENTS

1 21Emydura ACTAGCAACGGATACCATAG GTATATCTAGGCTACATTGTLepidochelys ACTAACAAAGGACGCCGTAG GTACGTCTTGGCAACATTGAVaranus CATAACAAAGCACGCAGTAG GCGCGTATTGACAACCTTGAIguana CAAAACACAGCACTCAGTCG GCGGCTATTGACACTGTTGAAlligator CATCCAAAACCAAACCTAAG GCGTCCATTCAATACAATGACorvus CATAACAAGGCAAGCCGAGG GCGAAAATTCACCAAACTGA

41 61Emydura TAGCTTACCGATAGTACTGG TGACTCTAGAATGCCTAGTCLepidochelys TCGCGTCGGGATAGTACTGG TGAATATAGACTGCCTCATCVaranus TCGCGTCGGGACGACGCTGG TGAATATCTACTAAATCATCIguana TCGAGTCGGGGGGAAACCAG TGCCTATCTACTAAATCATCAlligator TAACGATTGGACGGGGCAGC TGAACCTCTGGAATACCATACorvus TAAAAACCGCCCGGGACAGC TGTTCCTCAACAATCAAATA

1 Only one coronoid bone in the mandible

2 Body enclosed in a shell

3 Presence of a shell with numerous apertures

4 Presence of supratemporal fenestrae

5 Presence of a pineal foramen

6 Fused premaxillae (one premaxilla)

7 Elongated naris reaches at least 25% of the skull length

8 Two rows of teeth on the palate

9 Presence of a mandibular fenestra

10 Presence of dorsal osteoderms

11 Posterior limbs vertically oriented

FEATURES TABLE

28


2.1.1 WHAT IS A FOSSIL?


The Earth is approximately 4.5 billion years old. Unfortunately, its agecannot be calculated directly from its rock materials, since erosion andtectonic activities have completely destroyed its earliest surface. Theoldest rocks found date from about 3.8 billion years ago: the Earth,then, must be at least as old as these rocks. To complete this information,scientists study material from other planets and meteorites, assuming thatall planets and other solid bodies present in the Solar System were formedat the same time and that their age is the same.

Scientists do not know precisely when life appeared on Earth. Theoldest known fossils are about 3.5 billion years old, but the earliestones are scarce and hardly identifiable. Complex organisms with hard parts that are more likely to be preserved only became commonduring the Cambrian Period (about 600 mya).

2.1 WHAT IS PALEONTOLOGY?

2.1.1.a HOW OLD IS THE EARTH?

eologists classify rock strata according to a “geological timescale”. The rocks found in each stratum were formed in a certaingeological period and are named accordingly. The time scale

produced by scientists divides Earth’s history into major units, withthe oldest rocks usually at the very bottom. Its history is divided intoeras: Achaean, Proterozoic, Paleozoic, Mesozoic and Cenozoic, andeach era is subdivided into periods. For example, the Mesozoic Era is divided into three periods – Triassic, Jurassic and Cretaceous – andthe start date for each period is given in “millions of years ago” (mya).Each of these periods is also divided into several smaller parts named“stages”. Two main methods are used to establish this time scale: radiometric dating and stratigraphic dating.

The radiometric method provides relatively precise absolute ages forthe rocks researched by measuring the amount of weakly radioactiveelements naturally present in igneous rocks. It is based on a comparisonbetween the observed abundance of a naturally occurring radioactiveelement and its decay, which in turn produces another element (forexample, the disintegration of Potassium40 into Argon40) in a known period of time called “half-life”. Using this method, a precise date of theformation of the element can be determined. However, this methodcan generally only be applied to igneous rocks, such as volcanic ashor lava, and cannot be applied to fossil-bearing sediments that do notcontain freshly formed volcanic material.

As most fossil-bearing sedimentary strata are devoid of any volcanicmaterial, geologists also use fossils to assign an age to sedimentaryrock. This method, known as stratigraphic dating, is based on theassumption that fossil specimens of the same species lived at thesame time. Each stratum (layer of limestone, mudstone and sandstone)includes fossils of organisms that were alive when the stratum wasformed. Finding similar fossil species on different continents makes itpossible to correlate the ages of rock strata around the world. As thismethod only gives the relative age of the rocks, determining the absoluteage of any given sedimentary rock requires locating and dating (withradiometry) intercalated volcanic ash within sedimentary strata.

2.1.1.b TIME IN GEOLOGY

G

[fig. 2.a] GEOLOGICAL TIME SCALE

MYA: Million Years Ago

29



WHAT IS A FOSSIL?

ossils are the remains of ancient living organisms buried insediments (mainly mud and sand), and preserved throughnatural processes. Fossilization is a very slow process that can

take up to several thousands of years. Organisms usually decay rapidlyafter their death, but sometimes their remains may be partially preservedin rocks as fossils. For fossilization to even be possible, numerousconditions must be met. As such, it is an exceptional event, and only low rates of dead animals are fossilized.

The main conditions required for fossilization to take place are: anabsence of scavengers and bottom current for bone dispersal, a rapidburying process and water with an anoxic bottom, which reduces thepresence of micro-organisms that destroy soft tissue and bones.

These conditions are most often encountered in aquatic environmentssuch as oceans, rivers or lakes, where water may carry large quantitiesof sediment. The remains of ancient living organisms, buried underthick layers of sediment, are transformed into stony fossils (mineralsinvade the bone or woody cell spaces, converting the remains intostone). Most of the time, only the hard parts of organisms are preserved.

However, sometimes exceptional environmental conditions may leadsoft tissue such as skin, feathers, or even internal organs like intestinesto be preserved. Millions of years later, earth movements and erosion(rain, frost and running water) can bring the fossil to the surface, where it may eventually be found by a scientist or a lucky collector.

2.1.1.c FROM BURIAL TO EXCAVATION

[fig. 2.b] FROM LIFE TO FOSSIL

DeathThe plesiosaur reaches the end of its life and dies. Its body sinks to the seafloor.

Decay and burialAfter several weeks the plesiosaur is partially decomposed.The soft body parts decay and rot very soon after death.The hard body parts, such as bones, are all that remains. The marine reptile can only become a fossil if it is rapidlycovered over by sediment.

Sediment accumulation and permineralization Over time the skeleton is gradually buried deeper by accumulatingsediment. Slowly, the weight of the sediment compacts the underlying areas, pressing the grains together, driving excess waterout, depositing minerals in the pores, and ultimately turning the softsediment to hard rock. Minerals contained within the water-saturatedsediment replace the original minerals in the skeleton through a process called permineralization.

Uplift, erosion and exposureMany millions of years pass and the rock remains buried deepwithin the bedrock. However, tectonic forces may uplift thebedrocks, raising it above sea level and exposing it to erosion.Gradually, the exposed rock is stripped away until eventuallythe top of the plesiosaur's skull is visible at the surface.

1 2

3 4

F

30


UNIT 2 • WHAT IS PALEONTOLOGY?


he most frequent fossils are mineralized body parts such asshells, teeth, calcareous or siliciferous biological constructionsand bones, but there are in fact numerous types of fossils:

• Microfossils: some micro-organisms such as foraminifers, ostracodsand calcareous algae have an external or internal skeleton. Their accumulation on the ocean floor can produce calcareous rock ofgreat thickness (such as limestone and chalk).• Shell, biological constructions: some mollusks have an internal oran external shell that can eventually be preserved. Shell fossils are someof the most frequent. Bacteria, sponges, cnidarians or other micro-organisms can create constructions and reefs that are often preserved.• Teeth: as the most mineralized part of the vertebrate body, teeth are the most frequent fossilized vertebrate remains. The cartilaginousskeleton of the chondrichtyans (sharks and skates) is less mineralizedthan the bony skeleton of osteichthyan fishes; sharks are thus oftenknown by their teeth, frequently their only preserved remains. Smallanimals with fragile bones, such as the first mammals, are also oftenonly known by their teeth.• Bones: most of the bones found are isolated remains. Contrary towhat most people believe, discoveries of complete skeletons are rare.

