Detection of small intragenic deletions usingtargeted comparative genomic hybridization

Today’s agenda

Welcome — Dr. Mike Evans

Detection of small intragenic deletions using targeted comparative genomic hybridization — Dr. Madhuri Hegde

Closing remarks

Innovative clinical genetics and diagnostic solutions to advance molecular medicine

• Founded by Ed Southern in 1995• 64 people• State-of-the-art facilities• 3 core brands

OGT Begbroke: Corporate offices and high throughput labs

OGT Southern Centre: Biomarker discovery

CytoSure cytogenetics range

high quality data

meaningful results

standardisation

• Arrays• ISCA, UPD and Syndrome Plus• Chromosome X• Aneuploidy• DMD*• Oligome custom arrays • New! Modified Emory panel designs

• Labelling kits / sample tracking spikes

• Software

• Reagents and consumables

• Full automation options

• CytoSure Services

* Not available in USA

The OGT aCGH design process

aCGH arrays

All possible human genome probes

OligomeTM database

Further selection based on OGT probe rating and desired coverage and content

Selection based on specificity, Tm, GC, etc.

Design & hyb two different aCGH arrays

Optimised aCGH design = PRODUCT

Selection of best performing probes based on experimental results

Today’s agenda

Welcome — Dr. Mike Evans

Detection of small intragenic deletions using targeted comparative genomic hybridization — Dr. Madhuri Hegde

Closing remarks

Detection of Small intragenic Deletions Using Targeted

Comparative Genomic Hybridization

MadhuriHegde, Ph.D., FACMGAssociate Professor

Scientific Director, Emory Genetics LaboratoryDepartment of Human Genetics

Emory UniversityAtlanta, GA

Scherer et al. (2007)Nat Genet 39:s7-s15

GenomicVariation

G-banded karyotype

FISH

Microarray

(~5 Mb)

aCGH

FISH

MLPA

Real-Time PCR

Deletion/Duplication Detection Methodology in clinical diagnostics

PurposeWith the help of few examples of small deletions mapped in our laboratory,

-illustrate the success of this technology-demonstrate the detection limits, and-discuss the lessons learnt thus far

Scope

Small intragenic deletions (~2.5 kb and shorter)

Outline

Introduction-Array design @ EGL-Examples of deletions

Examples of small deletions mapped-Autosomal recessive disease gene PAH-Autosomal dominant disease gene SKT11-X-linked gene HPRT1 and EMD

obvious ones

Near the detection

limit

A. GeneTargeted

C. Whole Genome

B. GeneTargetedwith Backbone

Probe distribution

Probe densityKeeping a balance: decrease redundancy while not compromising of sensitivity

Duplication of Ex44

Exon-centric multi-gene high density array

Designed to detect CNVs encompassing single and multiple exon

Increase the cost-effectiveness without compromising on sensitivity

4x180k 4x180k 8x60k EGL_XLIDplus_v2 EGL_NMD_NBSplus_v2 EGL_DMDplus_V2

ASD 8784 ASD 8784 Cancer 9598 Cancer 9598 CDG 4908 CDG 4908

Congenital abnormality 13373 Congenital abnormality 13373

Congenital heart disease 16421 Congenital heart disease 16421 Cystic 12271 Cystic 12271 Diabetes 941 Eyes 961 Eyes 961 Growth disorder 51 Growth disorder 51 Hearing Loss 2392 Hemoglobinopathy 42 Hemoglobinopathy 42 Leukodystrophy 2273 LSD 6596 Metabolic 8742 Mitochondrial 485 Mitochondrial 485 MR 7704 NBS 14149 NMD 47414 NMD 47414Others 5874 Others 5874 XLMR 77999 DMD 12713

Examples of intragenic deletions

Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC)

Autosomal dominant inheritance37 year old male personal and a family history of multiple cutaneousleiomyomatosis

exons 10 9 8 7 6 5 4 3 2 1

Familial mutation:Deletion ~ 19 kb encompassing exon 2 to 9 of the FH gene

FH gene (~22 kb)

+1

-1

0

Deletion ~ 19 kb

2 year old East Indian male with a biochemical diagnosis of MSUD.

