a zebrafish model for waardenburg syndrome type iv reveals ... · a zebrafish model for waardenburg...

RESEARCH ARTICLE

dmm.biologists.org68

INTRODUCTIONThe Waardenburg syndromes (WS) form a family of disorders,characterised by pigmentation abnormalities and sensorineuralhearing loss, with diverse genetic causes (Read and Newton, 1997;Spritz, 2006). The severity of deafness in WS individuals can rangefrom mild to severe. Mutations in SOX10, EDN3 and EDNRB leadto WS type IV [WS4, also known as Waardenburg-Shah syndrome,or Yemenite deaf-blind syndrome (YDBS)], in which patients alsopresent with Hirschsprung’s disease (also known as congenitalmegacolon) (Puffenberger et al., 1994a; Puffenberger et al., 1994b;Edery et al., 1996; Hofstra et al., 1996; Pingault et al., 1998;Southard-Smith et al., 1999; Pingault et al., 2001; Inoue et al., 2004).In humans, different heterozygous effects have been associated withdifferent SOX10 alleles, with some resulting in WS4 (Pingault etal., 1998; Pingault et al., 2002) and others causing a more complexand severe neurocristopathy known as PCWH syndrome. Thissyndrome causes peripheral demyelinating neuropathy, centraldysmyelinating leukodystrophy, WS and Hirschsprung’s disease(Inoue et al., 1999; Pingault et al., 2000; Inoue et al., 2002; Verheijet al., 2006). The distinction between the different alleles dependsupon whether nonsense-mediated decay of the mRNA preventsthe translation of truncated, dominant negative SOX10 proteins:PCWH results from dominant negative mutations, whereas WS4results from haploinsufficiency (Inoue et al., 2004). Deletions at

the SOX10 gene locus have also been found to cause both WS4and WS2, a variant characterised by deafness and pigmentationdefects, but no additional symptoms (Bondurand et al., 2007).

The aetiology of the sensorineural deafness in WS4 and YDBSindividuals is likely to involve a loss of, or a reduction in the numberof, melanocytes contributing to the ear (Bondurand et al., 2000).In mammals, neural-crest-derived melanocytes populate the striavascularis of the cochlea as intermediate cells. These are thoughtto play a protective role and are essential for both the maintenanceof endolymph composition and generation of the endocochlearpotential (Steel and Barkway, 1989; Cable et al., 1992; Cable et al.,1993; Cable et al., 1994) (reviewed by Steel, 1995; Tachibana, 1999;Price and Fisher, 2001; Wangemann, 2002; Wangemann, 2006; Langet al., 2007). In the mouse, maintenance of the endocochlearpotential depends on expression of the potassium channel Kcnj10in intermediate cells (Marcus et al., 2002; Wangemann et al., 2004).Melanocytes also populate vestibular regions and theendolymphatic apparatus in the mammalian ear (Masuda et al.,1994; Escobar et al., 1995; Peters et al., 1995; Stanchina et al., 2006),but their role here is less clear; for example, mutations in Kcnj10have no effect on vestibular endolymph (Marcus et al., 2002).Analysis of the inner ear phenotype in murine models of WS andother auditory-pigmentary disorders has focused on the presenceof intermediate cells in the stria vascularis; deafness is usuallyattributed to the loss of intermediate cells in this tissue, leading toa reduction or collapse of endolymph volume, a loss of theendocochlear potential and subsequent hair cell degeneration(Tachibana et al., 1992; Cable et al., 1994; Matsushima et al., 2002;Stanchina et al., 2006) (reviewed by Tachibana, 1999; Tachibana etal., 2003).

Analysis of the inner ear in Sox10Dom heterozygote mice,however, hints that deafness might result from causes other than

Disease Models & Mechanisms 2, 68-83 (2009) doi:10.1242/dmm.001164

A zebrafish model for Waardenburg syndrome type IVreveals diverse roles for Sox10 in the otic vesicleKirsten Dutton1, Leila Abbas2, Joanne Spencer2, Claire Brannon1, Catriona Mowbray2, Masataka Nikaido1, Robert N. Kelsh1,* andTanya T. Whitfield2,*

SUMMARY

In humans, mutations in the SOX10 gene are a cause of the auditory-pigmentary disorder Waardenburg syndrome type IV (WS4) and related variants.SOX10 encodes an Sry-related HMG box protein essential for the development of the neural crest; deafness in WS4 and other Waardenburg syndromesis usually attributed to loss of neural-crest-derived melanocytes in the stria vascularis of the cochlea. However, SOX10 is strongly expressed in thedeveloping otic vesicle and so direct roles for SOX10 in the otic epithelium might also be important. Here, we examine the otic phenotype ofzebrafish sox10 mutants, a model for WS4. As a cochlea is not present in the fish ear, the severe otic phenotype in these mutants cannot be attributedto effects on this tissue. In zebrafish sox10 mutants, we see abnormalities in all otic placodal derivatives. Gene expression studies indicate deregulatedexpression of several otic genes, including fgf8, in sox10 mutants. Using a combination of mutant and morphant data, we show that the three soxgenes belonging to group E (sox9a, sox9b and sox10) provide a link between otic induction pathways and subsequent otic patterning: they actredundantly to maintain sox10 expression throughout otic tissue and to restrict fgf8 expression to anterior macula regions. Single-cell labellingexperiments indicate a small and transient neural crest contribution to the zebrafish ear during normal development, but this is unlikely to accountfor the strong defects seen in the sox10 mutant. We discuss the implication that the deafness in WS4 patients with SOX10 mutations might reflecta haploinsufficiency for SOX10 in the otic epithelium, resulting in patterning and functional abnormalities in the inner ear.

1Centre for Regenerative Medicine, Developmental Biology Programme,Department of Biology and Biochemistry, University of Bath, Bath, BA2 7AY, UK2MRC Centre for Developmental and Biomedical Genetics and Department ofBiomedical Science, University of Sheffield, Sheffield, S10 2TN, UK*Authors for correspondence (e-mail: [email protected];[email protected])

Dise

ase

Mod

els &

Mec

hani

sms

D

MM

Disease Models & Mechanisms 69

Ear defects in zebrafish cls/sox10 mutants RESEARCH ARTICLE

a loss of intermediate cells because, in the few samples analysed,these are still present in the ear (Stanchina et al., 2006), andendolymphatic collapse is not observed (Tachibana et al., 2003). Inaddition to contributing to melanocytes, neural crest cells alsomigrate around the otic vesicle; in the avian embryo, they contributeto part of the cartilaginous otic capsule and form all glial cells ofthe spiral and vestibular ganglia (gVIII) (Couly et al., 1993; LeDouarin and Kalcheim, 1999; Evans and Noden, 2006). Becauseneural-crest-derived glia are also Sox10 dependent, defects in thispopulation could contribute to the deafness found in WS4individuals (Kelsh and Eisen, 2000; Britsch et al., 2001; Paratore etal., 2001). In addition, a conserved site of Sox10 expression is inthe otic epithelium itself, suggesting that there might be a moredirect role for Sox10 in the development of the inner ear(Bondurand et al., 1998; Pusch et al., 1998; Cheng et al., 2000;Watanabe et al., 2000; Dutton et al., 2001b; Aoki et al., 2003; Honoréet al., 2003; Taylor and Labonne, 2005). If this is the case,haploinsufficiency or dominant negative versions of the Sox10protein might affect the otic epithelium directly, in addition tohaving effects on neural crest derivatives.

Sox proteins are classified into groups according to the degreeof identity between their HMG domains; Sox10 belongs to the Soxgroup E (Wegner, 1999; Kamachi et al., 2000). In zebrafish, fourgroup E sox (soxE) genes have been identified, sox8, sox9a, sox9band sox10, although sox8 is not expressed until at least the hatchingstage, and so only the latter three have been characterised in detail(Chiang et al., 2001; Dutton et al., 2001b; Li et al., 2002; Yan et al.,2002; Liu et al., 2003; Yan et al., 2005). Expression of sox9a, sox9band sox10 has been noted in the otic placode and early otic vesicle(Chiang et al., 2001; Dutton et al., 2001b; Li et al., 2002; Liu et al.,2003; Yan et al., 2005). However, detailed characterisation andcomparison of the expression patterns of these soxE genes in thedeveloping ear have not been documented, despite the importancefor interpretation of their partially overlapping functions in eardevelopment, which have been shown by analysis of mutants(Dutton et al., 2001b; Yan et al., 2002; Liu et al., 2003; Yan et al.,2005).

Mutations have been described in all three of these soxE genesand their phenotypes have been confirmed by morpholinophenocopy (Dutton et al., 2001a; Dutton et al., 2001b; Yan et al.,2002; Liu et al., 2003; Yan et al., 2005). In jef/sox9a mutants andmorphants, the early stages of inner ear development are relativelynormal but at later stages the ear is slightly reduced in size, andformation of the cartilaginous capsule that normally surrounds theear is defective (Yan et al., 2002; Yan et al., 2005). Similarly, a sox9bdeletion mutant and sox9b morphants show a slightly smaller earand reduced cartilage differentiation (Liu et al., 2003; Yan et al.,2005). Double mutants for both sox9a and sox9b either lack or haveonly vestigial otic vesicles, apparently owing to a failure to inducethe otic placode (Liu et al., 2003; Yan et al., 2005). The tpd mutant,which has a very similar phenotype to embryos in which both sox9genes are disrupted, appears to encode a coactivator of Sox9function (Rau et al., 2006). Multiple alleles of colourless (cls) disruptthe sox10 gene and result in severe abnormalities of both ear andnon-ectomesenchymal neural crest derivatives in homozygousmutants; all alleles are fully recessive and appear to act ashypomorphs or nulls (Kelsh et al., 1996; Whitfield et al., 1996; Kelshand Eisen, 2000; Dutton et al., 2001b; Elworthy et al., 2003;

Elworthy et al., 2005; Carney et al., 2006). These mutants also showoverproliferation of placode-derived neuromast precursors as aresult of the absence of posterior lateral line glial cells (Grant etal., 2005; López-Schier and Hudspeth, 2005). The ear defects incls/sox10 mutants are more severe than the effect of removing eitherof the sox9 genes singly, affecting non-sensory, sensory and neuralderivatives (Whitfield et al., 1996), as shown here. Detailedcharacterisation of the otic defects in sox10 mutants is required toevaluate the possibility that epithelial defects may contribute todeafness in cases of WS caused by mutations in SOX10.

Here, we analyse the expression of the soxE genes in developmentof the wild-type (WT) and sox10 mutant zebrafish otic vesicle. Wereveal that, initially, sox10 expression shows an extensive overlapwith that of sox9a and sox9b throughout the otic placode/vesicle.Subsequently, sox10 expression is strongly maintained in all oticepithelial cells, whereas sox9 gene expression becomes refined tospecific domains. Using specific markers, we show thatdifferentiation of most otic derivative cell-types can be observedin sox10 mutants, but that their organisation is abnormal.Abnormalities of the endolymphatic duct might contribute to thelate expansion of otic vesicles in sox10 mutant embryos. To assessthe interrelationship between the soxE group genes in oticdevelopment, we use mutant and morphant analysis to show thatmaintenance of sox10 expression in the ear is dependent upon soxEgene function, but that the loss of any one soxE gene is not sufficientto disrupt sox10 expression. We also show derepression of sox9expression in sox10 mutant ears. Thus, soxE genes show complexregulatory relationships; for example, the sox9a; sox9b doublemutant phenotype is likely to result, at least in part, fromconsequent loss of sox10 expression. We integrate our data into aworking model of otic vesicle development. We also show, by single-cell labelling, that the contribution of neural crest cells to the oticvesicle is small and transient, which strongly indicates that thesevere and varied defects in the developing sox10 mutant ear arelargely dependent upon Sox10 function within the otic epithelium.

