gbio0002-1 bioinformatics and geneticskbessonov/archived_data/gbio0002-1course... · gbio0002-1...
Post on 03-Sep-2018
215 Views
Preview:
TRANSCRIPT
GBIO0002-1 Bioinformatics
and Genetics
(Previous GBIO0009-1 Bioinformatics)
Introductory lecture Databases and R statistical language
Instructors • Course instructors
– Prof. Kristel Van Steen
• Office: 0/15 in B37
• E-mail: kristel.VanSteen@ulg.ac.be
• http://www.montefiore.ulg.ac.be/~kvansteen
– Prof. Franck DEQUIEDT
• Office: level +5, B34 (GIGA tower)
• E-mail: fdequiedt@ulg.ac.be
• Teacher Assistant
– Kyrylo Bessonov
• Office: 1/16 in B37
• kbessonov@ulg.ac.be
Course Scope This course is introduction to
bioinformatics and genetics fields
covering wide array of topics:
• accessing and working with main
biological DB (PubMed, Ensembl);
• sequence alignments;
• statistical genetics;
• microarray/genotype data analysis
• gene regulation mechanisms
• basic Molecular Biology concepts
Bioinformatics
Definition: the collection, classification,
storage, and analysis of biochemical
and biological information using
computers especially as applied to
molecular genetics and genomics
(Merriam-Webster dictionary)
Definition: a field that works on the
problems involving intersection of
Biology/Computer Science/Statistics
Genetics Definition: Study of heredity in general and
of genes in particular
(Concise Encyclopedia)
1.In 19th century Gregor Mendel formulated the basic concepts
of heredity
2.In 1909s Wilhelm Johannsen introduced a new word - gene
3.In 1909s Thomas Hunt Morgan provided evidence that genes
occur on chromosomes and that adjacent
4.In 1940s Oswald Avery showed that DNA is the chromosome
component that carries genetic information.
5.In 1962s the molecular structure of DNA was deduced by
James D. Watson, Francis Crick, and Maurice Wilkins.
6.In 1970s development of genetic recombination techniques
Course expected outcomes
• Gain a taste of various bioinformatics
fields coupled to hands-on knowledge
• Be able to perform
– multiple sequence alignments
– query biological databases
programmatically
– perform basic GWAS and microarray
analysis
– present scientific papers
Course practical aspects
• Mode of delivery: in class
• Activities:
– reading of scientific literature
– practical assignments (programming in R)
– in-class group presentations
• Meeting times:
– Thursdays from 2pm-6pm
– Room 1.123, Montefiore Institute (B28)
Course practical aspects
• Course material: will be posted on
Prof. Kristel Van Steen (lectures) and/or
Kyrylo Bessonov’s (practicals) website(s)
• Assignment submission: will be
done online via a special submission
website
– After the deadline, the assignment should be
e-mailed to Kyrylo Bessonov
(kbessonov@ulg.ac.be)
What will we be doing?
• We’ll cover a selected recent topics
in bioinformatics and genetics both
trough lectures and assignments
(including student’s presentations)
– reading papers from the bioinformatics
literature and analyzing/critiquing them
– Self-learning through assignments
– In-class hands-on presentation of tools
How will we do it?
• “Theory” classes
– All course notes are in English.
– Instructors
• Kristel Van Steen
• Franck DEQUIEDT
• The “theory” part of the course is
meant to be interactive:
– In-class discussions of papers / topics
How will we do it?
• “Practical” classes • During these classes will be looking at practical
aspects of the topics introduced in theory classes. It
is suggested to execute sample R scripts and
demonstrations on your PCs.
