genomics, medicine, and society american college of radiology may 13, 2003 francis s. collins, m.d.,...

Genomics, Medicine,and Society

American College of Radiology

May 13, 2003

Francis S. Collins, M.D., Ph.D.

A SMALL SAMPLING OF COOL THINGS ABOUT THE GENOME

• Humans have fewer protein-coding genes than expected – less than 30,000

• Only about 5% of human DNA seems to be under strong selective pressure – but 2/3 of this is of unknown function

• Male mutation rate is twice that of females

All of the original goals of the Human Genome Project have

been accomplished

What’s next?

Genomics to Biology

• Define the structure of human variation: the human haplotype map

• Sequence lots of additional genomes • Develop new technologies for sequencing, genotyping,

expression analysis, proteomics, and molecular imaging• Identify all functional elements of the genome• Identify all the proteins of the cell, and their interactions• Develop a computational model of the cell

Genomics to Biology

• Define the structure of human variation: the human haplotype map

• Sequence lots of additional genomes • Develop new technologies for sequencing, genotyping,

expression analysis, proteomics, and molecular imaging• Identify all functional elements of the genome• Identify all the proteins of the cell, and their interactions• Develop a computational model of the cell

Finding genes for Mendelian phenotypes has made tremendous

progress over the last 10 years

Finding genes for complex (polygenic) disorders and traits has moved much more slowly

Sequence from chromosome 7

GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACA/CTATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTA/GAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA

Three SNPs are present

Whole Genome Association Approach to Common Disease

and Pharmacogenomics

• Identify all 10 million common SNPs

• Collect 1000 cases and 1000 controls

• Genotype all DNAs for all SNPs

2000 DNAs x 10,000,000 SNPs

= 20,000,000,000 genotypes

Sequence from chromosome 7

GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACA/CTATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTA/GAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA

Are the SNPs correlated with their neighbors?

These three SNPs could theoretically occur in 8 different haplotypes

…C…A…A…

…C…A…G…

…C…C…A…

…C…C…G…

…T…A…A…

…T…A…G…

…T…C…A…

…T…C…G…

But in practice, only two are observed

…C…A…A…

…C…A…G…

…C…C…A…

…C…C…G…

…T…A…A…

…T…A…G…

…T…C…A…

…T…C…G…

~ 20,000 bp

A Haplotype Map of Human Variation

• Goal is to define all common haplotypes in the human genome

• Genome-wide association studies can then be done with 30 – 50 times less work

• Project is international (9 labs in 5 countries); was initiated in October 2002, using samples of African, Asian, and European origin

Genomics to Health• Identify the genetic and environmental risk factors for all

common disease• Develop “sentinel systems” for early detection of disease and

molecular taxonomy of illness• Develop and deploy high-throughput robotic screening of

small molecules for academic researchers• Catalyze development of large human cohorts for genotype-

phenotype correlations• Elucidate the role that genomics can play in reducing health

disparities• Utilize genomics to improve health in the developing world

Genomics to Society• Enhance genetic privacy and protection against genetic

discrimination• Encourage appropriate patenting and licensing practices to

benefit the public• Understand the relationship of genomics, race, and

ethnicity, and bring this to bear usefully on the often contentious dialog about race

• Assess the ramifications of advances in understanding genetic factors that influence behavior

• Define boundaries of the appropriate application of genomics in the non-medical arena

What will be the impact of genomics on the

practice of medicine?

I think there is a world market for maybe five computers.

-- Thomas Watson

Chairman of IBM, 1943

The concept is interesting and well-formed, but in order to earn better

than a ‘C’, the idea must be feasible.

-- Yale Professor evaluating Fred Smith’s student paper proposing

the FedEx company

We don’t like their sound, and guitar music is on the way out.

-- Decca Records, rejecting the Beatles, 1962

640K ought to be enough for anybody.

-- Bill Gates, 1981

Most of the major contributing genes for diabetes, heart disease,

cancer, mental illness, Alzheimer’s and Parkinson’s disease, asthma, etc. will be identified within the

next 5 – 10 years.

Pharmacogenomics: Unlocking the Human Genome for Better Drug Therapy

McLeod & Evans, Ann Rev Pharmacol Toxicol 41:101-21, 2001

All patients with same diagnosis

Treat

Remove

No response

Toxic response

Responses without

toxic side effects

Gleevec™ – Specifically TargetsAn Abnormal Protein, Blocking Its Ability To Cause Chronic Myeloid Leukemia

Chromosome 9;22 translocation

CML

Bcr-Abl fusion protein

Gleevec™

Bcr-Abl fusion protein

Normal

2010 -- Predictive genetic tests available for a dozen conditions

-- Interventions to reduce risk available for several of these

-- Will reasonably effective legislative solutions to genetic

discrimination be in place?

BUT….

Mainstreaming of individualized preventive medicine

-- Will access be inequitable? Will health disparities persist?

-- Pharmacogenomics is standard of care for several drugs

2020 -- Gene-based designer drugs available for diabetes, Alzheimer’s…

-- Gene therapy standard of care for several conditions

BUT….

Genomic therapeutic revolution in full swing

-- Intense debate underway on non-medical uses of genetics

To wrest from nature the secrets which have

perplexed philosophers in all ages, to track

to their sources the causes of disease, to

correlate the vast stores of knowledge, that

they may be quickly available for the

prevention and cure of disease -- these are

our ambitions.

Sir William Osler

www.genome.gov