correlating transcription initiation and conformational
Post on 26-Jul-2022
15 Views
Preview:
TRANSCRIPT
Article
Correlating Transcription
Initiation andConformational Changes by a Single-Subunit RNAPolymerase with Near Base-Pair ResolutionGraphical Abstract
Highlights
d Single-molecule fluorescence monitors most steps during
transcription initiation
d Abortive initiation occurs by RNA polymerase recycling or
exchange
d Initiation to elongation transition shows multiple branching
kinetic pathways
d Majority of productive transcription shows no detectable
abortive initiation
Koh et al., 2018, Molecular Cell 70, 695–706May 17, 2018 ª 2018 Elsevier Inc.https://doi.org/10.1016/j.molcel.2018.04.018
Authors
Hye Ran Koh, Rahul Roy,
Maria Sorokina, Guo-Qing Tang,
Divya Nandakumar, Smita S. Patel,
Taekjip Ha
Correspondencepatelss@rwjms.rutgers.edu (S.S.P.),tjha@jhu.edu (T.H.)
In Brief
Koh et al. report single-molecule
transcription that monitors most steps of
initiation in real time with near base-pair
resolution. They distinguish productive
and failed transcription; they also show
that a majority of productive transcription
occurs without abortive initiation and that
most of the abortive RNAs result from
multiple rounds of failed transcription
events.
Molecular Cell
Article
Correlating Transcription Initiationand Conformational Changes by a Single-SubunitRNA Polymerase with Near Base-Pair ResolutionHye Ran Koh,1,2 Rahul Roy,1 Maria Sorokina,1 Guo-Qing Tang,3 Divya Nandakumar,3 Smita S. Patel,3,*and Taekjip Ha1,4,5,6,*1Department of Physics and Center for the Physics of Living Cells, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA2Department of Chemistry, Chung-Ang University, Seoul 06974, Korea3Department of Biochemistry andMolecular Biology, Rutgers University, Robert Wood JohnsonMedical School, Piscataway, NJ 08854, USA4Howard Hughes Medical Institute, Baltimore, MD 21205, USA5Departments of Biophysics and Biophysical Chemistry, Biophysics, and Biomedical Engineering, Johns Hopkins University, MD 21205, USA6Lead Contact*Correspondence: patelss@rwjms.rutgers.edu (S.S.P.), tjha@jhu.edu (T.H.)
https://doi.org/10.1016/j.molcel.2018.04.018
SUMMARY
We provide a comprehensive analysis of transcrip-tion in real time by T7 RNA Polymerase (RNAP) us-ing single-molecule fluorescence resonance energytransfer by monitoring the entire life history of tran-scription initiation, including stepwise RNA synthe-sis with near base-pair resolution, abortive cycling,and transition into elongation. Kinetically branchingpathways were observed for abortive initiation withan RNAP either recycling on the same promoter orexchanging with another RNAP from solution. Wedetected fast and slow populations of RNAP in theirtransition into elongation, consistent with the effi-cient and delayed promoter release, respectively,observed in ensemble studies. Real-time moni-toring of abortive cycling using three-probeanalysis showed that the initiation events are sto-chastically branched into productive and failedtranscription. The abortive products are generatedprimarily from initiation events that fail to progressto elongation, and a majority of the productiveevents transit to elongation without making abor-tive products.
INTRODUCTION
The single-subunit T7 RNA polymerase (RNAP) catalyzes tran-
scription fundamentally in the same way as the multi-subunit
RNAPs, in spite of its relatively simple structure unrelated to
multi-subunit RNAPs (McAllister, 1993; Sousa, 1996). It starts
transcription by recognizing a specific DNA sequence termed
T7 promoter, a highly conserved 23-base pair (bp) sequence
from �17 to +6 relative to the initiation site for RNA synthesis
(Rosa, 1979). When the RNAP binds to its promoter DNA, it in-
duces promoter DNA bending and opening to generate a tran-
M
scription bubble from �4 to +2 that is stabilized by the initiating
nucleotide GTP (Figure 1A) (Tang and Patel, 2006a, 2006b; Ujvari
and Martin, 2000). In this initiation complex, where the upstream
promoter region is bound to the N-terminal domain of T7 RNAP
(Figures 1A and 1B), the growing RNA:DNA hybrid from 3 to
7 bps pushes against the N-terminal domain (Figure 1A, pink)
causing it to rotate by 40� (Figure 1B) (Bandwar et al., 2007;
Cheetham and Steitz, 1999; Durniak et al., 2008; Ma et al.,
2005; Mukherjee et al., 2002; Sousa et al., 1993; Tahirov et al.,
2002; Yin and Steitz, 2002). Ensemble fluorescence resonance
energy transfer (FRET) studies have measured stepwise DNA
scrunching and N-terminal domain rotation during initiation
(Tang et al., 2008, 2009). The final IC (initiation complex) to EC
(elongation complex) change involves a dramatic 220� rotation
that abrogates the upstream promoter interactions (Bandwar
et al., 2007; Cheetham and Steitz, 1999; Durniak et al., 2008;
Ma et al., 2005; Mukherjee et al., 2002; Sousa et al., 1993; Ta-
hirov et al., 2002; Yin and Steitz, 2002). In particular, the N-termi-
nal subdomain H (Figure 1C, green subdomain) refolds and
moves �70 A to the opposite end to become part of the RNA
channel in the EC. While the RNAP is in contact with the pro-
moter site, it goes through an abortive synthesis phase that re-
leases short RNAs of 2–13 nt in length (Figure 1D) (Brieba and
Sousa, 2001; Ikeda and Richardson, 1986; Jia and Patel,
1997a; Martin et al., 1988; Tang et al., 2005). Abortive cycling,
the process where RNAP restarts transcription after releasing
short RNA fragments, is a universal feature of transcription
(Carpousis and Gralla, 1980; Martin et al., 1988; Munson and
Reznikoff, 1981). In T7 RNAP, pushback from the rotation of
the N-terminal subdomain accompanying RNA synthesis could
destabilize the transcribing ternary RNAP-DNA complex,
thereby releasing the short RNAs as abortive products. Addition-
ally, persistent interactions between the N-terminal subdomain
(Figure 1A, pink) and the upstream promoter region affect the
abundance of the long abortives (11–13 nt in length) (Figure 1D)
(Tang et al., 2005). Weakening these interactions reduces long
abortives (Bandwar et al., 2006), whereas stable disulfide cross-
link between the two regions increases these products, without
affecting the short abortives (2–8 nt) (Esposito andMartin, 2004).
olecular Cell 70, 695–706, May 17, 2018 ª 2018 Elsevier Inc. 695
Figure 1. Structures of T7 RNAP in the Initiation and Elongation Phases and Schematics to Study Single-Molecule Transcription Initiation
(A) T7 RNAP IC with 3-nt RNA (PDB 1QLN). The dotted lines show the approximate location of the downstream promoter DNA.
(B and C) IC (B) with 7-nt RNA (PDB 3E2E) and elongation complex (C) (PDB 1MSW). The DNA template and non-template strands are in green and red,
respectively. The C-terminal domain of T7 RNAP (sky blue) remains mostly unchanged, and the N-terminal subdomains (yellow, pink, and green) undergo major
conformational changes. The donor Cy3 (green ball) was attached to amino acid 174 in subdomain H and acceptor Cy5 (red hexagon) at +17 on the promoter DNA
in configurations 3 and 4. The donor-acceptor distance changes from �80 A in IC to �40 A in EC.
(D) The kinetics of transcription on the �21 to +19 phi10 promoter fragment at 25�C with [g32P]GTP and NTPs (0.5 mM), T7 RNAP (15 mM), and promoter DNA
(10 mM, reproduced from Tang et al., 2005).
(E) Immobilized DNA containing the T7 promoter sequence with the fluorophore locations marked. The biotinylated dsDNA was immobilized on PEG-coated
quartz surface. The yellow box displays the T7 promoter site recognized by the RNAP.
(F) Outline of the single-molecule fluorescence experiments and labeling configurations tomeasure the various steps of the transcription reaction by the T7RNAP.
Different colors in T7 RNAP represent various protein domains. The green domain is subdomain H showing a large movement during IC to EC transition.
Biochemical and structural studies have characterized pro-
moter clearance, initial bubble collapse (Gong et al., 2004; Liu
and Martin, 2002), and transition into elongation in RNAPs
(Bandwar et al., 2007; Cheetham and Steitz, 1999; Durniak
et al., 2008; Ma et al., 2005; Mukherjee et al., 2002; Sousa
et al., 1993; Tahirov et al., 2002; Yin and Steitz, 2002). Because
the crystal structures offer static views, and ensemble methods
provide an average picture of steps during transcription initiation
and transition to elongation, the real-time monitoring of these
processes at the level of a single RNAP is desirable (Herbert
et al., 2008; Kapanidis et al., 2006; Revyakin et al., 2006). For
example, there could be multiple pathways of abortive initiation
and transition to elongation. These pathwaysmay arise from sto-
chastic events during abortive initiation and depend on the
696 Molecular Cell 70, 695–706, May 17, 2018
changing interactions of the RNAP with the promoter DNA, but
ensemble studies cannot sort out kinetic branching between
such pathways. Additionally, we do not know whether every
transcription initiation event has to go through an abortive phase.
Single-molecule techniques (Bustamante, 2008; Tamarat et al.,
2000) can resolve hidden characteristics that are averaged out
in ensemble transcription assays (Friedman and Gelles, 2012;
Herbert et al., 2008; Zhang et al., 2014). Single-molecule FRET
and magnetic tweezers studies have demonstrated DNA open-
ing and scrunching during initiation (Duchi et al., 2018; Kapanidis
et al., 2006; Revyakin et al., 2006; Tang et al., 2008). Similarly,
optical tweezers studies detected RNAP’s elongation in single
base-pair steps (Abbondanzieri et al., 2005), pausing (Herbert
et al., 2006), and termination (Larson et al., 2008). However,
the ability to monitor RNA synthesis and the accompanying
conformational changes of both the substrate DNA and RNAP
simultaneously during the various phases of transcription initia-
tion in real time and with a high resolution is lacking.
In this study, we placed fluorescent probes on the promoter
DNA and T7 RNAP and monitored the multistep reactions of
the transcription process in real time and with near single base
resolution using various single-molecule fluorescence methods
including protein-induced fluorescence enhancement, fluores-
cence lifetime and FRET (Ha, 2001; Ha et al., 1996). We moni-
tored the dynamics of each step including promoter binding,
closed to open transition, stepwise elongation of RNA, abortive
cycling, and transition into elongation by single RNAPmolecules.
We could quantify two kinetically distinct pathways of transcrip-
tion initiation and observe in real-time abortive events, transition
to elongation phase, and its intermediates. The unexpected
finding was that a majority of the productive initiation events
occurred with no detectable abortives, which is counterintuitive
but is consistent with probabilistic modeling.
