This article was downloaded by: [University of Newcastle (Australia)]On: 03 September 2014, At: 06:40Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registeredoffice: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Archives Of Phytopathology And PlantProtectionPublication details, including instructions for authors andsubscription information:http://www.tandfonline.com/loi/gapp20

Activities of plant cell wall-degradingenzymes by bacterial soft rot of orchidTri Jokoa, Ahmad Subandia, Nanda Kusumandaria, Arif Wibowoa &Achmadi Priyatmojoa

a Faculty of Agriculture, Department of Crop Protection,Universitas Gadjah Mada, Yogyakarta, IndonesiaPublished online: 30 Sep 2013.

To cite this article: Tri Joko, Ahmad Subandi, Nanda Kusumandari, Arif Wibowo & AchmadiPriyatmojo (2014) Activities of plant cell wall-degrading enzymes by bacterial soft rotof orchid, Archives Of Phytopathology And Plant Protection, 47:10, 1239-1250, DOI:10.1080/03235408.2013.838374

To link to this article: http://dx.doi.org/10.1080/03235408.2013.838374

PLEASE SCROLL DOWN FOR ARTICLE

Taylor & Francis makes every effort to ensure the accuracy of all the information (the“Content”) contained in the publications on our platform. However, Taylor & Francis,our agents, and our licensors make no representations or warranties whatsoever as tothe accuracy, completeness, or suitability for any purpose of the Content. Any opinionsand views expressed in this publication are the opinions and views of the authors,and are not the views of or endorsed by Taylor & Francis. The accuracy of the Contentshould not be relied upon and should be independently verified with primary sourcesof information. Taylor and Francis shall not be liable for any losses, actions, claims,proceedings, demands, costs, expenses, damages, and other liabilities whatsoever orhowsoever caused arising directly or indirectly in connection with, in relation to or arisingout of the use of the Content.

This article may be used for research, teaching, and private study purposes. Anysubstantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions

Activities of plant cell wall-degrading enzymes by bacterial soft rotof orchid

Tri Joko*, Ahmad Subandi, Nanda Kusumandari, Arif Wibowo andAchmadi Priyatmojo

Faculty of Agriculture, Department of Crop Protection, Universitas Gadjah Mada, Yogyakarta,Indonesia

(Received 21 August 2013; accepted 23 August 2013)

Soft rot by bacterial pathogens is one of the most widespread and destructive diseaseson various plants including orchids throughout the world. The pathogenicity of thepathogens is reported to be mainly determined by massive production of plant cellwall-degrading enzymes (PCDE). In the previous work, we have isolated 20 isolatesof bacterial soft rot from orchids collected in Yogyakarta Special Region and WestJava province, Indonesia. In this study, we further confirmed them as pathogens byhypersensitive reaction assay on tobacco leaves followed by pathogenicity test onPhalaenopsis sp. The production of four major PCDE by qualitative plate assaysincluding pectate lyase, polygalacturonase, cellulase and protease was also evaluated.Even though all the isolates were able to initiate soft rot symptom, our results showedtwo distinct groups which clustered as producing and non-producing PCDE. The 16SrDNA analysis revealed that the isolates belonged to the genera Pectobacterium,Klebsiella, Serratia, Enterobacter, Citrobacter, Providencia and Pseudomonas.

Keywords: soft rot; orchid; plant cell wall-degrading enzymes; 16S rDNA

Introduction

Orchidaceae is one of the largest families of flowering plants. In tropical countries, orch-ids have become a major ornamental export crop, and the demand for their cut flowershas increased rapidly over the years. As a potted ornamental plant, orchids have becomeimportant value in flower trade market. During the last decade, orchids sales in the USAhas an increasing value of approximately 80% from $70 million in 1997 to $126 millionin 2007 (Palma et al. 2010). Diseases affecting the family Orchidaceae include rootdiseases, stem and pseudo-bulb decays, leaf spots and flower blights. Worldwide, one ofthe most common and important limiting factors for cultivating Orchidaceae is soft rotdisease that attacks many nurseries all over the world (Keith et al. 2005). Bacterialdiseases in many orchid species, such as several bacteria belonging to genera Dickeya,Pectobacterium, Pantoea, Pseudomonas, Acidovorax and Burkholderia, which cause softrot diseases in a wide range of ornamental plants (Lee et al. 2002), are major concernsamong breeders due to their catastrophic effects on plant yield and market value. Smallwater-soaked spots appear on the leaves and often are surrounded by yellow halos. Theinfection will rapidly rot the leaves and spread more slowly into the rhizomes or pseudo-bulbs. The wet rot may have a foul odour and has water-soaked appearance. The disease

*Corresponding author. Email: tjoko@ugm.ac.id

© 2013 Taylor & Francis

Archives of Phytopathology and Plant Protection, 2014Vol. 47, No. 10, 1239–1250, http://dx.doi.org/10.1080/03235408.2013.838374

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014

spreads so rapidly that plants may be completely rotted in 2–3 days. The soft rotpathogens are opportunistic bacteria that can enter through wounds. In Yogyakarta andWest Java, Indonesia, the losses of orchids due to soft rot diseases were estimated at 30%or more (Joko et al. 2011).