• Plants: they are also found as leaves, trunk portions, seeds, fossilprints, or sometimes as carbonaceous deposits. Their large accumulationis responsible for the origin of coal and hydrocarbons. • Prints: footprints provide particularly important data on the locomotionof extinct forms (bipedalism, speed, etc.).• Coprolites: these are fossilized animal dejections. In certain cases,they make it possible to study the diet of extinct animals.• Eggs: the eggshell can be preserved but if the associated embryosare not preserved, it is often difficult to attribute an egg to a particularspecies or group. When the embryo is preserved, it is particularlysignificant for our understanding of the development of extinct groups.• Organs, skin, feathers, scales, and fur: the non-mineralized partsare rarely fossilized but skin, feathers and fur prints are occasionallypreserved. The presence of a dorsal fin in ichthyosaurs, or early feathersin theropod dinosaurs, was established by well-preserved soft tissues.• Pollen: when preserved, it is an excellent indicator of the paleoclimate.• Amber: amber is fossilized tree resin. Occasionally insects andexceptionally small vertebrates are trapped in this resin and preserved as incrusted parts of the amber.

2.1.1.d VARIOUS KINDS OF FOSSILS

T

The world has not always resembled the world of today. As the continents are constantly in motion due to the action of plate tectonics,the appearance of the Earth changes very gradually. Earth's surface ismade up of a series of large plates (like pieces of a giant puzzle).These plates move steadily in slow motion, traveling a few centimetersin a year. When two plates collide, they can either form mountain ranges or one can slide beneath the other. This creates areas ofintense earthquakes. When the plates move apart, molten mantlerocks rise between them, causing the sea floor to spread outwards.

About 250 million years ago, at the beginning of the Triassic period,all continental plates were joined together and formed a supercontinent(almost all land surfaces were joined together) that is now known asPangaea. The east of Pangaea was separated by an ocean called theTethys Ocean. At the beginning of the Jurassic period, approximately200 million years ago, Pangaea started to split apart into two largeland masses: Laurasia in the north (North America, Europe, Asia) and Gondwanaland in the south (South America, Africa, India,Australia, Antarctica). The Tethys connected to the Pacific through the opening of the Central Atlantic Ocean. The South Atlantic Ocean then opened during the Cretaceous.

As the sea level was higher than it is today, the central part of NorthAmerica was covered by a large sea called the Western InteriorSeaway, which was linked to the Gulf of Mexico in the south and theHudson Bay and Beaufort Sea in the north. The constantly changinggeography of the world drove the evolution of both marine and terrestrial faunas. As marine reptiles can disperse around the worldmore easily, the same genera can be found in Europe, Africa (TethysOcean) and in South and North America (Western Interior Seaway,Pacific, Atlantic). However, terrestrial faunas have generally evolvedindependently on isolated continents, so that very different speciesand genera are found on each continent.

When examining a world map, one can imagine how today's continentsmight once have fit together to form the ancient continent of Pangaea.The faunal distribution of the past was largely controlled by the positionof the continents and oceans. As such, terrestrial and marine faunasprovided strong support for the continental drift theory. Mesosauruswas a small Permian marine sauropsid whose fossils are found in SouthAfrica and Brazil. Since this animal was too small to cross the largeSouth Atlantic Ocean, scientists deduced that Africa and South Americawere still joined together during the Permian period (320-280 mya).

2.1.1.e TECTONIC PLATES AND FAUNAL DISTRIBUTION

PALEONTOLOGY AND EVOLUTION HISTORY

31



2.1.2 PALEONTOLOGY AND EVOLUTION HISTORY

he existence of fossils has been known for a long time, but their real origins remained mysterious until the end of the 18th century.Throughout the history of biology and paleontology there were not one but several theories of evolution in competition, yet only one currently remains: the neo-Darwinian theory of evolution. T

Traces of fossils have been found in French prehistoric sites, wherethey were used as ornaments. During Antiquity, several Greek philosophers mentioned the observation of fossils. Anaximander(610-547 BC) deduced the existence of ancient seas that had been“burned” by the sun by the presence of shells in mountains. Aristotle,Theophrastus, Pythagoras and Herodotus also tentatively consideredthe presence of ancient seas based upon fossils. Pliny the Elder imagined that fossil shark teeth had fallen from the sky or the moon,and named them “glossoptera” (tongue stone). He was also the firstto name fossils “ostracites” (oyster-shaped) and “spongites” (sponge-shaped).

The Chinese scientist Shen Kuo (1031-1095) was the first to proposea hypothesis about the formation of the Earth and the seas based onhis observation of fossils. From marine fossils found in strata, he deducedthat the Earth was remodeled by the sedimentation of mud, and theerosion of mountains. He also proposed the first paleoclimatic obser-vation, with the presence of fossil bamboo in a location where the climate was not suitable to the plant’s survival, and suggested thatthe climate was different during ancient times.

In Europe, fossils are considered petrified living forms or natural artifacts(Agricola, 1494-1555; Martin Lister, 1638-1712). During the 17th

century, fossils were recognized as ancient living formswith the belief that all the forms disappeared at thesame time as the biblical deluge. Science and fossilswere recognized in relation to religion until the 18thcentury. The natural world was considered to be unchangedand ordered according to the will of the Creator.

2.1.2.a ANCIENT DISCOVERIES AND THE MIDDLE AGES

The complementarity of the geographic distribution of the small Permian marine reptile Mesosaurus in South Africa and Brazil was one of the arguments that German scientist Alfred Wegener (1880 - 1930) used to support his continental drift theory in 1912.

A fossil depicted on a Greek vase (560-540 B.C.).Note that the monster emerges from the cave and has a sclerotic eye ring.

South AmericaAfrica

[fig. 2.c] MESOSAURUS AND THE CONTINENTAL DRIFT

[fig. 2.d] ANCIENT DISCOVERIES

32




n the 16th-17th centuries, cabinets of curiosities appeared in Europe, and aristocrats, some merchants and early “scientists” created collections in the form of primitive

museums. These collections were often heteroclite, assembling fossils, animals, plants, minerals, etc.

Jean Marchant (1650?-1678)was the director of the Jardin duRoi in Paris and in 1617 suggestedthat plant species from the samegenus could have a common origin. He was likely the first toever consider “anomalies” (theword and concept of mutationwas unknown) as a possible originfor the transformation of species.

Benoist de Maillet (1656-1738)considered that the transformation of a species was caused byhereditary modifications (1748).He supposed that life was born inthe oceans, which were presenteverywhere, and that their with-drawal forced certain animals toadapt to life on land. Humans wouldtherefore have had their origin inthese animals, and thus in fishes!

The first person to really workon animal heredity was Pierre Louis Moreau de Maupertuis (1698-1759). He suggested a transformation of species based on “anoma-lies” (mutations) and individual morphological variations that appea-red randomly in nature, which could be transmitted to descendants.He stated the first hypothesis on the transformation of species in1754 as follows: “…how could the multiplication of the most dissimilarspecies have sprung from just two individuals? They would owe theirorigin to some fortuitous productions in which the elementary parts(reproductive particles) have not preserved the order they had intheir mother and father: each degree of error would have produced a new species: with the increase of divergence came the infinite animal diversity we see today; it will maybe increase with time.” Forthis author, all animals would originate from the same ancestor.

Progress also came from the study of animal development. Karl Ernstvon Bear (1792-1876) studied embryology and considered that the firstperiods of development were similar in numerous groups, yet theirmorphology diverged quickly afterwards. This demonstrated a commonorigin for the organisms. It wasn’t until 1778 that a fossil was recognizedas being from an extinct species, by the French naturalist GeorgesBuffon (1707-1788). This “first fossil” is the American mastodon,Mammut americanum, which earlier had frequently been thought tobelong to “giants”, and was described as a “lost species” by Buffon.

The study of fossils strongly modified the perception of the history oflife. Due to the succession of different fossil faunas, Georges Cuvierconsidered that the history of life was impacted by dramatic events;intense catastrophes that cause numerous species to become extinct.Between these brutal “revolutions,” new populations appear through

migrations. This theory is named“catastrophism”. The discoveryof the extinct large mosasaurconfirmed his view (see box).

Jean-Baptiste Lamarck (1744-1829)did not consider the existence ofthese “revolutions,” but suggestedthat environmental modificationscause morphological transforma-tions, which are transmitted todescendants. To explain thecontinuity between some fossilsand extant forms, he suggests atransformation of species overtime. Three main points aredeveloped in Lamarck’s theory:the inheritance of acquired traits;the function creates the organ;and life becomes more complex.In his theory, the use or non-useof an organ due to environmentalconditions causes the developmentor decline of this organ, which is transmitted to descendants.

The inheritance of acquired traits is a particularly important concept,one that endured until the end of the 19th century.