RESULTS AND DISCUSSION
The double-stranded (ds) DNA (47 bp) containing the consensus
T7 promoter sequence was immobilized on a polyethylene glycol
(PEG)-coated quartz surface via neutravidin-biotin interaction,
and reactions were initiated by adding RNAP with or without
ribonucleoside 50-triphosphates (NTPs) (Figure 1E). We used
four different labeling configurations to probe the various steps
of transcription by T7RNAP on single DNAmolecules (Figure 1F).
In configuration 1, Cy3 fluorophore was conjugated to the non-
template strand at position �4, which is at the upstream edge
of the initiation bubble in the promoter site (transcription start
site of the position +1). Measurement of fluorescence intensity
and the lifetime of Cy3 in configuration 1 monitors both promoter
binding and melting by RNAP (Sorokina et al., 2009). In configu-
ration 2, Cy3 and Cy5 were conjugated to position �4 of the
non-template strand and position +17 of the template strand,
respectively, so that FRET between them reports on DNA
bending/scrunching during transcription initiation (Tang et al.,
2008). In configuration 3, RNAP (V174C mutant) was labeled
with Cy3 at its subdomain H (Cy3-RNAP) and DNA was labeled
with Cy5 at position +17 of the template strand (Figures
1A–1C). Thus, FRET reports on the significant relocation of sub-
domain H that occurs during the IC-to-EC transition (Cheetham
and Steitz, 1999; Sousa et al., 1993; Tahirov et al., 2002; Yin and
Steitz, 2002). Finally, configuration 4 combines configurations
2 and 3, where Cy3-RNAP was used with Cy3-Cy5 doubly
labeled DNA, simultaneously reporting on transcription initiation
and IC-to-EC transition.
RNAP Binding and Promoter OpeningFirst, we measured the single-molecule kinetics of T7 RNAP
binding to Cy3-labeled DNA in configuration 1. The fluorescence
intensity of Cy3 increases by its proximity to a protein (Hwang
and Myong, 2014; Luo et al., 2007; Myong et al., 2009). Before
the addition of the RNAP, the intensity of Cy3 at position �4 on
the non-template strand (configuration 1) remained low and
constant over time, but upon adding T7 RNAP, the Cy3 signal
fluctuated among three intensity levels; low, mid, and high (Fig-
ures 2A and 2B). The low-intensity state comes fromCy3-labeled
DNA by itself (U), and the mid/high-intensity states arise from the
RNAP-bound DNA species (B). We measured the single-mole-
cule fluorescence lifetimes using time-correlated single photon
counting to test our states assignment further (Figure 2C). The
fluorescence lifetime of Cy3, which is the average time between
its excitation and fluorescence photon emission, is sensitive to
the local environment and has distinct values for closed and
open complexes (Sorokina et al., 2009). The lifetime of the low-
intensity state is the shortest and matches the lifetime of DNA
alone, �0.8 ns (Figure 2D) (Sorokina et al., 2009). The lifetime
of the high-intensity state,�1.3 ns (Figures 2C and 2D), matches
the lifetimes of both the open complex bound to the initiating
NTP, 30-dGTP (Sorokina et al., 2009; Stano et al., 2002) and
the pre-melted DNA-RNAP (mismatches from �4 to +2) (Soro-
kina et al., 2009). Therefore, we assign the low-intensity state
to the DNA-only state and the high-intensity state to the open
complex with a transcription bubble. We putatively assign the
mid intensity state with an intermediate lifetime to the RNAP-
bound closed complex, where the DNA is not open, but the
DNA is bent (see below).
The closed and open complexes (state C and state O, respec-
tively) in the time traces were grouped as the RNAP-bound state
B (blue box), and the DNA only is the unbound state U
(yellow box) (Figure 2B). Dwell-time analysis of the U and B
states provided the kinetics of RNAP binding and dissociation
from the DNA, respectively (Figures 2E and 2F). The inverse of
the average dwell time of U depended linearly on RNAP concen-
tration with a slope of 5.66 (±0.16) 3 107 M–1s–1 (Figure 2E),
which is the kon rate constant of RNAP-DNA complex formation.
It is only three times slower than the previous estimate in bulk
(Tang and Patel, 2006b), suggesting that Cy3 labeling at
the �4 base or surface immobilization of the RNAP-DNA com-
plex has only moderate impacts on the RNAP-DNA interaction.
The inverse of the average dwell time of B did not depend on
the RNAP concentration and provided an apparent T7 RNAP
dissociation rate of 1.2 s–1 (Figure 2F).
Within the RNAP-bound B state, two different intensity states,
state C (mid-intensity) and state O (high-intensity) exist (Fig-
ure 2B). The dwell time shows that the state C is more stable
than the open state O (Figures 2G and 2H). The average C dwell
time provides the promoter opening rate of 3.9 ± 0.3 s–1 (Fig-
ure 2H). The average O dwell time was shorter than our time
resolution of 16 ms for time traces in Figures 2A and 2B (corre-
sponding to a rate constant of 62.5 s–1) (Figure 2G), and consis-
tent with the fast rate of promoter closing of 125–150 s–1
measured by stopped-flow kinetics (Stano et al., 2002; Tang
and Patel, 2006a). The fluorescence intensity histogram pro-
vided an O to C ratio of 0.28 (Figure S1A), which is also consis-
tent with the 30%–35% of the open complex observed in bulk
experiments without initiating NTP (Bandwar and Patel, 2001;
Villemain et al., 1997), further supporting our states assignment.
Next, we measured the FRET from the donor (Cy3) and
acceptor (Cy5) intensities of the doubly labeled DNA (configura-
tion 2) upon addition of RNAP (Figures 2I–2K). The apparent
FRET efficiency was the same (�0.3) for all of the species
(U, C, and O), because the quantum yield of Cy3 is affected by
Molecular Cell 70, 695–706, May 17, 2018 697
Figure 2. Dynamics of RNAP Binding and
DNA Opening
(A) Real-time observation of T7 RNAP binding to
the promoter DNA and DNA opening. Time traces
of Cy3 intensity measured in configuration 1 show
increases in fluorescence intensity correlated with
the RNAP binding events. Dotted lines are guides
for three different intensity levels.
(B) A zoom-in of the time trace is displayed in the
red box of (A). B and U represent RNAP-bound
and RNAP-unbound states, respectively.
(C) Time traces of fluorescence intensity (top) and
lifetime (bottom) of Cy3 (10 nM RNAP).
(D) Fluorescence lifetime distributions of DNA only
(top), DNA with 10 nM RNAP (middle), and DNA
with 10 nM RNAP and 1mM 30-dGTP. The red and
blue lines show the average lifetimes of O and C
states, respectively.
(E) The binding rate (mean ± SEM) of the RNAP to
the DNA increases linearly with the RNAP con-
centration with a slope of 5.66 (±0.16) 3 107
M–1s–1 corresponding to the kon rate constant.
(F) The RNAP dissociation rates (mean ± SEM)
from the DNA (�1.2 s–1) plotted against the RNAP
concentration.
(G) Dwell-time histogram of state (O) fit to a single
exponential fit estimating the promoter closing
rate constant (>62.5 s–1).
(H) Dwell-time histogram of state (C) and a single
exponential fit providing the promoter opening
rate constant (3.9 s–1).
(I) FRET from the donor (Cy3, green) and acceptor
(Cy5, red)-labeled promoter DNA upon RNAP
binding (configuration 2). Diagram showing
sequential DNA bending caused by RNAP binding,
DNA opening, and initial NTP binding steps.
(J–M) Corrected FRET efficiency histograms from
(J) DNA alone, (K) closed complex, (L) open com-
plex, and (M) IC stalled at +1/+2.
See also Figures S1 and S2.
the RNAP binding and promoter opening steps, and this masks
the change in FRET efficiency. We, therefore, calculated the cor-
rected FRET efficiency (Ecorr) using the relative quantum yields of
Cy3 and Cy5 and the total fluorescence intensity, Itotal (Figures
S1B and S1C). The corrected FRET efficiency histograms distin-
guished the three species (U, C, and O) and provided additional
information about DNA bending (Figures 2I–2L). Ecorr is the
lowest for DNA alone (Figure 2I) and increases from 0.15 /
0.22 upon RNAP binding to DNA in the closed complex (Fig-
ure 2J). The higher FRET value of DNA in the C state implies
that the DNA is bent in the closed complex (Figure 2J), which
has not been observed previously because bulk studies could
not resolve DNA bending from DNA opening (Tang and Patel,
2006a). The Ecorr increases further (0.22 / 0.28) when the
RNAP transitions to the open complex (O) (Figure 2K), indicating
698 Molecular Cell 70, 695–706, May 17, 2018
additional DNA bending with transcrip-
tional bubble formation (Tang and Patel,
2006a). Interestingly, when the initiating
NTP (30-dGTP) was added, we observed
an additional increase in Ecorr (0.28 /
0.47) (Figure 2L), which indicates further bending of the DNA in
the IC bound to NTP at position +1/+2 (Tang and Patel, 2006a,
2006b). Figure 2M summarizes the proposed conformational
changes in the promoter DNA caused by RNAP and 30-dGTP
binding based on the sequential increase of FRET efficiency at
each step.
DNA Scrunching/Bending in the ICNext, we measured the FRET in the doubly labeled DNA (config-
uration 2) during initial RNA synthesis (Figure 3A). We stalled
transcription at defined positions using a limiting set of NTPs
and 30dNTP analogs. The quantum yield of Cy3 did not change
between these stalled positions, making the quantum yield
correction of FRET efficiency unnecessary (Figure S2A). The un-
corrected FRET efficiency, E, increased sequentially from the
stalled position +1/+2 to position +6: 0.3 for DNA only, 0.43 at
position +1/+2 with 30-dGTP, 0.5 at position +3 with GTP, and
0.65 both at the position +4 and +6, with GTP+30-dATP and
GTP+ATP, respectively (Figure 3A). We previously reported
that these increases in E are caused by a combination of step-
wise scrunching and bending of the DNA, which brings Cy5 at
position +17 closer to Cy3 at position �4 (Durniak et al., 2008;
Tang et al., 2008).
A single high FRET population (E = 0.65) at +6 at saturating
concentrations of GTP (1 mM) and ATP (0.5 mM) indicates that
the RNAP rapidly synthesize the 6-mer RNA and stays at the
position +6 until 6-mer RNA release (Margeat et al., 2006; Tang
et al., 2008). To measure the real-time transcription reaction up
to 6-mer synthesis, we used sub-saturating NTP concentrations
(20 mM GTP and 10 mM ATP). We could discern four distinct
states in single-molecule time traces, transitioning from E = 0.3
through 0.43 and 0.5 to 0.65 (Figure 3B). TheseE valuesmatched
those of the E histograms of DNA only (E = 0.3), RNAP stalled at
position +1/+2 (E = 0.43), position +3 (E = 0.5) and positions +4
to +6 (E = 0.65). Thus, the single-molecule time course repre-
sents the real-time observation of transcription initiation by a sin-
gle T7 RNAP with near base-pair resolution. The steep drop of E
from the highest E state in Figure 3B is due to RNA release as an
abortive product, as we will discuss below.
