interaction of poly(adp-ribose) polymerase 1 with apurinic/apyrimidinic sites within clustered dna...
Post on 03-Aug-2016
213 Views
Preview:
TRANSCRIPT
The base excision repair (BER) system is responsible
for repair of damage caused by ionizing radiation and
exogenous oxidizing and alkylating agents that act simi�
larly to endogenous factors [1]. The same system also
repairs apurinic/apyrimidinic (AP) sites. AP sites are pro�
duced by spontaneous hydrolysis of the N�glycoside bond
and also by elimination of an incorrect or damaged base
by DNA glycosylases. Under physiological conditions,
~10,000 AP sites are produced in mammalian cells per
day [2]. Clustered damage, or multiple lesions in which
oxidized bases, AP sites, and strand breaks are combined
within one or two turns of the DNA helix and can be
located in both strands of DNA present a significant
problem for the cell. Such damage is characteristic for
ionizing radiation and therapeutic radiomimetics [3].
Depending on the type of ionizing radiation, 20�30%
of damages are direct double�strand breaks in DNA,
whereas other damages are located within clusters [4].
The repair of such damage requires careful control of the
succession of repair of individual damages to prevent for�
mation of double�strand breaks, which are most toxic for
cells [3]. Studies in vitro with purified BER proteins and
nuclear extracts have shown that repair of clustered dam�
age can be associated with formation of double�strand
breaks [5]. The presence of breaks within clusters and of
AP sites in the opposite DNA strand increases the proba�
bility of formation of double�strand breaks compared to
the case of multiple damages as different oxidized bases
[6]. Despite the numerous studies on repair of multiple
damages by BER proteins that have been performed using
cell extracts and repair systems reconstructed from indi�
vidual proteins, exact regulatory mechanisms and factors
ISSN 0006�2979, Biochemistry (Moscow), 2011, Vol. 76, No. 1, pp. 147�156. © Pleiades Publishing, Ltd., 2011.
Original Russian Text © M. M. Kutuzov, E. S. Ilina, M. V. Sukhanova, I. A. Pyshnaya, D. V. Pyshnyi, O. I. Lavrik, S. N. Khodyreva, 2011, published in Biokhimiya, 2011,
Vol. 76, No. 1, pp. 176�187.
147
Abbreviations: A, dAMP; APE1, human apurinic/apyrimidinic
(AP) endonuclease 1; AP site, apurinic/apyrimidinic site;
BER, base excision repair; DD, decane�1,10�diol residue;
DEG, diethylene glycol residue; DTT, dithiothreitol; PARP1,
human poly(ADP�ribose) polymerase 1; THF, 3�hydroxy�2�
hydroxymethyltetrahydrofuran residue.
* To whom correspondence should be addressed.
Interaction of Poly(ADP�ribose) Polymerase 1with Apurinic/Apyrimidinic Sites within Clustered DNA Damage
M. M. Kutuzov, E. S. Ilina, M. V. Sukhanova, I. A. Pyshnaya,D. V. Pyshnyi, O. I. Lavrik, and S. N. Khodyreva*
Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of the Russian Academy of Sciences,
pr. Akademika Lavrent’eva 8, 630090 Novosibirsk, Russia; fax: (383) 363�5153; E�mail: svetakh@niboch.nsc.ru
Received July 30, 2010
Revision received August 20, 2010
Abstract—To study the interaction of poly(ADP�ribose) polymerase 1 (PARP1) with apurinic/apyrimidinic sites (AP sites)
within clustered damages, DNA duplexes were created that contained an AP site in one strand and one of its analogs situ�
ated opposite the AP site in the complementary strand. Residues of 3�hydroxy�2�hydroxymethyltetrahydrofuran (THF),
diethylene glycol (DEG), and decane�1,10�diol (DD) were used. It is shown for the first time that apurinic/apyrimidinic
endonuclease 1 (APE1) cleaves the DNA strands at the positions of DEG and DD residues, and this suggests these groups
as AP site analogs. Insertion of DEG and DD residues opposite an AP site decreased the rate of AP site hydrolysis by APE1
similarly to the effect of the THF residue, which is a well�known analog of the AP site, and this allowed us to use such AP
DNAs to imitate DNA with particular types of clustered damages. PARP1, isolated and in cell extracts, efficiently interact�
ed with AP DNA with analogs of AP sites producing a Schiff base. PARP1 competes with APE1 upon interaction with AP
DNAs, decreasing the level of its cross�linking with AP DNA, and inhibits hydrolysis of AP sites within AP DNAs contain�
ing DEG and THF residues. Using glutaraldehyde as a linking agent, APE1 is shown to considerably decrease the amount
of AP DNA�bound PARP1 dimer, which is the catalytically active form of this enzyme. Autopoly(ADP�ribosyl)ation of
PARP1 decreased its inhibitory effect. The possible involvement of PARP1 and its automodification in the regulation of AP
site processing within particular clustered damages is discussed.