Even though previous scientists had seen the presence of an evolution of the species, none could explain its mechanisms.Charles Darwin provided an explanation with his theory of naturalselection (1859). Darwin’s arguments were developed as follows:

1/ organisms vary (within the same species, individuals vary; this isthe intra-specific variability);

2/ the variations can be transmitted to descendants, and can be selectedby humans (this is artificial selection, used by horticulturists and cattle-breeders; humans modify the composition of the species cultivated or bred);

3/ the environment creates a natural selection (more individuals thatcan survive with the available natural resources are born; individualsare thus in competition with one another for survival; within the varia-tion in species, those that for some reason have an advantage due tothe environment, leave more descendants than other variations);

4/ at the species level, natural selection produces a transformation of the species (the inheritable feature of advantaged individuals becomes dominant in the population).

2.1.2.b THE 17TH CENTURY AND THE BEGINNING OF THE NATURAL SCIENCES

I[fig. 2.e] FIRST “MUSEUMS”

Doctor Ole Worm’s (1588-1654) cabinet of curiosities in Copenhagen (Denmark).

33



In England, during the same period, Mary Anning (1799-1847) discoveredthe first complete fossil of an ichthyosaur (1810). She was twelve yearsold, and collected fossils to sell them and support her family. Her next twomajor discoveries, in 1828, were a complete plesiosaur skeleton, and thefirst pterosaur found outside of Germany. Some months before her death,she was appointed honorary member of the Geological Society of London, and thus became the first female member of this prestigious society despite the fact that only men were permitted.

MARY ANNING (1799-1847)[ ]

The next step of progression in the knowledge of evolutionarymechanisms occurred thanks to the discovery of genetics.

In 1865, the botanist Johann Gregor Mendel (1822-1884) proved theinheritability of morphological characteristics with his work on the peaplant. Later, in 1883, August Weissmann (1834-1914) definitivelyrejected Lamarck’s theory of the inheritance of acquired traits, and, in1901, Hugo de Vries (1848-1935) suggested the concept of genes,and introduced the terms gene and mutation in the theory of evolution.

A new species appears suddenly through a single mutation: this isknown as saltationism. De Vries rejected the role of natural selectionin the appearance of new species.

After 1910, advances in the genetics of populations and study of fruitflies provided a new synthesis of the “neo-Darwinian” theory of evolution:mutations happen randomly; evolution is defined as the modificationof frequency of these mutations under the effects of natural selection.

PALEONTOLOGY AND EVOLUTION HISTORY

Paleontology was really born with Georges Cuvier. He popularized comparative anatomy, a science comparing the anatomy of species, and used it to study fossils in the light of extant species to determine their classification. He used this method with the first marine reptile ever described: a mosasaur found in Maastricht (the Netherlands) and confiscated by the French revolutionary army. He compared the anatomy of its skull with extant forms, and in 1808 proved for the first time the existence of extinct giant reptiles, sixteen years before the first description of a dinosaur by William Buckland in 1824.

GEORGES CUVIER (1769-1832) [ ]

34




he study of fossil records shows that organisms renew themselvesover time: the life of a species has, on average, a one millionyear time frame. Species appear and disappear continually,

mainly through local or regional environmental, geographical andclimatic variations, or simply because of their replacement by anotherrival species. More general modifications, however, regularly disrupttheir life, causing crises of greater or lesser severity.

Through these crises, numerous species, and sometimes completegroups, disappear simultaneously and somewhat abruptly. It is oftendifficult to assess the length of a crisis; what appeared as a suddenoccurrence in a fossil record, could have taken thousands or millionsof years. These crises are followed by an explosion of diversity. Thenew groups that appear are not unrelated to those from the previousperiod, but are often marginal groups.

T

2.1.3 WHAT IS EVOLUTION?

2.1.3.a ORGANISMS RENEW THEMSELVES OVER TIME

The morphology of individuals, and thus their genetic characteristics,which are not strictly identical (i.e., variations), enables evolution tooccur. Mutations are the first driving force of evolution.

They appear randomly in the genetic material of an organism and, as they are coded in the genome, can be transmitted to descendants. These mutations can affect organisms in their anatomy, morphology, physiology, behavior, etc.

2.1.3.b HOW ARE CHARACTERISTICS TRANSMITTED?

The second driving force of evolution is natural selection. Mutationscan be beneficial, harmful or neutral for organisms. Individuals whoundergo helpful mutations survive better than others, reproducemore and gradually become the majority. How a mutation is beneficial,harmful or neutral can depend on environmental and external conditions.Most mutations are neutral, but can become helpful or harmful if theenvironmental conditions or other kinds of pressures vary.

For example, the mutation that caused DDT resistance in mosquitoes wasneutral and appeared only by chance. Individuals with this mutationwere rare, but with the general use of DDT, only individuals who underwentthis mutation survived, rapidly becoming the majority. Successive selection and addition of numerous mutations can lead to a new species.

If the environmental variation is too drastic, or if the beneficial mutationis not present in the population, the progressive selection cannotoccur, and the population (or species) disappears. Moreover, a mutationis helpful at a period of time within a particular environment, but canbe harmful later, due to a variation in this environment.

Stephen Jay Gould and Niles Eldredge developed and completed the theory with the concept of punctuated equilibrium to explain the presence of apparently stable species during long periods of time,punctuated by the sudden appearance of a new species (speciation)in their fossil record. If the stable period is interpreted as a period ofequilibrium between the species and its environment, speciationoccurs from small populations that are separated during a period oftime from their original population (by a new mountain range, forest,lake, new environment, or migration).

The small population, isolated from the original one, can evolve inde-pendently and faster, changing genetically and morphologically tobecome a new species. When it extends its territory or is again incontact with the original species, the new species may replace it. Inthe geologic timescale this replacement seems to be sudden. Ifduring the stable period the species seems unchanged, this does notmean that it did not evolve. In fossils, only bones or shells are seen,and these are dictated by only 5 percent of an animal genome; theother 95 percent can evolve without being detected in fossils.

Hazard/natural selection accompanies evolution: generation aftergeneration, selection embraces various viable solutions in relation tomorphological, functional, phylogenetical and environmental constraints.

2.1.3.c NATURAL SELECTION

WHAT IS EVOLUTION?

35



[fig. 2.f] NATURAL SELECTION

Variation within the species (intraspecific variability).For example, some mosquitos are DDT-resistant (grey mosquitos).

Differential reproduction.In this example, non DDT-resistant mosquitos are killed or surviveto reproduce less often than DDT-resistant mosquitos do.

Heredity. The surviving DDT-resistant mosquitos have DDT-resistantbaby mosquitos because this particularity has a genetic basis.

Result.The more advantageous trait, DDT resistance,which allows the mosquitos to have more offspring, becomes more common in the population. If this process continues, eventually all individuals in the population will be DDT-resistant.

THE CONCEPT OF “ADAPTATION”[ ]The concept of adaptation is often misunderstood.Organisms do not really adapt to new circumstances as if it were an active and conscious choice; in general, amutation that increases the chances of an organism’s survival of an environmental variation does not appeardue to this selective pressure. Instead, it is selected in thepopulation where this mutation was present by chance(this must be balanced, as recent research suggests thereis an increase of mutations in stressor conditions, increasingthe chances of appearance of a mutation, and thus of beneficial mutations in bacteria and cells).

All morphological traits are not necessarily adaptive. Theycan be the result of physical constraints (the selection inDarwin’s finches concerns the size of the beak but, inorder to bear a large beak, their heads and thus theirbodies must be larger; a modification in one part of thebody can induce other modifications in the body); or theresult and remains of an organism’s history (the phrenicnerve that controls the diaphragm in humans does not gothrough the vertebrae;it comes directly from the base ofthe skull. This complex passage is inherited from osteichthyanfish ancestors, where the gills are close to the skull).

1 2

3 4

DDT (dichlorodiphenyltrichloroethane) was created as the first of the modern insecticides early in World War II. Now banned in many countries, it was initially used with great effect to combat malaria, typhus, and the other insect-borne human diseases among both military and civilian populations.

36




aleontology is the study of fossilized remains (any fossils: plantsor animals) found in geological formations. Our knowledge of pastlife on our planet is the result of more than 200 years of

paleontological research. Professional paleontologists may specializein one specific field, for example in the study of fossilized plant remains(paleobotanist), micro-organisms (micropaleontologist) or animalspossessing backbones (vertebrate paleontologists, like Drs. Bardet,Gasparini, Kear, Motani and Rieppel, who are portrayed in the movie), which include dinosaurs and marine reptiles. Some use fossil records toreconstruct the biology, diversity and evolution of the fossil groups studiedand, therefore, mainly concentrate on anatomical aspects of the fossils.

Other paleontologists may focus on the age of sedimentary rocks or ancient climate conditions, and will therefore use collections of fossilized plants or animals to narrow down the age of rocks (biostratigraphy)or characterize past environmental conditions (paleoenvironments).