To determine the average rate of each RNA lengthening
step, we carried out dwell-time analysis of each state
(DNA, +1/+2, +3, +4 to +6). The dwell-time histograms displayed
a peaked distribution instead of a simple exponential, suggest-
ing that there ismore than one rate-limiting stepwithin each state
(Figure 3C). At 20 mM GTP, 10 mM ATP, and 10 nM RNAP, the
average rates of exiting the states with E = 0.3, 0.43, 0.5, and
0.65 were 0.26 (±0.08), 1.53 (±0.34), 0.71 (±0.14), and 0.07
(±0.01) s–1, respectively These exit rates of the E = 0.3 and
0.43 states are very similar to the measured rate constants of
2-mer and 3-mer RNA synthesis by pre-steady-state kinetics
at 20 mM GTP (Jia and Patel, 1997b).
Abortive Cycling PathwayAs described above, during transcription initiation in the pres-
ence of GTP and ATP, where transcription cannot continue
past the +6 position, there was an abrupt drop in E after a delay
(Figure 3B). The sudden drop in E cannot be caused by the tran-
sition to EC because structural and biochemical studies indicate
that transition to EC is not expected at position +6 and occurs
between 8 and 12 nt synthesis (Bandwar et al., 2006). Instead,
our analysis below indicates that the decrease in E is due to
RNA release. Thus, the repetitive cycles of stepwise increase
in E and a sudden decrease represent real-time monitoring of
the abortive cycling of the RNAP during transcription initiation
(Figures 4A and 4B). We observed two types of abortive cycling:
one, where the RNAP stays bound to the DNA even after RNA
release and restarts another round of RNA synthesis (RNAP re-
cycling), and, two, where the RNAP dissociates from the DNA
with or after RNA release, so that the next round begins only after
the binding by another RNAP (RNAP exchange) (Figure 4C).
Figure 4A shows an example of the RNAP exchange pathway
(green circle in Figure 4C). Herein, we observed repetitive transi-
tions of E from 0.3 to 0.65 (DNA scrunching/bending during initial
transcription to position +6), and then to 0.43 (red line) (relaxation
of scrunched/bent DNA upon RNA release), and then to 0.3
(black line) (RNAP dissociation). A large drop in Itotal (blue trace)
that reverses protein-induced fluorescence enhancement of Cy3
accompanies the E = 0.3 state, consistent with RNAP dissocia-
tion. The dwell-time analysis provided additional evidence for the
RNAP exchange pathway. If RNAP is dissociating, we expect the
exit rate of the E = 0.3 state to depend on the concentration of
RNAP (KD �10 nM) and not on the concentration of GTP, which
is what we observed (Figures 4D and 4E). The above shows that
the E = 0.3 state is the DNA-only state resulting from RNAP
dissociation accompanying RNA release.
Figure 4B shows an example of the RNAP recycling pathway
(orange circle in Figure 4C). Herein E increases from 0.43 to
0.65 (initial transcription), drops to 0.43 (RNA release), and in-
creases again, suggesting that transcription reinitiates without
RNAP dissociation (no visits to the E = 0.3 state). As expected
for a non-dissociating RNAP, the average dwell time of the
E = 0.43 state depends on the concentration of GTP (the first
three NTPs to be incorporated in the RNA), but not on the
RNAP concentration (Figures 4F and 4G). These results support
our interpretation that the E = 0.43 state is the RNAP-bound
state. Also, the Itotal does not drop significantly, suggesting
that the transcription bubble is intact in this intermediate. If the
bubble had collapsed, a reduction in Cy3 quantum yield would
have changed the total fluorescence intensity more significantly.
We also observed from the same DNA molecule both the
RNAP exchange and RNAP recycling pathways (Figure S3A),
indicating that one or the other abortive cycling pathway is not
due to a chemical defect in single DNA molecules. The partition-
ing between the RNAP exchange and RNAP recycling de-
pended, as expected, on the concentration of GTP. At higher
concentrations of GTP, the RNAP recycling pathway was
preferred (Figure S3B) likely because of kinetic competition be-
tween RNA synthesis and RNAP dissociation.
RNAP Conformational Changes during Transition to ECT7 RNAP undergoes major conformational changes during IC to
EC transition (Figures 1A–1C) (Durniak et al., 2008; Tang et al.,
2008; Yin and Steitz, 2002), including translation of the subdo-
main H by �70 A toward the active site of T7 RNAP to become
a part of the RNA exit tunnel. We prepared a functionally active
cysteine-light RNAP, reported earlier (Mukherjee et al., 2002),
and introduced a cysteine at V174 within the subdomain H and
labeled it with Cy3 (Figure S4A). The DNA was labeled with
Cy5 at position +17 of the template strand (configuration 3,
Figure 5A).
First, we examined E histograms of RNAP complexes in
configuration 3 stalled at positions +1, +4, +6, +7, +8, +9,
and +12 after a reaction time of 1 min (Figure S4B). We observed
a single population (E�0.1) for positions +1, +4, +6, and +7, two
populations, low and mid E (E �0.1 and 0.4) at positions +8
and +9, and a single high E population (E �0.8) at position +12
(Figures 5B and S4B). The low E values observed at positions +1
through +7 are indicative of a large distance between
position +17 on the DNA and V174C on the RNAP, as shown in
Figures 1A and 1B, consistent with the crystal structures of IC3
and IC7 (Durniak et al., 2008). The high E value of the population
Molecular Cell 70, 695–706, May 17, 2018 699
Figure 3. Real-Time Observation of Transcription Initiation with near Base-Pair Resolution
(A and B) E histograms in configuration 2 at +1/+2, +3, +4, and +6 transcriptional stall positions (A) and representative time traces of transcription reaction
(20 mM GTP and 10 mM ATP) stalling at position +6 (B). Colored horizontal bands mark different FRET states.
(C) Dwell-time distributions of four distinct FRET states—0.3, 0.43, 0.5, and 0.65—resolved as shown in (B) and fits a gamma distribution function, tn–1e–kt, from
which we calculated the average rates, k/n, of leaving each FRET state.
(D) Each RNA lengthening rate up to 6-nt RNA synthesis and estimation on the rate of abortive product release at each position.
at position +12 is consistent with the completion of IC to EC tran-
sition at +12 (Bandwar et al., 2006; Tang et al., 2009) that brings
the Cy3-labeled subdomain H toward the active site as shown in
Figure 1C. Therefore, our labeling configuration can reliably
detect changes in FRET that are expectedwith the RNAP confor-
mational changes associated with the IC to EC transition.
At positions +8 and +9, the mid E population appeared over
time at the expense of the low E population. The rate was
0.09 min–1 at position +8 and 1.1 min–1 at position +9 (Figures
S5A–S5D). Experiments performed using configuration 2
showed that RNAP complexes stalled at position +8 undergo un-
scrunching/unbending as observed through E decrease over a
similar timescale (Figure S5E). Therefore, RNAP complexes
stalled at +8 and +9 positions are capable of acquiring a struc-
ture where the H subdomain moves over, and DNA scrunch-
ing/bending partially reverses. However, this intermediate
structure appears to be distinct from EC because the Itotal of
700 Molecular Cell 70, 695–706, May 17, 2018
the two E populations at position +8 observed using configura-
tion 2 are comparable (Figures S5F and S5G), meaning that pro-
tein proximity to Cy3 on �4 position is the same. Therefore, the
mid E state at positions +8 and +9 observed using configuration
3 appears to be a new state, which has undergone a partial
conformational change to bring the subdomain H closer to
the +17 position on the DNA while maintaining interactions be-
tween the RNAP and promoter.
Next, we monitored IC to EC transition in real time in configu-
ration 3 with all four NTPs present at saturating concentrations
(1 mM GTP and 0.5 mM ATP, UTP, and CTP) (Figure 5C). The
time trace was partitioned into three segments – IC (pink), tran-
sition (yellow), and EC (blue) (Figure 5C). The low E state is the
IC segment lasting from +1 to +7, the steep increase of E is the
transition segment when the structural changes in RNAP occur,
and the high E state is the EC segment. In the presence of all
NTPs,�10%of time traces showed themid E state (Figure S5H).
Figure 4. Abortive Cycling Pathways: RNAP Exchange versus RNAP Recycling
(A and B) Two representative time traces showing abortive cycling pathways of transcription reaction stalling at +6 (20 mMGTP and 10 mMATP) measured using
configuration 2. Green (Cy3 intensity), red (Cy5 intensity), blue (total intensity), and black (E). In the time trace shown in (A), repetitive drops to both E �0.43
(red line) and E = 0.3 state (black line) are observed. In the time trace shown in (B), only repetitive drops to E�0.43 (red line) are observed. The drop in fluorescence
at the very end of the trace at the top panel is due to photobleaching.
(C) The abortive cycling pathways via RNAP exchange (green circle) and RNAP recycling (orange circle).
(D) The exit rate (mean ± SEM) of E = 0.3 state versus [RNAP].
(E) The exit rate (mean ± SEM) of E = 0.3 versus [GTP].
(F and G) The exit rate (mean ± SEM) of E = 0.43 state versus [RNAP] (F) and [GTP] (G).
See also Figure S3.
Dwell-time analysis showed that the IC segment is about 1.2 s
in duration, and this represents the time interval between RNAP
binding and the transition to EC (Figure 5D), which may also
include abortive cycling without RNAP dissociation. This phase
has a duration similar to the 1.3–4.6 s of lag time between
RNAP binding and the beginning of the elongation phase, deter-
mined both using optical tweezers (Skinner et al., 2004) and the
pre-steady-state kinetics of transcription initiation (Jia and Patel,
1997a; Tang et al., 2009). However, this is slower than �0.2 s of
lag time between RNAP binding and the beginning of the elonga-
tion phase obtained by fast fluorescence in situ hybridization
method at 37�C probably because of the temperature difference
(Zhang et al., 2014).
Dwell-time analysis of the transition segment showed fast and
slow initiation populations transitioning into EC (Figure 5E). The
average rate constants of the two distinct populations during
the transition are 18.4 and 4.8 s–1 (Figure 5E). We hypothesize
that the fast and slow populations of initiating complexes arise
from a kinetic branch after 8 nt synthesis. The slower population
might be related to the mid E state detected at positions +8
and +9, which maintains promoter interactions and therefore
transitions to EC more slowly. In ensemble studies, the popula-
tion that maintains upstream promoter interactions ends up
making 11–13 long abortives (Bandwar et al., 2006; Esposito
and Martin, 2004). The faster population would be the IC com-
plex that clears the promoter and transitions to EC quickly
(Bandwar et al., 2007). The biological significance of the fast
and slow populations escaping to elongation is not apparent,
but this mechanism could aid in the initiation of DNA replication.
