algorithmic self-assembly for nano-scale fabrication erik winfree computer science computation &...
TRANSCRIPT
![Page 1: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/1.jpg)
Algorithmic self-assembly for nano-scale
fabrication
Erik Winfree Computer Science
Computation & Neural Systemsand
The DNA Group @ Caltech
DARPA NSF NASA
![Page 2: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/2.jpg)
Constructing Complex Molecular Objects(Development/Morphogenesis)
Information specifies a process that creates organization
![Page 3: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/3.jpg)
Creating OrderBlueprints,Template
-------------Arbitrary structure.
Larger object requires
larger template.
Periodiccrystals
-------------Few components,
large homogeneousobject.
Algorithmicgrowth
-------------Few components,
large intelligently-organized
object.
![Page 4: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/4.jpg)
Nadrian Seeman &
DNA nanotechnology
![Page 5: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/5.jpg)
Chemical structure of DNA
G
A
A
G
T
C
C
T
![Page 6: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/6.jpg)
DNA
single-stranded double-stranded
AGTCTTCGAATGCTAATTGCGCT
AGCGCAATTAGCATTCGAAGACT
![Page 7: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/7.jpg)
Designing DNA molecular complexes
Nadrian Seeman, 1980’s
GATTACA
CTAATGTTAGGCAG
ATCCGTC
AC
TG
GT
G
TG
AC
CA
C
GATTACA
CTAATGT
ATCCGTC
TG
AC
CA
C
AC
TG
GT
G
TAGGCAG
![Page 8: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/8.jpg)
Chen and Seeman, Nature 350, 631 (1991).
![Page 9: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/9.jpg)
Periodic 2-tile crystal (DAO-E lattice)
TCACT
AGTGA
CATAC
GTATG
TCTTG
AGAAC ATCTC
TAGAG
Winfree, Liu, Wenzler, Seeman, Nature 394: 539-544 (1998)
1 24 3
3 42 1
![Page 10: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/10.jpg)
Self-Assembly of DNA
![Page 11: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/11.jpg)
High resolution AFM imaging
Hole = lattice defect Conformation of helix and sticky ends?
Rizal Hariadi, Winfree groupcrystal growth movie
![Page 12: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/12.jpg)
Some variations
Mao, Sun, Seeman, JACS 1999
Winfree, Liu, Wenzler, Seeman, Nature, 1998
LaBean et al, JACS, 2000
![Page 13: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/13.jpg)
More variations
1D ribbons
1D tubes
(Schulman, Winfree, 06)
Zigzag ribbon 2D periodic
lattices
Nano-track
3-helix bundle
TX-tube
6-helix bundle
4x4 tube
DX tube
DX lattice
TX lattice
4x4 lattices
triangle lattice
hexagonal lattice
3 point-star lattices
symmetry lattice
single-strand DX-like tubes …
Rhombus ribbon
…
(Mao, Sun & Seeman, 1999)
Rhombus lattice
(Mao, Sun & Seeman 99)
(Winfree, Liu, Wenzler & Seeman 98)
(LaBean, Yan, Kopatsch, Liu, Winfree, Reif, & Seeman 00)
(Liu, Park, Reif & LaBean 04)
(Liu, Wang, Deng, Walulu & Mao 04) (He, Tian, Chen, Deng,
Ribbe & Mao 05)
(He, Chen, Liu,Ribbe & Mao 05)
(He, Chen, Liu,Ribbe & Mao 05)
(Park, Yin, Liu, Reif LaBean & Yan 05)
(Park, Barish, Li, Reif,Finkelstein,Yan & LaBean 05)
(Rothemund, Ekani-Nkodo, Papadakis, Kumar,
Fygenson & Winfree 04)
… (Mathieu, Liao,
Kopatsch, Wang, Mao & Seeman
05)
Chiral DX tube
(Mitchell, Harris, Malo, Bath &Turberfield 04)
HJ lattice
(Malo, Mitchell, Venien-Bryan, Harris,Wille,Sherratt &
Turberfield 05)
(Reishus, Shaw, Brun,Chelyapov & Adleman 05)
DDX lattice
(Chelyapov, Brun, Gopalkrishnan, Reishus, Shaw & Adleman 04)
(Yan, Park, Finkelstein,Reif & LaBean 03)
(Yan, Park, Finkelstein,Reif & LaBean 03)
TX ribbon
(Li, Park, Reif, LaBean, Yan 03)
(Rothemund 05)
SAO lattice
![Page 14: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/14.jpg)
DNA computing
Adleman, Science (1994)
Len Adleman:DNA self-assembly is programmable
![Page 15: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/15.jpg)
The Sierpinski Triangle(aka Pascal’s Triangle mod 2)
0 0 0 0 0 0 0 1 0 0 0 0 0 0 00 0 0 0 0 0 1 1 0 0 0 0 0 0
0 0 0 0 0 0 1 0 1 0 0 0 0 00 0 0 0 0 1 1 1 1 0 0 0 0 0
0 0 0 0 0 1 0 0 0 1 0 0 0 00 0 0 0 1 1 0 0 1 1 0 0 0 0
0 0 0 0 1 0 1 0 1 0 1 0 0 0
0 0 0 0 0 0 1 1 0 0 0 0 0 0
each new number is the sum of the two below it
Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004
![Page 16: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/16.jpg)
The Sierpinski Triangle(aka Pascal’s Triangle mod 2)
Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004
![Page 17: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/17.jpg)
The Sierpinski Triangle
(aka Pascal’s Triangle mod 2)
Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004
![Page 18: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/18.jpg)
DAO-E Sierpinski Tile Set
decorrelation movie powers of two movie
![Page 19: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/19.jpg)
Making the boundary (the input string)
750
nm
}
25 nm
![Page 20: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/20.jpg)
DAO-E Sierpinski experiments
Algorithmic crystals
1.6 um scan
deco
rrel
atio
n m
ovie
scaffold strand
algorithmic growth
errors during assembly
![Page 21: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/21.jpg)
DAO-E Sierpinski triangle experiments
Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2: e424 (2004)
340nm
![Page 22: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/22.jpg)
![Page 23: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/23.jpg)
Scaffolded DNA origami
![Page 24: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/24.jpg)
Folding long single-stranded DNA
The sequence of DNA provides unique addresses for each location.
“Staple strands” bind locations together according to the design.
![Page 25: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/25.jpg)
Folding long single-stranded DNA
The sequence of DNA provides unique addresses for each location.
“Staple strands” bind locations together according to the design.
![Page 26: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/26.jpg)
Folding long single-stranded DNA
The sequence of DNA provides unique addresses for each location.
“Staple strands” bind locations together according to the design.
![Page 27: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/27.jpg)
Scaffolded DNA origami
![Page 28: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/28.jpg)
Scaffolded DNA origami
![Page 29: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/29.jpg)
Scaffolded DNA origami
![Page 30: Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Group @ Caltech DARPA NSF NASA](https://reader035.vdocuments.net/reader035/viewer/2022062423/56649ef45503460f94c07256/html5/thumbnails/30.jpg)
Creating OrderBlueprints,Template
-------------Arbitrary structure.
Larger object requires
larger template.
Periodiccrystals
-------------Few components,
large homogeneousobject.
Algorithmicgrowth
-------------Few components,
large intelligently-organized
object.