Most people think that paleontologists spend the majority of theirtime in the field searching for or collecting fossils. Although fossil collection is undoubtedly essential for further study, professionalpaleontologists usually spend most of their time in museums or universities studying and describing their discoveries. Additionally,paleontologists may spend a large amount of their time teaching students, as well as preserving fossils in good condition and writing pro-jects for funding, as fieldwork generally involves large teams workingover several weeks and thus requires considerable financial support.

P

2.1.4 THE JOB OF A PALEONTOLOGIST

2.1.4.a WHAT DOES IT ENTAIL?

Fossil discovery is often the result of chance and a large number of specimens kept in museum and university collections have beenfound by “lucky” amateur collectors. Paleontologists do not searchfor fossils randomly; they usually concentrate their exploration onlocalized areas. How do they choose the areas? Paleontologistssearch for fossils where sedimentary rocks are exposed and thuseasily accessible (quarries, mines, building excavations, deserts, seacliffs, etc.). They first use geological maps to locate the appropriaterocks that may contain fossils. In order to find Mesozoic marine reptiles, for instance, paleontologists focus their research on marinesedimentary rocks of the Triassic, Jurassic or Cretaceous age. Thesubsequent fieldwork entails prospecting for new locations. Fossilhunters patiently survey the sedimentary rock, inspecting fossil fragments exposed on the ground’s surface. Only after successful prospecting work will fossil hunters start digging.

Sedimentary rocks are usually very hard, and scientists have to useappropriate instruments to dig. Most of the time, hammers, chisels,punches and trowels are much more helpful than brushes. Fossil hunting requires patience and tenacity. Scientific expeditions do notoften lead to major discoveries: partial or complete skeletons are veryrarely found. Geolocalization and the precise sedimentary successionin which fossils have been found are recorded in the field and areuseful for further comparison. Once discovered, fossils need to beexcavated. This is a delicate operation, as fossils are very fragile. Most of the time, fossils are not entirely removed from the rock.

The hunter carefully digs out the rock around the fossil so that part of the sediment pod encompassing the fossil is conserved. Bones aresometimes covered by tissue or paper before being enclosed in plaster.Once the plaster has dried, the fossil-bearing block is removed formthe surrounding rock and brought to the laboratory for further preparation and cleaning by lab specialists.

Tiny fossil teeth, bones and invertebrates are easy to remove andtransport to the laboratory. Collecting and transporting large fossilssuch as large mosasaur bones require special skills. As fossil bones areconsiderably heavier than the original bones, packaging and transportusing motorized vehicles and, in some cases, aircrafts is often requiredfor larger specimens. In the laboratory, the first step is to clean thefossils and remove them from their surrounding protective plasterand rock matrix. Technicians and paleontologists then use a cleaningtool (engraver, awl, brush, etc.) or chemical solutions (acetic or formicacid) to meticulously remove the entire matrix rock from the fossil.Damaged fossils collected in several pieces are then reassembled.

Finally, fragile fossils are consolidated with diluted glue or coveredwith resin. The study of microfossils requires microscopic observation,so micropaleontologists have to crush the rock sample with a mortar, then apply some of the powder to a slide to inspect it under a microscope. In all cases, cleaning and repairing fossils takes a longtime and requires the special skills of professionals.

2.1.4.b DISCOVERY, EXCAVATION AND PREPARATION

THE JOB OF A PALEONTOLOGIST

37



ubsequent to preparation, the study of newly discovered specimensbegins. Paleontologists usually spend thousands of hours in their labstudying specimens. They examine, identify (bones are most often

broken and incomplete), measure, photograph, describe, and run multipletests on the fossils found, as well as compare them with fossils found in different paleontological collections. Methods and techniques for studyingfossils are constantly improving. As such, paleontologists have a large arrayof available techniques. Some examples include: comparative anatomy,computer modeling of locomotion and soft-tissue reconstruction. Theseinvestigations usually lead to new questions and help elaborate hypotheses about evolution or paleobiology.

The information gathered from the study of fossils is then shared with otherresearchers around the world. Scientists publish articles in scientific journalswhere they present their research. They describe all the available detailsconcerning the fossils or assemblages of fossils: age, size, anatomical `description, taphonomical aspects, etc.

These articles are read by various peers from different countries and maybecome the basis for further work. For example, scientists can potentiallyprovide data on the evolutionary relationships of organisms using the diverse subdivisions of the field of paleontology, which in turn leads to a deeper understanding of actual biodiversity.

2.1.4.c STUDY

Transmission of knowledge to the public or to students is an essentialand important part of the job, so most paleontologists also spend a greatamount of their time carrying out university or museum responsibilities.

Professional paleontologists may work in museums. They carry outtheir own research and teach and lecture on exhibits. Fossils are greatattractions in natural history museums and some, like vertebrates,require expert anatomists who know how to reconstruct and mountthem appropriately. Complete skeletons are scarcely found and fossilsare always very fragile, so nowadays most specimens in museumexhibitions are plastic casts. In this way, a life-size reconstruction ofthe entire specimen can give an impression of how it may have looked.

Fossil displays in museums are often just a fraction of the fossils themuseum owns in its collections. The majority of specimens is oftenfragmentary or not particularly spectacular, and is therefore kept instorage. Museums may create plaster molds of important discoveriesfor further exchange with other institutions, hence increasing thevariety of specimens in exhibitions.

Professional paleontologists can also be college and university professors. Most work in geology or biology departments, where they usually teach general geology courses or evolutionary biology in addition to paleontology.

2.1.4.d KNOWLEDGE TRANSMISSION AND CURATORIAL WORK

In order to become a paleontologist, undergraduate students need a strong background in sciences and must learn both biology and geology. It should be noted that young PhD graduates in paleontologyare not assured to get the job they want; interesting positions rarelybecome available. Professional paleontologists generally work formuseums or universities, and are responsible for collections, teaching,exhibitions and research. A small number of paleontologists also work for government surveys or oil companies.

2.1.4.e HOW TO BECOME A PALEONTOLOGIST

S

38



2.2 ACTIVITIES

OBJECTIVES: Students debate and propose theories and experiments to answer this question:“What is a fossil?”


MATERIAL REQUIRED: Plaster of Paris, shell, leaf or chicken bone, oil, wax.

ACTIVITY: When dealing with fossils, students wonder about their origin and formation. In the present activity they propose hypotheses and experiments to test these.

PREPARATION: 1/ Ask students “what is a fossil?”2/ Students propose several hypotheses: a print, bones transformed within a rock, bones that “sink” in the rock, etc.3/ They propose experiments to test them.

Students can work in groups, each group doing one experiment.

SEVERAL EXPERIMENTS ARE PROPOSED HERE:

Prints: 1/ With plaster of Paris in a large bowl, students dip a leaf in and take it out.2/ They can insert a shell in the plaster, and break it once it is dry: the “fossil” print is found on the plaster.The same experiment can be carried out with potter’s clay.3/ Shape wax like an animal using a stick or similar shaping tool, and then insert it in wet plaster (not toodeep). When it is dry, heat the plaster slowly to melt the wax (to represent the decomposition of the organism). You can insert a new material (e.g. potter’s clay) in the hole to represent the replacement of the organism by new minerals. Break up the plaster.

Students propose a conclusion for their experiments, and state how these allow them to explain the origin of the fossils.

WHAT IS A FOSSIL?

☛

39



SEDIMENTATION AND FOSSILS

WHAT IS A FOSSIL?

OBJECTIVES: Students learn that moving water erodes landforms, and that sediments bury dead organisms, which become fossils.


MATERIAL REQUIRED: Soil, large bowl, spray bottle, water, fish food (daphnia).

ACTIVITY: Students observe how animals are buried in sediments, and where these sediments come from.

PREPARATION: 1/ Discuss the origin of fossils and how organism remains can be found in rocks with students.2/ Discuss where the sediments come from.3/ Propose an experiment.4/ In a large bowl, create a “mountain” of potter’s clay filling the bowl halfway.5/ Pour in a small amount of water, slowly, to fill the other half.6/ Place a small shell in the water (it should not be too light).7/ Spray water on the “mountain”.8/ The erosion in the water causes sediment to cover the “dead animal”.9/ Explain that animal cadavers, particularly those of micro-organisms in calcareous rock, are another source of sediment. 10/ Sprinkle the fish food (daphnia) on the surface of the water and spray it to demonstrate its death (the daphnia should sink).11/ You can wait several days for the water to evaporate, and see the new “fossiliferous rock”.