T7 DNA polymerase uses a T7 RNAP-made RNA transcript
to initiate DNA replication (Richardson, 1983). This transcript
must be handed over from T7 RNAP to the DNA polymerase,
andwe speculate that the slower rate of transition into elongation
would facilitate this process.
Dwell-time analysis of the EC segment showed a relatively
long duration of 1.2 s, which represents the time it takes for
the RNAP to complete the synthesis of RNA after the IC to EC
transition and dissociate from the DNA. The elongation rate of
T7 RNAP is fast (40–200 nt/s) (Anand and Patel, 2006; Kim and
Larson, 2007; Skinner et al., 2004); hence, short RNAs (14 nt
from +12 to +25) are synthesized quickly. The relatively long
dwell time in the EC segment suggests that the RNAP does
Molecular Cell 70, 695–706, May 17, 2018 701
Figure 5. Conformational Change of the RNAP during Transition from IC to EC
(A) In configuration 3, the IC is expected to show a low FRET between Cy3 at aa 174 in T7 RNAP and Cy5 in the promoter at +17, and the elongation complex (EC),
a high FRET based on the crystal structure (Tahirov et al., 2002; Yin and Steitz, 2002).
(B) FRET efficiency histogram of the complex stalled at +1, +9, and +12 transcriptional positions shows an increase in FRET efficiency from initiation to elongation.
(C) Representative time trace of the transcription reaction in the presence of all NTPs showing the intensity and FRET changes accompanying the conformational
changes of RNAP during the transition from IC to EC divided into three sections—IC, transition, and EC.
(D–F) Dwell-time analysis of initiation (D), transition (E), and elongation (F) sections are shown in (C). Fits to gamma distribution functions (two gamma functions for
E) are shown in red.
See also Figures S4 and S5.
not dissociate from the promoter DNA immediately after
completing the RNA synthesis.
Failed versus Productive InitiationWith the tools in place to probe the various steps of transcription,
we set out to investigate whether we could observe a full tran-
scription cycle, in particular, visualize both abortive initiation
and transition into elongation in a single experiment. To take
advantage of both labeling configurations 2 and 3, we designed
a 3-probe experiment with Cy3-labeled RNAP and dual-labeled
DNA (configuration 4, Figure 6A). This 3-probe system can report
on DNA scrunching/bending during abortive initiation and
the conformational change of RNAP during the transition to
elongation.
Figure 6B shows the anticipated time traces from the 3-probe
system, as simulated by averaging the time traces of configura-
tions 2 and 3. The simulated time traces in blue are from config-
uration 2 and in sky blue from configuration 3. The FRET values
at each transcriptional stall position are based on the FRET histo-
grams (Figures 3A, S4B, and S5E). We calculated the simulated
702 Molecular Cell 70, 695–706, May 17, 2018
time traces of the 3-probe experiments (configuration 4) by
averaging the expected FRET efficiencies from experiments in
configurations 2 and 3. We expect, as shown in the black line
in the upper panel of Figure 6B, that the apparent FRET effi-
ciency, E, will decrease when the Cy3-labeled RNAP binds to
the dual-labeled DNA (blue star). This decrease is from the pres-
ence of an additional donor on the RNAP that does not contribute
significantly to FRET in the IC. As initial transcription proceeds,
E will increase progressively due to DNA bending and scrunch-
ing. Finally, a large increase in E will occur when RNAP transi-
tions to EC and undergoes a conformational change that brings
Cy3 on the RNAP close to Cy5 at position +17 of the DNA. When
the RNAP dissociates after producing the full transcript, E will
drop to the initial value of the DNA-only species.
Figure 6B lower panel shows the anticipated time traces from
the 3-probe system, where transcription initiation contains abor-
tive synthesis. We expect that the apparent FRET efficiency,
E, will decrease when the Cy3-labeled RNAP binds to the dual-
labeled DNA (blue star). As initial transcription proceeds, E will
increase progressively due to DNA bending and scrunching
Figure 6. Real-Time Observation of the
Entire Transcription Reaction Including the
Direct Observation of Abortive Cycling
(A) The labeling scheme of configuration 2: Cy3
and Cy5 on DNA with wild-type RNAP, configu-
ration 3: Cy5-labeled DNA andCy3-labeled RNAP,
and configuration 4: Cy3 and Cy5 on DNA and
Cy3-labeled RNAP.
(B) Expected time traces of apparent FRET effi-
ciency (black) from the three-probe experiment
were simulated by averaging the time traces of
configuration 2 (blue) and configuration 3 (sky
blue). The top panel shows a simulation for a
productive transcription reaction without abortive
synthesis, and the bottom panel shows a simula-
tion for a productive transcription reaction with
repetitive abortive synthesis. The blue and red
asterisks mark the moments of RNAP binding and
abortion, respectively.
(C–E) Representative time traces of the three-
probe experiments in the presence of all NTPs
showing (C) productive initiation without any
abortion, (D) failed initiation without transition to
EC, and (E) productive initiation with multiple
rounds of abortive initiation. The top panel shows
the total intensity (blue), the middle-panel shows
the intensity of Cy3 (green) and Cy5 (red), and the
bottom-panel shows the FRET efficiency. RNAP
binding is marked with a blue star and abortion
with a red star.
(F) The percentage (mean ± SEM) of failed and
productive initiations for two different promoters,
class III consensus promoter (promoter 1) and
class II T7 promoter ø1.3 (promoter 2). *p < 0.05
(two-tailed unpaired t test).
(G and H) The number of the abortive events per
RNAP (mean ± SEM) in failed (G) and productive
(H) initiation events.
but show repeated drops to lower E (red star) due to abortive
synthesis as observed above in Figure 4A. The above events
could be followed by a large increase in E when the RNAP tran-
sitions to EC as observed in Figure 5C. Finally, the efficiency E
will drop to the initial value of the DNA-only species when the
RNAP dissociates after producing the full transcript.
Representative single-molecule time traces show three typical
examples of transcription events observed with the 3-probe sys-
tem. Some RNAP molecules made the transition to EC without
any abortive event (Figure 6C). Some experienced one or more
rounds of abortive cycling, marked by red stars, without ever
making a transition to EC (Figure 6D), whereas other RNAPs
eventually transited to the elongation phase after one or more
rounds of abortive cycling (Figure 6E). The representative sin-
gle-molecule time shown in Figure 6C is composed of RNAP
binding, initiation, the transition to EC, and RNAP release steps.
Additionally, RNAP binding and dissociation events were clearly
detected via the sudden increase and decrease of the total inten-
sity, respectively (Figures 6C–6E, blue lines).
We classified the transcription events into two categories
based on the outcome: failed initiation if the molecule experi-
ences the transcriptional initiation and fails to transit to the elon-
gation phase (Figure 6D), and productive initiation if the IC to EC
transition occurred (Figures 6C and 6E). The population of failed
initiation described here might be similar to the unproductive
initiation reported from ensemble studies of the bacterial RNAP
(Vo et al., 2003). On the stronger class III consensus promoter
(promoter 1) with which we performed all experiments using
configurations 1, 2, and 3, 72.4% of the RNAPs (of 650 total mol-
ecules) that initiated transcription showed productive initiation,
and 27.6% failed initiation (Figure 6F). Note that we assumed
that all molecules showing the conformational change of the
N-terminal subdomain H would generate run-off products. To
determine whether the branching ratio between the two out-
comes is dependent on the promoter strength, we carried out
experiments with a weaker T7 promoter. The weaker class II
T7 promoter ø1.3 (promoter 2) had the RNAP binding frequency
that is half as high as the binding frequency of promoter 1 (0.08 ±
0.01 versus 0.18 ± 0.02min–1). Promoter 2 also showed less pro-
ductive initiation (52.2% ± 8.1% among �250 molecules in Fig-
ure 6), consistent with ensemble data (Bandwar et al., 2006;
Ikeda, 1992; Lopez et al., 1997).
We counted the number of abortive events in the productive
initiation and failed initiation events in the consensus promoter.
Molecular Cell 70, 695–706, May 17, 2018 703
Figure 7. Probabilistic Model Predicts the Outcomes of Transcription Initiation
(A) Probabilistic model is showing that each incidence of open state formation can result in a transition to elongation (E), RNAP dissociation (D), and abortive
product release (A). After an abortive product release (A), the RNAP-DNA complex returns to the open state (O), and the three different paths from (A) start again,
and so on. RNAP that does not experience any initiation is shown as D* to distinguish from the dissociation events of RNAP at the initiation stage.
(B) Abortive to run-off ratio was calculated from the experiment shown in the ensemble gel assay by Tang et al. (2005) on the Phi10 promoter. The error bars
represent SD from 3measurements. The abortive to run-off ratio is 1.33 when all abortive products (2–13-mer) are included is reduced to 0.92 ± 0.06 when 2-mer
products are excluded and is further reduced to 0.75 ± 0.04 when 12–13-mer products are also excluded. The dashed red line denotes the abortive to run-off ratio
predicted by single-molecule experiments.
Interestingly, in the productive initiation, 76.8% ± 1.0% of RNAP
did not undergo any detectable abortion, 17.6% ± 1.3% one
abortive event, and �5% underwent 2 or 3 abortive events. In
failed initiation, 76.5% ± 2.1% of RNAP underwent one abortion,
16.4% ± 1.5% two abortive events, and �7% 3–4 abortive
events (Figures 6G and 6H).
We developed a probabilistic model to explain the various
outcomes of transcription initiation (Figure 7A; see also Supple-
mental Information). Briefly, each incidence of open state
formation can result in the transition to elongation (E), RNAP
dissociation (D), or abortive product release (A). The outcome
A brings about another branching point into E, D, or A and so
on. Here, we assume that there is no memory effect such that
each branch of outcome occurs with history-independent prob-
ability (PE, PD, and PA). Using the experimental data shown in
Figures 6F–6H, for promoter 1, we obtained PA = 0.22, PD =
0.5, and PE as 0.28 (Supplemental Information). We cannot
distinguish between photobleaching of Cy3 and RNAP disso-
ciation; therefore, PD should include a contribution from photo-
bleaching. However, photobleaching does not change the
partitioning ratio between E and A, and the agreement with
gel-based quantification of abortive and run-off products ratio
(see below) suggests that photobleaching has only moderate
effects on the estimated probability values.
We verified these probabilities by comparing the calculated ra-
tio of abortive products to run-off products from ourmodel to the
values obtained from ensemble transcription reactions analyzed
by the gel assay that resolves 2-mer to 19-mer run-off (Supple-
mental Information; Figure 7B). We found a good agreement
between the abortive to run-off ratios from the single-molecule
measurements (0.79) and from the ensemble measurements
(0.75–0.9), after correcting for the fact that single-molecule mea-
surements do not detect 2-mer abortives.