RESULTSGroup E sox genes are expressed throughout the otic epitheliumfrom early stagesWe have made a detailed analysis of the expression of the soxE genesin the developing zebrafish otic placode and vesicle. All three of thegenes examined, sox9a, sox9b and sox10, are expressed from earlystages in preplacodal ectoderm (Fig. 1). Initially, sox10 expression isthe weakest of the three, probably reflecting a slightly later onset ofexpression. Expression of sox9a is restricted to an oval domain thatis likely to correspond to only pre-otic tissue at the one-somite stage(Fig. 1B), whereas sox10 and, to a much greater degree, sox9bexpression extends anteriorly and posteriorly in the head within themidbrain and hindbrain regions (Fig. 1A,C). Thus, this expressionincludes early cranial neural crest cells. By the 15-somite stage, whenthe otic placode has formed, sox10 expression persists throughoutthe placode, whereas expression of the two sox9 genes isdownregulated in the anteroventral part of the placode(supplementary material Fig. S1). Subsequently, after cavitation ofthe vesicle and from at least 24 to 48 hours postfertilisation (hpf),sox10 continues to be ubiquitously expressed throughout the oticepithelium, whereas expression of the sox9 genes becomes restrictedspatially (Fig. 2 and supplementary material Fig. S2). Thus, at 24 hpf,

Dise

ase

Mod

els &

Mec

hani

sms

D

MM


Ear defects in zebrafish cls/sox10 mutantsRESEARCH ARTICLE

sox9a expression is restricted to three domains, two dorsal and oneventral, and is downregulated in regions where hair cells aredifferentiating in the two maculae (Fig. 2). By 48 hpf, both sox9 geneshave become largely downregulated in the otic epithelium, but sox9bexpression is retained in the epithelial projections that form thesemicircular canal system (supplementary material Fig. S2).

sox9a and sox9b are known targets of Fgf-dependent pathwaysof zebrafish otic induction (Phillips et al., 2001; Léger and Brand,2002; Maroon et al., 2002). However, sox10 expression is presentand appears to be relatively normal in ace/fgf8 mutants (data notshown). We have also examined the expression of sox10 in variousmutant backgrounds known to affect otic epithelial patterning anddevelopment, but expression is normal in smu/smo mutants (whichlack Hedgehog signalling) (Barresi et al., 2000; Hammond et al.,2003) and in vgo/tbx1, noi/pax2a and dog/eya1 mutants (data notshown), each of which lacks the function of a transcription factorexpressed in early otic epithelium (Piotrowski et al., 2003; Hans etal., 2004; Mackereth et al., 2005).

Sox10 does not appear to be autoregulatory in the zebrafish earbut might regulate the expression of the sox9 genesWe extended our studies of WT ear development to examine theexpression patterns of the soxE genes in the absence of sox10function (Fig. 2 and supplementary material Fig. S2). At both 24and 48 hpf we saw no difference in the proportion of otic vesiclecells expressing sox10 between WT and sox10 mutant embryos (Fig.2A-B�). Expression of sox9 genes at 24 hpf is largely comparablein sox10 mutants and their WT siblings, although sox9a expressionin the dorsal otic vesicle is somewhat more extensive (Fig. 2C-C�,D-D�). By 48 hpf, ectopic expression of sox9a is prominent in theotic epithelium of sox10 mutants, whereas in WT siblings

expression is restricted to periotic mesenchyme (supplementarymaterial Fig. 2C-D�). Likewise, sox9b expression appears to beslightly upregulated in the ventral otic epithelium of sox10 mutantsat 24 hpf (Fig. 2E-F�), and expression here persists at 48 hpf(supplementary material Fig. 2F�). Note that the epithelialprojections forming the semicircular canal system, which normallyexpress sox9b strongly at 48 hpf (supplementary material Fig. 2E�),are rudimentary in sox10 mutants (supplementary material Fig.2F�). Thus, although sox10 transcription appears to be independentof sox10 function, Sox10 represses sox9 gene transcription (directlyor indirectly) in the otic epithelium at later stages. Note, however,that a role for sox10 in regulating its own transcription is revealedwhen sox9 activity is also reduced (see below).

Otic vesicle morphology is abnormal in sox10 mutantsAbnormalities in otic morphology were noted in the initialdescriptions of zebrafish sox10 mutants (Whitfield et al., 1996). Wehave examined defects in sox10 mutant otic vesicle morphology from27 hpf, when mutants can be identified on the basis of theirpigmentation phenotype. At 27 hpf, there are subtle defects in oticvesicle shape: the dorsal epithelium of the mutant is not as thin asin the sibling, and the ventral epithelium is more uniform in thickness(Fig. 3A,B; Fig. 7A-D). By 48 hpf, the vesicle is clearly misshapen andsmaller than normal, and the otoliths are small and more closelyspaced than in the WT embryo (Fig. 3C-E). Development of theepithelial projections that form the semicircular canal system isinitially delayed (Fig. 3C,D); they eventually develop, but arerudimentary (Fig. 3F,G). Expression of the semicircular canal tissuemarkers ugdh1 (Busch-Nentwich et al., 2004) and dacha (Hammondet al., 2002) is, however, normal in the epithelial projections that arepresent (data not shown). The otoliths remain very small and sit closeto one another in the mutant (Fig. 3H-K). At 5-8 days post fertilisation(dpf), the otic phenotype is very variable; some ears remain very smallbut others become grossly distended, sometimes on one side of thefish only (Fig. 3J-O). Further, where semicircular canal pillars haveformed, they appear thinner than normal (Fig. 3N).

Regional markers indicate patterning defects in sensory and non-sensory regions of the cls/sox10 mutant earThe complex morphological defects coupled with the early onsetof sox10 expression in otic development led us to examinemolecular markers of otic patterning in sox10 mutants. Whereasthe expression of some markers, such as pax2a, is unaffected inthe sox10 mutant ear (Fig. 4A-D), several markers are expressedabnormally. Interestingly, these often show both a loss of expressionin their normal domain and ectopic expression elsewhere. At 24hpf, fgf8 is expressed close to its normal domain in anteroventralepithelium (with a slight extension dorsally and medially), but isalso misexpressed at the posterior of the ear in sox10 mutants (Fig.4E-H). Ectopic fgf8 expression at the posterior of the otic vesiclehas also been reported in ace/fgf8 mutants (Léger and Brand, 2002),but we find that in sox10 mutants this phenotype is fully penetrant[n=14/49 (29%) embryos from an unsorted clutch], whereas inace/fgf8 embryos a posterior patch of fgf8 expression was only seenin two out of 12 identified mutants (data not shown). By 30 hpf,expression is lost in the anteroventral epithelium and, instead, isdisplaced to a broad region over the medial wall of the vesicle, whichpersists through to at least 49 hpf (Fig. 4I-J and data not shown).

Fig. 1. Early expression of the soxE genes overlaps strongly duringdevelopment of the WT otic placode. Dorsal views of flattened whole-mount one-somite stage embryos (A-D) and transverse sections through thepresumptive otic region [(E-G, the plane of section is indicated by the whitebar in (A-C)] showing sox10 (A,E), sox9a (B,F) and sox9b (C,G) expression.Superimposition of false-coloured whole-mount patterns (D) indicates theextensive overlap of soxE gene expression in otic and neural crest regions, butalso more extensive expression of sox9b in the premigratory neural crest atthis stage. o=presumptive otic region. Bars, 150 μm (A-D); 50 μm (E-G).

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



If the staining reaction is allowed to develop further, an occasionalfaint trace of fgf8 expression is seen at the posterior of sibling oticvesicles at 24 hpf, but in all cases the ectopic expression in mutantotic vesicles is at comparable or higher levels to that found in thenormal anterior domain. pax5, which is also normally expressedin an anteroventral domain corresponding to the anterior (utricular)macula, is also misexpressed in a similar pattern (Fig. 4K-L). fsta,a marker of non-sensory posterior otic epithelium, is overexpressedat the posterior of the ear at 24 hpf, and is later widely misexpressedin medial otic epithelium at 49 hpf when the normal posteriorexpression domain is very weak (Fig. 4M-P). Therefore, the medialwall of the ear shows both abnormal and strong expression ofmarkers of both anterior and posterior identity. The expression ofcentral, ventral otic epithelium markers is also abnormal; otx1expression is slightly expanded and the sharp anterior boundaryof its expression domain is lost, whereas wnt4a expression is morediffuse than normal (Fig. 4U-V and data not shown).

bmp4 is normally expressed at the anterior and posterior ends ofthe otic vesicle at 24-27 hpf, but by 48 hpf, bmp4 expression marksall cristae and a dorsal domain corresponding to the endolymphaticduct (Mowbray et al., 2001) (L.A. and T.T.W., unpublished) (Fig.4Q,S). In sox10 mutants, the level of bmp4 expression is upregulatedat 24-27 hpf but the pattern is largely normal, appearing concentratedin the anterior and posterior regions on the lateral wall of the vesicle(Fig. 4R). However, at 48 hpf, the lateral crista domain and dorsal

endolymphatic duct domain are lost in the mutant ear, whereas theanterior and posterior crista domains of expression are hugelyexpanded (Fig. 4T). bmp2b and msxc, which also mark cristae at 48hpf, also indicate loss of the lateral crista domain (Whitfield et al.,1996) (data not shown). Expression of a second marker of cristaeand the endolymphatic duct, aldh1a3, also reveals two abnormalcrista expression domains at 48 hpf; expression in the lateral cristais reduced to a trace and expression in the endolymphatic duct ismissing (Fig. 4W,X).

In addition, we documented changes in the expression patternsof two connexin genes, cx27.5 (homologous to mammalianCX32/GJB1) and cx33.8 (homologous to CX26/GJB2 andCX30/GJB6) (Eastman et al., 2006). At 72-74 hpf, expression of bothgenes is lacking in the cls/sox10 mutant ear (Fig. 4Y-BB). Both genesare normally expressed in the lateral crista, which is missing in themutant, probably accounting for the loss of this expression domain;however, cx33.8 is also expressed in the anterior macula at this stage(Fig. 4AA, arrow), and this domain of expression is also missing inthe sox10 mutant ear (Fig. 4BB).

cls/sox10 mutant otic phenotypes are enhanced by knockdown ofsox9 genesAlthough sox10 may not be absolutely dependent upon itself formaintenance of its expression, it is plausible that sox9 geneexpression compensates for the loss of sox10. To test this, embryos

Fig. 2. soxE gene expression in cls/sox10 mutantembryos at 24 hpf. The ears of cls/sox10 mutants (B,D,F)and WT siblings (A,C,E) are shown in a lateral view ofwhole-mount embryos (A-F) and in transverse sectionsthrough the anterior (A’-F’), medial (A’’-F’’) and posterior(A’’’-F’’’) regions. At this stage, sox10 is expressedthroughout the otic epithelium and expression is largelyunchanged in cls/sox10 mutants. In WT siblings, theexpression of sox9a and sox9b is lost from anteroventraland posteromedioventral regions, where hair cells arebeginning to differentiate in the two maculae. Expressionis retained in a central ventral region and this domain ofsox9b expression appears to be slightly upregulated incls/sox10 mutants (arrows). Arrowheads in (C) and (E’’’)indicate possible sox9a and sox9b expression in the SAG. Inthis figure, and all subsequent figures, the developing oticstructures are shown in a lateral view with anterior to theleft and dorsal to the top unless stated otherwise. Bars,75 μm (A-F); 50 μm (A’-F’’’).

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



from crosses of sox10 carriers were injected with sox9a or sox9bmorpholinos, or mixtures of the two, and patterning of oticvesicles was then observed at 30 hpf. Note that, in each case,equimolar mixtures of pairs of gene-specific morpholinos wereused at doses phenocopying the described jaw and bodymorphology phenotypes of sox9 mutants (Liu et al., 2003; Yan etal., 2005). As expected from previous studies (Liu et al., 2003; Yanet al., 2005), knockdown of sox9 function resulted in smaller oticvesicles, with knockdown of both sox9 genes often resulting intiny patches of otic epithelia, especially when performed in a sox10mutant background (Fig. 5G,H). In some cases, such morphantsshowed no indication of an otic epithelium. Occasionally, sox9-morpholino-treated embryos developed small, but duplicated, oticvesicles, as detected using markers including sox10, fgf8 or pax2a(data not shown).

We asked specifically whether soxE gene function is requiredfor maintenance of sox10 expression in the otic epithelium.Although injection of any one sox9 morpholino into siblingembryos did not affect the ubiquitous strong expression of sox10in otic epithelial cells, knockdown in sox10 mutants resulted inreduced levels of sox10 expression (Fig. 5C-F). Furthermore, theremaining expression was often patchy in its distribution throughthe epithelium (Fig. 5C-F). These phenotypes were noted whenthe function of any two soxE genes was disrupted, and enhancedwhen the function of all three genes was disrupted. Theseobservations suggest that the soxE group genes function

redundantly in the maintenance of sox10 gene expression in theotic epithelium.