The outbreak of soft rot disease in orchid floriculture is favoured by highrelative humidity and temperature during cultivation or transportation to markets. Itspathogenicity results from the secretion of extracellular enzymes responsible for the disor-ganisation of the plant cell wall (Fu & Huang 2011). Many fungal and bacterial pathogenssecrete a large arsenal of hydrolytic enzymes that digest the plant cell wall, allowing thepathogen to have access to nutrients (Walton 1994). Such enzymes can release plant cellwall–derived elicitors that activate plant defence responses (Davis et al. 1984; Nothnagelet al. 1983). The soft rot bacterial pathogen is armed by coordinated production of highlevels of multiple enzymes and isoenzymes, which break down plant cell walls andrelease nutrients for bacterial growth (Toth et al. 2003). The pectolytic and other macerat-ing enzymes produced by soft rot pathogens result in a loss of structural integrity in hosttissue and a characteristic soft rot (Cother & Sivasithamparam 1983; Joko et al. 2007a).Soft rot bacteria have developed a complete and efficient set of plant cell wall-degradingenzymes (PCDE) such as pectinases, cellulases (Cels) and proteases (Prts) to deal withthe complexity of plant cell wall polymers (Collmer & Keen 1986). Among theseenzymes, pectinases are considered to be the main exoenzymes which break down andutilise pectins in the middle lamella and plant cell walls causing tissue collapse, celldamage and cell leakage (Barras et al. 1994). Besides PCDE, type III secretion system,which is encoded by hrp (hypersensitive reaction and pathogenicity) gene clusters, is alsoan essential requirement for virulence in soft rot bacteria. The hrp genes control theability of phytopathogenic bacteria to cause disease and to elicit hypersensitive reactionson resistant plants (Lindgren 1997). In this study, we described the production of PCDEof 20 isolates of bacterial soft rot collected from various species of orchids and thecorrelation with the virulence of the bacteria. The bacterial isolates were identified bysequencing a partial fragment of 16S rDNA, and the sequences obtained were used toconstruct phylogenetic tree to identify the similarity between them.

Materials and methods

Bacterial isolates, media and growth condition

Bacterial isolates used in this study are described in Table 1. The bacteria were grownat 27 °C in yeast peptone agar (YPA) medium containing 1% trypton, 0.5% yeast extractand 1.5% agar at pH 6.8. Optical density (OD) of the bacterial culture was measured bya spectrophotometer (Shimadzu, Japan). The isolates were routinely maintained at 4 °Cafter growth at 27 °C on YPA. For long-term maintenance, stock cultures were stored in25% (v/v) glycerol, 75% (v/v) YP at −20 or −80 °C (Joko et al. 2007b).

Hypersensitive reaction assay

Bacterial cells of soft rot pathogen were collected by centrifuging overnight culturegrown in YPB medium at 5000 × g for 5 min, washed three times with sterile doubledistilled water (DDW) and resuspended in sterile DDW to appropriate cell density. A 4weeks-old non-host tobacco plants (Nicotiana tabacum cv. Bright Yellow) grownin green house were infiltrated with the bacterial suspensions at a cell density of

1240 T. Joko et al.

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014

1 × 105 CFU/ml into young leaves using a needleless syringe. After inoculation, plantswere kept in room temperature for the development of hypersensitive reaction (HR).

Pathogenicity test

One-year-old seedlings of Phalaenopsis sp. in a pot grown in glass house were purchasedfrom a local nursery. Soft rot bacterial isolates were grown in YPA plates at 27 °C over-night and resuspended in 5 ml of sterile DDW. The orchid leaves were wounded withneedle and 50 µl of bacterial suspension containing 1 × 108 CFU/ml was infiltrated intothe leaf until run-off. After inoculation, sterilised moistened cotton was attached on inoc-ulated leaf and covered with a plastic bag to allow enough moisture (Figure 1(a)). Theexperiment was replicated three times, and sterile DDW was used as control. The plantwas incubated at room temperature and symptom development was observed daily. Dis-ease development was evaluated beginning at 2–4 days after inoculation by measuringthe length of the water-soaked lesion that formed at the inoculation site.

