clemson university school of health research spring ... · 2/5/2019  · versus intravenous...

Post on 22-Aug-2020

3 Views

Category:

Documents

0 Downloads

Preview:

Click to see full reader

TRANSCRIPT

CLEMSON UNIVERSITY

SCHOOL OF HEALTH RESEARCH

Spring Information Exchange

February 5, 2019 2:00 - 3:30 PM

Operationalizing Clemson’s Strategic Plan

• Biomedical Devices

• Regenerative Medicine

• Biomaterials

• Mobile Health Technologies

• Health Informatics

• Healthcare Access and Delivery

• Health Predictors

• Health Disparities

• Genetic Disorders & Personalized

Medicine

Health Innovation Research Innovation Cluster

2:00 – 2:05 Welcome • Windsor Westbrook Sherrill, PhD

2:05 – 2:25 College Spotlight: SCIENCE • Cynthia Young, PhD, College of Science Founding Dean • Trudy Mackay, PhD, Professor, Genetics and Biochemistry

2:25 – 2:30 SCIENCE Health Research Highlights • Apparao Rao, PhD, Associate Dean for Discovery

2:30 – 2:50 Prisma Health Collaboration Spotlight • Des Kelly, MD, Chief Medical Research Officer, Prisma Health–Upstate • Mike Devane, MD Vice Chair of Academics, Department of Radiology

2:50-2:55 Brief and Spectacular: Faculty Fellowship Spotlight • Kristin Scott, PhD, Associate Professor, Management

2:55 - 3:10 CUSHR Appointment Committee Update and Announcements • Larry Fredendall, PhD, Chair, CUSHR Appointment Committee • J. Cole Smith, PhD, Associate Provost for Academic Initiatives

3:10 – 3:30 Refreshments and Conversation

CUSHR Information Exchange Agenda

Welcome

Dr. Windsor Westbrook Sherrill Associate Vice President for Health Research

Provost’s Distinguished Professor, Public Health Sciences Chief Science Officer, Prisma Health–Upstate

Dr. Cynthia Young Founding Dean, College of Science

College Spotlight: SCIENCE

Dr. Trudy Mackay Self Family Endowed Chair in Human Genetics

Professor, Genetics and Biochemistry Director, Center for Human Genetics

Genetic Variation (Nature)

Environmental Variation (Nurture)

AACTGGCCTCCTCCTCCTCCTATACGTTACCGG………………….CGATTCCAAA AACTGGCCTCCT……………….ATACGTTACCGG………………….AAACCTTAGC AACTGGCCTCCT……………….ATACGTTACCGC………………….AAACCTTAGC AACTGGCCTCCT……………….ATACGTTACCGC……..3kb…..AAACCTTAGC

75% human disease genes have fly ortholog

Control and manipulate genetic background, gene expression, environmental exposure

Economical to rear large numbers

Fly models of: Glaucoma

Heart disease Longevity and senescence

Alcohol and drug sensitivity Food consumption

Ataxia Sleep, circadian rhythm

Clemson University Center for Human Genetics

Understand how genetic variation in human populations causes variation in health and disease

Use this knowledge for improved diagnostics, therapeutics, precision medicine

Requires interdisciplinary approach: Statistical and computational genetics

Bioinformatics Genomics

Animal models, patient avatars CRISPR/Cas9 gene editing

Illumina NovaSeq 6000

Up to 6 Tb (6 × 1012 base pairs!) data in two days

48 human genomes 500 human exomes

400 human transcripomes at 30X coverage

Scalable for smaller genomes (flies)

Chromium 10X single cell transcriptomic

and epigenetic profiling capability

Clemson University Center for Human Genetics

Cluster Hire: Five Assistant Professors 2 computational

3 molecular biologists

Center Staff Scientists Dr. Miyoung Shin, Genomics core

Dr. Vijay Shankar, Bioinformatics core

We are seeking collaborators

SCIENCE Health Research Highlights

Dr. Apparao Rao Associate Dean for Discovery

R. A. Bowen Professor of Physics Director, Clemson Nanomaterials Institute

CUSHR Faculty Fellows: Prof. Jeff Anker, Chemistry, Spring/Summer 2018 Area of focus: Cancer biomarkers, implantable sensors to monitor bone healing Prof. Dev Arya, Chemistry, Spring/Summer 2019 Area of focus: Drug design and development