We extended these studies by looking at other early oticvesicle markers and comparing the changes in expressionpatterns at 30 hpf when one or more soxE group genes wereinhibited. At this stage, pax2a expression is essentiallyunchanged in sox10 mutants (Fig. 4A-D) and is retained in theotic cells of sox10 mutants and in their WT siblings injectedwith either sox9a or sox9b morpholinos, or both sox9 genemorpholinos (data not shown; see also Liu et al., 2003). Thus,otic pax2a expression does not seem to be regulated by soxEgene function. In contrast, otic expression of fgf8 becomesincreasingly deregulated as soxE gene function is decreased (Fig.6). Knockdown of a single sox9 gene results in limited ectopicfgf8 expression at the posterior of the ear; a double sox9knockdown results in similar ectopic posterior expression to thatobserved in sox10 mutants, whereas the injection of sox9morpholinos into sox10 mutants results in a further expansionof fgf8 expression. When the function of all three soxE genes isperturbed, almost all cells in the residual otic tissue express fgf8(Fig. 6H). We conclude that fgf8 expression in the developingotic vesicle is normally restricted to the developing anteriormacula by the activity of soxE gene products. Expression of foxi1is more variable, even in WT embryos at this stage, butnevertheless a similar pattern of increasing deregulation of geneexpression is seen (data not shown).

Fig. 3. Otic vesicle size and morphology is aberrant in sox10mutants. (A-D,F-O) DIC images of the ears of live sibling (WT) andcls/sox10 mutant embryos. (A,B) At 27 hpf, the images show slightdifferences in vesicle morphology. (C,D) By 48 hpf, the anterior andposterior semicircular canal projections (arrows) are not visible inthe mutant. (E) Quantitation of the anteroposterior (AP) length ofthe otic vesicle (mean±s.e.) at 48 hpf for WT and cls/sox10 mutants.n=10 for each genotype; p=0.0003 (t-test). (F-I) At 72 hpf, theepithelial projections are now fused to form pillars (arrows) in theWT embryo, but are disorganised in the mutant. (H,I) 72 hpfimages focused on the otoliths (arrowheads). (J) A WT ear at 6days postfertilisation (dpf). (K-M) Three different examples ofsox10 mutant ears at 5 dpf showing the variability in size. All theseears contained two small otoliths, but they are out of the focalplane in (L) and (M). (N,O) Dorsal views of two cls/sox10 mutants at8 dpf showing hugely distended and misshapen ears [bilateral in(N) and unilateral in (O), where the ear on the left remains smalland uninflated]. A thin semicircular canal pillar (arrow) spans theenlarged lumen. All panels are lateral views, with anterior to theleft, except for (N) and (O) which represent dorsal views, withanterior to the top. Mutants in (E) are the clsm618 allele; mutants inall other panels are the clst3 allele. Bars, 50 μm.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



Sensory epithelia differentiate in cls/sox10 mutant ears, but arenot patterned correctlyWe examined hair cell development in the cls/sox10 mutant ear byusing FITC-phalloidin staining, which marks the actin-richstereociliary bundle on the apical surface of each hair cell (Haddonand Lewis, 1996). At 28-30 hpf, hair cell production in the cls/sox10mutant ear appears relatively normal; two to four hair cells arepresent in each macula, as in the WT embryo (Fig. 7A-H). Theotic vesicle is more rounded than normal, and the epithelium ofthe otic vesicle appears disrupted in places. However, by 48-51 hpf,there is no longer a clear distinction between anterior and posteriormaculae; the patches are misplaced around the medial wall, andare too close together, sometimes forming a continuous patch.

By 60 hpf, five separate sensory patches are evident in the WTzebrafish ear: two maculae, each containing 30±2 hair cells (n=3ears), and three cristae. In the cls/sox10 mutant, there is somevariability in the hair cell phenotype. Macular hair cells appear to

occupy one contiguous strip covering the medial wall of the vesicle(Fig. 7M-P), possibly correlating with the misexpression of anteriormacula markers in this region (pax5 and fgf8; Fig. 4I-L). Anteriorand posterior foci of hair cells are also present; these occupy thepositions of the anterior and posterior cristae, but often havehigher numbers of hair cells than would be expected for cristaeat this stage (Fig. 7Q-T). In some ears they are contiguous withthe medial patch of hair cells, forming a single patch of hair cellsthat extends round from the anterior to the posterior of the vesicle.This was confirmed by assessing the expression of the hair cellmarker pou4f3 (data not shown). The ear is so misshapen at thisstage that is difficult to resolve whether the anterior and posteriorhair cell groups reflect enlarged cristae (which might correlate withthe enlarged domains of bmp4 expression at the anterior andposterior of the vesicle; Fig. 4T) or displaced macular hair cells(which might correlate with the dorsomedially displaced fgf8 andpax5 expression), or both. In some ears the lateral crista appears

Fig. 4. Otic vesicle patterning is disrupted incls/sox10 mutants. Whole-mount in situ hybridisationsshowing the changes in gene expression domains in theclst3 (cls) mutant otic vesicle. (A,C,E,G,O,P,S-BB) are lateralviews, with anterior to the left; (B,D,F,I,J,H,M,N,Q,R) aredorsal views, with anterior to the top. The age in hpf isshown for each panel. (A-D) pax2a expression at 24 hpfappears normal in sox10 mutants, marking the medialside of the vesicle. (E-H) fgf8 expression at 24 hpf. Inmutants, expression in the normal anteroventraldomain is expanded (arrows) and ectopic expression isobserved at the posterior of the vesicle (arrowheads).(I,J) fgf8 expression at 30 hpf. In the mutant, the normalanteroventral expression [(I) arrows] extends all aroundthe medial side of the mutant vesicle (J). (K,L) Partiallydissected whole-mounts showing pax5 expression at 50hpf in the otic vesicle. WT expression of pax5 at thisstage [(K), dorsal view, anterior to the left] marks theextreme medial edge of the utricular macula (um), withno expression in the cristae (ac, anterior crista) orsaccular macula (sm). Ectopic expression is present inthe posterior of the mutant otic vesicle [(L), dorsolateralview, anterior to the left, arrowhead]. (M,N) Theposterior expression domain of fsta is stronger in sox10mutants at 24 hpf. (O,P) By 49 hpf, WT otic fstaexpression is very weak; in the mutant, ectopic fstaexpression stretches over the medial wall of the oticvesicle (arrowhead). (Q,R) bmp4 expression at 24 hpf ismuch stronger in the mutant otic vesicle. (S,T) At 50 hpf,bmp4 expression normally marks the three cristae(asterisks) and the endolymphatic duct (ED). In themutant, lateral crista and ED expression domains arelost; expression in the remaining two cristae isexpanded (asterisks). (U,V) Expression of wnt4a (bracket)is slightly expanded in the mutant. (W,X) aldh1a3expression normally marks the three cristae (asterisks),anterior macula (arrow) and ED at 72 hpf; in the mutant,the lateral crista domain is very weak, and the anteriormacula and ED domains are absent [see (S) and (T),above]. (Y,Z) Expression of connexin27.5 is lost in thelateral crista (asterisk) of the mutant at 3 dpf. (AA-BB)Expression of connexin33.8 is lost in the lateral crista(asterisk) and anterior macula (arrow) of the mutant at 3dpf. Bars, 25 μm.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



to be missing, whereas in others it is present but appears apicallyconstricted, possibly in the process of being extruded from theepithelium (e.g. Fig. 7T), which may correlate with the loss of bmp4expression in this domain. At 72 hpf, hair cells occupy the entiremedial wall of the vesicle; in the example shown, only one cristais present. A similar pattern is found at 5-6 dpf (Fig. 7W,X),although in many cases the ear is grossly distended (see Fig. 3); ifthis is the case, organisation of hair cells into separate sensorypatches is not evident (data not shown).

The neurogenic domain is expanded in cls/sox10 mutant earsThe statoacoustic ganglion (SAG) arises by delamination ofneuroblasts from the otic epithelium. In the neural crest, sox10 hasbeen shown to have a role in sensory neuron specification andsurvival (Britsch et al., 2001; Sonnenberg-Riethmacher et al., 2001;Carney et al., 2006). Hence, we asked whether sox10 mutants mightshow disrupted sensory neuron formation in the SAG. We used twomarkers of early delaminating neuroblasts, neurogenin1 (ngn1) andneuroD, to examine 30 hpf embryos. In WT embryos, ngn1 isexpressed in otic sensory neuron precursors before delamination,whereas neuroD is rarely expressed in the otic epithelium itself atthis stage; both are robustly expressed in the nascent ganglion (Fig.8A,C; data not shown). In cls/sox10 mutants, both ngn1 and neuroDappear to be expressed at higher levels, or in supernumerary sensoryneuron precursors, in both the otic epithelium and the nascentganglion (Fig. 8A-D); this phenotype continues until at least 36 hpf

(Fig. 8G,H). However, expression of snail2, which also appears tomark delaminating otic neuroblasts – albeit possibly a differentpopulation to the ngn1- and neuroD-positive cells, is unaffected (Fig.8E,F). To test whether the abnormal expression of ngn1 and neuroDin the mutants correlates with an abnormal number of neurons inthe SAG, we stained embryos with antibodies to Isl1 and the Huantigen, both of which mark differentiating and mature neurons(Haddon et al., 1998; Marusich et al., 1994). We found that the overalllevels of Isl1 protein expression are decreased in the SAG of cls/sox10mutants (Fig. 8I,J), although Hu levels are indistinguishable (Fig.8K,L). However, counts of Isl1-positive nuclei and Hu-positive cellsin the SAG revealed no significant differences in the number ofneurons in cls/sox10 mutants (Isl1: WT, 46.1±9.9; cls/sox10 mutant:46.8±9.1; p=0.85, t-test; n=12 ears for each genotype. Hu: WT,21.80±6.268; cls/sox10 mutant: 26.57±3.359; p=0.0877, t-test; n=10and n=7 ears, respectively). We conclude that the abnormalexpression of ngn1 and neuroD in the cls/sox10 mutant otic vesicleand developing SAG does not result in a significant overproductionof SAG neurons, possibly owing to increased cell death (see below).

Levels of cell death are increased in the cls/sox10 mutant earSox10 has been shown to have a key role in promoting neuralcrest cell survival: in zebrafish, death of neural crest cells in sox10mutants occurs principally between 35 and 45 hpf (Dutton etal., 2001b). Therefore, we used TUNEL staining to assesswhether apoptosis contributed to the otic phenotypes in sox10

Fig. 5. sox9 knockdown results in loss of sox10 expression in oticepithelia. In situ hybridisations showing sox10 expression (arrows) in the oticvesicle of 30 hpf WT (A,C,E,G,G’) and sox10 mutant (cls) (B,D,F,H) zebrafishinjected with sox9a morpholinos (sox9a MO) (C,D), sox9b morpholinos (sox9bMO) (E,F) or sox9a and sox9b morpholinos (sox9a sox9b MO) (G,G’,H). Bars,20 μm (A-G); 40 μm (G’).

Fig. 6. fgf8 expression becomes increasingly deregulated as soxE genefunction is impaired. Expression of fgf8 (dark blue, arrows) in the otic vesicleof 30 hpf WT (A,C,E,G) and sox10 mutant (cls; B,D,F,H) zebrafish injected withsox9a (sox9a MO; C,D) or sox9b (sox9b MO; E,F), or with sox9a and sox9bmorpholinos (sox9a sox9b MO; G,H) was determined using whole-mount insitu hybridisation. Bar, 20 μm.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



mutants. Embryos were examined between 25 and 40 hpf; at alltime points, cell death in the otic epithelium and/or SAG wassignificantly elevated over WT siblings (Tables 1 and 2; Fig.8G-J). Although WT and sox10 mutant embryos cannot be easilydistinguished morphologically at 25 hpf, 25% of the embryos ina batch have apoptotic cells in the otic epithelium and/or SAG.We infer that sox10 mutants already have elevated cell death inthe ear at this stage. At all stages up to at least 40 hpf, elevatedcell death was prominent in both the otic epithelium and theSAG, although individual embryos differed widely in the numberof apoptotic cells they displayed.