Enzyme assays

Plate assays for major extracellular enzymes, pectate lyase (Pel), polygalacturonase(Peh) and Cel were done as previously described (Chatterjee et al. 1995). The Pel platecontained 1% (w/v) of polygalacturonic acid (PGA), 1% (w/v) of yeast extract, 0.38 µMCaCl2 in 100 mM Tris-HCl (pH 8.5) and 0.8% (w/v) agarose. The Peh plate contained1% (w/v) PGA, 1% (w/v) yeast extract, 2.2 mM EDTA, 110 mM sodium acetate (pH5.5) and 0.8% (w/v) agarose. The Cel plate contained 0.1% (w/v) carboxymethylcellulose, 25 mM sodium phosphate (pH 7.0) and 0.8% (w/v) agarose. The medium wassupplemented with sodium azide. Wells were made in the medium with a cork borer

Table 1. Bacterial isolates used in this study.

No. Isolates Host Origin

1 CatLb2 Cattleya sp. Lembang, West Java2 DrCis Dendrobium sp. Cisarua, West Java3 DrSl1 Dendrobium sp. Sleman, Yogyakarta4 DrSl2 Dendrobium sp. Sleman, Yogyakarta5 OcYk Oncidium sp. Yogyakarta, Yogyakarta6 OcSl2 Oncidium sp. Sleman, Yogyakarta7 OcLb2 Oncidium sp. Lembang, West Java8 OcCis Oncidium sp. Cisarua, West Java9 On11.3 Oncidium sp. Cianjur, West Java10 Pal1.2 Phalaenopsis sp. Cianjur, West Java11 Pal3.2 Phalaenopsis sp. Cianjur, West Java12 Pal3.4 Phalaenopsis sp. Cianjur, West Java13 PhCis Phalaenopsis sp. Cisarua, West Java14 PhDh Phalaenopsis sp. Sleman, Yogyakarta15 PhLb1 Phalaenopsis sp. Lembang, West Java16 PhKp Phalaenopsis sp. Kulon Progo, Yogyakarta17 PhSl2 Phalaenopsis sp. Sleman, Yogyakarta18 PhYk Phalaenopsis sp. Yogyakarta City, Yogyakarta19 PfAgr Phalaenopsis sp. Cianjur, West Java20 PfDr Dendrobium sp. Cianjur, West Java

Archives of Phytopathology and Plant Protection 1241

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014

(ϕ5 mm), and the bottoms were sealed with 10 µl of 0.8% (w/v) agarose. The enzymeassay for Prt was done according to Shin et al. (2007). The medium for Prt plate con-tained K2HPO4 (0.7 g/l), KH2PO4 (0.3 g/l), MgSO4·7H2O (0.5 g/l), FeSO4·7H2O (0.01g/l), ZnSO4 (0.001 g/l), agar (15–20 g/l) and skim milk (2.5 g/l).

The Bacterial isolates were grown at 27 °C until early stationary phase by measuringOD at 660 nm with spectrophotometer (Shimadzu, Japan). The cells were collected bycentrifuging at 5,000 × g for 5 min and 30 µl of this culture supernatant was applied toeach well for Pel, Peh and Cel plates. The plates were then incubated at 27 °C for16–18 h. The Pel and Peh plates were developed with 5M H2SO4, while the Cel platewas developed with 0.1% (w/v) Congo red solution for 10–15 min and then neutralisedwith 1M NaCl gently shaking for 5 min four times. For Prt assay, the bacterial isolateswere streaked on to the medium and the clear zone of Prt activity was observed aroundthe streak without any further treatment.

Figure 1. (a) Pathogenicity test of bacterial isolates on the leaves of Phalaenopsis sp. The leafwas wounded with needle and 1 × 108 CFU/ml of 50 µl of bacterial suspension was infiltrated intothe leaf until run-off. After inoculation, sterilised moistened cotton was attached on inoculatedleaf. (b) Typical soft rot lesion developed arround inoculation site (indicated by arrow) 2–4 daysafter artificial pin-pricking inoculation.