☛

40



2.2 ACTIVITIES

OBJECTIVES: Students learn how fossils help date geologic layers.

DURATION: 40 min.

MATERIAL REQUIRED: A copy of the stratigraphic fossils, on the following page to be distributed to each student; and a copy of the specimen from Activity 1.2 “What a fossil!” (p. 25) to be dated by each student.

ACTIVITY: Students are asked to mimic the work of a paleontologist when finding an unidentified fossil; and date its stratigraphic layers using a collection of fossils from known periods.

PREPARATION: 1/ Talk with students about how a geologic layer can be dated.2/ The teacher can introduce radioactive dating, explaining how this method cannot be applied to sedimentary layers. It can only be used with volcanic and metamorphic layers intercalated with sediment. 3/ Distribute the copy of the fossil to be dated (see Activity 1.2), the stratigraphic fossils and the stratigraphic scale on the following page. 4/ The first fossil is presented as newly found, unknown before, discovered in a layer of an unknown age with several other fossils. These other fossils have already been identified and are known in other layers of known ages.5/ Ask how the other fossils can help determine the age of the new fossil.6/ Students answer the question.7/ Eventually students can try to determine which animal seen in the movie seems to be closely related to thenew fossil (based on anatomical characteristics). This part can be replaced by Activity 1.2 “What a fossil!” (p. 25)

INSTRUCTIONS FOR STUDENTS:The fossil presented here is a newly found, unknown fossil, just discovered in a layer of unknown age.Fortunately, it has been found together with other fossils. These are identified, and they are known in other layers of known ages.

Trace the stratigraphic period for each fossil on the geologic scale and use the result to figure out the age of the layer and, therefore, of the new fossil.

NOTE TO TEACHERS: This activity can be done before or after Activity 1.2 “What a fossil!” (p. 25)The unknown fossil, as well as the stratigraphic fossils, is found in the Smoky Hill Chalk (Kansas), but the stratigraphic distributions provided herein are not real; they are designed to facilitate the educational objective of the exercise.

HOW CAN FOSSILS HELP DATE SEDIMENTS?

☛

41



HOW CAN FOSSILS HELP DATE SEDIMENTS?

Clams (bivalves)

Million Years Ago

Cladoceramus undulatoplicatusLate Turonian-Early Maastrichtian

90-69 Mya

Volviceramus grandisLate Coniacian-Middle Campanian

87-76 Mya

Platyceramus platinusLate Coniacian-Early Campanian

87-82 Mya

Tusoteuthis longaLate Cenomanian -

Late Santonian95-84 Mya

Placenticeras meekiLate Turonian -Late Santonian

91-84 Mya

Heterohelix globulosaEarly Coniacian -Late Santonian

89-83 Mya

Hastigerinella watersiLate Turonian -Late Santonian

90-83 Mya

10 cm / 3.9 in 10 cm / 3.9 in

Cephalopods Microfossils

Belemnites Ammonites Foraminifera

10 cm / 3.9 in 10μm

Cenomanian Turonian Coniacian Santonian Campanian Maastrichtian

L A T E C R E T A C E O U S

100 95 90 85 80 75 70 65

STRATIGRAPHIC FOSSILS

TIME SCALE

42



2.2 ACTIVITIES

WHAT DO YOU KNOW ABOUT MARINE REPTILES?

OBJECTIVES: Students provide answers to a quiz on marine reptiles and their evolution, and correct their answers after seeing the movie.

DURATION: : 2 x 25 min

MATERIAL REQUIRED: The quiz on the following page.

ACTIVITY: This activity may be started before seeing the film to prepare the studentsand allow them to gather more information during the viewing.

PREPARATION: 1/ Distribute a copy of the quiz to each student. 2/ They complete it.3/ See “Sea Rex: Journey to a Prehistoric World”.4/ They can correct their quiz.5/ Discuss and correct the quiz with the students in the classroom.

NOTE TO TEACHERS:1/ A.True; B.False; C.False; D.False; E.False; F.True; G.False; H.False; I.False; J.False; K.False; L.True; M.True; N.True; O.False.2/ A.c; B.c; C.a; D.a; E.b; F.a.; G.b.3/ No, some, like ichthyosaurs, disappeared a long time before the impact, while others, like marine crocodiles and marine turtles, did survive the crisis.

☛

43



WHAT DO YOU KNOW ABOUT MARINE REPTILES?

1/ TRUE OR FALSE?

A. Marine reptiles can breathe in the air but not underwaterB. Plesiosaurs still exist

C. Some dinosaurs lived in the seaD. Humans and dinosaurs coexisted for some time

E. Humans appeared just after the extinction of dinosaursF. The Cenozoic is the age of mammals

G. The continents have always been in their current positionH. All marine reptiles returned to land to lay their eggs

I. The Earth’s climate has always been the same as todayJ. The Jurassic is the last period of the Mesozoic era

K. The great white shark is the largest shark to have ever existed on EarthL. North America was covered by sea water at the end of the Cretaceous

M. There are no flying dinosaursN. Some marine reptiles ate stones

O. Ichthyosaurs are closely related to dolphins

Before the film True False

After the film True False

2/ MULTIPLE CHOICE QUESTIONS

A/ Where was the first identified fossil of a marine reptile found?

a. Australiab. USAc. The Netherlands

B/ What is the nationality of the father of vertebrate paleontology Georges Cuvier?a. Americanb. Englishc. French

C/ What is the age of the Earth?a. 4.55 billion yearsb. 3.5 million yearsc. 8,000 years

D/ When did life appear on Earth?a. at least 3.5 billion years agob. 500 million years agoc. 2,000 years ago

E/ What did the first life forms look like?a. dinosaursb. bacteriac. plants

F/ Where did these first life forms live?

a. in the seab. on landc. in the air

G/ What was the first identified marine reptile?a. an ichthyosaur b. a mosasaurc. a plesiosaur

3/ WRITE AN ANSWER

Did all marine reptiles disappear after the asteroid impact approximately 65 million years ago?

44


3.1.1 WHAT IS A BIOLOGICAL CRISIS?


“biological crisis”, also known as “mass extinction”, designates a geologically short (less than one-million-year-long) event of widespreadextinction, which affects a variety of unrelated groups of animals and plants. Today, over 99 percent of species that have ever inhabited theEarth are extinct; some due to a ‘biological crisis’ but most only because of the natural course of evolution. Fossil records of life may help

paleontologists to better understand when species became extinct and which species were most vulnerable to extinction.

3.1.2 HAS THIS HAPPENED BEFORE?

3.1 WHAT A CRISIS!

A

Species renew themselves over time. They constantly appear and become extinct due to local environmental or climatic disturbances.More widespread events of species renewal are periodically observedthroughout geological time and are described as mass extinctions. Geologists and paleontologists have identified numerous events of massextinction that have affected the history of life on Earth. Though mostof these crises had limited consequences on species diversity and are,as such, considered “minor,” five of these extinction events, informallyknown as the “Big Five,” are thought to have had really dramatic effectson species diversity. These include the following events:

3.1.2.a END ORDOVICIAN (445 MYA)

At the end of the Ordovician period, marine species experienced a dramatic extinction, which in fact took place in two distinct “parts”.Most scientists believe that each of these steps was related to rapid anddistinct climate changes. This period was marked by a very importantcooling that made possible the extension of huge icecaps, which werelocated around the South Pole, to Africa.

This first climatic event produced a significant decrease in sea levelsand changes in oceanic circulation that are thought to have led to theextinction of numerous marine species. A few thousand years later,from a yet unidentified cause, the climate warmed abruptly and most of the ice melted, leading to the extinction of the majority of speciesthat had adapted to cooler conditions.

3.1.2.b END DEVONIAN (360 MYA)

The end-Devonian extinction also saw the end of numerous marinespecies. The causes of this mass extinction are yet poorly understood,but available geological evidence indicates that major climate and sea-level changes at that time triggered an extensive and rapid decrease of ocean oxygenation. As marine life depends greatly on oxygen for its survival and development, most researchers think thatthese climate-related changes in ocean ventilation were the ultimate culprits of this biological crisis.

3.1.2.c PERMO-TRIASSIC CRISIS (251 MYA)

The Permian-Triassic crisis, which took place about 250 million yearsago, represents the most dramatic extinction event of all time. Lifenearly disappeared entirely at that time, as about 95% of all speciesdied. Most scientists believe that this very important biological crisiswas triggered by the conjunction of several factors, which includedintense volcanism, changes in sea level, climate and oceanic circulation.