Neural crest cells occasionally contribute to the ear and can giverise to several otic derivativesUnlike mammals, the teleost ear has no cochlea and, therefore,no stria vascularis. Furthermore, neither melanophores normelanoblasts are present in the zebrafish ear during embryonic

stages (data not shown). Nevertheless, we tested whether there wasany neural crest contribution to the zebrafish ear. We usediontophoretic labelling with rhodamine-dextran to label singleneural crest cells in the region of rhombomere 4 (Dutton et al.,2001b); cells were labelled in the embryo at around the seven-somitestage (12 hpf) and, thus, were premigratory (Raible et al., 1992;Schilling and Kimmel, 1994), but they were already clearlydistinguishable morphologically from otic placode cells. Afterlabelling, embryos were recovered and then re-examinedapproximately one hour after labelling to confirm that single cellswere indeed labelled. These cells all showed a mesenchymalmorphology characteristic of neural crest cells (Fig. 9A-C). Embryoswere then re-examined at around 36 hpf and the number and fateof labelled cell clones was recorded (Table 3). These cells gave riseto all expected fates, including craniofacial cartilage, multiplepigment cell-types, glia and some neurons of the cranial ganglia.In addition, a small proportion (5%; Table 3) of clones contained

Fig. 7. Sensory epithelia are disrupted incls/sox10 mutants. Confocal images(projected Z sections) of FITC-phalloidin-stained ears to show sensory patch defectsin clst3 mutant embryos. The age in hpf isshown for each panel. (A-H) Initial hair celldevelopment at 28-30 hpf in both theanterior (A,C,E,G) and posterior (B,D,F,H)maculae is relatively normal in cls/sox10mutants. (I) By 51 hpf, there are 10-20 haircells in the WT anterior macula(arrowhead) and slightly fewer in theposterior macula (arrow). (J-L) Threeexamples of a cls/sox10 mutant ear at 51hpf. The anterior macula (arrowheads) hasrelatively normal numbers of hair cells, butis misplaced medially; the posteriormacula (arrows) has reduced numbers ofhair cells. (M) In WT ears at 60 hpf, the twomaculae are clearly distinct in shape andposition in the vesicle (arrowhead, anteriormacula; arrow, posterior macula). (N-P) Three examples of a cls/sox10 mutantear at 60 hpf, focused on the medial wall ofthe vesicle. Separate maculae are nolonger discernible. (Q) A lateral plane offocus at 60 hpf in a WT ear reveals hair cellsin the three cristae (asterisks). (R-T) Threeexamples of cristae in cls/sox10 mutantears at 60 hpf. Anterior and posteriorthickenings are evident (asterisks), withvariable numbers of hair cells. Right handasterisk in (T) shows a possible lateralcrista. (U,V) Sensory patches in WT andcls/sox10 mutant ears at 72 hpf. Theasterisk in (V) shows a possible anteriorcrista. (W,X) Sensory patches in a 5 dpf WT(W) and a 6 dpf cls/sox10 mutant (X). Theasterisk in (X) indicates unidentifiablecrista. Panels (A-T) are lateral views withanterior to the left; (U) and (V) are dorsalviews of the left-sided ears (anterior to thetop); (W) and (X) are dorsal views of right-sided ears (anterior to the top). Bars,25μm.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



progeny that were clearly incorporated within the otic epithelium,and that in at least one case formed part of a sensory macula. Thiswas confirmed by confocal microscopy using BODIPY ceramideto reveal tissue morphology (Fig. 9D-G). This contribution to theotic vesicle was, however, transient because we were unable to findlabelled cells in the epithelium at 72 hpf. In one case where a clonehad contributed to the otic epithelium, we did later see a singlelabelled sensory neuron in the SAG. We conclude that, althoughthe majority of otic cells derive from the otic placode, a small subsetof otic cells are derived from the neural crest, but that most or allof these might be lost. In part, this might result from delaminationduring SAG formation, although this inference will need to be testedrigorously using further approaches.

DISCUSSIONSox10 participates in a feedback loop with sox9 genes to establishotic-specific patterns of gene expressionCurrent models of otic induction in zebrafish place the maintenanceof otic sox9a and sox9b expression downstream of two convergentotic induction pathways, each dependent on Fgf activity (Phillipset al., 2001; Léger and Brand, 2002; Maroon et al., 2002; Nissen et

al., 2003; Hans et al., 2004; Solomon et al., 2004; Hans et al., 2007).The exact requirements for initiation of soxE gene expression inthe otic region are less clear. Otic expression of sox9a, and to alesser extent sox9b, is dependent on Fgf signals from the centralnervous system (CNS) (Liu et al., 2003), and expression of the sox9genes is reduced, but not completely lost, in the absence of eitherfoxi1 or dlx3b activity (Liu et al., 2003; Hans et al., 2004). We foundthat zebrafish sox10 is not dependent on Fgf8 function, asexpression is normal in ace (fgf8) mutants (data not shown),although treatment of Xenopus embryos with the Fgf inhibitorSU5402 eliminates both otic and neural crest expression of sox10(Honoré et al., 2003). All three soxE genes are coexpressed withdlx3b from early stages (one somite) in domains where neural crestand otic precursors overlap. The timing of the onset of soxE geneexpression is similar to that of pax8, which marks the otic domainby the 10 hpf (tailbud) stage (Phillips et al., 2001) and precedes theonset of pax2a expression in otic cells at the three-somite stage(Fig. 1). pax2a expression appears to be independent of soxEfunction in zebrafish since, even in triple mutant/morphants,residual otic cells show pax2a expression (data not shown).Disruption of pax gene function at stages before the onset of pax2a

Fig. 8. cls/sox10 mutants show abnormal neurogenic development in the ear. Lateral views of WT (A,C,E) and sox10t3 mutant (B,D,F) embryos at 30 hpfshowing the otic epithelium and the statoacoustic ganglion (SAG). Note that, although snail2 expression (E,F) is comparable between genotypes, both neuroD-(A,B) and neurogenin1- (C,D) expressing cells are more prominent in the mutant otic epithelia (the arrows indicate selected positive cells in the epithelium). At thisstage, neuroD is strongly expressed in the developing SAG but only rarely in cells within the otic epithelium; (A) shows a rare individual with detectable neuroDexpression in one or two neuroblasts before they have delaminated from the epithelium. The mutant in (B) is typical. (G,H) Transverse section of WT (G) andsox10t3 mutant (H) embryos showing the location of neuroD-expressing cells in the mutant otic epithelium. (I-L) Lateral views showing expression of the neuronalmarkers Islet-1 (I,J) and Hu (K,L) at 30 hpf in WT (I,K) and sox10 mutant (J,L) embryos. (M-P) Cell death in the developing ear. (M,N) 35 hpf embryos labelled foranti-Hu (brown) and TUNEL (dark blue) show prominent dying cells (arrows) in both the otic epithelium and the SAG (outlined with a black line) of clst3 mutants(N), whereas such cells are usually absent from WT siblings (M). Note that WT embryos have TUNEL+ cells outside of the ear. (O,P) Quantitation (mean±s.e.) ofTUNEL+ dying cells in the otic epithelium (O) and of TUNEL+/Hu+ SAG neurons (P) in WT (n=12) and sox10 mutant (n=10) embryos at 30 hpf (see also Tables 1 and2). Bar, 20 μm [the bar in (A) applies to (A-H,K-N) and the bar in (I) applies to (I, J)].

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



expression suggests that Pax8 plays an early role in the initiationor maintenance of sox9 gene expression (Hans et al., 2004).However, in Xenopus, pax8 expression in the otic placode isdependent on sox9 function (Saint-Germain et al., 2004). It istherefore difficult to place soxE factors either upstream ordownstream of pax factors in a simple linear pathway in the ear;dissection of the gene regulatory network underlying otic inductionwill require an exhaustive analysis of transcription factor bindingto the regulatory regions of all these genes.

Once expression of pax and soxE gene expression is establishedin the otic region, their expression patterns are maintained orrefined by complex cross-regulatory actions. Our results withmorpholino disruption of the sox9 genes corroborate previousobservations in which morpholino knockdown of sox9b in jefhi1134

(sox9a) mutants results in the loss of the otic vesicle, with just afew scattered patches of pax2a-positive cells at 36 hpf (Liu et al.,2003). We show that within the soxE group, the activity of any twosoxE genes is required for the maintenance of sox10 expressionthroughout the placode, and that an important early role of all threesox genes is to restrict fgf8 expression to anterior macula regions.Note that cavitation to form a vesicle can occur with the loss ofone or even two soxE factors, despite the reduction in overall otictissue (data not shown). This is in contrast to the mouse Sox9mutant, in which an otic placode forms but fails to invaginate toform a vesicle (Barrionuevo et al., 2008). Since vesicle formationin the zebrafish involves cavitation, rather than invagination, it isperhaps not surprising that this role for Sox9 is not conserved.

As development proceeds, sox10 appears to be required for thedownregulation of sox9 gene expression in the otic vesicle. Thus,sox10 provides a link between the otic induction pathways, oticspecification factors (pax and sox9 genes) and subsequent oticpatterning. This key function is demonstrated by multiple instancesof abnormal marker gene expression in the sox10 mutant oticvesicle. Thus, we show shifts in anteroventral (utricular macula)expression domains to more dorsomedial positions (fgf8, pax5);deregulation or ectopic expression of several markers (fgf8, pax5,fsta, bmp4); loss of markers of the lateral crista and endolymphaticduct (bmp4, aldh1a3); and precocious neurogenesis in the oticepithelium (ngn1, neuroD). Although the abnormal patterning ofsensory patches reflects these changes in gene expression,specification of sensory hair cells within the maculae appears tobe unaffected since differentiated hair cells appear on schedule.

Failure of endolymphatic duct development or function mightaccount for the late, and variable, otic swelling seen in mutants.

The otic phenotype of sox10 and hnf1b mutant embryos is verysimilarWe note the striking similarity of the sox10 mutant otic phenotypeto that described for the hnf1b mutant (formerly vhnf1 or tcf2)(Lecaudey et al., 2007). Many aspects appear similar at the 24-26hpf stage, in particular the misexpression of fgf8 and pax5. Bothmutants also show a transient increase in otic neurogenesis andtend to form only two cristae. The hnf1b mutant phenotype hasbeen interpreted as an anteriorisation of the otic vesicle (Lecaudeyet al., 2007). We do not suggest that the sox10 mutant oticphenotype is a straightforward anteriorisation, because althoughanterior markers (fgf8 and pax5) are expressed ectopically, theposterior group of hair cells in sox10 mutants does not resemblean anterior macula; in addition, and in contrast to the hnf1b mutant,expression of the posterior marker fst is upregulated. hnf1b codesfor a transcription factor that is expressed in the hindbrain and notin the ear; in the hnf1b mutant, rhombomere 5 (r5) fails to developcorrectly and the r5-specific expression of val/mafb, wnt1, wnt3aand wnt8b is lost (Hans et al., 2007; Lecaudey et al., 2007). Giventhe similarity of the otic phenotypes in the sox10 and hnf1bmutants, it is likely that they function in the same pathway. InXenopus, injection of a dominant negative Wnt8 mRNA eliminatesSox10 expression in the neural crest and otic placode (Honoré etal., 2003). However, we suggest it is unlikely that, in zebrafish, sox10is a direct target of a localised signal (such as a Wnt) from r5, sinceour preliminary data (not shown) suggest that sox10 expression isunaffected in hnf1b mutants. Instead, we propose that sox10 mightbe required for competence of otic tissue to respond to a hindbrainsignal. Alternatively, Hnf1b activity could be required for theexpression of a partner of Sox10 in the otic epithelium.

Neural crest cells make a small contribution to the zebrafish earThe expression patterns of soxE genes in zebrafish suggest thatneural crest cells and otic placode cells are initially intermingled.In the chick, fate-mapping studies have shown that otic, neuralcrest, epidermal, epibranchial and CNS precursors are initiallyintermixed (Streit, 2002). Placodal precursors for the otic vesicle,lens, olfactory epithelium, cranial ganglia and lateral line are alsoinitially intermixed at the 50-60% epiboly (5-6 hpf ) stage in

Table 1. Apoptotic cell death is elevated in the otic vesicle of sox10 mutants

Number of TUNEL-labelled cells in the otic vesicle, mean±±s.e.

Embryo stage (hpf) WT sox10 mutant P( 0±052 n= ( 36.0±11.2)92 n=9) 0.0103

( 52.0±33.003 n= ( 74.0±08.1)21 n=10) 0.0165

( 0±053 n= ( 08.0±19.2)11 n=11) 0.0047

( 62.0±33.004 n= ( 69.0±64.4)21 n=11) 0.0013

Table 2. Apoptotic cell death is elevated in the statoacoustic ganglion of sox10 mutants

Number of TUNEL-labelled cells in the SAG, mean±±s.e.

Embryo stage (hpf) WT sox10 mutant P( 0±052 n= ( 13.0±98.0)92 n=9) 0.0207

( 31.0±52.003 n= ( 04.0±5.1)21 n=10) 0.0368

( 0±053 n= ( 32.0±28.0)11 n=11) 0.0047

( 81.0±52.004 n= ( 52.0±46.0)21 n=11) 0.0519

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



zebrafish, but there is already clear anteroposterior organisationin the fate map (Kozlowski et al., 1997). After cell sorting throughextensive cell movements, neural crest cells in the chick embryocontribute to the glia of the VIIIth ganglion and nerve, and to thecartilaginous otic capsule (Le Lièvre, 1978; Noden, 1978; D’Amico-Martel and Noden, 1983; Couly et al., 1993; Le Douarin andKalcheim, 1999). In quail/chick chimeras, neural crest cells wereobserved to contribute to a minority of cells in the vestibular, butnot the acoustic, ganglion (D’Amico-Martel and Noden, 1983);however, this study was not able to follow whether these cellsentered the otic epithelium first before differentiating. Neuralcrest cells have not been shown previously to contribute to theotic epithelium itself, apart from the melanocytes that populatethe stria vascularis, vestibular epithelium and endolymphatic ductof the mammalian ear (Steel and Barkway, 1989). Nevertheless,in fish and amphibian embryos, neural crest cells have been shownto contribute to sensory and supporting cells of the lateral linesystem (Collazo et al., 1994), and previous observations have alsoshown that the neural crest occasionally contributes to thezebrafish ear (T. Schilling, personal communication). In thechick, it has been reported that cells migrating from ventralregions of the neural tube can contribute to the otic vesicle (Aliet al., 2003).