• Optional reading assignments will be assigned:
– to prepare for discussions in class based on the previously
posted papers (no grading; yet participation grades)
• “Homework assignments” are of 3 types (graded)
– Homework assignments result in a “group” report and
can be handed in electronically in French or in English
– Homework assignments constitute an important part of this
course
Types of HW assignments • Three types of homework assignments are:
– Literature style assignment (Type 1)
• A group of students is asked to select a paper
from the provided ones. The group prepares in-
class presentation and a written report
• All oral presentations of HW1,HW2, HW3 will be
done at the end of the semester (all together)
– Programming style assignment (Type 2)
• A group is asked to develop an R code to
answer assignment questions
– Classical style assignment (Type 3)
• A group is provided with questions to be
answered in the written report. Usually R scripts
are provided and require execution / modification
Report writing tips
• Every homework assignment involves writing a
short report
– Suggested length approximately five single-spaced
typed pages of text, excluding figures, tables and
bibliography
– Longer reports are accetable
• It should contain
– an abstract (e.g., brief description of the paper content,
description of the problem)
– results/discussion part
– If citations are made to other papers, there should be a
bibliography (any style is OK)!
• Only one report per group is needed.
• Submit report via online system
Course materials
• All course materials will be either
posted on Prof. Kristel van Steen’s
and/or Kyrylo Bessonov’s websites.
– Please check both sites
• There is no course book
• Final course schedule will be posted
online shortly
Evaluation scheme
• Written exam: 40% of the final mark
– Multiple choice questions/open book
– In French / English
• Assignments: 50% of the final mark
– Total of 3 assignments
• Participation in discussions (10%)
– Throughout the course
– During oral student’s presentations
• Last lecture of the course
Assignment submission
• All assignments should be zipped into
one file (*.zip) and submitted online
• Create a submission account
Account creation • Any member of the group can submit assignment
• Account details will be emailed to you automatically
• All GBIO009-1 students should create an account
Submit your assignment • After account creation login into a submission page
• The remaining time to deadline is displayed. Good idea to
check it from time to time in order to be on top of things
• File extension should be zip
• Can submit assignment as many times as you wish
Definition
• “R is a free software environment for
statistical computing and graphics”1
• R is considered to be one of the most
widely used languges amongst
statisticians, data miners,
bioinformaticians and others.
• R is free implementation of S language
• Other commercial statistical packages
are SPSS, SAS, MatLab
1 R Core Team, R: A Language and Environment for Statistical Computing, Vienna, Austria (http://www.R-project.org/)
Why to learn R?
• Since it is free and open-source, R is
widely used by bioinformaticians and
statisticians
• It is multiplatform and free
• Has wide very wide selection of
additional libraries that allow it to use
in many domains including
bioinformatics
• Main library repositories CRAN and
BioConductor
Programming? Should I be scared?
• R is a scripting language and, as
such, is much more easier to learn
than other compiled languages as C
• R has reasonably well written
documentation (vignettes)
• Syntax in R is simple and intuitive if
one has basic statistics skills
• R scripts will be provided and
explained in-class
Topics covered in this tutorial
• Operators / Variables
• Main objects types
• Plotting and plot modification functions
• Writing and reading data to/from files
Variables/Operators
• Variables store one element x <- 25
Here x variable is assigned value 25
• Check value assigned to the variable x
>x
[1] 25
• Basic mathematical operators that could be applied
to variables: (+),(-),(/),(*)
• Use parenthesis to obtain desired sequence of
mathematical operations
Arithmetic operators
• What is the value of small z here? >x <- 25
> y <- 15
> z <- (x + y)*2
> Z <- z*z
> z
[1] 80
Vectors
• Vectors have only 1 dimension and
represent enumerated sequence of
data. They can also store variables > v1 <- c(1, 2, 3, 4, 5)
> mean(v1)
[1] 3
The elements of a vector are specified
/modified with braces (e.g. [number]) > v1[1] <- 48
> v1
[1] 48 2 3 4 5
Logical operators
• These operators mostly work on
vectors, matrices and other data types
• Type of data is not important, the same
operators are used for numeric and
character data types Operator Description
< less than
<= less than or equal to
> greater than
>= greater than or equal to == exactly equal to != not equal to
!x Not x x | y x OR y
x & y x AND y
Logical operators
• Can be applied to vectors in the
following way. The return value is
either True or False > v1
[1] 48 2 3 4 5
> v1 <= 3
[1] FALSE TRUE TRUE FALSE FALSE
R workspace
• Display all workplace objects
(variables, vectors, etc.) via ls(): >ls()
[1] "Z" "v1" "x" "y" "z"
• Useful tip: to save “workplace” and
restore from a file use: >save.image(file = " workplace.rda")
>load(file = "workplace.rda")
How to find help info?