This model and the estimated probability of each branch
enable us to highlight unanticipated and exciting conse-
quences. (1) A significant fraction of the total initiation events
(56% on promoter 1 and 41% on promoter 2) can make it to
704 Molecular Cell 70, 695–706, May 17, 2018
elongation without detectable abortive events. (2) The failed
initiations produce twice the number of abortive events as the
ones from productive initiation, even though the failed popula-
tion is only one-third as large as the productive population. The
counterintuitive finding that the majority of the successful
transcription produce no abortive products, however, can be
explained with probabilistic modeling without invoking RNAP
heterogeneity in branching ratio between productive and failed
initiation.
The methods and findings from this study should be widely
applicable to other single-subunit and multi-subunit RNAPs.
For multi-subunit and single-subunit mitochondrial RNAPs,
the transition to EC can be monitored by the translocation of
its cofactor, instead of the subdomain movement observed
here. Therefore, the approaches we developed here would be
applicable for RNAPs by monitoring the transcription initiation
from DNA conformational change and the transition to EC
from the distance changes between the cofactor and the
DNA promoter.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
d METHOD DETAILS
B TIRFM and single-molecule FRET imaging
B Single-molecule fluorescence lifetime measurement
B DNA sequences, labeling, and annealing
B Expression, purificationm and labeling of Cys-light
RNAP with V174C mutation
d QUANTIFICATION AND STATISTICAL ANALYSIS
B Single-molecule data analysis
B Gamma factor correction
B Model of abortive initiation
SUPPLEMENTAL INFORMATION
Supplemental Information includes five figures and can be found with this
article online at https://doi.org/10.1016/j.molcel.2018.04.018.
ACKNOWLEDGMENTS
This work was supported by NIH grants (GM118086, GM122569) and by the
Korea Research Foundation (KRF-2006-612-C0020).
AUTHOR CONTRIBUTIONS
Conceptualization, H.R.K., S.S.P., and T.H.; Investigation, H.R.K., R.R., M.S.,
G.-Q.T., and D.N.; Resources, S.S.P. and T.H.; Writing – Original Draft, H.R.K.;
Writing – Review & Editing, H.R.K., S.S.P., and T.H.; Supervision, S.S.P. and
T.H.; Funding Acquisition, H.R.K., S.S.P., and T.H.
DECLARATION OF INTERESTS
The authors declare no competing interests.
Received: December 5, 2017
Revised: February 23, 2018
Accepted: April 19, 2018
Published: May 17, 2018
REFERENCES
Abbondanzieri, E.A., Greenleaf, W.J., Shaevitz, J.W., Landick, R., and Block,
S.M. (2005). Direct observation of base-pair stepping by RNA polymerase.
Nature 438, 460–465.
Anand, V.S., and Patel, S.S. (2006). Transient state kinetics of transcription
elongation by T7 RNA polymerase. J. Biol. Chem. 281, 35677–35685.
Bandwar, R.P., and Patel, S.S. (2001). Peculiar 2-aminopurine fluorescence
monitors the dynamics of open complex formation by bacteriophage T7
RNA polymerase. J. Biol. Chem. 276, 14075–14082.
Bandwar, R.P., Tang, G.Q., and Patel, S.S. (2006). Sequential release of pro-
moter contacts during transcription initiation to elongation transition. J. Mol.
Biol. 360, 466–483.
Bandwar, R.P., Ma, N., Emanuel, S.A., Anikin, M., Vassylyev, D.G., Patel,
S.S., and McAllister, W.T. (2007). The transition to an elongation complex
by T7 RNA polymerase is a multistep process. J. Biol. Chem. 282,
22879–22886.
Brieba, L.G., and Sousa, R. (2001). T7 promoter release mediated by DNA
scrunching. EMBO J. 20, 6826–6835.
Bustamante, C. (2008). In singulo biochemistry: When less is more. Annu. Rev.
Biochem. 77, 45–50.
Carpousis, A.J., andGralla, J.D. (1980). Cycling of ribonucleic acid polymerase
to produce oligonucleotides during initiation in vitro at the lac UV5 promoter.
Biochemistry 19, 3245–3253.
Cheetham, G.M., and Steitz, T.A. (1999). Structure of a transcribing T7 RNA
polymerase initiation complex. Science 286, 2305–2309.
Duchi, D., Gryte, K., Robb, N.C., Morichaud, Z., Sheppard, C., Brodolin, K.,
Wigneshweraraj, S., and Kapanidis, A.N. (2018). Conformational heterogeneity
and bubble dynamics in single bacterial transcription initiation complexes.
Nucleic Acids Res. 46, 677–688.
Durniak, K.J., Bailey, S., and Steitz, T.A. (2008). The structure of a transcribing
T7 RNA polymerase in transition from initiation to elongation. Science 322,
553–557.
Esposito, E.A., and Martin, C.T. (2004). Cross-linking of promoter DNA to T7
RNA polymerase does not prevent formation of a stable elongation complex.
J. Biol. Chem. 279, 44270–44276.
Friedman, L.J., and Gelles, J. (2012). Mechanism of transcription initiation at
an activator-dependent promoter defined by single-molecule observation.
Cell 148, 679–689.
Gong, P., Esposito, E.A., andMartin, C.T. (2004). Initial bubble collapse plays a
key role in the transition to elongation in T7 RNA polymerase. J. Biol. Chem.
279, 44277–44285.
Ha, T. (2001). Single-molecule fluorescence resonance energy transfer.
Methods 25, 78–86.
Ha, T., Enderle, T., Ogletree, D.F., Chemla, D.S., Selvin, P.R., and Weiss, S.
(1996). Probing the interaction between two single molecules: Fluorescence
resonance energy transfer between a single donor and a single acceptor.
Proc. Natl. Acad. Sci. USA 93, 6264–6268.
Herbert, K.M., La Porta, A., Wong, B.J., Mooney, R.A., Neuman, K.C., Landick,
R., and Block, S.M. (2006). Sequence-resolved detection of pausing by single
RNA polymerase molecules. Cell 125, 1083–1094.
Herbert, K.M., Greenleaf, W.J., and Block, S.M. (2008). Single-molecule
studies of RNA polymerase: Motoring along. Annu. Rev. Biochem. 77,
149–176.
Hwang, H., and Myong, S. (2014). Protein induced fluorescence enhancement
(PIFE) for probing protein-nucleic acid interactions. Chem. Soc. Rev. 43,
1221–1229.
Ikeda, R.A. (1992). The efficiency of promoter clearance distinguishes T7 class
II and class III promoters. J. Biol. Chem. 267, 11322–11328.
Ikeda, R.A., and Richardson, C.C. (1986). Interactions of the RNA polymerase
of bacteriophage T7with its promoter during binding and initiation of transcrip-
tion. Proc. Natl. Acad. Sci. USA 83, 3614–3618.
Jia, Y., and Patel, S.S. (1997a). Kinetic mechanism of transcription initiation by
bacteriophage T7 RNA polymerase. Biochemistry 36, 4223–4232.
Jia, Y., and Patel, S.S. (1997b). Kinetic mechanism of GTP binding and RNA
synthesis during transcription initiation by bacteriophage T7 RNA polymerase.
J. Biol. Chem. 272, 30147–30153.
Kapanidis, A.N., Margeat, E., Ho, S.O., Kortkhonjia, E., Weiss, S., and Ebright,
R.H. (2006). Initial transcription by RNA polymerase proceeds through a DNA-
scrunching mechanism. Science 314, 1144–1147.
Kim, J.H., and Larson, R.G. (2007). Single-molecule analysis of 1D diffusion
and transcription elongation of T7 RNA polymerase along individual stretched
DNA molecules. Nucleic Acids Res. 35, 3848–3858.
Larson, M.H., Greenleaf, W.J., Landick, R., and Block, S.M. (2008). Applied
force reveals mechanistic and energetic details of transcription termination.
Cell 132, 971–982.
Liu, C., and Martin, C.T. (2002). Promoter clearance by T7 RNA polymerase.
Initial bubble collapse and transcript dissociation monitored by base analog
fluorescence. J. Biol. Chem. 277, 2725–2731.
Lopez, P.J., Guillerez, J., Sousa, R., and Dreyfus, M. (1997). The low proces-
sivity of T7 RNA polymerase over the initially transcribed sequence can limit
productive initiation in vivo. J. Mol. Biol. 269, 41–51.
Luo, G., Wang, M., Konigsberg, W.H., and Xie, X.S. (2007). Single-molecule
and ensemble fluorescence assays for a functionally important conformational
change in T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 104, 12610–12615.
Ma, K., Temiakov, D., Anikin, M., and McAllister, W.T. (2005). Probing confor-
mational changes in T7 RNA polymerase during initiation and termination by
using engineered disulfide linkages. Proc. Natl. Acad. Sci. USA 102,
17612–17617.
Margeat, E., Kapanidis, A.N., Tinnefeld, P., Wang, Y., Mukhopadhyay, J.,
Ebright, R.H., and Weiss, S. (2006). Direct observation of abortive initiation
and promoter escape within single immobilized transcription complexes.
Biophys. J. 90, 1419–1431.
Martin, C.T., Muller, D.K., and Coleman, J.E. (1988). Processivity in early
stages of transcription by T7 RNA polymerase. Biochemistry 27, 3966–3974.
McAllister, W.T. (1993). Structure and function of the bacteriophage T7 RNA
polymerase (or, the virtues of simplicity). Cell. Mol. Biol. Res. 39, 385–391.
Mukherjee, S., Brieba, L.G., and Sousa, R. (2002). Structural transitions medi-
ating transcription initiation by T7 RNA polymerase. Cell 110, 81–91.
Munson, L.M., and Reznikoff, W.S. (1981). Abortive initiation and long ribonu-
cleic acid synthesis. Biochemistry 20, 2081–2085.
Molecular Cell 70, 695–706, May 17, 2018 705
Myong, S., Cui, S., Cornish, P.V., Kirchhofer, A., Gack, M.U., Jung, J.U.,
Hopfner, K.P., and Ha, T. (2009). Cytosolic viral sensor RIG-I is a 50-triphos-phate-dependent translocase on double-stranded RNA. Science 323,
1070–1074.
Revyakin, A., Liu, C., Ebright, R.H., and Strick, T.R. (2006). Abortive initiation
and productive initiation by RNA polymerase involve DNA scrunching.
Science 314, 1139–1143.
Richardson, C.C. (1983). Bacteriophage T7:Minimal requirements for the repli-
cation of a duplex DNA molecule. Cell 33, 315–317.
Rosa, M.D. (1979). Four T7 RNA polymerase promoters contain an identical
23 bp sequence. Cell 16, 815–825.
Roy, R., Hohng, S., and Ha, T. (2008). A practical guide to single-molecule
FRET. Nat. Methods 5, 507–516.
Skinner, G.M., Baumann, C.G., Quinn, D.M., Molloy, J.E., and Hoggett, J.G.