Although melanophores migrate around, and settle close to, theotic vesicle in the zebrafish embryo, they never appear to penetratethe otic epithelium itself – at least during the first five days ofdevelopment. Furthermore, it is unlikely that melanophores play arole in the early stages of zebrafish otic development, ashomozygous nacre/mitfa embryos, which lack melanophores, haveno obvious otic defects or behavioural abnormalities that areindicative of hearing or vestibular dysfunction (Lister et al., 1999;O’Malley et al., 2004). However, using single-cell labelling, we findthat a small population of neural crest cells does contribute to theotic epithelium. Our sample is small, but indicates that these cellsusually only transiently incorporate into the otic epithelium; in onecase, such cells contributed a neuron to the SAG, but in all othercases (n=4) these cells subsequently disappeared. It is perhaps notsurprising that neural crest cells can contribute to the oticepithelium, since otic and neural crest precursors initially sharethe expression of several genes (including the soxE genes). Weestimate that the neural crest contribution to the ear is small, withthe vast majority of cells still being placodal in origin. Therefore,we think it unlikely that loss of these cells contributes significantlyto the otic phenotype in sox10 mutant embryos.

The cause of deafness in WS4 individualsThe aetiology of the deafness in WS4 individuals who carry SOX10mutations is not straightforward. In the Waardenburg syndromes,together with other pigmentation and deafness variant syndromes,hearing loss is generally attributed to the loss of intermediate cells(melanocytes) in the stria vascularis of the cochlea, where they playa vital role in the maintenance of endolymph volume and theendocochlear potential and, ultimately, in hair cell survival (Steel andBarkway, 1989; Tachibana, 1999). Phenotypic analysis of mousemodels of the WS syndromes has, thus, concentrated almostexclusively on the melanocyte phenotype. For example, in micecarrying homozygous mutations in the Ednrb or Mitf genes, the striavascularis lacks melanocytes, leading to an endolymphatic collapseand degeneration of hair cells in the organ of Corti (Tachibana et al.,1992; Matsushima et al., 2002; Tachibana et al., 2003).

Sox10 differs from other pigmentation pathway genes (Edn3,Ednrb, Pax3 and Mitf) in that it is strongly expressed both in theneural crest and the otic epithelium, a pattern that is highlyconserved in both fish and mammals. As a result, it is possible thatdeafness in WS4 individuals who carry SOX10 mutations not onlyresults from a deficit of melanocytes in the ear, but also reflectsadditional roles for SOX10 in the otic epithelium. Interestingly, inthe mouse models, hearing loss does not always correlate withmelanocyte defects: melanocytes are still present in theheterozygous Sox10Dom mouse ear and the endolymph volumeappears normal. In occasional individuals with hearing loss,vacuoles were found in the stria and spiral ligament, and hair cellswere absent in the organ of Corti (Tachibana et al., 2003; Stanchinaet al., 2006). However, a role for Sox10 in melanocytes of the striais revealed in Sox10Dom/+;Ednrbs/s double mutants, in which a severeloss, or absence, of melanocytes in the ear is seen, representing anenhanced phenotype from that observed in the Ednrbs/s singlemutant. In single and double mutants at birth, analysis of hair cellsin the organ of Corti revealed normal hair cell formation, even inmelanocyte-free ears, suggesting that any subsequent hair cell lossis the result of degeneration (Stanchina et al., 2006).

Fig. 9. Neural crest cells make a minor, and transient, contribution to theotic vesicle. Single premigratory neural crest cells in the rhombomere 4region of WT embryos that have been labelled iontophoretically withrhodamine dextran. The cells are shown at the 10-somite stage, approximately1 hour after labelling (A-C, three different cells). The progeny of single labelledcells that contribute to the otic epithelium are shown at 36 hpf, approximately24 hours after labelling (D-G, four different examples). The insets show close-ups of each cell or clone. Note that occasional progeny incorporated into theotic epithelium include cells in the sensory epithelium of the anterior macula(D). The clone in (E) includes three cells in the otic epithelium, plus one lyingoutside the epithelium. The fate of this latter cell is not known. Bar, 25 μm.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



Although we do not detect haploinsufficiency in the zebrafishsox10 mutant, in humans, SOX10 mutations generally showdominant inheritance, owing to either haploinsufficiency ordominant negative mutations. Our work indicates that it is possible,even likely, that dominant forms of deafness in WS resulting fromSOX10 mutations involve inner ear malformations as well as a deficitof melanocytes. Computed tomography (CT) and other scan studiesinvolving WS individuals have given variable results, with somestudies indicating that inner ear malformations (includingsemicircular canal malformations) might be common in WS(Nemansky and Hageman, 1975; Higashi et al., 1992; Madden et al.,2003) and others indicating that cochlear defects in WS are rare,making these individuals good candidates for cochlear implanttherapy (Cullen et al., 2006; Daneshi et al., 2005) (reviewed by Oysuet al., 2001). Temporal bone CT scans have been described for fourpatients known to be carrying mutations or heterozygous deletionsin SOX10. Interestingly, three of these patients had severemorphological abnormalities of the inner ear: a WS4 patient carryinga SOX10 mutation had bilateral semicircular canal agenesis (Sznajeret al., 2008); a PCWH patient, carrying a large heterozygous deletionencompassing the entire SOX10 gene, had bilateral semicircular canalhypoplasia and vestibular malformation; and a WS2 patient, carryinga smaller heterozygous deletion within the SOX10 gene, hadsemicircular canal hypoplasia and dilatation, together with vestibularmalformation and dilatation (Bondurand et al., 2007). Thesestructural abnormalities correspond well to the defects that mightbe predicted from our analysis of the zebrafish model.

Even if structural abnormalities are not present, the loss ormisexpression of Sox10 target genes in the ear, especially thoseimplicated in deafness such as the connexin genes, could contributeto hearing loss. In the zebrafish sox10 mutant ear, many of the genesthat we examined show complex patterns of misexpression, withloss of normal domains of expression and derepression, or ectopicexpression, elsewhere. In mammalian glia, the connexin genesCX32/GJB1 and CX47 are known targets of Sox10 function(Bondurand et al., 2001; Schlierf et al., 2006). Connexins play crucialroles in the inner ear: mutations in CX26/GJB2 and CX30/GJB6account for the most common form of inherited deafness (DFNB1)in humans, whereas mutations in CX32/GJB1 have been implicatedin causing the sensorineural deafness in Charcot-Marie-Toothdisease (Stojkovic et al., 1999; Lee et al., 2002). Our data indicatethat expression of the orthologous connexin genes cx27.5 and cx33.8is lost in zebrafish sox10 mutant ears at 72-74 hpf. Although lossof expression may partly be explained by the loss of the lateral crista,it is possible that the direct or indirect downregulation of connexin

gene expression could contribute to the hearing loss in individualscarrying SOX10 mutations.

Studies of Sox10 targets in mammalian neural crest derivativessuggest that Sox10 function is dose sensitive in the mammal, raisingthe possibility that similar patterning defects might occur in the earsof mammals heterozygous for Sox10 mutations. Any structuralabnormalities may be attributed to a requirement for Sox10 in earlypatterning of the otic vesicle. Disruption to endolymph homeostasismight result from the loss of melanocytes in the stria vascularis,and/or through abnormal functioning of gap junctions owing todownregulation of connexin gene expression, or, alternatively, fromabnormalities in the endolymphatic duct. We conclude that deafnessin mammals carrying Sox10 mutations is likely to be complex inorigin, reflecting a direct role for Sox10 in otic placodal derivatives.

METHODSFish husbandryZebrafish (Danio rerio) embryos were obtained through naturalcrosses and were staged by morphology (Kimmel et al., 1995). Themutant alleles used in this study were: aceti282a, clst3, clsm618,dogtc257e, hnf1bhi2169Tg, noitu29a, smub641 and vgotm90b. Chorions wereremoved with watchmaker’s forceps and the embryos weremaintained in embryo medium (Westerfield, 2000). Living embryoswere mounted in 1.2% low melting point agarose (Eisen et al., 1989),for single cell iontophoretic injection of fluorescent dye, or in 3%methyl cellulose dissolved in embryo medium for later observations,and observed using Nomarski (DIC) optics. Where necessary,embryos were anaesthetised using a dilute solution of tricainemethylsulfonate (MS-222; Sigma). All experiments complied withinstitutional and national animal welfare laws, guidelines andpolicies. Procedures involving fish older than 5 dpf were undertakenunder licence from the UK Home Office.

Morpholino injectionsMorpholinos (Gene Tools; sequences in Table 4) were used to knockdown sox9a and sox9b gene function, both individually and incombination, in clsm618 embryos and their siblings, as describedpreviously (Dutton et al., 2001a). Two morpholinos were used incombination to knock down the expression of each of sox9a andsox9b, and all four morpholinos were used in combination to knockdown the expression of sox9a and sox9b simultaneously (Table 4).Morpholinos were injected into the yolk of embryos prior to the16-cell stage using a Drummond Nanoject II apparatus (DrummondScientific Co., Broomall, PA). Initial experiments showed thatindividual morpholinos generated similar, consistent phenotypes

Table 3. Fates of single neural crest cells in the rhombomere 4 region

Fate n % Notes

eluspac cito ot detubirtnoc taht )%6( sllec xis sedulcnI8314eussit evitcennoc/egalitraC

6171serohpohtnaX

1121serohponaleM

89ailG

55snorueN

tsol erew srehto eht ,GAS eht ni noruen a emaceb llec eno ,fph 27 yB55edocalp citO

66deiD

egami ot tluciffid ro tsol rehtie slleC1121deifitnedinU

001701LATOT

This table shows the fate of labelled, single cell clones at 35-72 hpf, as deduced from cell morphology and location.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



affecting jaw development (sox9a and sox9b) and a curly tail downphenotype (sox9b) over a range of doses; these were fully consistentwith the published mutant and morpholino phenotypes (Liu et al.,2003; Yan et al., 2005). Subsequently, each gene-specific morpholinowas used at a relatively low dose, but in combination to avoid off-target effects. Each embryo received 4.6 ng of each morpholino,or 2.3 ng where both sox9a and sox9b were knocked downsimultaneously. The injection solution was labelled with Phenol Redto allow the distribution of the injected morpholinos to bevisualised. Injected and uninjected control embryos were incubatedat 28.5°C, before processing for marker expression.

Whole-mount in situ hybridisationRNA in situ hybridisation was performed as described previously(Kelsh et al., 2000) with clst3 or clsm618 mutants and theirphenotypically WT siblings. The probes used were: aldh1a3 (Pittliket al., 2008), bmp4 (Hammerschmidt et al., 1996), fgf8 (Guo et al.,1999), fst (Bauer et al., 1998), foxd3 (Odenthal and Nuesslein-Volhard, 1998), foxi1 (Hans et al., 2004), neuroD (Korzh et al., 1998),ngn1 (Blader et al., 1997), pax2a (Hans et al., 2004), pax8 (Hans etal., 2004), sna2 (Thisse et al., 1995), sox9a (Chiang et al., 2001),sox9b (Chiang et al., 2001) and sox10 (Dutton et al., 2001b).

SectioningEmbryos were post-fixed, embedded in paraffin and sectioned ata thickness of 7 μm. Sections were counterstained with Fast Red.Sections in Fig. 8G,H were hand cut (approximately 50 μm).

ImmunocytochemistryAntibody staining with anti-Hu mAb 16A11 (1:500) (Marusich etal., 1994) and anti-Isl1 (DSHB 40.2D6, 1:2000) was performed usingan anti-mouse Alexa 546 fluorescent secondary or an anti-mouse-HRP antibody and developed with DAB. Both antibodies stain twogroups of cells in the vicinity of the otic vesicle, one in ananteroventral position and the other in a posteromedial position.Isl1-positive nuclei (chromogenic stain) were counted individuallyin each group and the numbers for each individual ear were thencombined. Hu-positive cells (fluorescent stain) were counted fromsingle confocal sections of the anterior and posterior SAG cellgroups containing the largest number of cells. Counts from eachgroup were then combined for each ear.