The most probable culprits of the crisis were huge amounts of green-house gases produced by the gigantic eruption of lava in Siberia at thattime. These gases produced dramatic global warming, which in turnmodified oceanic and atmospheric circulation on a global scale. Theseprofound modifications of Earth’s climate led to the extinction of bothmarine and terrestrial species. Marine strata of this period indicate thatthe ocean became almost completely oxygen-depleted and was thusvery inhospitable for most known forms of marine life.

3.1.2.d TRIASSIC-JURASSIC (199 MYA)

The Triassic-Jurassic boundary, some 200 million years ago, witnessedthe extinction of 76% of all species in the oceans. The extinct speciesinclude both marine and terrestrial forms of plants and animals. Themost probable cause of this crisis was the eruption of a huge magmaticprovince in North Africa/North and South America, which at the timeformed a single continent. The eruption released huge amounts ofpoisonous and greenhouse gases, which in turn deeply affected theclimate, oceanic circulation and terrestrial vegetation.

Note: Please see details of the fifth major crisis, the Cretaceous-Tertiary (K/T) crisis, on the next page.

45



HAS THIS HAPPENED BEFORE?

800

700

600

500

400

300

200

100

0 600 MYA 400 MYA 200 MYA 0

VendianCambrian

OrdovicianSilurian

DevonianCarboniferous

PermianTriassic

JurassicCretaceous

Tertiary

Number of families

The evolution of biodiversity throughout time with the number of families indicated. Five major crises can be observed.

[fig. 3.a] THE BIG FIVE


SEA REX: JOURNEY TO A PREHISTORIC WORLD46

UNIT 3 • WHAT A CRISIS?

bout 65.5 million years ago, 75% of all species disappeared,including among reptiles, non-avian dinosaurs, plesiosaursand mosasaurs. Though the ultimate causes of the crisis are

still debated, two main culprits have been identified and are believedto have contributed to the mass extinction.

Scientists have collected abundant evidence that indicates that anasteroid of about 10 kilometers in diameter struck the Earth at theend of the Cretaceous. This impact produced a 200-km-wide crater,which is now buried below hundreds of meters of sediment in theYucatan province in Mexico. The collision of the large asteroid alsoreleased vast quantities of dust that is now found at the K/T boundaryalmost everywhere on Earth. Paleontologists and geologists believethat this impact released enormous quantities of gases, dust andwater. The huge amount of dust obscured the sky and inhibited plantphotosynthesis in oceans and on continents, thus leading to the collapse of the base of the food chain. The subsequent lack of foodresources led to the extinction of large herbivorous animals.

Also, the gases produced by the impact deeply altered the climate ona global scale. These dramatic changes probably led to the extinction of many plant and animal species, and disturbed both marine and terrestrial ecosystems for several years.

The end of the Cretaceous was also marked by the eruption of agigantic magmatic province, known as the Deccan province in India,which produced a 4-km (2.5 mile) thick layer of lava. The largeamount of lava created by the eruption is now exposed in India.Scientists think that this eruption produced vast quantities of gases,which probably led to strong modifications of climatic conditions on a global scale and contributed to the extermination of many speciesof marine and terrestrial plants. As plants constitute the base of manymarine and continental food webs, the eruption could have also playeda major role in the loss of species at that time.

Studies of lava flows in India indicate that the eruption began beforeand persisted a few thousand years after the asteroid impact, thussuggesting that the asteroid may have been the finishing blow of the K/T boundary crisis. Scientists, however, do not agree on whichof the two events had more dramatic consequences on the living species of the Late Cretaceous.

A

3.1.3 THE CRETACEOUS-TERTIARY CRISIS

3.1.3.a WHAT HAPPENED?

How volcanism and meteor impact affected the climate and living organisms.

[fig. 3.b] HYPOTHESES FOR THE K/T CRISIS

THE CRETACEOUS-TERTIARY CRISIS

47



Many animals and plants disappeared both in marine and terrestrialenvironments during the K/T crisis. Among these, non-avian dinosaursare certainly the most famous group that became extinct. However,they were not the only group of large reptiles to become extinct: inthe air, there was the simultaneous extinction of pterosaurs, a groupof flying reptiles, while in the sea, plesiosaurs and mosasaurs (seen inthe movie) became extinct as well. The K/T crisis also saw the extinc-tion of many marine invertebrates, like the well-known ammonites,which reigned over Mesozoic oceans for more than 150 million years.

Food webs that were directly based on plants were particularly affectedby the crisis. Herbivorous animals are thought to have disappearedfirst when their main food resources (plants on the continent andplankton in the oceans) became limited by severe changes in environmental conditions. This, in turn, limited the food available for carnivorous animals, which disappeared shortly afterwards.

On the other hand, food webs that were based on detritus, like thosepresent in rivers and lakes, were apparently less affected by theseenvironmental changes. This could explain why some freshwater animals, like turtles and crocodiles, were apparently not severelyaffected by the crisis. Additionally, small animals, such as small mammals and lizards, probably had an advantage during the crisis,because they did not need large amounts of food to survive. In addition, the economical physiology of some larger animals, such as terrestrial crocodyliforms, allowed them to wait for the return of normal conditions for several years.

3.1.3.b WHO DISAPPEARED? WHO SURVIVED?

The sediments from the K/T boundary contain high-gradeIridium (Ir). This element is found in asteroids.

Map of the Chicxulub crater (Yucatan Peninsula, Mexico). Thecrater was created 65 mya by the impact of a giant meteorite,which is generally thought to be the main cause of the K/T crisis.

ife has undergone five major mass extinctions in the past.Many scientists consider that human activities will lead to amajor biodiversity crisis, often referred to as the “sixth extinction.”

Indeed, it is widely recognized that human activities (carbon dioxideemissions, deforestation, over exploitation of natural resources on landand in the oceans, pollution, etc.) are putting intense ecological stresson many continental and marine plant and animal species. Though the“natural” extinction rates of the past millennia are currently poorlydocumented, many studies indicate that the extinction of current speciesis occurring at an unprecedented rate. These studies have thus sug-gested that if no global conservation policy is planned and appliedsoon, life on our planet will drastically change in the very near future.

Additionally, fossil records suggest that the recovery of global ecosystems following past mass extinctions has required severalthousands and even millions of years, although it is also a major period for species radiation and an increase in biodiversity. This suggests that our presence on Earth could alter life for a very longtime, but contrary to many claims, may not completely eradicate life on Earth; instead, it will more likely threaten our own survival as natural resources will become scarcer. It should also be noted thatscientists do not know the numeric representation of our modernbiodiversity with certainty, as they consider that there are between 3 million and 30 million living species (and perhaps more).Considering this, it is very difficult to estimate to what extent currentbiodiversity is affected and how it compares to previous crises.

[fig. 3.c] IRIDIUM [fig. 3.d] CHICXULUB CRATER

3.1.4. AND NOW?

L

48



3.2 ACTIVITIES

OBJECTIVES: Students learn that different animals inhabit various kinds of environments and have externalfeatures that help them thrive in different types of places.

DURATION: 45 min.

MATERIAL REQUIRED: the animals and pictures on the following page, scissors, glue.

ACTIVITY: Students match animals from two different periods with their corresponding environment (terrestrial/aquatic). They should explain their choices. What happened between the two periods? Some groups are new, others have disappeared.

PREPARATION: 1/ Distribute a copy of the animal images found on the following pages to each student.2/ On a paper, students schematize the sea and the continent during the Late Cretaceous, and then do the same for the Paleocene.3/ Explain that their figures represent the same place during two different periods of time.4/ Students cut out each animal and glue it in the correct environment (terrestrial or marine) for each period.5/ Students present arguments for their choices.6/ Ask the students what the differences are in fauna between the two periods.7/ Discuss what may have happened between these two pictures.

NOTE TO TEACHERS: All the animals in this activity were present in North America in or near the Western Interior Seaway duringthe Late Cretaceous (Maastrichtian) and Lower Paleocene.

WHICH ANIMAL, WHICH ENVIRONMENT?

☛

49



WHICH ANIMAL, WHICH ENVIRONMENT?

NORTH AMERICAN FAUNA DURING THE LATE CRETACEOUS

NORTH AMERICAN FAUNA DURING THE PALEOCENE

Alamosaurus

Pachyrhizodus Osteopygis

Plioplatecarpus

Elasmosaurus

Thoracosaurus

Quetzalcoatlus

Tyrannosaurus

Cretolamna

Avisaurus

Didelphodon

Coryphodon

Pantolambda

Thoracosaurus

Osteopygis

Pachyrhizodus

Cretolamna Titanoides Dakotornis

50



3.2 ACTIVITIES

OBJECTIVES: Students learn that living organisms depend on one another and on their environment for survival.