SCIENCE Health Research Highlights

SC Translational Research Improving Musculoskeletal Health (SC TRIMH) Junior Investigator: Prof. Hugo Sanabria, Physics and Astronomy Area of focus: Bone loss, therapeutics, cell/molecular level

Medical Enrichment Through Opportunities in Research (MEnTOR) NIH T35 Training Grant: Profs. Kerry Smith, Lesly Temesvari

Wallace R. Roy Functional Radiology Symposium (Saturday, March 16 at Greenville Memorial Hospital, Greenville, SC) Contact: Prof. Jeff Anker

Prisma Health Collaboration Spotlight

Dr. Desmond Kelly

Chief Medical Research Officer

Health Sciences Center, Prisma Health–Upstate

Dr. Mike Devane

Vice Chair of Academic Affairs

Department of Radiology

Radiology Research 2019

Current Clinical Trials

Collaboration with the Oncology department

Current Clinical Trials

•EPOCH 5.1 Phase III trial sponsored by BTG International.  Prospective, multi-center, randomized Phase III trial evaluating the efficacy and safety of Theraspheres (yttrium 90) in patients with metastatic colorectal cancer of the liver who have progressed with first line chemotherapy.

•RenovoRx TIGER-PAC Prospective, multi-center, randomized trial evaluating intra-arterial gemcitabine versus intravenous gemcitabine and nab-paclitaxel in patients treated with radiation therapy for locally advanced, unresectable pancreatic cancer.

Current Clinical Trials

Collaboration with the GI department

Current Clinical Trials

• Protocol Title: “A Phase 3 Randomized, Double-Blind, Placebo-Controlled Study Evaluating the

Safety and Efficacy of Selonsertib in Subjects with Nonalcoholic Steatohepatitis (NASH) with Bridging (F3) Fibrosis” Sponsor: Gilead Protocol # GS-US-384-1943

• Protocol Title: “A Phase, Randomized, Double-Blind, Placebo-Controlled Study Evaluating the Safety and Efficacy of Selonsertib in Subjects with Compensated Cirrhosis due to Nonalcoholic Steatohepatitis (NASH)” Sponsor: Gilead Protocol # GS-US-384-1944

• Protocol Title: “A Phase 3, Double-Blind, Randomized, Long-Term, Placebo-Controlled, Multicenter Study Evaluating the Safety and Efficacy of Obeticholic Acid in Subjects with Nonalcoholic Steatohepatitis” Sponsor: Intercept Protocol # 747-303

Future Clinical Trials

•Grant submission in progress: Multi-center, prospective, randomized trial evaluating drug coated balloon vs non-drug coated balloon in treatment of TIPS stenosis. Involving UAB, GHS, and Mayo Jacksonville.

• We would like to pursue additional clinical trials in Interventional Radiology, primarily regarding Interventional Oncology.

Clemson collaboration

• Radiology department working with Dr. Ron Gimbel with Clemson University Department of Public Heath.

• Several research projects underway

• Two transformative seed grants

Clemson collaboration

•Gimbel, Woo, Lowe. “Reducing variation of radiologist measurement of lung cancer and hepatic metastatic lesions presented in CT scan images through a physician driven clinical tool.” 2016

•Gimbel, Woo, Lowe, Devane. “Can Artificial Intelligence improve accuracy in measuring cancer lesions in computed tomography scans: A patient safety pilot study.” 2017

Clemson collaboration

•Gimbel, Tyler, Devane. IR vs Surgical ports. Retrospective analysis of cost effectiveness and patient outcome of surgical vs IR ports.

•Gimbel, Tyler, Hanna. Lung cancer screening accessibility in Greenville area.

Clemson collaboration

Collaborative project with Clemson, GHS Radiology, and GHS Orthopedics with Dr. Jeffrey Anker “Augmenting Plain Radiographs with Chemical Indicators.” The purpose of the project is to develop a novel technique to detect and measure local chemical concentrations on the surface of implanted medical devices using plain radiography.