Maple Syrup Urine DiseaseAutosomal Recessive inheritance

c.871C>T (p.R291X) nonsense mutation in exon 7 of DBT gene identified

exons 11 5 4 3 2 1

Deletion ~ 3.7 kb encompassing exon 5of the DBT gene

DBT gene (~63 kb)

+1

-1

0

Deletion 3.7 kb

-0.6

~-0.8

Even Shorter Intragenic Deletions (< 2.5 kb)

PAHPhenylketonuria (PKU)

Autosomal recessive inheritance- two mutations in trans

Metabolic disorder- biochemical profile adds to clinical suspicion

PKU case 1

• Age: 6.6 years• Gender: male• Ethnicity: Hispanic

Established patient of PKUCurrently enrolled in the Kuvan study at Emory

One copy of the c.838G>A (p.E280K) missense mutation in exon 7 of PAH gene

PKU case 2

• Age: 4 months• Gender: female• Ethnicity: Hispanic

Picked up on NBS, Elevated plasma phenylalanine.

One copy of the IVS12+1G>A splice donor site mutation

Patient

ReferenceGAA GlutamicacidAAA Lysine

Patient

Reference

Exon 12 Intron 12

exons

PAH gene (~79 kb)

13 9 6 3 1

PKU case 1

PKU case 2

868 bp

1,286 bp

Exon 6Exon 7

Two unrelated individuals with the same deletion

PKU case 1

PKU case 2

PAH gene

Allele 1 1134 bp

Allele 2 ~350 bp

100

200300

case 1 case 2

Allele specific PCR

Green: Repeat masker

Red: polymorphisms (SNP)

CAPITAL: exon

Underlined: primers

Breakpoint within a SINE: MIRb family

Breakpoint within a exon 6

Red box: “CT” is the microhomology at breakpoints.

868 bp

1,286 bp

800 bp800 bp Partial exon 6 deletion

Exon 6Exon 7 Intron 6

PKU case 1

PKU case 2

Note: breakpoint within an element

STK11Peutz-Jeghers syndrome (PJS)

Autosomal dominant inheritance- one mutation

Clinical Presentation & Family History

• Age: 30 years• Gender: female• Ethnicity: Caucasian

Personal history of polyps and intussusceptions and

family history of cancer; paternal aunt with breast cancer and paternal grandmother with pancreatic cancer.

exons

STK11 gene (~22 kb)

+1

-1

0

1 2 3 4,5 6 7 8 9 10

1076 bp

exons 2 3 4AluY

+1

-1

0

Exon3Intron2 Intron3Exon2 Exon 4Intron1

INT1_1F ex2_1F INT2_1F INT2_2F INT2_3F INT3_1R INT3_2R INT3_3R INT3_4R andINT3_5R

Possible deletion encompassing exon 3

Designing allele specific PCR

Exon3Intron2 Intron3Exon2 Exon 4Intron1

INT2_2F INT3_1R INT3_2R INT3_3R INT3_4R andINT3_5R

Data indicates a possible deletion of ~1kb.

Expected band size in bp 678 1130 1324 1580 1595

Possible exon 3 deletion

Proximal breakpoint 1170072 in intron 2

Distal breakpoint 1171039 in intron 3

Reference

Reference

Patient

Patient

exons 2 3 4

1076 bp

967 bp

AluY

+1

-1

0

Note: breakpoints outside of element

A few probes that did not perform ideally were unique

HPRT1Lesch-Nyhan Syndrome

X-linked inheritance- one mutation

Clinical Presentation & Family History

Lesch-Nyhan case

Pending prenatal24 year old female for carrier testing for afamilial HPRT1 mutation

?