(2004). Promoter binding, initiation, and elongation by bacteriophage T7
RNA polymerase. A single-molecule view of the transcription cycle. J. Biol.
Chem. 279, 3239–3244.
Sorokina, M., Koh, H.R., Patel, S.S., and Ha, T. (2009). Fluorescent lifetime tra-
jectories of a single fluorophore reveal reaction intermediates during transcrip-
tion initiation. J. Am. Chem. Soc. 131, 9630–9631.
Sousa, R. (1996). Structural and mechanistic relationships between nucleic
acid polymerases. Trends Biochem. Sci. 21, 186–190.
Sousa, R., Chung, Y.J., Rose, J.P., andWang, B.C. (1993). Crystal structure of
bacteriophage T7 RNA polymerase at 3.3 A resolution. Nature 364, 593–599.
Stano, N.M., Levin, M.K., and Patel, S.S. (2002). The +2 NTP binding drives
open complex formation in T7 RNA polymerase. J. Biol. Chem. 277,
37292–37300.
Tahirov, T.H., Temiakov, D., Anikin, M., Patlan, V., McAllister, W.T., Vassylyev,
D.G., and Yokoyama, S. (2002). Structure of a T7 RNA polymerase elongation
complex at 2.9 A resolution. Nature 420, 43–50.
706 Molecular Cell 70, 695–706, May 17, 2018
Tamarat, P., Maali, A., Lounis, B., and Orrit, M. (2000). Ten years of single-
molecule spectroscopy. J. Phys. Chem. A 104, 1–16.
Tang, G.Q., and Patel, S.S. (2006a). Rapid binding of T7 RNA polymerase is
followed by simultaneous bending and opening of the promoter DNA.
Biochemistry 45, 4947–4956.
Tang, G.Q., and Patel, S.S. (2006b). T7 RNA polymerase-induced bending of
promoter DNA is coupled to DNA opening. Biochemistry 45, 4936–4946.
Tang, G.Q., Bandwar, R.P., and Patel, S.S. (2005). Extended upstream A-T
sequence increases T7 promoter strength. J. Biol. Chem. 280, 40707–40713.
Tang, G.Q., Roy, R., Ha, T., and Patel, S.S. (2008). Transcription initiation in a
single-subunit RNA polymerase proceeds through DNA scrunching and rota-
tion of the N-terminal subdomains. Mol. Cell 30, 567–577.
Tang, G.Q., Roy, R., Bandwar, R.P., Ha, T., and Patel, S.S. (2009). Real-time
observation of the transition from transcription initiation to elongation of the
RNA polymerase. Proc. Natl. Acad. Sci. USA 106, 22175–22180.
Ujvari, A., and Martin, C.T. (2000). Evidence for DNA bending at the T7 RNA
polymerase promoter. J. Mol. Biol. 295, 1173–1184.
Villemain, J., Guajardo, R., and Sousa, R. (1997). Role of open complex insta-
bility in kinetic promoter selection by bacteriophage T7 RNA polymerase.
J. Mol. Biol. 273, 958–977.
Vo, N.V., Hsu, L.M., Kane, C.M., andChamberlin, M.J. (2003). In vitro studies of
transcript initiation by Escherichia coli RNA polymerase. 2. Formation and
characterization of two distinct classes of initial transcribing complexes.
Biochemistry 42, 3787–3797.
Yin, Y.W., and Steitz, T.A. (2002). Structural basis for the transition from
initiation to elongation transcription in T7 RNA polymerase. Science 298,
1387–1395.
Zhang, Z., Revyakin, A., Grimm, J.B., Lavis, L.D., and Tjian, R. (2014). Single-
molecule tracking of the transcription cycle by sub-second RNA detection.
eLife 3, e01775.
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER
Bacterial and Virus Strains
BL21/pAR1219 Studier FW N/A
BL21/pAR1219 cyslight V174 This paper N/A
Biological Samples
T7 RNA polymerase This paper N/A
V174C Cyslight T7 RNA polymerase This paper N/A
Chemicals, Peptides, and Recombinant Proteins
SP Sephadex Sigma SPC25120
CM-sephadex Sigma SP
DEAE-sephacel GE healthcare GE17-0500-01
g[32P]GTP Perkin Elmer NEG004Z
40% Acrylamide/Bis solution Biorad 1610148EDU
Cy3-NHS/ Cy5-NHS GE Healthcare, Chicago, IL PA13101/ PA15101
mPEG/ biotin PEG Laysan Bio, Arab, AL MPEG-SC-5000/Biotin-PEG-SC-5000
Neutravidin Pierce, Rockford, IL 31000
Trolox Sigma-Aldrich, St. Louis, MO 238813
Glucose oxidase Sigma-Aldrich, St. Louis, MO G2133
Catalase Roche, Indianapolis, IN 10106810001
NTP Roche, Indianapolis, IN 11277057001
dNTP TriLink, San Diego, CA K1007
Oligonucleotides
NT1, NT2, NT5, T1, T2, T5, biotin18, phi10 tempate,
phi10 nontemplate (Refer to the supplementary for
the sequence information)
Integrated DNA Technologies, Coralville, IA Custom order
Software and Algorithms
Data acquisition and analysis software https://cplc.illinois.edu/software/ Home-built
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources and reagents may be directed to and will be fulfilled by the Lead Contact, Smita S.
Patel (patelss@rwjms.rutgers.edu) and Taekjip Ha (tjha@jhu.edu).
METHOD DETAILS
All single molecule fluorescence measurements using configurations 2, 3 and 4 were performed with a total internal reflection
fluorescence microscope (TIRFM). Details of the surface passivation, optical configurations, and sample chamber assembly were
previously described (Roy et al., 2008). Imaging was performed upon excitation with 532 nm laser at 22 ± 1�C in 15 mM Tris Acetate
(pH 7.5), 10 mM Magnesium Acetate, 50 mM Sodium Acetate, 5 mM DTT, 0.1 mg/ml BSA and an oxygen scavenging system
(2 mM Trolox (Sigma-Aldrich, St. Louis, MO), 1% (w/v) dextrose, 165 U/ml glucose oxidase (Sigma-Aldrich, St. Louis, MO) and
2170 U/ml catalase (Roche, Indianapolis, IN)). Video recordings were processed to extract single molecule fluorescence intensities
at each frame, and custom written scripts were used to calculate FRET efficiencies. Data acquisition and analysis software can be
downloaded from https://cplc.illinois.edu/software/. Configuration 1 also used TIRFM except for correlative measurements of Cy3
intensity and lifetime, which used a confocal fluorescence scanning microscope equipped with single photon time-correlated single
photon counting as described previously(Sorokina et al., 2009).
Molecular Cell 70, 695–706.e1–e5, May 17, 2018 e1
TIRFM and single-molecule FRET imagingWe used a continuous Nd:YAG laser (532 nm, 75mW, CrystaLaser) to excite Cy3 on the DNA or the RNAP by generating evanescent
field via total internal light reflection. Fluorescence from Cy3 and Cy5 are collected by a water-immersion objective lens (60X, N.A. =
1.2, Olympus) after passing through a 550 nm long-pass filter (E550LP, Chroma), which filters out the excitation laser beam. The
filtered fluorescence light from Cy3 and Cy5 is divided by the 630 nm dichroic mirror (645DCXR, Chroma), and the one from Cy3
is reflected, and the one from Cy5 is transmitted. The divided fluorescence is focused into and detected by an EMCCD camera
(DU-589, Andor) with a time resolution of 16-100 ms and amplified before camera readout. Video recordings were processed to
extract single molecule fluorescence intensities at each frame, and custom written scripts were used to calculate FRET efficiencies.
Data acquisition and analysis software can be downloaded from https://cplc.illinois.edu/software/. Any TIRFM instrument including
commercial instruments that can measure single molecule fluorescence in two colors simultaneously would be suitable for FRET ex-
periments we performed.
PEG-coated quartz surface was prepared to block non-specific binding of DNA and T7 RNAP. Neutravidin (Pierce, Rockford, IL)
was injected onto the PEG surface and incubated for 2 min for non-covalent bonding to the biotinylated PEG, which was 2% of the
total PEG. Subsequently, biotinylated DNA was added and incubated for 5 min for surface immobilization. For single-molecule ex-
periments, appropriate concentration of T7 RNAP and NTPs were added to the immobilized DNA in 15 mM Tris Acetate (pH 7.5),
10 mM Magnesium Acetate, 50 mM Sodium Acetate, 5 mM DTT, 0.1 mg/ml BSA and an oxygen scavenging system (2 mM Trolox
(Sigma-Aldrich, St. Louis, MO), 1% (w/v) dextrose, 165 U/ml glucose oxidase (Sigma-Aldrich, St. Louis, MO) and 2170 U/ml catalase
(Roche, Indianapolis, IN)). All the experiments were performed at room temperature (22 ± 1�C).
Single-molecule fluorescence lifetime measurementThe fluorescent lifetime decays were measured for immobilized molecules using a home-built confocal microscope. The excitation
light is divided by a beam splitter, and one is sent to a photodiode for timing detection, and the other is reflected by a dichroic mirror
and focused on the sample by an oil-immersion objective (100X, NA 1.4). The emitted light is collected by the same objective lens,
focused on a pinhole and then imaged on a Silicon avalanche photodiode (APD) (Micro Photon Devices, PD5CTC). The signals from
the APD and the photodiode are correlated in a Time Correlated Single Photon Counter (TCSPC) device (SPC 630, Becker & Hickl
GmbH) for lifetime measurement.
All molecules were excited one-by-one by a pulsed laser (Spectra-Physics, Vanguard 2000-HM, 532 nm, Pulse width 12 ps, repe-
tition rate 76-80MHz) and located using sample-scanning piezo-controlled stage (Nano-Bio2 (2-axis) nanopositioner andNano-Drive
(2-axis) control system, Mad City Labs Inc.). A 20x20 mm2 area of the sample was translated to 256x256-pixel matrix and scanned
pixel-by-pixel to determine the intensity at each pixel site. The resulting intensity map was used to determine the coordinates of
immobilized single molecules by a Gaussian fit. The DNA concentration was adjusted to provide 40-80 single molecules absorbed
to the 20x20 mm2 area.
The signals from the APD and photodiode were collected by the TCSPC device installed inside a personal computer (Windows XP),
which measured the delay time between the fluorescent photon and the laser time signal, and the global time of fluorescence photon
detection. To construct the intensity trace, we counted the number of photons collected by the APD during 10 ms time interval and
plotted them versus the global time. To extract the lifetime, we divided photons into groups of 500 contiguous photons. For each
group, we built a delay time distribution histogram, which was fitted by an exponential decay curve using Maximum Likelihood Esti-
mator algorithm. The resulting lifetime values were plotted versus global time, constituting the molecule’s lifetime trace.