• Any function in R has help information
• To invoke help use ? Sign or help(): ? function_name()
? mean
help(mean, try.all.packages=T)
• To search in all packages installed in
your R installation always use
try.all.packages=T in help()
• To search for a key word in R
documentation use help.search(): help.search("mean")
Basic data types
• Data could be of 3 basic data types:
– numeric
– character
– logical
• Numeric variable type: > x <- 1
> mode(x)
[1] "numeric"
Basic data types
• Logical variable type (True/False): > y <- 3<4
> mode(y)
[1] "logical"
• Character variable type: > z <- "Hello class"
> mode(z)
[1] "character"
Objects/Data structures
• The main data objects in R are:
– Matrices (single data type)
– Data frames (supports various data types)
– Lists (contain set of vectors)
– Other more complex objects with slots
• Matrices are 2D objects (rows/columns)
> m <- matrix(0,2,3)
> m
[,1] [,2] [,3]
[1,] 0 0 0
[2,] 0 0 0
Lists
• Lists contain various vectors. Each
vector in the list can be accessed by
double braces [[number]] > x <- c(1, 2, 3, 4)
> y <- c(2, 3, 4)
> L1 <- list(x, y)
> L1
[[1]]
[1] 1 2 3 4
[[2]]
[1] 2 3 4
Data frames
• Data frames are similar to matrices but
can contain various data types > x <- c(1,5,10)
> y <- c("A", "B", "C")
> z <-data.frame(x,y)
x y
1 1 A
2 5 B
3 10 C
• To get/change column and row names
use colnames() and rownames()
Factors
• Factors type are similar to character
vectors but can provide info on
– on unique variables in the vector
– variable counts (quantity) > letters = c("A","B","C","A","C","C")
> letters = factor(letters)
[1] A B C A C C
Levels: A B C
> summary(letters)
A B C
2 1 3
Input/Output
• To read data into R from a text file use read.table()
– read help(read.table) to learn more
– scan() is a more flexible alternative raw_data <-read.table(file="data_file.txt")
• To write data into R from a text file use
read.table() > write.table(mydata, "data_file.txt")
Conversion between data types
• One can convert one type of data
into another using as.xxx where xxx
is a data type
Plots generation in R
• R provides very rich set of plotting
possibilities
• The basic command is plot()
• Each library has its own version of plot() function
• When R plots graphics it opens
“graphical device” that could be
either a window or a file
Plotting functions
• R offers following array of plotting
functions Function Description
plot(x) plot of the values of x variable on the y axis
plot(x,y) bi-variable plot of x and y values (both axis scaled based on values of x and y variables)
pie(y) circular pie-char boxplot(x) Plots a box plot showing variables via their quantiles hist(x) Plots a histogram(bar plot)
Plot modification functions
• Often R plots are not optimal and one
would like to add colors or to correct
position of the legend or do other
appropriate modifications
• R has an array of graphical parameters
that are a bit complex to learn at first
glance. Consult here the full list
• Some of the graphical parameters can be specified inside plot() or using other
graphical functions such as lines()
Plot modification functions
Function Description
points(x,y) add points to the plot using coordinates specified in x and y vectors
lines(x,y) adds a line using coordinates in x and y
mtext(text,side=3) adds text to a given margin specified by side number
boxplot(x) this a histogram that bins values of x into categories represented as bars
arrows(x0,y0,x1,y1, angle=30, code=1)
adds arrow to the plot specified by the x0, y0, x1, y1 coordinates. Angle provides rotational angle and code specifies at which end arrow should be drawn
