biologists should not deceive themselves with the thought that some new class of biological...

Biologists should not deceive themselves with the thought that some new class of biological molecules, of comparable importance to proteins,

remains to be discovered.

This seems highly unlikely.

—F. Crick (1958)

ContentsContentsBasicsBasics

RNA structureRNA structure

PredictionPrediction

RNA structure in biologyRNA structure in biology

RNA efferencingRNA efferencing

CellCell

Source: “Molecular Cell Biology” by Lodish et al.

Source: “Biology” by Campbell & Reece

Cellular macromoleculesCellular macromolecules

Source: “Molecular Cell Biology” by Lodish et al.

All nucleotides have a common All nucleotides have a common structurestructure

Source: “Molecular Cell Biology” by Lodish et al.

There are five principal bases in nucleic There are five principal bases in nucleic acidsacids

A, G, T, C are present in DNAA, G, U, C are present in RNA

Source: “Molecular Cell Biology” by Lodish et al.

Nucleotide subunits are linked togethNucleotide subunits are linked together by phosphodiester bonds er by phosphodiester bonds

Source: “Molecular Cell Biology” by Lodish et al.

Nucleotide terminologyNucleotide terminology

Source: “Molecular Cell Biology” by Lodish et al.

Native DNA is a double helix of Native DNA is a double helix of complementary anti-parallel chains complementary anti-parallel chains

Hydrogen bonding between complementary base pairs (A-T or G-C) holds the two strands together

Source: “Molecular Cell Biology” by Lodish et al.

DNADNA can undergo reversible strand can undergo reversible strand separationseparation

Source: “Molecular Cell Biology” by Lodish et al.

Source: “Biology” by Campbell & Reece

Source: “Molecular Cell Biology” by Lodish et al.

ContentsContents

BasicsBasics

RNA structureRNA structure

PredictionPrediction

RNA 2RNA 2ndnd structure in biology structure in biology

RNA efferencingRNA efferencing

Complementary sequences in RNA molecules Complementary sequences in RNA molecules maintain RNA secondary structure.maintain RNA secondary structure.

Source: “Bioinformatics” by David W. Mount

Features of RNA Secondary StructureFeatures of RNA Secondary Structure

In DNA, G≡CIn DNA, G≡C AA ＝＝ TT

In RNA, G≡CIn RNA, G≡C AA ＝＝ UU GG ＝＝ UU

Features of RNA Secondary StructureFeatures of RNA Secondary Structure

Primary structurePrimary structure

↓↓

Secondary StructureSecondary Structure

↓↓

Tertiary StructureTertiary Structure

Types of single- & double-stranded regions in Types of single- & double-stranded regions in RNA secondary structures.RNA secondary structures.

Source: “Bioinformatics” by David W. Mount

Interaction of RNA secondary structural Interaction of RNA secondary structural elements.elements.

Source: “Bioinformatics” by David W. Mount

Display of base pairs in an RNA secondary Display of base pairs in an RNA secondary structure by a circle plot.structure by a circle plot.

Source: “Bioinformatics” by David W. Mount

ContentsContentsBasicsBasics

RNA structureRNA structure

PredictionPrediction

RNA structure in biologyRNA structure in biology

RNA efferencingRNA efferencing

PredictionPrediction

Minimum Free-Energy Method

Sequence Co-variation

Global alignmentL G P S S K Q T G K G S – S R I W D N| | | | | | |L N – I T K S A G K G A I M R L G D A

Local alignment- - - - - - - - T G K G - - - - - - - | | |- - - - - - - - A G K G - - - - - - -

Adapted from “Bioinformatics” by D W Mount

DOROTHY--------HODGKINDOROTHYCROWFOOTHODGKIN

Dotplot

Adapted from “Introduction to Bioinformatics“ by A M Lesk

Drosophila melanogaster SLIT protein against itself

http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html

A G C T A G G A | | | | |C A C T A G G C

Dotplot

5’ A C G U - - - - G C G U 3’

| | | |

3’ U G C G - - - - U G C A 5’