DNA sequences, labeling, and annealingAll the DNAs used in this study were purchased purified from Integrated DNA Technologies (Coralville, IA). The 65-nt non-template
DNA strands (NT1, NT2, and NT5), their complementary 47-nt template DNA (T1, T2 and T5) and biotinylated 18-nt ssDNA (biotin18)
were incubated at 95�C for 5 min in the annealing buffer (10 mM Tris-HCl, pH 8, 50 mMNaCl) and cooled to room temperature slowly
to generate dsDNA.
NT1:50TGGCGACGGCAGCGAGGCTAAATTAATACGACTCACTATAGGGAGACCACAACGTTATCAGCTTC 30
NT2:50TGGCGACGGCAGCGAGGCTAAATTAATACGACTCACTATAGGGAGAGGCCATCGTTATCAGCTTC 30
NT5:50TGGCGACGGCAGCGAGGCGGAAGTAATACGACTCAGTATAGGGACAATCCATCGTTATCAGCTTC 30
T1:30ATTTAATTATGCTGAGTGATATCCCTCTGGTGTTGCAATAGTCGAAG 50
T2:30ATTTAATTATGCTGAGTGATATCCCTCTCCGGTAGCAATAGTCGAAG 50
T5:30CCTTCATTATGCTGAGTCATATCCCTGTTAGGTAGCAATAGTCGAAG 50
Biotin18: 30 biotin-ACCGCTGCCGTCGCTCCG 50
Underlined T in the non-template DNA and template DNA are an internal C6 amino-modified dT attached with Cy3 and Cy5
N-hydroxylsuccinimide (NHS) ester, respectively, and underlined italic G of the non-template DNA and C of template DNA is the tran-
scription start site.
NT1-T1 and NT2-T2 were used to obtain the FRET histograms at various transcription stall positions. With NT1-T1, we could stall
the RNAP complex at +1, +3, +4, +6, +7, +13, +14, and with NT2-T2, at +1, +3, +4, +8, +9, +11, +12. NT5-T5 had a different promoter
e2 Molecular Cell 70, 695–706.e1–e5, May 17, 2018
sequence from the NT1-T1 and NT2-T2 and was used to investigate the effect of promoter sequence on abortive cycling. To stall the
RNAP transcription at a predefined position, a limiting set of NTPs (Roche, Indianapolis, IN) and 30-dNTPs (TriLink, San Diego, CA)
were utilized.
Expression, purificationm and labeling of Cys-light RNAP with V174C mutationWild-type T7 RNAP and Cys-light T7 RNAP with the V174C mutation were purified as described (Mukherjee et al., 2002). The V174C
mutant has similar activity as theWT RNAP (Figure S4A). To monitor the conformational change during the transition from initiation to
elongation, V174C labeled with Cy3 was investigated, because the labeled 174 position shows a dramatic conformational change
during the transition.
The only exposed cysteine 174 of the Cys-light T7 RNAP mutant V174C was labeled with the Cy3 fluorophore as follows: The pro-
tein was extensively dialyzed overnight at 4�C against 50 mM phosphate buffer pH 7.5, 200 mM NaCl and 50% Glycerol to remove
DTT. A 1 mM (final) tris(2-carboxyethyl)phosphine (TCEP) solution was added to protect the reduced cysteine from oxidation. The
labeling reaction was performed by adding Cy3 maleimide (GE lifesciences) that was freshly dissolved in DMSO to the protein in
a protein:dye mixing ratio of 1:1.5. The reaction was continued for 1 h at room temperature or �2 h on ice with occasional shaking.
The glycerol concentration was reduced to less than 5% before applying the mixture to a size-exclusion column to separate the free
unbound dye. For a small-scale preparation, we found that repetitive separation (usually three times) through the mini-spin column
filled with 1 mL buffered Biogel P30 (Bio-Rad) provided satisfactory separation and high recovery yield. Measurements of the protein
absorbance at 280 nm and the labeled dye at 550 nm (Cy3) confirmed that the labeling ratio was 1 to 1. Extensive dialysis against
buffer overnight appeared not to improve quality. The concentration of the labeled protein was calculated as [RNAP] (mM) =
(O.D.280CF280 3 O.D.550)/(εRNAP 3 l), where CF280 is the ratio of dye absorbance at 280 nm relative to the peak absorbance at
550 nm for Cy3 ( = 0.08). The label concentrationwas calculated asO.D.550 /εcy33 l), where l is the length of the cuvette (1 cm), εRNAP =
0.14 mM-1cm-1, and εcy3 = 0.15 mM-1cm-1. As a control, the cysteine-light RNAP without the V174C did not show dye labeling
(less than 10%).
QUANTIFICATION AND STATISTICAL ANALYSIS
Single-molecule data analysisFRET efficiency E = IA / (g ID + IA), where ID is the fluorescence from Cy3 and IA from Cy5 after appropriate removal of crosstalk and
background. Gamma factor, g, was assumed to be 1 for most FRET experiments where the quantum yield of Cy3 and Cy5 were
barely changed except the experiment in Figure 2, where the change of quantum yield of Cy3 was large enough to affect the
FRET efficiency. The FRET efficiency of DNA-only, closed, and open complex, displayed in Figure 2, were obtained by correction
with appropriate gamma factors which we calculated from the absolute gamma factor of DNA-only and the relative gamma factors
among DNA-only, closed and open complex (Figure S2A). The Dwell-time analysis was performed on the distinct intensity or FRET
states to get an average kinetic rate constant. The collected dwell-time was fit to the gamma distribution, t n-1exp(-kt), where we could
calculate the average kinetic rate constant as k/n.
Michaelis-Menten equation was used to fit the kinetic rates dependence on the concentration of RNAP and NTP. It is expressed as
v = Vmax [S] / (KM + [S]) + V0 where v is a kinetic rate of making products, Vmax, a maximum rate constant, V0, a residual rate with no
substrate, [S] is the substrate concentration, and KM, Michaelis-Menten constant.
Gamma factor correctionFRET efficiency E was calculated using E = IA / (g ID + IA), where ID is the fluorescence intensity of the donor, Cy3, and IA of the
acceptor, Cy5, after appropriate correction of background and crosstalk between the two detection channels. The gamma factor,
g, is defined as fAhA/fDhD, where fD and fA are the quantum yields of Cy3 and Cy5, respectively, and hD and hA are the detection
efficiencies of donor and acceptor channels, respectively. Detection efficiency is invariant for a given experimental setup, so the
quantum yield is the only variable term that affects the gamma factor
We checked the relative quantum yield of Cy3 and Cy5 at various transcription stall positions for the DNA construct labeled with
Cy3 at the �4 position of the non-template strand and with Cy5 at the +17 position of the template strand, respectively. The Cy3
intensities increased sequentially from its values in DNA-only to the closed complex and the open complex (Figure S1B), and did
not change appreciably from the open complex to various stalled positions until the transition to the elongation complex (Figure S5F).
The fluorescence intensity of Cy5, measured after direct excitation with 632 nm laser, did not change between the DNA-only, the
closed/open complexes, and throughout the tested transcription stalled positions (Figure S1C). Therefore, the FRET efficiency
was corrected for the RNAP binding and promoter opening steps by employing the gamma factor which takes into account the
changes in quantum yields.
Figure S1B shows the relative Cy3 intensities of DNA-only, the closed complex, and the open complex in a ratio of 1: 1.6: 2.3, which
corresponds to the relative Cy3 quantum yields of the three species. The detection efficiencies of Cy3 and Cy5 emission channels
and the quantum yield of Cy5were invariant during RNAP binding and DNA opening process. Hence, the relative gamma factor of the
three species were calculated as the inverse of Cy3 quantum yield, which resulted in a ratio of 1: 0.63: 0.43 for DNA-only, the closed
complex, and the open complex, respectively. The absolute gamma factor of DNA-only was obtained as 2.5 from single molecule
Molecular Cell 70, 695–706.e1–e5, May 17, 2018 e3
time traceswhere Cy5was photobleached and usingDIA/DID upon photobleaching as ameasure of the gamma factor. Therefore, the
gamma factor of the closed complex was calculated as 2.5 3 0.63 = 1.56, and that of the open complex as 2.5 3 0.43 = 1.08.
Even though the uncorrected apparent FRET efficiency, Eapp, of DNA-only, closed and open complex appeared the same as 0.3,
the g-corrected FRET efficiency, Ecorr, were 0.15, 0.22 and 0.28, respectively.
Model of abortive initiationWe developed a phenomenological model to describe abortive initiation (Figure 7A).
The open complex O is assumed to have three possible outcomes:
1) RNAP dissociation (D)
2) RNAP recycling after abortive product release (A)
3) Transition to the elongation phase (E)
Only the second outcome A returns the complex to the initial ‘‘open state (O)’’ to continue with another round with three possible
outcomes. We call the probabilities of each outcome PE, PD and PA.
In our experimental detection of failed initiation, dissociation without initiating transcription is not detected. Therefore, the proba-
bility of failed initiation Pfail, determined experimentally to be 0.28 for promoter 1 (Figure 6F), is given by
Pfail = ðPA 3PD +PA 3PA 3PD +PA 3PA 3PA 3PD +.:Þ=ð1--PDÞ=PD 3PA=ð1� PAÞ=ð1� PDÞ (Eq. 1)
where (1-PD) is the correction factor to account for the fact that the experimental determined Pfail does not include the events where
RNAP dissociates without initiating a transcript.
Likewise, the probability of successful initiation Psucc, determined experimentally to be 0.72 for promoter 1 (Figure 6F), is given by
Psucc = ðPE +PA 3PE +PA 3PA 3PE +.Þ=ð1� PDÞ =PE=ð1� PAÞð1� PDÞ (Eq. 2)
In addition,
PD +PA +PE = 1 (Eq. 3)
For molecules that ultimately failed to transit to the elongation phase, the probability Pfail(n) that n abortive products are made before
RNAP dissociation is given by PD3 PAn/(1-PD). Therefore, PA can be approximated by Pfail(n+1)/Pfail(n) for various n values. Likewise,
using Psucc(n) versus n, we can determine PA independently.
PA = Pfail (n+1) / Pfail (n) = 0.22 for both promoters (which is calculated from Figure 6G) (Equation 3)
By putting PA = 0.22, Pfail = 0.28 and Psucc = 0.72 into Equation 1 and 2,
Pfail =PD 3 0:22=ð1� 0:22Þð1� PDÞ= 0:28
Psucc =PE=ð1� 0:22Þð1� PDÞ= 0:72
By solving the two equations above, we get PD = 0.50 and PE = 0.28 for promoter 1. Similarly, we get PD = 0.63 and PE = 0.15 for the
promoter 2.