?

exons

HPRT1 gene (~40.5 kb)

1 2 3 4 5 6 7,8 9

+1

-1

0

-5

?

?

2,780 bp

Exon 5 is 18 bp

+1

-1

0

-5

Exon 5

Max (2757bp)

Min (381bp)

Int4_1

Int4_2

Int4_3

Int4_4

Intron 4 Intron 5

Int5_4

HPRT_Int5_5R

Int5_6Int5_2

Int5_1 Int5_3 Int5_5

HPRT_Int4_1F

HPRT_Int4_2F HPRT_Int5_5R

2745 bp fragment expected in wild type

2657 bp fragment expected in wild type

88bp size difference 500-400-300-

500-400-300-

Mapped a total of 380 bp in the amplicon157 bp of intron 4 69 bp insertion154 bp of intron 5

157 bp of intron 4 69 bp insertion

The Inserted 69 bpsequence match best on a gene desert on Chromsome 5.

ATTCTAGTGATGTTTTCAGGCCTCAGGGGGCGGGTTGGGGGTGGTGGAGGTGGTGTGTATAATATCACT

EMD case

• Age: 46 year• Gender: male• Ethnicity: caucasian

Wt

Ex1 Ex2 Ex3 Ex1 Ex2 Ex3 Ex1 Ex2 Ex3

Pt. water

Exon 1 and 2 did not amplify for the patient

exons

EMD gene (~2 kb)

+1

-1

0

1 2 3 4 5 6

-2

-3

-4

-5

exons 1 2

252 bp+1

-1

0

-5

Forward Primer 1F 1FReverse Primer 2R 3R

Wt Pt. H2O Wt Pt. H2O 1kb+

-100

-200

-300-400-500-650-850-------1000

Wt expected band with 1F/2RWould be 480 bp

For Wt expected band with 1F/3RWould be 677 bp

Band ~370 bpSuggesting~300 bp deletion

Band ~170 bpSuggesting~300 bp deletion

exon1

exon2

Red nucleotides are deleted. Exons are capitalizedMicrohomology is limited to two nucleotides, “GC”

exons 1 2

252 bp

366 bp

+1

-1

0

-5

Deletion encompassing Partial exon 1 and entire exon 2

ConclusionsaCGH has come light years ahead from MLPA days

We cover all the genes that we sequence (except two that have pseudogenes)

Array design has been a continuous processTime to assess individual probe performance

Small Intragenic deletions (<2.5 kb) data is valuable Insight into the mechanism

Most breakpoints have 2-3 bases of microhomology at breakpoints

Duplications?

Acknowledgements

Directors:Bradford Coffee Ph.D. FACMGLora Bean Ph.D. FACMGKatie Rudd Ph.D. FACMGAlice Tanner Ph.D. C.G.C.

SyedHussainAskree, MBBS, PhDEphremLip Hon Chin, BS (Tech), CLSp (MB)

Today’s agenda

Welcome — Dr. Mike Evans

Detection of small intragenic deletions using targeted comparative genomic hybridization — Dr. Madhuri Hegde

Closing remarks

Modified Emory panel designs — available now!

Modified Emory panel designs now available from OGT• Including complimentary class-leading CytoSure Interpret Software

Visit booth 416 for disorder lists and special introductory offer

Disorders covered

• Autism Spectrum Disorders• Congenital Abnormalities• Congenital Disorders of Glycosylation• Congenital Heart Disease• Cystic Disorders• Diabetes• Duchenne Muscular Dystrophy*• Eye Disorders• Hearing Loss

• Hemoglobinopathy• Inheritable Cancer• Intellectual Disability (MR)• Leukodystrophy• Lysomal Storage Disorders• Metabolic Disorders• Mitochondrial Disorders• Neuro Muscular Dystrophy• X Linked Intellectual Disabilities

* Not available in US.

55

Thank youwww.ogt.co.uk