1242 T. Joko et al.

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014

Identification of isolates by 16S rDNA sequence analysis

Bacterial isolates from orchids were identified based on 16S rDNA partial sequenceanalysis. To extract the DNA, the cells were harvested from 5 ml of overnight cultureand the pellets were lysed in 0.6 ml nuclei lysis solution. The procedures for DNAextraction and purification were done according to manual protocol of commercial kit(Promega, Wizard Genomic DNA purification kit). The quality and integrity of DNAwere checked by electrophoresis on 1% agarose gel. DNA was quantified and diluted to10 ng/ml (Joko et al. 2012). The 16S rDNA was amplified using polymerase chain reac-tion (PCR) with the universal primers 984f (5′−AACGCGAAGAACCTTAC−3′) andreverse primer 1378r (5′−CGGTGTGTACAAGGCCCGGGAACG−3′), which are tar-geted to the conserved region of bacterial 16S rRNA genes and permit the amplificationof an approximately 394-bp fragment (Heuer et al. 1997). The reaction mixture con-tained 1 μl of the purified genomic DNA, 1 μl of each primer and 25 μl GoTaq®Greenmaster mix (Promega, USA) in a total volume of 50 μl. Amplification was done in athermocycler (MyCycler, Bio-Rad). Initial denaturation at 94 °C for 2 min was followedby 34 cycles of denaturation at 94 °C for 15 s, annealing at 55 °C for 30 s and elonga-tion at 68 °C for 30 s. After 34 cycles, there was a final 5 min extension at 72 °C andthen cooled and held at 4 °C. The presence and yield specific of PCR products were vis-ualised by 2% agarose (w/v) gel stained with ethidium bromide and visualised under aUV light. The PCR products were purified and sent to the sequencing company (1stBASE, Malaysia). The sequences were edited using BioEdit software and comparedwith those retrieved from the GenBank nucleotide sequence databases. Phylogenetic treewas constructed by the neighbor-joining method and bootstrap analysis using Mega5software.

Results

Development of HR

The result showed that the development of HR on tobacco leaves varied among thetested bacterial isolates. Even though all of bacterial isolates were able to induce HR,the incubation time required for HR development was different (Table 2). The variationin incubation time for the development of HR induction indicated that the bacterial iso-lates causing soft rot on Orchidaceae might be from different genera or species.

Pathogenicity of bacterial soft rot

The time course of symptoms on the orchid leaves after inoculation was monitored andcompared. Plants artificially inoculated with isolates of soft rot bacteria developedsymptoms similar to the commonly observed field symptoms. Data presented in Table 3suggested that all bacterial isolates under investigation were able to infect Phalaenopsisleaves and induce soft rot, although they varied in the severity of rot that they initiated.We found that 20 bacterial isolates caused typical soft rot symptoms on the leaves ofPhalaenopsis sp. after artificial wound inoculation (Figure 1(b)), showing watery decayof the inoculated leaf. As the disease progressed, the lesions expanded rapidly and weresurrounded by a water-soaked halo. In this study, it was found that at 2–4 dayspost-inoculation, a progressive disorganisation of tissues was more visible. Tissuenecrosis with dark green colour at the initial site of inoculation was observed and wasmore obvious. The result also showed that some isolates could be considered as highly

Archives of Phytopathology and Plant Protection 1243

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014

pathogenic with length of symptom more than 3.5 cm, whereas other isolates wereshown to be moderate and weak virulent. Isolate Pal3.4 produced the most severe softrot symptom in a shorter time, that is, two days, while isolate Pal1.2 was the slowest

Table 2. Development of HR of orchid bacterial soft rot on tobacco leaves.

No. Isolates HR development (days after inoculation)

1 CatLb2 12 DrCis 23 DrSl1 34 DrSl2 25 OcYk 26 OcSl2 27 OcLb2 28 OcCis 39 On11.3 310 Pal1.2 311 Pal3.2 412 Pal3.4 113 PhCis 314 PhDh 315 PhLb1 416 PhKp 417 PhSl2 318 PhYk 219 PfAgr 420 PfDr 4

Table 3. Pathogenicity of orchid bacterial soft rot on Phalaenopsis sp.

No. Isolates

Symptom appeared

Days after inoculation (Dai) Length (cm)

1 CatLb2 2 2.672 DrCis 2 3.633 DrSl1 3 2.654 DrSl2 2 3.665 OcYk 4 1.366 OcSl2 2 1.797 OcLb2 2 3.678 OcCis 4 1.349 On11.3 2 1.9710 Pal1.2 4 0.6811 Pal3.2 3 2.0312 Pal3.4 2 5.2213 PhCis 3 1.4314 PhDh 3 1.1215 PhLb1 3 1.2316 PhKp 3 1.4517 PhSl2 3 0.9918 PhYk 3 1.2519 PfAgr 3 0.7420 PfDr 3 0.77

1244 T. Joko et al.

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014

and less severe. Reisolation from the artificially infected plants yielded the same patho-gen, thus completing Koch’s postulation. Furthermore, water-inoculated control did notinduce any soft rot symptoms.