Presentations 2017-2018

• Chamberlin J, Collins J, Schammel D, Schammel C, Devane AM, Trocha S. 2017. Comparing Y-90 Radioembolization and DEB-TACE for Unresectable Hepatocellular Carcinoma with an Evaluation of ALBI Grade and Child-Pugh Score as Prognostic Indicators. World Congress of Interventional Oncology. Poster Presentation. Boston MA. June 2017

• Hood M, Sprunger H, Collins J, Schammel C, Young A, Devane AM. Usefulness of Nephrometry Scoring Systems for Predicting Outcomes and Complications of Percutaneous Cryotherapy and Microwave Ablation Therapy at a Regional Medical Center. World Congress of Interventional Oncology. Poster Presentation. Boston MA. June 2017

Presentations 2017-2018

• Patel M, Horton S, Ewing A, Devane AM, Abrams GA. Utility of Non-Invasive

Methods for Predicting Severity of Liver Fibrosis in Adult Fontans.  27th Annual International Symposium on Adult Congenital Heart Disease 2017 Sept. Poster Presentation.

• Borem RA, Walters JD; Madeline AL, Madeline LA, Mercuri JJ. Characterization of Chemonucleolysis-Induced Disc Degeneration in an Ovine Model: A Pilot Study. Poster Presentation at the Orthopedic Research Society 2018 Annual Meeting at the Hyatt Regency New Orleans in New Orleans, Louisiana, March 10-13

Presentations 2017-2018

• Topoluk N, Collins J, Schammel D, Lynn M, Madeline LA, Hakimi, R. 2017. Clinical

Correlations of Vectors of Neoplastic Spread in Patients with Pituitary Adenomas. American Society of Neuroimaging, 40th Annual Meeting, Los Angeles, CA. January 2017. Poster

• A J Gunn, MD, J A McFarland, MD; S Dhand, MD; N W Ertel, MD; A K Abdel Aal, MD, PhD; M Devane, MD. Lessons Learned About Diagnostic Radiology Reporting from Practicing Interventional Radiology. RSNA Exhibit 11/25/18.

Presentations 2017-2018

• Qi Guo, Melissa Millard, Christine Wilhelm, Ashley Elrod, Nick Erdman, Lacey E. Dobrolecki, Brian McKinley, Mary Rippon, Wendy Cornett, John Rinkliff, Amanda Scopteuolo, Linda Gray, James Epling, Barbara Garner, Jeff Hanna, Eric McGill, C. David Williams, David Schammel, David L. Kaplan, Christopher Corless, Jeff Edenfıeld, Michael T. Lewis, Howland E. Crosswell, Teresa M. DesRochers. Complex, patient-derived, multi-cell type, 3D models of breast cancer for personalized prediction of therapeutic response. American Association for Cancer Research Poster Presentation. Chicago, Ilinois March 14-18, 2018

Publications 2017-2018

• Khalilzadeh O, Baerlocher MO, Shyn PB, Connolly BL, Devane AM, Morris CS, Cohen AM, Midia M, Thornton RH, Gross K, Caplin DM, Aeron G, Misra S, Patel NH, Walker TG, Martinez-Salazar G, Silberzweig JE, Nikolic B. “Proposal of a New Adverse Event Classification by the Society of Interventional Radiology Standards of Practice Committee.” J Vasc Interv Radiol. 2017 Oct;28(10):1432-1437.

• Hanna JW. Q&A Radiology Imaging. GHS Proc. June 2017;2(1):5-7

• Colelay MJ, Ivey LE, Gainey J, Faulkner RV , Johnson A, Brechtel L, Madeline LA, Nathaniel TI. Pharmacological thrombolysis for acute ischemic stroke treatment: Gender differences in clinical risk factors. Advances in Medical Sciences. Volume 63, Issue 1, March 2018, Pages 100-106.

• Abrams GA, Deeter III WT. LOGIQ E9 Shear Wave Elastrography for Detection of Liver Fibrosis in Patients with Chronic HepatitisC Virus. Southern Medical Journal. Volume 109, Number 11, November 2016

Publications 2017-2018

• Lawson T, Wienke JR. American College of Radiology: Case in Point; Juvenile Dermatomyositis. Online

Publication date 6/19/2017. • Johnson A, Brechtel L, Madeline LA, Nathaniel TI. Pharmacological thrombolysis for acute ischemic

stroke treatment: Gender differences in clinical risk factors. Advances in Medical Sciences. Volume 63, Issue 1, March 2018, Pages 100-106.

• Gimbel RW, Pirrallo RG, Lowe SC, et al. Effect of clinical decision rules, patient cost and malpractice information on clinician brain CT image ordering: a randomized controlled trial. BMC Medical Informatics and Decision Making. 2018;18:20. doi:10.1186/s12911-018-0602-1.