Whole-mount double staining for TUNEL and Hu antibody Embryos were developed for TUNEL staining using a fluoresceinlabel (Dutton et al., 2001b) incubated with alkaline-phosphatase-conjugated anti-fluorescein (Boehringer Mannheim) and developedusing 4-nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate (Boehringer Mannheim). The embryos weresubsequently processed for anti-Hu as detailed inImmunocytochemistry, and developed with DAB.

Microscopy and photographyEmbryos were examined using standard DIC optics or fluorescence,as appropriate on the Nikon Eclipse E800, and photographed usingeither a Canon digital SLR or SPOT camera, or examined on anOlympus BX51 and photographed using either an Olympus C-3030ZOOM camera and AnalySIS software or a CELLB cameraand software. Confocal images were taken using a Zeiss LSM 510or a Leica SP confocal microscope. Images were processed usingAdobe Photoshop. Panels in Fig. 1A-D and Fig. 8D-F are compositesof different focal planes.

Data analysisData were analysed using Prism3.0.

Single-cell labellingIndividual neural crest cells were labelled by iontophoresis, asdescribed previously (Dutton et al., 2001b). Briefly, cells were

Table 4. Sox9 morpholinos used in this study

Gene Morpholino name Morpholino sequence (5 -3 )

Sox9a GGGTCGAGGAGATTCATGCGAACACsox9aSox9a.b CGTAGATGGACGATCTCAGAGAATT

Sox9b TGCAGAGAGAGAGTGTTTGAGTGTGsox9bSox9b.b-3A AGCTGCTGAAACACACACAGATCCT

TRANSLATIONAL IMPACT

Clinical issueThe Waardenburg syndromes are rare genetic disorders characterised by bothdeafness and pigmentation abnormalities. Classically, they are described asneural crest syndromes; the hearing loss in patients has been attributed to theloss of neural-crest-derived pigment cells in the cochlea of the inner ear, wherethese cells play an essential role in hearing. Waardenburg syndrome type IV(WS4) and other variants can be caused by dominant mutations in the SOX10gene, which codes for a transcriptional regulator that is essential for pigmentcell development. However, SOX10 is not only expressed in the neural crest,but also in the developing inner ear itself. This raises the possibility that thehearing loss and other inner ear defects seen in WS4 patients could result fromthe loss of a direct function of SOX10 in the ear, rather than an indirect loss ofneural-crest-derived pigment cells.

ResultsWe have used a zebrafish model of WS4, the colourless/sox10 mutant. Thismutant displays the same spectrum of abnormalities as found in WS4 patients,affecting the ear, pigment cells and enteric neurons. By labelling neural crestcells, we have shown that a few neural crest cells do normally contribute to thezebrafish ear as it develops, but the loss of these cells is unlikely to account forthe severe ear defects found in the mutant. Much more strikingly, the loss ofsox10 function results in gene expression abnormalities in the developing earfrom early stages, including the misregulation of genes coding for signallingmolecules such as Fgf8 and Bmp4. As a result, severe structural and sensoryabnormalities of the ear develop at later stages, including defects in thesemicircular canals, sensory patches and endolymphatic duct. Thus, sox10(together with the related sox9 genes) is crucial for establishing andmaintaining correct patterns of gene expression in the inner ear at early stagesof development.

Implications and future directionsThis study demonstrates a direct role for Sox10 in the developing zebrafish ear,and raises the possibility that hearing loss in WS4 patients carrying SOX10mutations could be compounded by structural and functional deficits inaddition to the loss of neural-crest-derived pigment cells in the inner ear. Ourfindings are corroborated by descriptions of severe inner ear structuralabnormalities in WS patients carrying SOX10 mutations, which would be veryunlikely to result from the loss of pigment cells alone. This work helps us tounderstand the aetiology of the inner ear defects in these patients and toexplain both hearing loss and any vestibular problems in cases of WS causedby SOX10 mutations.

doi:10.1242/dmm.002212

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



injected intracellularly with a 5% solution of lysinated rhodaminedextran (10,000 MW; Molecular Probes, Eugene, OR) dissolved in0.2 M KCl, using glass micropipettes that were pulled on a Flaming-Brown micropipette puller model P-97 (Sutter Instrument Co.,Novato, CA). Micropipette tips were filled with 3-5% lysinatedrhodamine dextran in 0.2 M KCl and the needles backfilled with0.2 M KCl. Premigratory crest cells that were segregated from, andlateral to, the neural keel between the posterior eye and the anteriorboundary of somite one were labelled in embryos at the eight-somite stage. Only embryos with single labelled crest cells wereanalysed. Labelled cells were monitored visually using both DICand fluorescence on a model BX50WI microscope (Olympus), butdocumented using confocal imaging with an LSM 510 (Zeiss), thenprocessed using Adobe Photoshop. Cells were then monitored twicedaily for 3 days until the progeny could be identified based on theirmorphology and location. Progeny fates were identified by themorphological characteristics described previously (Raible et al.,1992; Raible and Eisen, 1994; Schilling and Kimmel, 1994; Duttonet al., 2001b). Thus, melanophores contained melanin granules,xanthophores were visibly yellow and fluoresced at a wavelengthnear that of fluorescein, iridophores contained iridescent granules,cartilage formed characteristic stacks of vacuolated cells, neuronshad axons and were appropriately positioned, and glia wereassociated with axonal processes. Otic cells were defined as thoseincorporated into the otic epithelium. Although connective tissuehas been described as a fate for neural crest cells in the head(Schilling and Kimmel, 1994), these cells, along with cells inpositions with limited optical resolution or that were notmorphologically identifiable as one of the above cell types, werecategorised as unidentified.

FITC-phalloidin stainingEmbryos were fixed, permeabilised and stained with 2.5 μg/mlFITC-phalloidin as described previously (Haddon and Lewis, 1996).For dorsal views in older embryos, ears were dissected beforemounting. Embryos or dissected ears were mounted in Vectashield(Vector labs) and imaged with a Leica SP confocal microscope.ACKNOWLEDGEMENTSThis work was funded by the Wellcome Trust (063998). L.A. and C.M. were fundedby the MRC (G0300196, G78/5898). M.N. was funded by a Wellcome Trust VIPaward (083770). We thank Iryna Whittington for expert sectioning, Richard Squireand Marc Shedden for expert fish care in Bath, Dora Sapède for sending hnf1bmutants, and many members of the zebrafish community for sharing probes. Wethank Melanie Cotterill, Laina Murphy and Jill Shepherd for technical support andLisa van Hateren and the Sheffield aquarium staff for care of the Sheffield fishstocks. Confocal imaging for Fig. 7 was carried out in the Sheffield LightMicroscopy Facility, funded by grants from Yorkshire Cancer Research and theWellcome Trust (GR077544AIA), and for Figs 8 and 9 in the Bath BioimagingCentre, funded by the Wellcome Trust (GR077454/Z/05/Z). The CDBG zebrafishfacility was supported by the MRC (G0400100, G0700091) and the EU FP6 (ZF-MODELS). The University of Bath zebrafish aquarium was supported by aWellcome Trust Equipment Grant (066326).

COMPETING INTERESTSThe authors declare no competing financial interests.

AUTHOR CONTRIBUTIONSR.N.K. and T.T.W. developed the concepts and approach; K.D., L.A., J.S., C.B., C.M.and M.N. performed experiments; K.D., L.A., C.M., M.N., R.N.K. and T.T.W. analysedthe data; R.N.K. and T.T.W. prepared and edited the manuscript.

SUPPLEMENTARY MATERIALSupplementary material for this article is available athttp://dmm.biologists.org/cgi/content/full/2/1-2/68/suppl/DC1

Received 18 July 2008; Accepted 12 November 2008.

REFERENCESAli, M. M., Jayabalan, S., Machnicki, M. and Sohal, G. S. (2003). Ventrally emigrating

neural tube cells migrate into the developing vestibulocochlear nerve and oticvesicle. Int. J. Dev. Neurosci. 21, 199-208.

Aoki, Y., Saint-Germain, N., Gyda, M., Magner-Fink, E., Lee, Y. H., Credidio, C. andSaint-Jeannet, J. P. (2003). Sox10 regulates the development of neural crest-derivedmelanocytes in Xenopus. Dev. Biol. 259, 19-33.

Barresi, M. J., Stickney, H. L. and Devoto, S. H. (2000). The zebrafish slow-muscle-omitted gene product is required for Hedgehog signal transduction and thedevelopment of slow muscle identity. Development 127, 2189-2199.

Barrionuevo, F., Naumann, A., Bagheri-Fam, S., Speth, V., Taketo, M. M., Scherer,G. and Neubuser, A. (2008). Sox9 is required for invagination of the otic placode inmice. Dev. Biol. 317, 213-224.

Bauer, H., Meier, A., Hild, M., Stachel, S., Economides, A., Hazelett, D., Harland, R.M. and Hammerschmidt, M. (1998). Follistatin and noggin are excluded from thezebrafish organizer. Dev. Biol. 204, 488-507.

Blader, P., Fischer, N., Gradwohl, G., Guillemot, F. and Strahle, U. (1997). The activityof Neurogenin1 is controlled by local cues in the zebrafish embryo. Development124, 4557-4569.

Bondurand, N., Kobetz, A., Pingault, V., Lemort, N., EnchaRazavi, F., Couly, G.,Goerich, D. E., Wegner, M., Abitbol, M. and Goossens, M. (1998). Expression of theSOX10 gene during human development. FEBS Lett. 432, 168-172.

Bondurand, N., Pingault, V., Goerich, D. E., Lemort, N., Sock, E., Caignec, C. L.,Wegner, M. and Goossens, M. (2000). Interaction among SOX10, PAX3 and MITF,three genes altered in Waardenburg syndrome. Hum. Mol. Genet. 9, 1907-1917.

Bondurand, N., Girard, M., Pingault, V., Lemort, N., Dubourg, O. and Goossens, M.(2001). Human Connexin 32, a gap junction protein altered in the X-linked form ofCharcot-Marie-Tooth disease, is directly regulated by the transcription factor SOX10.Hum. Mol. Genet. 10, 2783-2795.

Bondurand, N., Dastot-Le Moal, F., Stanchina, L., Collot, N., Baral, V., Marlin, S.,Attie-Bitach, T., Giurgea, I., Skopinski, L., Reardon, W. et al. (2007). Deletions atthe SOX10 gene locus cause Waardenburg syndrome types 2 and 4. Am. J. Hum.Genet. 81, 1169-1185.

Britsch, S., Goerich, D. E., Riethmacher, D., Peirano, R. I., Rossner, M., Nave, K. A.,Birchmeier, C. and Wegner, M. (2001). The transcription factor Sox10 is a keyregulator of peripheral glial development. Genes Dev. 15, 66-78.

Busch-Nentwich, E., Söllner, C., Roehl, H. and Nicolson, T. (2004). The deafness genedfna5 is crucial for ugdh expression and HA production in the developing ear inzebrafish. Development 131, 943-951.

Cable, J., Barkway, C. and Steel, K. P. (1992). Characteristics of stria vascularismelanocytes of viable dominant spotting (Wv/Wv) mouse mutants. Hear. Res. 64, 6-20.

Cable, J., Jackson, I. J. and Steel, K. P. (1993). Light (Blt), a mutation that causesmelanocyte death, affects stria vascularis function in the mouse inner ear. PigmentCell Res. 6, 215-225.

Cable, J., Huszar, D., Jaenisch, R. and Steel, K. P. (1994). Effects of mutations at the Wlocus (c-kit) on inner ear pigmentation and function in the mouse. Pigment Cell Res.7, 17-32.

Carney, T. J., Dutton, K. A., Greenhill, E., Delfino-Machin, M., Dufourcq, P., Blader,P. and Kelsh, R. N. (2006). A direct role for Sox10 in specification of neural crest-derived sensory neurons. Development 133, 4619-4630.

Cheng, Y., Cheung, M., Abu-Elmagd, M. M., Orme, A. and Scotting, P. J. (2000).Chick Sox10, a transcription factor expressed in both early neural crest cells andcentral nervous system. Brain Res. Dev. Brain Res. 121, 233-241.

Chiang, E. F., Pai, C. I., Wyatt, M., Yan, Y. L., Postlethwait, J. and Chung, B. (2001).Two sox9 genes on duplicated zebrafish chromosomes: expression of similartranscription activators in distinct sites. Dev. Biol. 231, 149-163.