Syntheses of PCDE

The activities of PCDE in orchid bacterial soft rot were analysed by qualitative plateassay methods measuring four major PCDE including Pel, Peh, Cel and Prt.Hugouvieux-Cotte-Pattat et al. (1996) reviewed that the pathogenicity of soft rot bacte-ria, especially that of caused by Dickeya sp. and Pectobacterium sp., is mainly due tothe ability of the bacteria to secrete multiple isoenzymes released through type I andtype II secretion system. Pel, Peh and Cel that secreted via type II secretion system arethe major pathogenicity factors in these bacteria. Prt, which is secreted via type I, is aminor pathogenicity factor. However, Marits et al. (1999) reported that mutation of prtgene resulted in the reduction of bacterial pathogenicity, thus playing a predominant rolein plant tissue maceration.

Our results as shown in Table 4 suggested that the ability of orchid bacterial soft rotin producing PCDE was relatively varied. Two groups were differentiated as producing-and non-producing PCDE, in which six bacteria were not able to synthesise PCDEwhile other 14 bacterial isolates were capable of producing PCDE. It was found thatonly one isolate (Pal3.4) could produce all the PCDE tested. The result also consistentlyshowed that isolate Pal3.4 that has the highest virulence among others is known to havethe ability to synthesise Pel, Peh, Cel and Prt by plate assay. There is a linear correla-tion between the ability to produce enzymes and the resulting disease severity. However,

Table 4. Production of PCDE by bacterial soft rot of orchid.

No. Isolates

Enzyme produced

Pectate lyase Polygalacturonase Cellulase Protease

1 CatLb2 − − − +++2 DrCis − − − −3 DrSl1 − − − −4 DrSl2 − − − +5 OcYk − − − ++6 OcSl2 − − − −7 OcLb2 − +++ − −8 OcCis − +++ − −9 On11.3 − +++ − −10 Pal1.2 − +++ − −11 Pal3.2 − − − −12 Pal3.4 +++ +++ +++ ++13 PhCis − − − −14 PhDh − − − +15 PhLb1 − − − +++16 PhKp − − − −17 PhSl2 +++ − − −18 PhYk +++ − − −19 PfAgr +++ − − −20 PfDr +++ − − −

Notes: +++: high enzyme activity; ++: medium enzyme activity; +: low enzyme activity; −: no enzymeactivity.

Archives of Phytopathology and Plant Protection 1245

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014

Figure 2. Phylogenetic tree showing the relationship of the orchid soft rot bacterial isolates andthe closely related strains available in the GenBank. On the basis of the alignment of 16S rDNAsequences, a phylogenetic tree was constructed using the neighbor-joining method. The stabilityof the tree was assessed by 1000 bootstrap replications with Felsenstein confidence limits. Thesequence of Agrobacterium tumefaciens was used as an outgroup. The bacterial names indicatethe sequences obtained from GenBank and filled triangle indicates the sequences of the isolatesfrom this study.

1246 T. Joko et al.

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014

a different result was shown as indicated by isolate DrCis, in which the plate assayresult was not able to produce PCDE although it belongs to a group of high virulence.

Phylogenetic analysis of soft rot bacterial isolates

The 16S rDNA gene from the bacterial isolates was subjected to DNA sequencing andphylogenetic analysis. The nucleotide BLAST search of partial sequences for variousisolates showed that they belonged to the families Enterobacteriaceae and Pseudomonad-aceae (Figure 2). The 17 bacterial isolates had variable percentage identities withfamily Enterobacteriaceae (99–100%) of the genera Pectobacterium, Klebsiella, Serratia,Enterobacter, Citrobacter and Providencia; whereas the remainder had 99–100% homol-ogy to family Pseudomonadaceae of the genus Pseudomonas. A phylogenetic tree wasdeveloped by aligning 16S rDNA sequences of different bacteria taken from GenBank(http://www.ncbi.nlm.nih.gov) and sequences of the isolates from this study.

The first cluster consisted of isolates CatLb2, DrSl1 and PfDr, which were closelyrelated to Pseudomonas, and was divided into two sub-clusters. The first sub-clusterconsisted of the isolates CatLb2 and DrSl1, with a similarity of 99%; while the secondsub-cluster consisted of the isolate PfDr with a similarity of 100%. The second clusterconsisted of the isolate Pal3.2, which was closely related to Citrobacter and shared a100% similarity. The third cluster consisted of the isolate DrCis, which shared a 99%similarity to Serratia. The fourth cluster was divided into two sub-clusters: the first sub-cluster consisted of the isolates PhLb1, OcYk, OcLb2, DrSl2, PhSl2 and PhCis, with asimilarity of 100%; while the second sub-cluster consisted of the isolate On11.3 with asimilarity of 99%. These isolates were closely related to Klebsiella. The fifth clusterwas represented by the isolate PhKp, which was close to Providencia with a similarityof 99%. The sixth cluster comprised of the isolate Pal3.4, which was related toPectobacterium with a similarity of 100%. Finally, the seventh cluster was divided intofour sub-clusters that where the isolates were closely related to Enterobacter. The firstsub-cluster consisted of the isolates Pal1.2 and PhDh with a similarity of 99%, whilethe second sub-cluster was represented by the isolate OcSl2 with a similarity of 100%.The third sub-cluster was represented by the isolates PhYk and PfAgr with a similarityof 99% and the fourth has isolate OcCis which shared a 100% similarity.