• Colello MJ, Ivey LE, Gainey J, Faulkner RV , Johnson A, Brechtel L, Madeline LA, Nathaniel TI. Pharmacological thrombolysis for acute ischemic stroke treatment: Gender differences in clinical risk factors. Advances in Medical Sciences. Volume 63, Issue 1, March 2018, Pages 100-106.

Publications 2017-2018

• Freeman, B. M., Powell, B. C., Devane AM, Hale, A. L., & Gandhi, S. S. Traumatic Aorto-cisterna Chyli

Fistula with Treatment of Aortic Pseudoaneurysm with CT-guided Thrombin Injection. Annals of Vascular Surgery, 48, 4–5. http://doi.org/10.1016/j.avsg.2018.01.011

• Schachter JL, Patel M, Horton SR, Devane AM, Ewing A, Abrams GA. Fibrosure and elastography poorly predict the severity of liver fibrosis in Fontan associated liver disease. Congenital Heart Disease. August 2018. https://doi.org/10.1111/chd.12650

• Avasarala J, Parti N. Can Aspirin Minimize Stroke Risk and New Lesion Formation in Multiple Sclerosis?. Front Neurol. 2018;9:613.

• Roop, BA; Wienke, JR. MD; American College of Radiology: Case in Point; ”Biker’s Nodule.” Online Publication date 5/10/2018.

• Wienke, JR. Question & Answer. “Radiology Imaging.” GHS Proc. November 2017;2(2):91-93

Relationships with Industry

Dr. Mike Devane:

• Speaker for Ethicon, Inc.

• Consultant for BTG, Inc.

• Advisory Board for Dova Pharmaceuticals 10/2018.

Social Media

• Backtable.com Podcast Episode 15. Renal Ablation Therapies with Dr. Mike Devane and Dr. Ahmed Kamel. October 29, 2017.

• Backtable.com Podcast Episode 23. Adrenal Vein Sampling with Dr. Mike Devane. February 20, 2018.

Research Topics of Interest

•Hepatic fibrosis and portal hypertension

• Treatment of hepatocellular carcinoma and hepatic metastatic disease

• Lung cancer screening

• Imaging cost effectiveness

• Artificial intelligence in imaging

• Computerized tumor measurement

• Pancreatic cancer treatment

Dr. Kristin Scott

Associate Professor, Management

CUSHR Faculty Fellow Summer/Fall 2018

Brief and Spectacular: Faculty Fellowship Spotlight

GHS Faculty Fellow: Clinician Burnout Kristin Scott, PhD

MY PROJECT New Employee Orientation (NEO) Program redesigned from a 2 day (16 hour) to a 1 day (8 hour) program with half the content converted to an online format. • Change occurred August 27, 2018 • Longitudinal study of 112 new employees (all

occupations); half were surveyed in the 4 weeks prior and the other half in the 4 weeks after the redesign transition. • Assess pre, during and post burnout • Evaluate employee and organizational factors

that enhance or detract from new hire experience

• Project currently in phase 3 (wrap up April)

Thank you Sharon Wilson! Director, Conscious Leadership

GHS Faculty Fellow: Clinician Burnout Kristin Scott, PhD

Lessons Learned • There are many opportunities for

collaboration! • Be persistent, inquisitive • Continually changing environment –

presents challenges but mostly opportunities

Benefits • Many positive relationships

established • On going research projects • Meaningful impact (professionally,

personally)

Thank you Terrie Long! Director, Learning and Development

Dr. Larry Fredendall Trevillian Distinguished Professor, Department of Management

Clemson Campus Research Director, Health Sciences Center, Prisma Health-Upstate

CUSHR Appointment Committee Update and Announcements

Announcements (Funding Opportunity): Faculty Fellowship Special Call Reminder - Summer / Fall 2019

The Faculty Fellows program is a research quasi-sabbatical. Selected Fellows spend at least 3 days per week on site in a Prisma Health Department during the Fellowship semesters conducting research with a Prisma Health host. This exciting opportunity offers senior faculty an opportunity to increase research connections within the health care system.

The application window is OPEN!!!

Application Deadline: February 15, 2019

Application Timeline

Call released: January 15, 2019 Application due: February 15, 2019

Fellowship semesters: Summer/Fall 2019

Current Faculty Fellows

Dev Arya, PhD, Chemistry

Thomas Britt, PhD, Psychology

CUSHR Update: Appointment Schedule

Clinical Faculty Appointments occur in the FALL of each year • These appointments are for our health system partners

CUSHR Faculty Scholar Appointments occur in the SPRING of each year • These appointments are for Clemson faculty in recognition of

leadership in collaborative health research.