We can do additional calculations to address some interesting feature of RNAP transcription for the consensus promoter
(promoter 1) as below:
(1) 78% of the total productive initiation events elongate without any abortion:
PE=ðPE +PA 3PE +PA 3PA 3PE +.Þ=PE=ðPE=ð1� PAÞÞ= 1� PA = 0:78
(2) The ratio of total abortive product from failed initiation to total abortive products from productive initiation is 1.8:
ðPA 3PD + 23PA 3PA 3PD + 33PA 3PA 3PA 3PD +.Þ=ð13PA 3PE + 23PA 3PA 3PE + 33PA 3PA 3PA 3PE +.Þ=�PD 3PA
.ð1� PAÞ2
�.�PE 3PA
.ð1� PAÞ2
�
= 1:8
e4 Molecular Cell 70, 695–706.e1–e5, May 17, 2018
(3) 56% of the total initiation events elongate without any abortion:
PE=ð1� PDÞ= 0:56
(4) 0.79 is the ratio of abortive products to run-off products:
fðPA 3PD + 23PA 3PA 3PD + 33PA 3PA 3PA 3PD +.Þ+ ð13PA 3PE + 23PA 3PA 3PE + 33PA 3PA 3PA 3PE +.Þg=�ðPE +PA 3PE +PA 3PA 3PE +.Þ=
n�PD 3PA
.ð1� PAÞ2
�+�PE 3PA
.ð1� PAÞ2
�o.ðPE=ð1� PAÞÞ= 0:79
To validate our model, we calculated the ratio of abortive products to run-off using the data obtained by the ensemble gel assay
and compared it with the value calculated by our model, 0.79. The calculated value from the gel assay is 1.34. The apparent
discrepancy is likely due to the fact that the 2-mer abortive products are not detectable in the single molecule assay and the
12-mer and 13-mer abortive products (produced after the conformational change of RNAP) are regarded as EC in our single-mole-
cule assay (Figure 7B).
Therefore, the apparent ratio of abortive products to run-off products = (NAbortives(3-13-mer)-NAbortives(11-12-mer))/
(Nrun-off +NAbortives(11-12-mer)) = 0.75.
Where various abortive products and run-off products are obtained by quantifying the gel bands. Therefore, after correcting for
misclassified events, we get a good agreement between ratios obtained from single molecule analysis (0.79) and gel assay (0.75).
Molecular Cell 70, 695–706.e1–e5, May 17, 2018 e5
Molecular Cell, Volume 70
Supplemental Information
Correlating Transcription Initiation
and Conformational Changes by a Single-Subunit
RNA Polymerase with Near Base-Pair Resolution
Hye Ran Koh, Rahul Roy, Maria Sorokina, Guo-Qing Tang, Divya Nandakumar, Smita S.Patel, and Taekjip Ha
Supplemental Information
Correlating transcription initiation and conformational
changes by a single subunit RNA polymerase with near base
pair resolution
Hye Ran Koh1,2, Rahul Roy1, Maria Sorokina1, Guo-Qing Tang3, Divya
Nandakumar3, Smita S. Patel3* and Taekjip Ha1,4,5,6*
1 Department of Physics and Center for the Physics of Living Cells, University of
Illinois at Urbana-Champaign, Urbana, IL 61801, USA
2 Department of Chemistry, Chung-Ang University, Seoul 06974, Korea
3 Department of Biochemistry and Molecular Biology, Rutgers University, Robert
Wood Johnson Medical School, Piscataway, New Jersey 08854, USA
4 Howard Hughes Medical Institute, Baltimore, MD 21205, USA
5 Departments of Biophysics and Biophysical Chemistry, Biophysics and Biomedical
Engineering, Johns Hopkins University, MD 21205, USA
6 Lead Contact
* Correspondence: patelss@rwjms.rutgers.edu (S.S.P.), tjha@jhu.edu (T.H.)
2
Supplemental Figures
Figure S1. Related to Figure 2. Transition between the DNA-only state, and the two RNAP
bound states, the closed and open complexes, and relative quantum yields of Cy3 and Cy5
during the transition and transcription initiation.
(A) Population of DNA-only, closed complex and open complex were investigated by analyzing
the average intensity histogram from ~780 molecules at 20 nM RNAP. DNA-only species
appeared as a lowest-intensity peak, closed complex as a mid-intensity peak, and open complex as
highest-intensity peak. The equilibrium constant of closed to open complex was calculated as 0.28
3
by dividing the peak area of open complex by the one of closed complex, which is consistent with
a previous bulk data (B) The fluorescence intensity histogram of Cy3 conjugated to the -4 position
of non-template DNA from selected states of DNA-only, closed and open complex. The average
fluorescence intensity was calculated from the histogram, giving the intensity ratio among DNA-
only, the closed complex and the open complex as 1: 1.6: 2.3 which represents a relative quantum
yield of Cy3 among them. (C) The fluorescence intensity of Cy5 conjugated to the +17 position of
template DNA without RNAP, with RNAP but not NTPs, and with RNAP stalled at various
positions. We observed no significant change of Cy5 intensity throughout.
4
Figure S2. Related to Figure 2. Gamma factor and dwell time analysis of each RNA
lengthening step during transcription initiation
(A) The gamma factor was calculated at various stall position, reporting no significant change of
gamma factor during transcription initiation from +1 to +11. It suggests that the quantum yield of
Cy3 is sustained during transcription initiation. (B) Dwell time distribution of four distinct FRET
states - 0.3, 0.43, 0.5 and 0.65 - resolved in Figure 3B. All dwell time histograms showed peaked
distributions which were fit to a gamma distribution function, tn-1e-kt, from which we calculated
the average rates, k/n, of leaving each FRET state.
5
Figure S3. Related to Figure 4. Decision between two pathways of abortive cycling: RNAP
recycling vs. RNAP exchange
(A) Time traces showing two pathways of abortive cycling in the same DNA molecule where the
RNAP recycling pathway is displayed with a blue circle and the RNAP exchange pathway with a
red one. The FRET state when RNA is released without RNAP release is displayed as the pink bar.
A RNAP complex can choose one of two pathways after RNA release. (B) The frequency of RNAP
recycling and RNAP exchange pathway was counted at 10 nM RNAP and 500 μM ATP with
various GTP concentration in the range from 10 μM to 500 μM. 23 % of the RNAP were
undergoing recycling at 10 μM GTP, which increased to 93 % at 500 μM GTP. This suggests that
the RNAP recycling pathway becomes dominant at high GTP concentration. We rationalize that
at high GTP concentration, the GTP binding rate becomes faster than the RNAP release rate; hence
the RNAP recycling pathway dominates over the RNAP exchange pathway. The frequency of
RNAP recycling and RNAP exchange is equal at 26 μM of GTP.
6
Figure S4. Related to Figure 5. Gel analysis of the transcription activity of the Cy3-labeled
V174C mutant of Cys-light T7 RNAP and its conformational change during the transition to
EC
(A) To test the transcription competency of the Cy3-labeled V174C mutant, 2 µM T7 RNAP (wild-
type or the labeled V174C) was mixed with 1 µM T7 φ10 promoter (from -22 to +18) following
by the addition of the NTP mixture (1 mM GTP, 100 µM GTP, CTP and UTP each) spiked with
-32P-ATP. The reaction buffer is 50 mM Tris-Cl, pH 7.6, 40 mM NaCl, 10 mM MgCl2, 10%
glycerol, and 1mM DTT. The reaction was quenched after time periods of 0, 10, 30 and 60 s by
adding 200 mM EDTA. RNA products were resolved on a 23% polyacrylamide/7M urea
7
sequencing gel, The gel was exposed to a phosphor screen and scanned on Typhoon 9410
instrument (Molecular Dynamics). The Cy3-labeled V174C mutant was competent in transcription
and essentially had the same profile of transcription from initiation to elongation as that of the
unlabeled WT polymerase. (B) FRET efficiency between Cy3 conjugated to the residue 174 in the
subdomain H of T7 RNAP and Cy5 conjugated to +17 position of the template DNA strand
(configuration 3) at various transcriptional stall positions at 1 min after addition of RNAP and
NTPs. Low FRET efficiency was observed at transcriptional stalled positions +1 to +7, and high
FRET efficiency was observed at the stalled position +12. This is consistent with the translational
movement of subdomain H of T7 RNAP bring V174 closer to +17 position on the DNA during
the transition to EC. Interestingly, an intermediate FRET efficiency centered at 0.45 was observed
at the stalled positions +8 and +9, which suggested the existence of an intermediate complex on
the pathway from IC to EC. The broad distribution of FRET efficiency at stalled position +11
might be caused by fast the transitions between states or additional states. A plot of peak FRET
efficiency at various transcriptional stalled positions is displayed at the bottom. For position +11,
FRET histogram is broadly distributed without distinct peaks and therefore we omitted this
position from the plot. The plot shows the sudden FRET increase at stalled position +8 from the
transition of the IC to the intermediate complex, and another sharp FRET increase at position +12
caused by the transition to EC.
8
Figure S5. Related to Figure 5. Transition to an intermediate state from the IC at stalled
positions +8 and +9 occurs while the RNAP is still in contact with the promoter
(A,B) FRET histograms of Cy5-DNA and Cy3-RNAP (configuration 3) at the transcriptional
stalled position +8 and +9 over time. Low FRET efficiency (IC) disappeared as the mid FRET
efficiency (intermediate state) centered at 0.45 grew over reaction time. (C,D) The transition rate
constant from IC to the intermediate complex was estimated to be 0.09 and 1.1 m-1 for positions
+8 and +9, respectively, by exponential fitting of the ratio of IC over the total population vs. time.
The transition rate constant at position +9 was about 10 times faster than the one at the position
+8. (E) FRET histograms of dual-labeled DNA and non-labeled RNAP (configuration 2) at the
9
transcriptional stalled position +8 over time. (F) The total fluorescence intensities of DNA-only,
+3 and +8 RNAP complexes and the corresponding FRET efficiencies were obtained using
configuration 2. The plots show the total intensity vs. Eapp for each of the ~ 5000 molecules. The
total intensity of RNAP complex stalled at position +3 was double the total intensity of DNA-only.
RNAP binding to the promoter site and subsequent promoter opening step caused the quantum
yield increase of Cy3 conjugated to the promoter site. The total intensity of the newly-emerging
FRET peak in the RNAP complex stalled at position +8 (dotted green circle) matches the
intermediate state in (A) and did not decrease, demonstrating that the RNAP is still bound to the
promoter site. (G) With configuration 1, the Cy3 intensity did not increase after adding 10 nM
RNAP because the RNAP-bound state was short lived without NTPs. Fluorescence intensity
doubled as compared to DNA-only when the RNAP is stably bound to the promoter. At position
+8, the Cy3 intensity did not drop back to DNA only, suggesting no promoter clearance at stalled
position +8 in spite of the structural change observed in the RNAP. At position +12, the Cy3
intensity went back to the initial state where no RNAP is stably bound to the promoter DNA. This
suggests that the RNAP is released from the promoter site at position +12 and the transition to EC
is achieved. (H) The intermediate state during the transition from IC to EC identified in stalled
complexes at positions +8 and +9 was short-lived and not clearly distinguished in most time traces.
However, about 10 % of time traces showed a clear intermediate state as shown here.
top related