Discussion

The results presented in this report confirm the presence of orchid bacterial soft rot. Theinduction of HR by all the tested bacterial isolates suggested that these bacteria possessdominant type III secretion system that encodes the secretion of Hrp effector protein.There is considerable evidence that the Hrp system of various plant pathogenic bacteriacan deliver effector protein into host cells (Cornelis & Van Gijsegem 2000). The hrpgenes from many plant pathogenic bacteria have subsequently been isolated and DNAsequences studies confirmed that many hrp genes cloned from various pathogenicbacteria are homologous. Thus, hrp genes appeared to be universal among diversenecrosis-causing, Gram-negative, plant-pathogenic bacteria. Since hrp genes are essentialfor bacteria both to elicit the plant HR and to cause disease, it was suggested that someof the proteins that transverse the Hrp secretion apparatus may be elicitors of plant HRand that others may be involved in causing necrosis during pathogenesis (He 1996).Yang et al. (2002) reported that mutation of hrpC and hrpG produced no HR ontobacco leaves for 16 h after inoculation, while mutation of hrpN showed only slightHR induction.

Archives of Phytopathology and Plant Protection 1247

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014

A large number of bacterial isolates were recovered from diseased tissue and wereallowed grow on YPA medium. These isolates varied in their ability to produce PCDE,but one isolate produced high amounts of four major PCDE in comparison to that ofPectobacterium sp. and Dickeya sp. The variation in the ability of bacterial isolates toproduce four major PCDE reveals that, in fact, pathogenicity of these bacteria, espe-cially those could not produce PCDE, were not solely due to these enzymes as reportedon genera Dickeya and Pectobacterium. It is noteworthy that besides four major PCDE,the bacteria are also reported to posses multiple minor exoenzymes or type III effectorproteins that might play an important role in the pathogenicity of these bacteria, or per-haps there are some other unidentified pathogenicty factors exist. A prominent featureof soft rot bacteria is due to the involvement of complex extracellular pectolyticenzymes under tight regulation in breakdown pectic substances, which are effective asintercellular cement in plant tissues and act as barriers for the penetration of manybacterial pathogens.

The results obtained from the conserved sequence of the 16S rDNA coupled withthe nucleotide sequences revealed that the isolated bacteria are closely related to thegenera Pectobacterium, Klebsiella, Serratia, Enterobacter, Citrobacter, Providencia andPseudomonas. On a molecular basis, all isolates belonged to the Gram-negative group.We did not find Gram-positive bacteria in this study after identification based on thesequence of 16S rDNA, suggesting that Gram-positive bacteria might not be the causalpathogens of soft rot in Orchidaceae. Most of the isolates (17 isolates) belonged to thefamily Enterobacteriaceae (85%), with the remaining three isolates (15%) belonging tothe family Pseudomonadaceae. It indicated that Enterobacteriacea group were more pre-valent in orchid soft rot disease. This finding was in line with that reviewed by Char-kowski et al. (2012), wherein the bacteria in the family of Enterobacteriaceae, especiallyPectobacterium sp. and Dickeya sp., are the major causal agents of soft rot disease inmany crops. Pectobacterium sp. is also the most commonly reported soft-rot associatedpathogen known to cause the disease in crops worldwide, including in ornamental cropssuch as lily (Hahm et al. 2003), cactus (Kim et al. 2007) and dieffenbachia (Cetinkaya-Yildiz et al. 2004). In the previous work, Masyahit et al. (2009) reported that Entero-bacter cloacae, another member of Enterobacteriaceae, is the causal pathogen of soft roton dragon fruit in Peninsular Malaysia. Wu et al. (2011) also reported that Enterobactersp. could cause soft rot on the konjac in China. However, there was no previous reporton the occurrence of soft rot bacterial disease caused by genera Klebsiella, Serratia, Cit-robacter and Providencia. Therefore, this study could be considered as the first reportof these genera as soft rot pathogens.