abline(h=y) draws horizontal line at y coordinate
rect(x1, y1, x2, y2) draws rectangle at x1, y1, x2, y2 coordinates
legend(x,y) plots legend of the plot at the position specified by x and y vectors used to generate a given plot
title() adds title to the plot
axis(side, vect) adds axis depending on the chosen one of the 4 sides; vector specifying where tick marks are drawn
Demos
• R functionality demonstration
– Plots: demo(graphics)
– 3D: demo(persp)
– GLM data modelling: demo(lm.glm)
Installation of new libraries
• There are two main R repositories
– CRAN
– BioConductor
To install package/library from CRAN install.packages("seqinr")
To install packages from BioConductor source("http://bioconductor.org/biocLite.R")
biocLite("GenomicRanges")
Installation of key libraries
• Install latest R version on your PC. Go
to http://cran.r-project.org/
• Install following libraries by running install.packages(c("seqinr", "muscle", "ape",
"GenABEL")
source("http://bioconductor.org/biocLite.R")
biocLite("limma","affy","hgu133plus2.db","Biosti
ngs")
Conclusions
• We hope this course will provide you
with the good array of analytical and
practical skills
• We chose R for this course as it is very
flexible language with large scope of
applications and is widely used
Biologists Collect LOTS of Data • Hundreds of thousands of species to explore
• Millions of written articles in scientific journals
• Detailed genetic information:
• gene names
• phenotype of mutants
• location of genes/mutations on chromosomes
• linkage (distances between genes)
• High Throughput lab technologies
• PCR
• Rapid inexpensive DNA sequencing (Illumina HiSeq)
• Microarrays (Affymetrix)
• Genome-wide SNP chips / SNP arrays (Illumina)
• Must store data such that
• Minimum data quality is checked
• Well annotated according to standards
• Made available to wide public to foster research
What is database?
• Organized collection of data
• Information is stored in "records“, "fields“, “tables”
• Fields are categories
– Must contain data of the same type (e.g. columns
below)
• Records contain data that is related to one object
(e.g. protein, SNP) (e.g. rows below)
SNP ID SNPSeqID Gene +primer -primer
D1Mit160_1 10.MMHAP67FLD1.seq lymphocyte antigen 84 AAGGTAAAAGGCAAT
CAGCACAGCC
TCAACCTGGAGTCAGA
GGCT
M-05554_1 12.MMHAP31FLD3.seq procollagen, type III,
alpha
TGCGCAGAAGCTGA
AGTCTA
TTTTGAGGTGTTAATGG
TTCT
Biological Databases The number of databases is contantly growing!
- OBRC: Online Bioinformatics Resources Collection
currently lists over 2826 databases (2013)
Main databases by category Literature
• PubMed: scientific & medical abstracts/citations
Health
• OMIM: online mendelian inheritance in man
Nucleotide Sequences
• Nucleotide: DNA and RNA sequences
Genomes
• Genome: genome sequencing projects by organism
• dbSNP: short genetic variations
Genes
• Protein: protein sequences
• UniProt: protein sequences and related information
Chemicals
• PubChem Compound: chemical information with structures,
information and links
Pathways
• BioSystems: molecular pathways with links to genes, proteins
• KEGG Pathway: information on main biological pathways
Growth of UniProtKB
database • UniProtKB contains mainly protein
sequences (entries). The database
growth is exponential
• Data management issues? (e.g.
storage, search, indexing?)
Source: http://www.ebi.ac.uk/uniprot/TrEMBLstats
num
ber
of
entr
ies
Primary and Secondary
Databases
Primary databases
REAL EXPERIMENTAL DATA (raw)
Biomolecular sequences or structures and associated
annotation information (organism, function, mutation linked to
disease, functional/structural patterns, bibliographic etc.)