Collazo, A., Fraser, S. E. and Mabee, P. M. (1994). A dual embryonic origin forvertebrate mechanoreceptors. Science 264, 426-430.

Couly, G. F., Coltey, P. M. and Le Douarin, N. M. (1993). The triple origin of skull inhigher vertebrates: a study in quail-chick chimeras. Development 117, 409-429.

Cullen, R. D., Zdanski, C., Roush, P., Brown, C., Teagle, H., Pillsbury, H. C. 3rd andBuchman, C. (2006). Cochlear implants in Waardenburg syndrome. Laryngoscope116, 1273-1275.

D’Amico-Martel, A. and Noden, D. M. (1983). Contributions of placodal and neuralcrest cells to avian cranial peripheral ganglia. Am. J. Anat. 166, 445-468.

Daneshi, A., Hassanzadeh, S. and Farhadi, M. (2005). Cochlear implantation inchildren with Waardenburg syndrome. J. Laryngol. Otol. 119, 719-723.

Dutton, K., Dutton, J. R., Pauliny, A. and Kelsh, R. N. (2001a). A morpholinophenocopy of the colourless mutant. Genesis 30, 188-189.

Dutton, K. A., Pauliny, A., Lopes, S. S., Elworthy, S., Carney, T. J., Rauch, J., Geisler,R., Haffter, P. and Kelsh, R. N. (2001b). Zebrafish colourless encodes sox10 andspecifies non-ectomesenchymal neural crest fates. Development 128, 4113-4125.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



Eastman, S. D., Chen, T. H.-P., Falk, M. M., Mendelson, T. C. and Iovine, M. K. (2006).Phylogenetic analysis of three complete gap junction gene families reveals lineage-specific duplications and highly supported gene classes. Genomics 87, 265-274.

Edery, P., Atti’e, T., Amiel, J., Pelet, A., Eng, C., Hofstra, R. M., Martelli, H., Bidaud,C., Munnich, A. and Lyonnet, S. (1996). Mutation of the endothelin-3 gene in theWaardenburg-Hirschsprung disease (Shah-Waardenburg syndrome). Nat. Genet. 12,442-444.

Eisen, J. S., Pike, S. H. and Debu, B. (1989). The growth cones of identifiedmotoneurons in embryonic zebrafish select appropriate pathways in the absence ofspecific cellular interactions. Neuron 2, 1097-1104.

Elworthy, S., Lister, J. A., Carney, T. J., Raible, D. W. and Kelsh, R. N. (2003).Transcriptional regulation of mitfa accounts for the sox10 requirement in zebrafishmelanophore development. Development 130, 2809-2818.

Elworthy, S., Pinto, J. P., Pettifer, A., Cancela, M. L. and Kelsh, R. N. (2005). Phox2bfunction in the enteric nervous system is conserved in zebrafish and is sox10-dependent. Mech. Dev. 122, 659-669.

Escobar, C., Zuasti, A., Ferrer, C. and Garcia-Ortega, F. (1995). Melanocytes in thestria vascularis and vestibular labyrinth of the Mongolian gerbil (Merionesunguiculatus). Pigment Cell Res. 8, 271-278.

Evans, D. J. and Noden, D. M. (2006). Spatial relations between avian craniofacialneural crest and paraxial mesoderm cells. Dev. Dyn. 235, 1310-1325.

Grant, K. A., Raible, D. W. and Piotrowski, T. (2005). Regulation of latent sensory haircell precursors by glia in the zebrafish lateral line. Neuron 45, 69-80.

Guo, S., Brush, J., Teraoka, H., Goddard, A., Wilson, S. W., Mullins, M. C. andRosenthal, A. (1999). Development of noradrenergic neurons in the zebrafishhindbrain requires BMP, FGF8, and the homeodomain protein soulless/Phox2a.Neuron 24, 555-566.

Haddon, C. and Lewis, J. (1996). Early ear development in the embryo of thezebrafish, Danio rerio. J. Comp. Neurol. 365, 113-123.

Haddon, C., Jiang, Y.-J., Smithers, L. and Lewis, J. (1998). Delta-Notch signalling andthe patterning of sensory cell differentiation in the zebrafish ear: evidence from themind bomb mutant. Development 125, 4637-4644.

Hammerschmidt, M., Serbedzija, G. N. and McMahon, A. P. (1996). Genetic analysisof dorsoventral pattern-formation in the zebrafish: requirement of a BMP-likeventralizing activity and its dorsal repressor. Genes Dev. 10, 2452-2461.

Hammond, K., Hill, R. E., Whitfield, T. T. and Currie, P. D. (2002). Isolation of threezebrafish dachshund homologues and their expression in sensory organs, the centralnervous system and pectoral fin buds. Mech. Dev. 112, 183-189.

Hammond, K. L., Loynes, H. E., Folarin, A. A., Smith, J. and Whitfield, T. T. (2003).Hedgehog signalling is required for correct anteroposterior patterning of thezebrafish otic vesicle. Development 130, 1403-1417.

Hans, S., Liu, D. and Westerfield, M. (2004). Pax8 and Pax2a function synergistically inotic specification, downstream of the Foxi1 and Dlx3b transcription factors.Development 131, 5091-5102.

Hans, S., Christison, J., Liu, D. and Westerfield, M. (2007). Fgf-dependent oticinduction requires competence provided by Foxi1 and Dlx3b. BMC Dev. Biol. 7, 5.

Higashi, K., Matsuki, C. and Sarashina, N. (1992). Aplasia of posterior semicircularcanal in Waardenburg syndrome type II. J. Otolaryngol. 21, 262-264.

Hofstra, R. M., Osinga, J., Tan-Sindhunata, G., Wu, Y., Kamsteeg, E. J., Stulp, R. P.,van Ravenswaaij-Arts, C., Majoor-Krakauer, D., Angrist, M., Chakravarti, A. et al.(1996). A homozygous mutation in the endothelin-3 gene associated with acombined Waardenburg type 2 and Hirschsprung phenotype (Shah-Waardenburgsyndrome). Nat. Genet. 12, 445-447.

Honoré, S. M., Aybar, M. J. and Mayor, R. (2003). Sox10 is required for the earlydevelopment of the prospective neural crest in Xenopus embryos. Dev. Biol. 260, 79-96.

Inoue, K., Tanabe, Y. and Lupski, J. R. (1999). Myelin deficiencies in both the centraland the peripheral nervous systems associated with a SOX10 mutation. Ann. Neurol.46, 313-318.

Inoue, K., Shilo, K., Boerkoel, C. F., Crowe, C., Sawady, J., Lupski, J. R. andAgamanolis, D. P. (2002). Congenital hypomyelinating neuropathy, centraldysmyelination, and Waardenburg-Hirschsprung disease: phenotypes linked bySOX10 mutation. Ann. Neurol. 52, 836-842.

Inoue, K., Khajavi, M., Ohyama, T., Hirabayashi, S., Wilson, J., Reggin, J. D.,Mancias, P., Butler, I. J., Wilkinson, M. F., Wegner, M. et al. (2004). Molecularmechanism for distinct neurological phenotypes conveyed by allelic truncatingmutations. Nat. Genet. 36, 361-369.

Kamachi, Y., Uchikawa, M. and Kondoh, H. (2000). Pairing SOX off: with partners inthe regulation of embryonic development. Trends Genet. 16, 182-187.

Kelsh, R. N. and Eisen, J. S. (2000). The zebrafish colourless gene regulatesdevelopment of non-ectomesenchymal neural crest derivatives. Development 127,515-525.

Kelsh, R. N., Brand, M., Jiang, Y. J., Heisenberg, C. P., Lin, S., Haffter, P., Odenthal,J., Mullins, M. C., van Eeden, F. J., Furutani-Seiki, M. et al. (1996). Zebrafish

pigmentation mutations and the processes of neural crest development.Development 123, 369-389.

Kelsh, R. N., Schmid, B. and Eisen, J. S. (2000). Genetic analysis of melanophoredevelopment in zebrafish embryos. Dev. Biol. 225, 277-293.

Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995).Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253-310.

Korzh, V., Sleptsova, I., Liao, J., He, J. and Gong, Z. (1998). Expression of zebrafishbHLH genes ngn1 and nrd defines distinct stages of neural differentiation. Dev. Dyn.213, 92-104.

Kozlowski, D. J., Murakami, T., Ho, R. K. and Weinberg, E. S. (1997). Regional cellmovement and tissue patterning in the zebrafish embryo revealed by fate mappingwith caged fluorescein. Biochem. Cell Biol. 75, 551-562.

Lang, F., Vallon, V., Knipper, M. and Wangemann, P. (2007). Functional significanceof channels and transporters expressed in the inner ear and kidney. Am. J. Physiol.Cell Physiol. 293, C1187-C1208.

Le Douarin, N. M. and Kalcheim, C. (1999). The Neural Crest. Cambridge: CambridgeUniversity Press.

Le Lievre, C. S. (1978). Participation of neural crest-derived cells in the genesis of theskull in birds. J. Embryol. Exp. Morphol. 47, 17-37.

Lecaudey, V., Ulloa, E., Anselme, I., Stedman, A., Schneider-Maunoury, S. andPujades, C. (2007). Role of the hindbrain in patterning the otic vesicle: a study of thezebrafish vhnf1 mutant. Dev. Biol. 303, 134-143.

Lee, M. J., Nelson, I., Houlden, H., Sweeney, M. G., Hilton-Jones, D., Blake, J.,Wood, N. W. and Reilly, M. M. (2002). Six novel connexin32 (GJB1) mutations in X-linked Charcot-Marie-Tooth disease. J. Neurol. Neurosurg. Psychiatry 73, 304-306.

Léger, S. and Brand, M. (2002). Fgf8 and Fgf3 are required for zebrafish ear placodeinduction, maintenance and inner ear patterning. Mech. Dev. 119, 91-108.

Li, M., Zhao, C., Wang, Y., Zhao, Z. and Meng, A. (2002). Zebrafish sox9b is an earlyneural crest marker. Dev. Genes Evol. 212, 203-206.

Lister, J. A., Robertson, C. P., Lepage, T., Johnson, S. L. and Raible, D. W. (1999).nacre encodes a zebrafish microphthalmia-related protein that regulates neural-crest-derived pigment cell fate. Development 126, 3757-3767.

Liu, D., Chu, H., Maves, L., Yan, Y. L., Morcos, P. A., Postlethwait, J. H. andWesterfield, M. (2003). Fgf3 and Fgf8 dependent and independent transcriptionfactors are required for otic placode specification. Development 130, 2213-2224.

López-Schier, H. and Hudspeth, A. J. (2005). Supernumerary neuromasts in theposterior lateral line of zebrafish lacking peripheral glia. Proc. Natl. Acad. Sci. USA 102,1496-1501.

Mackereth, M. D., Kwak, S. J., Fritz, A. and Riley, B. B. (2005). Zebrafish pax8 isrequired for otic placode induction and plays a redundant role with Pax2 genes inthe maintenance of the otic placode. Development 132, 371-382.

Madden, C., Halsted, M. J., Hopkin, R. J., Choo, D. I., Benton, C. and Greinwald, J.H. J. (2003). Temporal bone abnormalities associated with hearing loss inWaardenburg syndrome. Laryngoscope 113, 2035-2041.

Marcus, D. C., Wu, T., Wangemann, P. and Kofuji, P. (2002). KCNJ10 (Kir4.1) potassiumchannel knockout abolishes endocochlear potential. Am. J. Physiol. Cell Physiol. 282,C403-C407.

Maroon, H., Walshe, J., Mahmood, R., Kiefer, P., Dickson, C. and Mason, I. (2002).Fgf3 and Fgf8 are required together for formation of the otic placode and vesicle.Development 129, 2099-2108.

Marusich, M. F., Furneaux, H. M., Henion, P. D. and Weston, J. A. (1994). Huneuronal proteins are expressed in proliferating neurogenic cells. J. Neurobiol. 25,143-155.

Masuda, M., Yamazaki, K., Kanzaki, J. and Hosoda, Y. (1994). Ultrastructure ofmelanocytes in the dark cell area of human vestibular organs: functionalimplications of gap junctions, isolated cilia, and annulate lamellae. Anat. Rec. 240,481-491.

Matsushima, Y., Shinkai, Y., Kobayashi, Y., Sakamoto, M., Kunieda, T. andTachibana, M. (2002). A mouse model of Waardenburg syndrome type 4 with a newspontaneous mutation of the endothelin-B receptor gene. Mamm. Genome 13, 30-35.

Mowbray, C., Hammerschmidt, M. and Whitfield, T. T. (2001). Expression of BMPsignalling pathway members in the developing zebrafish inner ear and lateral line.Mechanisms of Development 108, 179-184.