Source: “Bioinformatics” by David W. Mount

Source: “Bioinformatics” by David W. Mount

RNA 2RNA 2ndnd Structure Website Structure Website

http://www.bioinfo.rpi.edu/~zukerm/rna/http://www.bioinfo.rpi.edu/~zukerm/rna/

PredictionPrediction

Minimum Free-Energy Method

Sequence Co-variation

Source: “Bioinformatics” by David W. Mount

Source: “Bioinformatics” by David W. Mount

RNA 2RNA 2ndnd Structure Website Structure Website

http://www.genebee.msu.su/services/rna2_reduced.htmlhttp://www.genebee.msu.su/services/rna2_reduced.html

1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC----1 CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATAATCCTCTCCCCGCC----2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA2 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCGCCTCCCGGCACCA3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA3 GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAATATCCGCCTCCCGGCACCA

1 C1 CGGCGGGGTAGCGGGGTAGAAGCGCAAGCCTGGTAGCGCCTGGTAGCTTCGTCGGGCTCATAATCCTCCGTCGGGCTCATAATCCTCTTCCCCGCCCCGCCC----C----2 G2 GCCC-AGGATAC-AGGATAGGCTCTCCAGTTGGTAGAAGTTGGTAGAGGCAGAGGACTGAAAATCCGCCAGAGGACTGAAAATCCGCCCTCCCGTCCCGGGCACCACACCA3 G3 GCCC-AGGATAC-AGGATAGGCTCTCCAGTTGGTAGAAGTTGGTAGAGGCAGAGGACTGAATATCCGCCAGAGGACTGAATATCCGCCCTCCCGTCCCGGGCACCACACCA

Limitations of Prediction-AssumptionLimitations of Prediction-Assumption

The most likely structure is similar to the The most likely structure is similar to the energetically most stable structure.energetically most stable structure.

The energy associated with any position in The energy associated with any position in the structure is only influenced by local the structure is only influenced by local sequence and structure.sequence and structure.

The structure is assumed to be formed by The structure is assumed to be formed by folding of the chain back on itself in a folding of the chain back on itself in a manner that does not produce any knots.manner that does not produce any knots.

Source: “Bioinformatics” by David W. Mount

ContentsContents

BasicsBasics

RNA structureRNA structure

PredictionPrediction

RNA structure in biologyRNA structure in biology

RNA efferencingRNA efferencing

RNA 2RNA 2ndnd structure in Biology structure in Biology

Nuclear RNA splicingNuclear RNA splicing

Group I/II intron splicingGroup I/II intron splicing

RibosomeRibosome

RNA sensorRNA sensor

Processing of eukaryotic mRNA Processing of eukaryotic mRNA

Source: “Molecular Cell Biology” by Lodish et al.

Source: “Molecular Cell Biology” by Lodish et al.

Source: “Gene VII” by Lewin

Interaction of the RNP motif from U1A Interaction of the RNP motif from U1A protein and RNAprotein and RNA

Figure 11-10

Source: “Molecular Cell Biology” by Lodish et al.

hnRNP proteins may assist in processinhnRNP proteins may assist in processing and transport of mRNAsg and transport of mRNAs

Figure 11-11

Source: “Molecular Cell Biology” by Lodish et al.

Splicing occurs at short, conserved Splicing occurs at short, conserved sequencessequences

Figure 11-14

Consensus sequences around 5 and 3 splice sites in vertebrate pre-mRNA

Source: “Molecular Cell Biology” by Lodish et al.

Splicing proceeds via two sequential Splicing proceeds via two sequential transesterfication reactionstransesterfication reactions

Figure 11-16

Source: “Molecular Cell Biology” by Lodish et al.

Small nuclear RNAs (snRNAs) assist in Small nuclear RNAs (snRNAs) assist in the splicing reaction the splicing reaction

Figure 11-17

Source: “Molecular Cell Biology” by Lodish et al.

Spliceosomal splicing cycleSpliceosomal splicing cycle

Figure 11-19

Source: “Molecular Cell Biology” by Lodish et al.