The pathogenicity analysis suggested that various isolates could cause differentdegrees of virulence in Phalaenopsis sp. We found here that based on 16S rDNAsequence analysis, the isolate Pal3.4 which produced complete PCDE and caused themost severe symptom on the pathogenicity assay belonged to the genus Pectobacterium,suggesting that member of this genus could efficiently produce massive PCDE as theirmajor pathogenicity factors. Despite the fact that genus Pseudomonas has been fre-quently reported as the pathogen of soft rot diseases on orchids, until recently, little wasknown about its major pathogenicity factors as well as other members of the familyEnterobacteriaceae including Klebsiella, Serratia, Enterobacter, Citrobacter and Provi-dencia to develop typical soft rot symptom on orchid.

Our results in this report revealed that there are many bacterial species involved incausing soft rot disease in Orchidaceae. Our results also confirmed the suggestion thatbacterial soft rot of orchid could be polyaetiological in nature as previously reported on

1248 T. Joko et al.

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014

Zantedeschia spp. (Krejzar et al. 2008) and Agave tequilana (Hidalgo et al. 2004), inwhich a different species can elicit similar disease symptoms and the causal pathogensmay be present at the same time in the diseased tissues.

AcknowledgementThis study was supported by Research Grant from Faculty of Agriculture, Universitas GadjahMada, Indonesia 2011−2012.

ReferencesBarras F, Van Gijsegem F, Chatterjee AK. 1994. Extracellular enzymes and pathogenesis of

soft-rot Erwinia. Annu Rev Phytopathol. 32:201–234.Cetinkaya-Yildiz R, Mirik M, Aysan Y, Kusek M. 2004. An outbreak of bacterial stem rot of

Dieffenbachia amoena caused by Erwinia carotovora subsp. carotovora in the EasternMediterranean Region of Turkey. Plant Dis. 88:310–311.

Charkowski A, Blanco C, Condemine G, Expert D, Franza T, Hayes C, Hugouvieux-Cotte-PattatN, Solanilla EL, Low D, Moleleki L, Pirhonen M, Pitman A, Perna N, Reverchon S, Palenzu-ela PR, Francisco MS, Toth I, Tsuyumu S, van der Waals J, van der Wolf J, Van Gijsegem F,Yang CH, Yedidia I. 2012. The role of secretion systems and small molecules in soft-rotEnterobacteriaceae pathogenicity. Annu Rev Phytopathol. 50:425–429.

Chatterjee A, Cui Y, Liu Y, Dumenyo CK, Chatterjee AK. 1995. Inactivation of rsmA leads tooverproduction of extracellular pectinases, cellulases, and proteases in Erwinia carotovorasubsp. carotovora in the absence of the starvation/cell density-sensing signal, N-(3-oxohexa-noyl)-L-homoserine lactone. Appl Environ Microbiol. 61:1959–1967.

Collmer A, Keen NT. 1986. The role of pectic enzymes in plant pathogenesis. Annu RevPhytopathol. 24:383–453.

Cornelis GR, Van Gijsegem F. 2000. Assembly and function of type III secretory systems. AnnuRev Microbiol. 54:735–774.

Cother EJ, Sivasithamparam K. 1983. Erwinia: the “carotovora” group. In: Fahy FC, Presley GJ,editors. Plant bacterial diseases, a diagnostic guide. Sydney: Acad. Press; 87–106.

Davis KR, Lyon GD, Darvill AG, Albersheim P. 1984. Host-pathogen interactions: XXV. Endo-polygalacturonic acid lyase from Erwinia carotovora elicits phytoalexin accumulation byreleasing plant cell wall fragments. Plant Physiol. 74:52–60.

Fu SF, Huang HJ. 2011. Molecular characterization of the early response of orchid Phalaenopsisamabilis to Erwinia chrysanthemi infection. Orchid Biotechnol II:283–308.

Hahm SS, Han KS, Shim MY, Choi JJ, Kwon KH, Choi JE. 2003. Occurrence of bacterial softrot of lily bulb caused by Pectobacterium carotovorum subsp. carotovorum and Pseudomonasmarginalis in Korea. Plant Pathol J. 19:43–45.

He SY. 1996. Elicitation of plant hypersensitive response by bacteria. Plant Physiol. 11:865–869.Heuer H, Krsek M, Baker P, Smalla K, Wellington EM. 1997. Analysis of actinomycete commu-

nities by specific amplification of genes encoding 16S rRNA and gel-electrophoretic separa-tion in denaturing gradients. Appl Environ Microbiol. 63:3233–3241.

Hidalgo J, Virgen-Calleros G, Mart′ınez-de la Vega O, Vandemark G, Olalde-Portugal V. 2004.Identification and characterisation of bacteria causing soft-rot in Agave tequilana. Eur J PlantPathol. 110:317–331.