CUSHR Update: New Clinical Faculty - Fall 2018

John Absher, MD Melissa Bailey-Taylor, MD Brian Burnikel, MD Ki Chung, MD John Cull, MD Meredith Eicken, MD Alex Ewing,PhD Sudha Garimella, MD William Hand, MD Meenu Jindal, MD

Bill Kelly, MD Julie Linton, MD Enrique Urrea Mendoza, MD Thomas Pace, MD Stephan Pill, MD Fredy Revilla, MD Prerana Roth, MD Kerry Sease, MD Michael Sridhar, MD Antine Stenbit, MD

Prisma Health

Announcements: Faculty Scholar Appointments

Faculty Scholars are Clemson Faculty who are recognized for their leadership in implementing Clemson’s collaborative health-related research agenda.

The application window is now OPEN!!!

Application Deadline: March 4, 2019 Completed applications are to be sent to CUSHR cushr@clemson.edu

CUSHR Faculty are profiled on the CUSHR website by College at http://www.clemson.edu/health-research/faculty/

Faculty Scholars are found across a wide range of disciplines at the University,

and their research is moving ClemsonFORWARD. Health Innovation research is addressing a diverse spectrum of issues to improve health and health care.

Announcements (Funding Opportunity): MUSC collaborative seed grants

Hollings Cancer Center in conjunction with LOWVELO

Projects must include Clemson & MUSC investigator

• Pre-Clinical & Clinical Concept Award ($50K, 1 year) • Idea Award ($50K, 1 year) • Team Science (up to $150K per year for up to 2 years and must

include at least 3 investigators)

Announcements (Funding Opportunity): SC-TRIMH Pilot Projects

SC-TRIMH is pleased to announce that it will fund multiple pilot projects grants to expand the pool of investigators at Clemson University working on musculoskeletal diseases.

• The SC Translational Research Improving Musculoskeletal Health (SC TRIMH) is a newly established National Institutes of Health Center of Biomedical Research Excellence.

• The submission deadline is February 15, 2019.

More info is available under Limited Submissions on the Office of Research Development website: https://www.clemson.edu/research/development/funding-opportunities/

Goal: Enhance and expand the Biomedical Research capacity at Clemson University

Announcements (Funding Opportunity): Faculty SUCCEEDS

• Applications for funding under the Faculty SUCCEEDS R-Initiative program are due on Feb. 27. The grants provide funding to help multi-disciplinary teams compete for significant external funding. Additionally, the Division of Research is accepting proposals for Major Research Instrumentation grants that help fund equipment purchases and upgrades. MRI applications are due March 27.

• For more information, visit the Clemson Faculty SUCCEEDS page on the Clemson Research Initiatives webpage (http://www.clemson.edu/research/r-initiatives/CU-SUCCEEDS.html)

Announcements (Awards): 2019 Seed Grant Awardees

Transformative Seed Grants

Innovative Teaching and Learning: Key Metrics of an Undergraduate Nursing Academic and Clinical Learning Environments Lori Stanley, DNP John Whitcomb, PhD Chief Nursing Officer Clemson University Forehead temperature-regulating device for insomnia in children with ADHD: a pilot study Jonathan Hintze, MD Goutam Koley, PhD Department of Pediatrics Clemson University Identifying Risk Factors and Barriers to Substance Use Disorder Recovery Prerana Roth, MD Kaileigh Byrne, PhD Department of Internal Clemson University Medicine Feasibility, acceptability, and preliminary efficacy of a cognitive behavioral therapy for opioid use disorder Alain Litwin, MD Irene Pericot-Valverde, PhD Department of Medicine Clemson University

The Impact of Remote Telepresence on Interprofessional Healthcare Team Collaboration and Satisfaction Kenneth Becker, MD Janice Lanham, RN, MS, CNS, FNP Department of Family Clemson University Medicine The Use of Patient-Specific 3D Printed Anatomic Models in Pre-Operative Planning and Patient Engagement to Improve Hip Arthroscopy Outcomes Jason Folk, MD John DesJardins, PhD Department of Clemson University Orthopaedics Understanding the perspectives and needs of African-American and Latino caregivers of persons with Alzheimer’s Disease in Upstate South Carolina Melissa Bailey-Taylor, Nicole Davis, PhD, APRN DO, MPH Clemson University Department of Geriatrics