Source: “Gene VII” by Lewin

Self-splicing group II introns provide Self-splicing group II introns provide clues to the evolution of snRNPsclues to the evolution of snRNPs

Figure 11-20

Source: “Molecular Cell Biology” by Lodish et al.

RNA 2RNA 2ndnd structure in Biology structure in Biology

Nuclear RNA splicingNuclear RNA splicing

Group I/II intron splicingGroup I/II intron splicing

RibosomeRibosome

RNA sensorRNA sensor

Self-splicing group I introns were the firSelf-splicing group I introns were the first examples of catalytic RNAst examples of catalytic RNA

Figure 11-51

Source: “Molecular Cell Biology” by Lodish et al.

A Preorganized Active Site in the Crystal Structure of the TA Preorganized Active Site in the Crystal Structure of the Tetrahymena etrahymena RibRibozyme Barbara L. Golden,* Anne R. Gooding, Elaine R. Podell,Thomas R. ozyme Barbara L. Golden,* Anne R. Gooding, Elaine R. Podell,Thomas R.

Cech*Cech*Science 282, 259~264 (1998)Science 282, 259~264 (1998)

The ribozyme core is formed by the junThe ribozyme core is formed by the junction of four helicesction of four helices

The model for P1’s interaction with the ribozyme juThe model for P1’s interaction with the ribozyme juxtaposes the guanosine-binding sitextaposes the guanosine-binding site

Source: “Molecular Cell Biology” by Lodish et al.

Source: “Gene VII” by Lewin

Source: “Gene VII” by Lewin

RNA 2RNA 2ndnd structure in Biology structure in Biology

Nuclear RNA splicingNuclear RNA splicing

Group I/II intron splicingGroup I/II intron splicing

RibosomeRibosome

RNA sensorRNA sensor

Source: “Gene VII” by Lewin

Source: “Gene VII” by Lewin

Source: “Gene VII” by Lewin

The Structural Basis of Ribosome The Structural Basis of Ribosome Activity in Peptide Bond SynthesisActivity in Peptide Bond Synthesis

Poul Nissen, Jeffrey Hansen, Nenad Ban,Peter Poul Nissen, Jeffrey Hansen, Nenad Ban,Peter B. Moore and Thomas A. SteitzB. Moore and Thomas A. Steitz

Nature (2000) 289, 920~930Nature (2000) 289, 920~930

The ribosome is a ribozymThe ribosome is a ribozyme.e.

RNA 2RNA 2ndnd structure in Biology structure in Biology

Nuclear RNA splicingNuclear RNA splicing

Group I/II intron splicingGroup I/II intron splicing

RibosomeRibosome

RNA sensorRNA sensor

Thiamine derivatives bind messengerThiamine derivatives bind messengerRNAs directly to regulate bacterialRNAs directly to regulate bacterial

gene expressiongene expression

Wade Winkler*, Ali Nahvi† & Ronald R. Breaker*Wade Winkler*, Ali Nahvi† & Ronald R. Breaker*

Nature (2002) 419, 952~956.Nature (2002) 419, 952~956.

http://rfam.wustl.edu/http://rfam.wustl.edu/

Sequence Alignment Scoring versus Structural Alignment Scoring Cell, 109, 137–140, 2002

http://www.imb-jena.de/RNA.htmlhttp://www.imb-jena.de/RNA.html

ContentsContentsBasicsBasics

RNA structureRNA structure

PredictionPrediction

RNA structure in biologyRNA structure in biology

RNA efferencingRNA efferencing

2,431 pairs of sense–antisense transcripts overlapping in the exons of the sense gene by at least 20 bases.NATURE VOL 420 (2002) p563

Science 296:p1263, 2002Science 296:p1263, 2002

A model for the molecular steps in RNA silencing.

Science 296:p1260, 2002Science 296:p1260, 2002

Science 296:p1260, 2002Science 296:p1260, 2002

EMBO Report 2:p986, 2001EMBO Report 2:p986, 2001