Hugouvieux-Cotte-Pattat N, Condemine G, Nasser W, Reverchon S. 1996. Regulation of pectinol-ysis in Erwinia chrysanthemi. Annu Rev Microbiol. 50:213–257.

Joko T, Hirata H, Tsuyumu S. 2007a. Sugar transporter (MfsX) of major facilitator superfamily isrequired for flagella-mediated pathogenesis in Dickeya dadantii 3937. J Gen Plant Pathol.73:266–273.

Joko T, Hirata H, Tsuymu S. 2007b. A sugar transporter (MfsX) is also required by Dickeyadadantii 3937 for in planta fitness. J Gen Plant Pathol. 73:274–280.

Joko T, Kiswanti D, Hanudin Subandiyah S. 2011. Occurence of bacterial soft-rot of Phalaenopsisorchids in Yogyakarta and West Java, Indonesia. Proceeding of Internasional Seminar on“Natural Resources, Climate Change, and Food Security in Developing Countries”; June27–28. Surabaya, Indonesia; pp. 255–265.

Archives of Phytopathology and Plant Protection 1249

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014

Joko T, Koentjoro MP, Somowiyarjo S, Rohman MS, Liana A, Ogawa N. 2012. Response of rhi-zobacterial communities in watermelon to infection with Cucumber green mottle mosaic virusas revealed by cultivation-dependent RISA. Arch Phytopathol Plant Prot. 45:1810–1818.

Keith LM, Sewake KT, Zee FT. 2005. Isolation and characterization of Burkholderia gladiolifrom orchids in Hawaii. Plant Dis. 89:1273–1278.

Kim JH, Joen YH, Kim SG, Kim YH. 2007. First report on bacterial soft rot of graft-cactusChamaecereus silvestrii caused by Pectobacterium carotovorum subsp. carotovorum in Korea.Plant Pathol J. 23:314–317.

Krejzar V, Mertelík J, Pánková I, Kloudová K, Kůdela V. 2008. Pseudomonas marginalis associ-ated with soft rot of Zantedeschia spp. Plant Prot Sci. 44:85–90.

Lee YA, Chen KP, Chang YC. 2002. First report of bacterial soft rot of white flowered calla lilycaused by Erwinia chrysanthemi in Taiwan. Plant Dis. 86:1273.

Lindgren PB. 1997. The role of hrp genes during plant bacterial interactions. Annu Rev Phytopa-thol. 35:129–152.

Marits R, Kõiv V, Laasik E, Mäe A. 1999. Isolation of an extracellular protease gene of Erwiniacarotovora subsp. carotovora strain SCC3193 by transposon mutagenesis and the role of pro-tease in phytopathogenicity. Microbiology. 145:1959–1966.

Masyahit M, Sijam K, Awang Y, Satar MGD. 2009. First report on bacterial soft rot disease ondragron fruit (Hylocereus spp.) caused by Enterobacter cloacae in Peninsular Malaysia. Int JAgric Biol. 11:659–666.

Nothnagel EA, McNeil M, Albersheim P, Dell A. 1983. Host-pathogen interactions: XXII. Agalacturonic acid oligosaccharide from plant cell walls elicits phytoalexins. Plant Physiol.71:916–926.

Palma MA, Chen YJ, Hall C, Bessler D, Leatham D. 2010. Consumer preferences for pottedorchids in the Hawaiian market. Hortechnology. 20:239–244.

Shin DS, Park MS, Jung S, Lee MS, Lee KH, Bae KS, Kim SB. 2007. Plant growth-promotingpotential of endophytic bacteria isolated from roots of coastal sand dune plants. J MicrobiolBiotechnol. 17:1361–1368.

Toth IK, Bell KS, Holeva MC, Birch PRJ. 2003. Soft rot Erwiniae: from genes to genomes. MolPlant Pathol. 4:17–30.

Walton JD. 1994. Deconstructing the cell wall. Plant Physiol. 104:1113–1118.Wu J, Ding Z, Diao Y, Hu Z. 2011. First report on Enterobacter sp. causing soft rot of

Amorphophallus konjac in China. J Gen Plant Pathol. 77:312–314.Yang CH, Gavilanes-Ruiz M, Okinaka Y, Vedel R, Berthuy I, Boccara M, Chen JW, Perna NT,

Keen NT. 2002. hrp genes of Erwinia chrysanthemi 3937 are important virulence factors.Mol Plant Microbiol Interact. 15:472–480.

1250 T. Joko et al.

Dow

nloa

ded

by [

Uni

vers

ity o

f N

ewca

stle

(A

ustr

alia

)] a

t 06:

40 0

3 Se

ptem

ber

2014