DURATION: 40 min.

MATERIAL REQUIRED: A copy of the environment depicted on the following page for each student.

ACTIVITY: Students trace with arrows the relationships between the organisms featured in the image of a Late Cretaceous ocean. They mark the animals that disappeared at the end ofthe Cretaceous and, guided by their teacher, propose a hypothesis of what happened andhowthe meteorite impact affected this food chain, as well as which part was directly affected.

PREPARATION: 1/ Distribute the figure to each student.2/ They trace the relationships between the organisms shown in the figure (who eats what).3/ They note which groups disappeared at the end of the Cretaceous.4/ They propose a hypothesis on what could have happened. 5/ Explain the meteorite theory, and ask how it could have perturbed the food chain.

NOTE TO TEACHERS: The darkness created by the fall of the meteorite caused great damage to the phytoplankton (prevented photosynthesis) and thus affected the entire food chain that depended on them.

PALEO-FOOD CHAIN PERTURBATION

☛

51



PALEO-FOOD CHAIN PERTURBATION

SUN

ENERGY

PHYTOPLANKTON

ZOOPLANKTON

PHYTOPLANKTON:

CO2+ENERGY

=

PHOTOSYNTHESIS

THE MARINE ENVIRONMENT DURING THE LATE CRETACEOUS

52



3.2 ACTIVITIES

OBJECTIVES: Students learn that the history of life has been disrupted by major catastrophic events.

DURATION: 45 min.

MATERIAL REQUIRED: the figure and graph on the following page and the figure from Activity 3.2“Paleo-food Chain Perturbation” (page 51).

ACTIVITY: Students analyze two food chain diagrams: one in marine environments and the other in freshwater. They compare the evolution of diversity in these environmentsduring the crisis. They propose a hypothesis on how the crisis impacted these two environments in different ways.

PREPARATION: 1/ Introduce the cause of the K/T crisis to students.2/ Distribute the figure on the following page and the figure from Activity 3.2 “Paleo-food Chain Perturbation” (page 51).3/ Students reconstruct the food chain for both environments.4/ They discuss the differences between the two food chains. 5/ Distribute the graph on the evolution of fish diversity in marine and freshwater environments. 6/ Students answer questions 4 and 5 below.

INSTRUCTIONS FOR STUDENTS:1/ Using arrows, reconstruct the food chain for both environments presented here.2/ What are the differences between the two food chains? 3/ Look at the “Evolution of fish diversity in marine and freshwater environments” graph.4/ What are the differences in the evolution of diversity in marine and freshwater environments?5/ Propose a hypothesis for why the impact of the crisis is different in each case.

NOTE TO TEACHERS:The darkness created by the fall of the meteorite caused great damage to the phytoplankton (prevented photosynthesis), and thus affected the entire food chain that depended on them. In freshwater environments, the base of the food chain was not phytoplankton, but detritus, which did not require direct light, so they were weakly affected by a brief decrease in light.

CRISIS? DID YOU SAY CRISIS? NOT FOR EVERYBODY…

☛

53



CRISIS? DID YOU SAY CRISIS? NOT FOR EVERYBODY…

Detritus(organic debris)

Aquaticplants

Campanian Maastrichtian Danian

CRETACEOUS PALEOCENE

35

30

25

20

15

10

5

0

Marine fishes

Freshwater fishes

THE FRESHWATER ENVIRONMENT DURING THE LATE CRETACEOUS

EVOLUTION OF FISH DIVERSITY IN MARINE AND FRESHWATER ENVIRONMENTS

Num

ber

of fa

mili

es

SUN

ENERGY

Decomposers(e.g. bacteria)

54



3.2 ACTIVITIES

OBJECTIVES: Students learn how to analyze fossil evidence in relation to biological diversity and mass extinction.

DURATION: 45 min.

MATERIAL REQUIRED: The tables on the following page, graph paper.

ACTIVITY: Using an information table, students trace the evolution of diversity for several marine groups during the Mesozoic and the beginning of the Paleocene. They should analyzethe graph and propose a hypothesis on what happened at the end of the Cretaceous, based on what they saw in the film.

PREPARATION: 1/ Distribute the first table on the following page to each student.2/ They answer questions 1, 2 and 3 below. 3/ Distribute the second table.4/ They then answer questions 4 and 5.

INSTRUCTIONS FOR STUDENTS:1/Trace the evolution of the diversity from the Late Cretaceous to the Early Eocene on three graphs:a/aquatic groups, b/terrestrial and aerial groups, c/evolution of the entire diversity. 2/Analyze the graphs: which groups disappear?; which ones survive the K/T crisis?3/What happened with the dinosaurs at the end of the Cretaceous?4/Using the second table, trace the evolution of the diversity for non-avian dinosaurs and for birds in the“terrestrial groups” graph.5/Compare what happened with dinosaurs and mammals.

NOTE TO TEACHERS: As birds belong to Dinosauria, they are included as “dinosaurs” in the first table. This is why they do not disappear at the end of the Cretaceous in the first table.

DIVERSITY IN CRISIS...

☛

55



DIVERSITY IN CRISIS...

Mammals Crocodyliforms Dinosaurs Pterosaurs Sharks Marine turtles Mosasauroids Plesiosauria Ichthyosauria

Cenomanian 2 4 19 5 20 4 3 2 1

Turonian 2 3 19 5 13 4 3 2 1

Coniacian 2 4 24 5 10 5 3 2 0

Santonian 5 4 23 5 16 5 1 2 0

Campanian 17 8 27 3 25 6 1 2 0

Maastrichtian 15 8 33 2 28 5 1 2 0

Danian 32 7 4 0 27 4 0 0 0

Tanetian 68 7 6 0 30 4 0 0 0

Ypresian 78 6 22 0 32 4 0 0 0

Non-Avian Dinosaurs Birds

Cenomanian 18 1

Turonian 17 2

Coniacian 19 5

Santonian 20 3

Campanian 24 3

Maastrichtian 25 8

Danian 0 4

Tanetian 0 6

Ypresian 0 22

TABLE 1: NUMBER OF FAMILIES DURING THE LATE CRETACOUS AND EARLY PALEOCENE

TABLE 2

56



TABLE OF ILLUSTRATIONS

ADDITIONAL ONLINE RESOURCES

[fig. 1.a] A Paraphyletic Group . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 6[fig. 1.b] History and Relationships of Marine Reptiles . . . . . . . . . . . . . . . . . . . . p 9[fig. 1.c] Allopleuron - Skeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 11[fig. 1.d] Allopleuron - Skull . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 11[fig. 1.e] Mosasaurus - Skeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 12[fig. 1.f] Mosasaurus - Skull . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 12[fig. 1.g] Ophthalmosaurus - Skeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 13[fig. 1.h] Ophthalmosaurus - Skull . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 13[fig. 1.i] Placochelys - Skeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 14[fig. 1.j] Placochelys - Skull . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 14[fig. 1.k] Nothosaurus - Skeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 15[fig. 1.l] Nothosaurus - Skull . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 15[fig. 1.m] Elasmosaurus - Skull . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 16[fig. 1.n] Elasmosaurus - Skeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 16[fig. 1.o] Swimming Styles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 17[fig. 1.p] Tooth Morphology and Prey Preference . . . . . . . . . . . . . . . . . . . . . . . . . p 18[fig. 1.q] A 185-Million-Year-Old Fossil of an Ichthyosaur Giving Birth . . . . . . . p 19[fig. 1.r] A Mosasaur Palate and a Gila Monster’s Tongue . . . . . . . . . . . . . . . . . . p 19[fig. 2.a] Geological Time Scale . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 28[fig. 2.b] From Life to Fossil . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 29[fig. 2.c] Mesosaurus and the Continental Drift . . . . . . . . . . . . . . . . . . . . . . . . . . p 31[fig. 2.d] Ancient Discoveries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 31[fig. 2.e] First “Museums” . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 32[fig. 2.f] Natural Selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 35[fig. 3.a] The Big Five . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 45[fig. 3.b] Hypotheses for the K/T Crisis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 46[fig. 3.c] Iridium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 47[fig. 3.d] Chicxulub Crater . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . p 47

http//www.SeaRex-theFilm.com

For more information about marine reptiles:http://www.ucmp.berkeley.edu/people/motani/ichthyo/http://www.plesiosaur.com/http://www.plesiosauria.com/index.htmlhttp://www.oceansofkansas.com/contents.htmlhttp://research.amnh.org/~esg/https://www.dmr.nd.gov/ndfossil/research/articles/cooperstown/cooperstown_pierre_shale.html

For more information about Paleontology:http://www.paleoportal.org/index.phphttp://www.palaeos.com/Mesozoic/Mesozoic2.html#Marine_Reptileshttp://www.tyrrellmuseum.com/http://www.nhm.org/site/

For more information about marine reptile anatomy:http://courses.washington.edu/chordate/453photos/teeth_photos/specialized_teeth.htmhttp://evolution.berkeley.edu/

GLOSSARY

Biological crisis: A geologically short (lessthan one million year-long) event of widespreadextinction which affects a variety of unrelated groups of animals and plants.