Nemansky, J. and Hageman, M. J. (1975). Tomographic findings of the inner ears of24 patients with Waardenburg’s syndrome. Am. J. Roentgenol. Radium Ther. Nucl. Med.124, 250-255.

Nissen, R. M., Yan, J., Amsterdam, A., Hopkins, N. and Burgess, S. M. (2003).Zebrafish foxi one modulates cellular responses to Fgf signaling required for theintegrity of ear and jaw patterning. Development 130, 2543-2554.

Noden, D. M. (1978). The control of avian cephalic neural crest cytodifferentiation. I.Skeletal and connective tissues. Dev. Biol. 67, 296-312.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM



O’Malley, D. M., Sankrithi, N. S., Borla, M. A., Parker, S., Banden, S., Gahtan, E. andDetrich, H. W., 3rd. (2004). Optical physiology and locomotor behaviors of wild-typeand nacre zebrafish. Methods Cell Biol. 76, 261-284.

Odenthal, J. and Nuesslein-Volhard, C. (1998). fork head domain genes in zebrafish.Dev. Genes Evol. 208, 245-258.

Oysu, C., Oysu, A., Aslan, I. and Tinaz, M. (2001). Temporal bone imaging findings inWaardenburg’s syndrome. Int. J. Pediatr. Otorhinolaryngol. 58, 215-221.

Paratore, C., Goerich, D. E., Suter, U., Wegner, M. and Sommer, L. (2001). Survivaland glial fate acquisition of neural crest cells are regulated by an interplay betweenthe transcription factor Sox10 and extrinsic combinatorial signaling. Development128, 3949-3961.

Peters, T. A., Kuijpers, W., Tonnaer, E. L., van Muijen, G. N. and Jap, P. H. (1995).Distribution and features of melanocytes during inner ear development inpigmented and albino rats. Hear. Res. 85, 169-180.

Phillips, B. T., Bolding, K. and Riley, B. B. (2001). Zebrafish fgf3 and fgf8 encoderedundant functions required for otic placode induction. Dev. Biol. 235, 351-365.

Pingault, V., Bondurand, N., Kuhlbrodt, K., Goerich, D. E., Prehu, M. O., Puliti, A.,Herbarth, B., Hermans-Borgmeyer, I., Legius, E., Matthijs, G. et al. (1998). SOX10mutations in patients with Waardenburg-Hirschsprung disease. Nat. Genet. 18, 171-173.

Pingault, V., Guiochon-Mantel, A., Bondurand, N., Faure, C., Lacroix, C., Lyonnet,S., Goossens, M. and Landrieu, P. (2000). Peripheral neuropathy withhypomyelination, chronic intestinal pseudo-obstruction and deafness: adevelopmental “neural crest syndrome” related to a SOX10 mutation. Ann. Neurol.48, 671-676.

Pingault, V., Bondurand, N., Le Caignec, C., Tardieu, S., Lemort, N., Dubourg, O., LeGuern, E., Goossens, M. and Boespflug-Tanguy, O. (2001). The SOX10 transcriptionfactor: evaluation as a candidate gene for central and peripheral hereditary myelindisorders. J. Neurol. 248, 496-499.

Pingault, V., Girard, M., Bondurand, N., Dorkins, H., Van Maldergem, L., Mowat, D.,Shimotake, T., Verma, I., Baumann, C. and Goossens, M. (2002). SOX10 mutationsin chronic intestinal pseudo-obstruction suggest a complex physiopathologicalmechanism. Hum. Genet. 111, 198-206.

Piotrowski, T., Ahn, D. G., Schilling, T. F., Nair, S., Ruvinsky, I., Geisler, R., Rauch, G.J., Haffter, P., Zon, L. I., Zhou, Y. et al. (2003). The zebrafish van gogh mutationdisrupts tbx1, which is involved in the DiGeorge deletion syndrome in humans.Development 130, 5043-5052.

Pittlik, S., Domingues, S., Meyer, A. and Begemann, G. (2008). Expression of zebrafishaldh1a3 (raldh3) and absence of aldh1a1 in teleosts. Gene Exp. Patt. 8, 141-147.

Price, E. R. and Fisher, D. E. (2001). Sensorineural deafness and pigmentation genes:melanocytes and the Mitf transcriptional network. Neuron 30, 15-18.

Puffenberger, E., Kauffman, E., Bolk, S., Matise, T., Washington, S., Angrist, M.,Weissenbach, J., Garver, K., Mascari, M., Ladda, R. et al. (1994a). Identity-by-descent and association mapping of a recessive gene for Hirschsprung’s disease onhuman chromosome 13q22. Hum. Mol. Genet. 3, 1217-1225.

Puffenberger, E. G., Hosoda, K., Washington, S. S., Nakao, K., deWit, D.,Yanagisawa, M. and Chakravarti, A. (1994b). A missense mutation of theendothelin-B receptor gene in multigenic Hirschsprung’s disease. Cell 79, 1257-1266.

Pusch, C., Hustert, E., Pfeifer, D., Sudbeck, P., Kist, R., Roe, B., Wang, Z., Balling, R.,Blin, N. and Scherer, G. (1998). The SOX10/Sox10 gene from human and mouse:sequence, expression, and transactivation by the encoded HMG domaintranscription factor. Hum. Genet. 103, 115-123.

Raible, D. W. and Eisen, J. S. (1994). Restriction of neural crest cell fate in the trunk ofthe embryonic zebrafish. Development 120, 495-503.

Raible, D. W., Wood, A., Hodsdon, W., Henion, P. D., Weston, J. A. and Eisen, J. S.(1992). Segregation and early dispersal of neural crest cells in the embryoniczebrafish. Dev. Dyn. 195, 29-42.

Rau, M. J., Fischer, S. and Neumann, C. J. (2006). Zebrafish Trap230/Med12 isrequired as a coactivator for Sox9-dependent neural crest, cartilage and eardevelopment. Dev. Biol. 296, 83-93.

Read, A. P. and Newton, V. E. (1997). Waardenburg syndrome. J. Med. Genet. 34, 656-665.

Saint-Germain, N., Lee, Y.-H., Zhang, Y., Sargent, T. D. and Saint-Jeannet, J.-P.(2004). Specification of the otic placode depends on Sox9 function in Xenopus.Development 131, 1755-1763.

Schilling, T. F. and Kimmel, C. B. (1994). Segment and cell type lineage restrictionsduring pharyngeal arch development in the zebrafish embryo. Development 120,483-494.

Schlierf, B., Werner, T., Glaser, G. and Wegner, M. (2006). Expression of connexin47 inoligodendrocytes is regulated by the Sox10 transcription factor. J. Mol. Biol. 361, 11-21.

Solomon, K. S., Kwak, S.-J. and Fritz, A. (2004). Genetic interactions underlying oticplacode induction and formation. Dev. Dyn. 230, 419-433.

Sonnenberg-Riethmacher, E., Miehe, M., Stolt, C. C., Goerich, D. E., Wegner, M. andRiethmacher, D. (2001). Development and degeneration of dorsal root ganglia inthe absence of the HMG-domain transcription factor Sox10. Mech. Dev. 109, 253-265.

Southard-Smith, E. M., Collins, J. E., Ellison, J. S., Smith, K. J., Baxevanis, A. D.,Touchman, J. W., Green, E. D., Dunham, I. and Pavan, W. J. (1999). Comparativeanalyses of the Dominant megacolon-SOX10 genomic interval in mouse and human.Mamm. Genome 10, 744-749.

Spritz, R. A. (2006). Melanoblast Development and Associated Disorders. In ThePigmentary System: Physiology and Pathophysiology (eds J. J. Nordlund, R. E. Boissy, V.J. Hearing, R. A. King, W. S. Oetting and J.-P. Ortonne), pp. 140-154. New York: OxfordUniversity Press.

Stanchina, L., Baral, V., Robert, F., Pingault, V., Lemort, N., Pachnis, V., Goossens,M. and Bondurand, N. (2006). Interactions between Sox10, Edn3 and Ednrb duringenteric nervous system and melanocyte development. Dev. Biol. 295, 232-249.

Steel, K. P. (1995). Inherited hearing defects in mice. Ann. Rev. Genet. 29, 675-701.Steel, K. P. and Barkway, C. (1989). Another role for melanocytes: their importance for

normal stria vascularis development in the mammalian inner ear. Development 107,453-463.

Stojkovic, T., Latour, P., Vandenberghe, A., Hurtevent, J. F. and Vermersch, P.(1999). Sensorineural deafness in X-linked Charcot-Marie-Tooth disease withconnexin 32 mutation (R142Q). Neurology 52, 1010-1014.

Streit, A. (2002). Extensive cell movements accompany formation of the otic placode.Dev. Biol. 249, 237-254.

Sznajer, Y., Coldéa, C., Meire, F., Delpierre, I., Sekhara, T. and Touraine, R. L. (2008).A de novo SOX10 mutation causing severe type 4 Waardenburg syndrome withoutHirschsprung disease. Am. J. Med. Genet. A 146, 1038-1041.

Tachibana, M. (1999). Sound needs sound melanocytes to be heard. Pigment Cell Res.12, 344-354.

Tachibana, M., Hara, Y., Vyas, D., Hodgkinson, C., Fex, J., Grundfast, K. andArnheiter, H. (1992). Cochlear disorder associated with melanocyte anomaly in micewith a transgenic insertional mutation. Mol. Cell. Neurosci. 3, 433-445.

Tachibana, M., Kobayashi, Y. and Matsushima, Y. (2003). Mouse models for fourtypes of Waardenburg syndrome. Pigment Cell Res. 16, 448-454.

Taylor, K. M. and Labonne, C. (2005). SoxE factors function equivalently during neuralcrest and inner ear development and their activity is regulated by SUMOylation. Dev.Cell 9, 593-603.

Thisse, C., Thisse, B. and Postlethwait, J. H. (1995). Expression of snail2, a secondmember of the zebrafish snail family, in cephalic mesendoderm and presumptiveneural crest of wild-type and spadetail mutant embryos. Dev. Biol. 172, 86-99.

Verheij, J. B., Sival, D. A., van der Hoeven, J. H., Vos, Y. J., Meiners, L. C., Brouwer,O. F. and van Essen, A. J. (2006). Shah-Waardenburg syndrome and PCWHassociated with SOX10 mutations: a case report and review of the literature. Eur. J.Paediatr. Neurol. 10, 11-17.

Wangemann, P. (2002). K+ cycling and the endocochlear potential. Hear. Res. 165, 1-9.Wangemann, P. (2006). Supporting sensory transduction: cochlear fluid homeostasis

and the endocochlear potential. J. Physiol. 576, 11-21.Wangemann, P., Itza, E. M., Albrecht, B., Wu, T., Jabba, S. V., Maganti, R. J., Lee, J.

H., Everett, L. A., Wall, S. M., Royaux, I. E. et al. (2004). Loss of KCNJ10 proteinexpression abolishes endocochlear potential and causes deafness in Pendredsyndrome mouse model. BMC Med. 2, 30.

Watanabe, K., Takeda, K., Katori, Y., Ikeda, K., Oshima, T., Yasumoto, K., Saito, H.,Takasaka, T. and Shibahara, S. (2000). Expression of the Sox10 gene during mouseinner ear development. Brain Res. Mol. Brain Res. 84, 141-145.

Wegner, M. (1999). From head to toes: the multiple facets of Sox proteins. Nucleic AcidsRes. 27, 1409-1420.

Westerfield, M. (2000). The zebrafish book. A guide for the laboratory use of zebrafish(Danio rerio). Eugene: Univ. of Oregon Press.

Whitfield, T., Granato, M., van Eeden, F., Schach, U., Brand, M., Furutani-Seiki, M.,Haffter, P., Hammerschmidt, M., Heisenberg, C., Jiang, Y. et al. (1996). Mutationsaffecting development of the zebrafish inner ear and lateral line. Development 123,241-254.

Yan, Y. L., Miller, C. T., Nissen, R. M., Singer, A., Liu, D., Kirn, A., Draper, B.,Willoughby, J., Morcos, P. A., Amsterdam, A. et al. (2002). A zebrafish sox9 generequired for cartilage morphogenesis. Development 129, 5065-5079.

Yan, Y. L., Willoughby, J., Liu, D., Crump, J. G., Wilson, C., Miller, C. T., Singer, A.,Kimmel, C., Westerfield, M. and Postlethwait, J. H. (2005). A pair of Sox: distinctand overlapping functions of zebrafish sox9 co-orthologs in craniofacial and pectoralfin development. Development 132, 1069-1083.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM

a zebrafish model for waardenburg syndrome type iv reveals ... · a zebrafish model for waardenburg...

Documents