Cancer Care Delivery Research A Longitudinal Study to Assess the Efficacy of Virtual Reality for Pain and Anxiety Management

in Autologous and Allogeneic Stem Cell Transplant Patients. Elizabeth Cull, MD Laura Stanley, PhD Department of Medicine Clemson University

Diabetes Seed Grants

The Effects of Resistance Exercise on Post-prandial Glycemic Control in Obese or Elderly Patients with Type 2 Diabetes: A Pilot Study Stephen Franks, DNP Kim Pickett. PhD Department of Medicine Clemson University

Announcements (Upcoming Events): Dempsey Conference and SAEM Conference

Dempsey Conference

The 3rd Annual Harriet and Jerry Dempsey Research

Conference is presented in association with the

Regional Conference of the Society of Academic

Emergency Medicine (SAEM) Feb 22-23.

When: Friday, Feb. 22, 2019, 8:30 a.m. - 1:30 p.m.

Where: Auditorium, CU Nursing Building, 605 Grove Road

RSVP: Kevin Taaffe: taaffe@clemson.edu

*Lunch will be served.

Society for Academic Emergency Medicine (SAEM) Southeastern Announcement and

Invitation

Full-day Saturday conference, a CPC competition, Simulation Olympics, and LLSA

Review opportunities. Showcase your residency, fellowship, and/or department in

our exhibitor fair.

When: February 22nd and 23rd, 2019

Where: USCSOM-G building, CU Nursing Building, and Greenville One Center

For More Information: Please visit saemsoutheast.com. Further questions can

be directed to info@saemsoutheast.com

Announcements (Upcoming Events): Dempsey Conference and SAEM Conference

Speakers:

• Tom Borg, PhD, MUSC: Extracellular Matrix in Heart Development & Regeneration

• Arash Kheradvar, MD, PhD, UC Irvine: Mitochondrial Transplantation for Cardiac Diseases

• Brian Denton, PhD, University of Michigan: Data Analytics for Optimal Detection of Metastatic Prostate Cancer

• Raj Ratwani, PhD, MedStar Health: Understanding Physician Stress, Workflow, and Task Interruptions

Announcements (Upcoming Event): CU FoodFORWARD Research Symposium

Clemson University FoodFORWARD Research Symposium

Hosted jointly by

College of Behavioral, Social and Health Sciences and College of Agriculture, Forestry and Life Sciences

When: Friday, March 1, 9-11:30 a.m.

Where: Watt Family Innovation Center, Clemson University

For More Information Contact:

Dean Leslie Hossfield at lhossfe@clemson.edu or

Dr. Michelle Parisi at mparisi@clemson.edu

Announcements (Upcoming Event): Nurturing Developing Minds Conference

2019 NURTURING DEVELOPING MINDS CONFERENCE AND RESEARCH SYMPOSIUM

"Creating Environments in Which Children and Families can Flourish"

• In partnership with the Institute for Child Success, and the Bradshaw Institute for Community Child Health & Advocacy

• Plenary sessions feature national experts on brain development and function, the impact of adversity, and interventions to support developmental resilience.

• February 28 – March 1 at the Embassy Suites (670 Verdae Blvd., Greenville, SC)

For more information: https://ghscme.ethosce.com/content/2019NDM#group-tabs-node-course-default1

Announcements (Upcoming Event): Wallace R. Roy Functional Radiology Symposium

• The Wallace R. Roy Functional Radiology Symposium brings together scientists, engineers, nurses, clinicians and students for a one-day symposium on functional radiology research.

• WHEN: Saturday, March 16, 2019

• WHERE: Greenville Memorial Hospital campus

More information can be found here:

https://www.clemson.edu/science/departments/chemistry/news-events/symposium.html

Announcements (Upcoming Event): Research Showcase

WHEN: Friday, April 12, 2019 WHERE: Clemson Nursing building, Greenville Memorial Hospital campus

Health Sciences Center Research Showcase

Announcements (Upcoming Event): Research Showcase

WHEN: Wednesday, May 8, 2019 WHERE: Watt Family Innovation Center

Clemson University

Reminder our 2nd Spring CUSHR meeting is held in collaboration with the University Research Day 2019 Clemson University Research Symposium: Moving ClemsonForward Through Research

Next CUSHR Meeting: May 8, 2019

top related