Bipedal: Walks on two hind limbs only.

Cabinet of Curiosities: In the 16th-17thcenturies, these were collections of manykinds of natural objects (fossils, animals,plants, etc.) and are primitive types of natural history museums.

Catastrophism: A 19th century theory suggesting that successive cataclysms caused the extinctions seen in the geological record.

Cenozoic Era: The youngest of the threeeras of the Phanerozoic Eon, extending from the end of the Mesozoic Era (65 mya)to the present, and is characterized by the rule of mammals.

Classification: The process of arrangingthings or organisms into related groups.

Comparative anatomy: The comparativestudy of organism structures that makes it possible to determine their classificationand history.

Convergence: A similar morphological characteristic, and often a superficial resemblance, acquired independently by two or several species or groups which isnot inherited from a common ancestor, suchas the wing in birds and bats or paddle-shaped limbs in turtles, plesiosaurs,mosasaurs and ichthyosaurs. These oftenresult from similar environmental conditions.

Derived feature: A feature is derived in a group comparatively to its condition in the ancestors of the group. The presenceof a fish-shaped tail in ichthyosaurs is a derived condition compared to the sharp tail of the ichthyosaurs’ ancestors. Shared derived features are inherited from a common ancestor and are used to infer evolutionary relationships.

Dinosaurs: A Mesozoic group of terrestrialarchosauromorphs with an erect stance.They also include the ancestors of modernbirds, as well as birds themselves in modernclassifications.

Era: A subdivision of geological time including several periods.

Extinction: The process by which living species die out of existence. The extinctionof a species occurs when the last individual of the species dies.

Fossil: The preserved remains, impressionor trace of an organism that once livedduring geological time and was preserved in sediments or rock.

Gastralia: Bones in the belly area (also called “abdominal ribs”).

Gastroliths: Stones that are swallowed tohelp grind up food in the stomach.

Genus: In classification, a group of two or several species sharing common characteristics.

Gondwana: A large landmass made up of what is today South America, Africa,India, Australia and Antarctica before their separation.

K/T crisis: A strong biological crisis thatmarks the limit between the Cretaceous and the Paleocene periods. Cretaceous isabbreviated as K (derived from the Germanname “Kreidezeit”) and Tertiary as T (Tertiaryis the historical name used for what is nowcalled the Paleocene and Neogene periods).

Lamarckism: A theory developed by Jean-Baptiste Lamarck during the 19th centurythat proposes that the anatomical features of an organism are produced by its effort to respond to the physical environment.This theory can be summarized in threemain points: the inheritance of acquiredcharacteristics; the function creates theorgan; and life becomes more complex.

Laurasia: A large landmass made up of what is today North America, Europe andAsia before their separation.

Mammal-like reptiles: Fossil animals thatlook like reptiles but are more closely related to mammals. Mammals originatedfrom these mammal-like reptiles.

Marine reptiles: A heterogeneous group of marine animals that originated from distantly related terrestrial sauropsids which became independently adapted to marine environments.

Mesozoic era: The period of time between65.5-251 mya. The Mesozoic era includesthe Triassic, Jurassic, and Cretaceous per-iods and was ruled by reptiles such as dino-saurs and marine reptiles.

Monophyletic group: A group of organismsformed by one ancestor and all its descendants.

Mutation: Any change in the sequence ofnucleotides of a gene.

Mya: Acronym for “million years ago.”

Natural selection: Mechanism of evolutionproposed by Charles Darwin: 1/ natural variations occur among individuals of the same species; 2/ these variations can be transmitted to their descendants; 3/ limited resources in natural environmentslimit the number of individuals that can survive, leading to severe competition; 4/ some of the natural variations mayimprove the chances of survival of a particular individual; 5/ over successive generations, these variations produce a transformation of thespecies thanks to this natural selection.

Neo-Darwinian theory of evolution: A theory completing and improving thetheory proposed by Charles Darwin. Themain difference with Darwin’s ideas is theincorporation of genetic mechanisms toexplain variations among species and their transfer to descendants.

Osteoderms: Bony plates in ventral or dorsal skin.

Oviparous: An animal which lays eggs.

Ovoviviparous: An animal in which the eggshatch inside the female genital tract so thatthe young exit the mother’s body alreadyalive, like mammals.

Paddle-shaped limbs: Limbs in the shape of a large and flat fin that roughly resemble a paddle. In this case, digits cannot moveindependently.

Paleontology: The study of ancient lifethrough fossils.

Pangaea: A large continental landmass(supercontinent) that once comprisedalmost all modern continents. It existedduring Permian and Triassic times (about300 million years ago) and began to split at the beginning of the Jurassic (about 200million years ago).

Paraphyletic group: A group of organismscomprising one ancestor and some but notall of its descendants. It is not considered inphylogenetic classification.

Pectoral and pelvic girdles: the bones that join the limbs in bodies. In humans, thepectoral girdle is formed by the collarboneand the shoulder blade (scapula), while the pelvic girdle is formed by the pelvis.

Period: A formal division of geological time included in an era.

Phylogenetic classification: A method of classification that groups organismsaccording to their evolutionary relationships.

Phylogenetic tree: A branching, tree-likerepresentation showing the evolutionaryrelationships of living or fossil organisms.

Pineal foramen: a single small hole in thecenter of the skull, beneath the orbits.

Piscivorous/Ichthyophagous: Fish-eating animals

Plankton: Small organisms inhabitingoceans or lakes (e.g. small algae andanimals).

Premaxillary bone: The anterior-most boneof the skull, forming the tip of the snout;there are two premaxillary bones formingeach side of the tip snout.

Pterosaurs: Flying reptiles that lived duringthe Mesozoic Era. Though they are closelyrelated to dinosaurs, they do not belong to this group.

Salt gland: In marine sauropsids the kidneysare not efficient enough to excrete all saltexcess so supplementary glands locatednear the eyes (turtles, thalattosuchians) oron the tongue (crocodiles) increase thecapacity to excrete salt.

Sauropsids: A group of organisms that bear several common features, such as the presence of a particular aperture in the palate. It includes extant animals classicallyconsidered reptiles (crocodiles, lizards, varanids, turtles).

Sister species: The species that is the most closely related to another in terms of evolutionary relationships.

Species: The fundamental category of biological classification. A species is mostcommonly defined as a group of organismsthat can reproduce together, their descendant being fertile.

Supratemporal fenestra: Two apertures oneach side of the skull, posterior to theorbits.

Tethys: The ocean formed by the division of Pangaea into two landmasses and separated the Laurasia and Gondwanlandduring the Jurassic.

Vertebrates: Animals with backbones.

Viviparous: Animals which give live birth to their young (developed in the mother’sbody), as opposed to laying eggs.

Western Interior Seaway: Name of theinterior sea that covered the central part of North America during the Cretaceous. It was linked to the Gulf of Mexico in thesouth and to the Hudson Bay and BeaufortSea in the north.

57



58



NOTES

NOTES

59



This Educators’ and Activities Guide was written byDrs. Stéphane Jouve and Peggy Vincent in collaboration with Dr. Nathalie Bardet, CNRS/National Museum of Natural History.Edited by Julien Bollée and Alexandra Body.Illustrations by Karine Sampol & Stéphane Jouve for 3D Entertainment Distribution.

Special Thanks to:François Mantello, Pascal Vuong, Ronan Chapalain,Catherine Vuong, Dr. Elisabeth Mantello and Sylvain Grain.

Scientific Advisors:Dr. Olivier C. Rieppel, Rowe Family Curator, The Field Museum, Chicago (IL)Dr. Ryosuke Motani, Professor, University of California, Davis (CA)Dr. Zulma Gasparini, Paleontologist, La Plata Museum/CONICET, La Plata (Argentina)Dr. Benjamin Kear, Paleontologist, La Trobe University, Melbourne (Australia)

Designed by malderagraphistes.Produced and Published by 3D Entertainment Distribution.

a word from the filmmakers - imax sydney · educational standards in biology and earth sciences,...

Documents