Secondary databases
DERIVED INFORMATION (analyzed and annotated)
Fruits of analyses of primary data in the primary sources (patterns, blocks, profiles etc. which represent the most conserved
features of multiple alignments)
Primary Databases
Sequence Information – DNA: EMBL, Genbank, DDBJ
– Protein: SwissProt, TREMBL, PIR, OWL
Genome Information – GDB, MGD, ACeDB
Structure Information – PDB, NDB, CCDB/CSD
Secondary Databases
Sequence-related Information – ProSite, Enzyme, REBase
Genome-related Information – OMIM, TransFac
Structure-related Information – DSSP, HSSP, FSSP, PDBFinder
Pathway Information – KEGG, Pathways
GenBank database
• Contains all DNA and protein sequences described in the scientific literature or collected in publicly funded research
• One can search by protein name to get DNA/mRNA sequences
• The search results could be filtered by species and other parameters
NCBI Databases contain more
than just
DNA & protein sequences
NCBI main portal: http://www.ncbi.nlm.nih.gov/
Fasta format to store sequences
Saccharomyces cerevisiae strain YC81 actin (ACT1) gene
GenBank: JQ288018.1
>gi|380876362|gb|JQ288018.1| Saccharomyces cerevisiae strain YC81 actin (ACT1)
gene, partial cds
TGGCATCATACCTTCTACAACGAATTGAGAGTTGCCCCAGAAGAACACCCTGTTCTTTTG
ACTGAAGCTCCAATGAACCCTAAATCAAACAGAGAAAAGATGACTCAAATTATGTTTGAA
ACTTTCAACGTTCCAGCCTTCTACGTTTCCATCCAAGCCGTTTTGTCCTTGTACTCTTCC
GGTAGAACTACTGGTATTGTTTTGGATTCCGGTGATGGTGTTACTCACGTCGTTCCAATT
TACGCTGGTTTCTCTCTACCTCACGCCATTTTGAGAATCGATTTGGCCGGTAGAGATTTG
ACTGACTACTTGATGAAGATCTTGAGTGAACGTGGTTACTCTTTCTCCACCACTGCTGAA
AGAGAAATTGTCCGTGACATCAAGGAAAAACTATGTTACGTCGCCTTGGACTTCGAGCA
AGAAATGCAAACCGCTGCTCAATCTTCTTCAATTGAAAAATCCTACGAACTTCCAGATGG
TCAAGTCATCACTATTGGTAAC
•
• The FASTA format is now universal for all
databases and software that handles DNA and
protein sequences
• Specifications: • One header line
• starts with > with a ends with [return]
OMIM database • Online Mendelian Inheritance in Man (OMIM)
• ”information on all known mendelian disorders linked to
over 12,000 genes”
• “Started at 1960s by Dr. Victor A. McKusick as a catalog of
mendelian traits and disorders”
• Linked disease data
• Links disease phenotypes and causative genes
• Used by physicians and geneticists
OMIM – basic search
• Online Tutorial: http://www.openhelix.com/OMIM
• Each search results entry has *, +, # or % symbol
• # entries are the most informative as molecular basis of
phenotype – genotype association is known is known
• Will do search on: Ankylosing spondylitis (AS)
• AS characterized by chronic inflammation of spine
OMIM-search results
• Look for the entires that link to the genes.
Apply filters if needed
Filter results if known SNP is associated to
the entry
Some of the interesting entries. Try to look
for the ones with # sign
OMIM-Finding disease linked genes • Read the report and find genes linked
phenotype (e.g. IL23R)
• Mapping – how the disease gene was found
PubMed database • PubMed is one of the best known
database in the whole scientific
community
• Most of biology related literature from all
the related fields are being indexed by this
database
• It has very powerful mechanism of
constructing search queries
• Many search fields ● Logical operatiors
(AND, OR)
• Provides electronic links to most journals
• Example of searching by author articles
published within 2012-2013
Demo/Assignment
• Question 1
– Explore OMIM database and key
clinical information on
• glioblastoma (brain cancer)
• Question 2
– Look for literature in PUBMED related
to the disease
• Learn on how to create search queries
top related