DOI: 10.1134/S0006297911010147
Key words: affinity modification, poly(ADP ribose) polymerase 1, Schiff base, apurinic/apyrimidinic sites and their analogs
148 KUTUZOV et al.
BIOCHEMISTRY (Moscow) Vol. 76 No. 1 2011
responsible for the efficient repair of cluster damages are
not established. Perhaps there are some proteins specifi�
cally interacting with clustered damages and regulating
their repair. Among the known proteins of the BER sys�
tem, this function may be fulfilled by poly(ADP�ribose)
polymerase 1 (PARP1). PARP1 recognizes breaks in
DNA produced not only under the influence of genotox�
ic agents (e.g. free radicals, ionizing radiation, mono�
functional alkylating agents), but also as a result of func�
tioning of BER enzymes [7]. On interacting with DNA
breaks in the presence of NAD+, the enzymatic activity of
PARP1 is manifested resulting in synthesis of negatively
charged polymer, poly(ADP�ribose), covalently bound to
PARP1 itself and to acceptor proteins [8]. The automod�
ification of PARP1 is thought to result in its dissociation
from DNA, which promotes the regulation of repair. We
have recently found that PARP1 can interact with AP
sites via formation of Schiff base [9], and it was suggested
that this protein should be involved in the regulation of
processing of AP sites within clustered damages. In this
connection it seems very interesting to study interactions
of PARP1 with DNA containing AP sites within clustered
damages and also mutual influences of PARP1 and APE1
(apurinic/apyrimidinic (AP) endonuclease 1) on interac�
tion with such DNA structures. APE1 is the major
enzyme processing AP sites in the cells of higher eukary�
otes [10].
Formation of Schiff base is a reversible process, but
the binding of protein with DNA can be stabilized by
reduction with sodium borohydride [9]. Such covalent
binding of proteins to nucleic acid is often used when
protein–nucleic acid interactions are studied [9, 11�13].
In the present work the interaction of PARP1 with
APE1 was studied using DNA duplexes with structure
imitating DNAs with a definite type of clustered damages
represented by two AP sites located opposite to each
other. On using such model DNAs, it was desirable that
one of the AP sites would be an analog maximally resist�
ant to the action of APE1, and 3�hydroxy�2�hydroxy�
methyltetrahydrofuran (THF), diethylene glycol (DEG),
and decane�1,10�diol residues (DD) were used as analogs
of AP sites. The THF residue is most widely used as a
mimetic of AP sites hydrolyzed by AP endonuclease�1
[14, 15]. The earlier used acyclic analogs of AP sites, eth�
ylene glycol and propandiol residues, are cleaved by
APE1 with approximately the same catalytic efficiency as
a THF residue [15]. New analogs of AP sites, DEG and
DD residues, were expected to be more resistant to the
action of APE1.
MATERIALS AND METHODS
Reagents used were as follows: dNTP, EDTA, Tris,
TEMED, imidazole, SDS, ammonium persulfate,
dithiothreitol (DTT), and Coomassie G�250 (Sigma,
USA); MgCl2, formamide, and NP�40 (Fluka,
Switzerland); acrylamide and glycerol (ICN, USA); β�
mercaptoethanol (Serva, Germany); N,N′�methylene
bisacrylamide (BioRad, USA); T4 phage polynucleotide
kinase and uracil�DNA glycosylase from Escherichia coli
(Biosan, Russia); [γ�32P]ATP (>110 TBq/mmol)
(Laboratory of Biotechnology, Institute of Chemical
Biology and Fundamental Medicine, Siberian Branch of
the Russian Academy of Sciences (ICBFM SB RAS)).
Other reagents were of domestic production.
Expressing vectors containing cDNA of human
APE1 and PARP1 were kindly provided by S. Wilson
(National Institutes of Health, USA) and M. S. Sato
(University of the Laval city, Canada), respectively.
Recombinant proteins were isolated as described in works
[13, 14]. Cell cultures of HeLa, MCF�7, human lung
fibroblasts, K�562, and BL�2 were kindly provided by
coworkers of ICBFM SB RAS M. A. Zenkova, V. A.
Matveeva, and P. P. Laktionov. Whole�cell and nuclear
extracts were prepared as described in work [11]. Protein
concentrations were determined by the Bradford method
[15] with BSA as a standard.
Oligodeoxyribonucleotides without modifications in
the strands were synthesized in the Laboratory of Medical
Chemistry (ICBFM SB RAS). Modified oligonucleotides
were prepared by incorporation into them of inserts based
on DEG, DD, and THF using corresponding phosphor�
amidite synthons synthesized by the method described in
[16]. The 5′�end of oligonucleotides was radiolabeled
using phage T4 polynucleotide kinase [17]; the products
were purified by electrophoresis in denaturing polyacryl�
amide gel with 7 M urea [17].
Oligonucleotides of the following sequences were
used: 5′�GGAAGACCCTGACGTTDEGCCCAACT�
TAATCGCC�3′; 5′�GGAAGACCCTGACGTTDDCC�
CAACTTAATCGCC�3′; 5′�GGAAGACCCTGACG�
TTTHFCCCAACTTAATCGCC�3′; 5′�GGAAGACC�
CTGACGTTACCCAACTTAATCGCC�3′; 5′�GGCG�
ATTAAGTTGGGUAACGTCAGGGTCTTCC�3′; 5′�GGCGATTAAGTTGGGCAACGTCAGGGTCTTCC�
3′; where U is dUMP.
Preparation of DNA duplexes containing AP sitesusing uracil�DNA glycosylase from E. coli. Reaction mix�
tures (5�10 µl volume) contained 32P�labeled uracil�con�
taining DNA (1 µM), uracil�DNA glycosylase (4 U/pmol
DNA), and also the following standard components:
50 mM Tris�HCl (pH 8.0), 50 mM NaCl. The reaction
was performed during 15 min at 37°C. AP sites in DNA
were generated immediately before the experiment.
Determination of APE1 activity. Reaction mixtures
(10 µl) contained 32P�labeled AP DNA (0.1 µM), 25 nM
APE1, 5 mM MgCl2 (CaCl2), and also standard compo�
nents: 50 mM Tris�HCl (pH 7.8), 40 mM NaCl, 1 mM
DTT, 0.1 mg/ml BSA. The reaction was performed for
15 min at 37°C and stopped by addition of sodium boro�
hydride and EDTA to the concentration of 20 mM. The
INTERACTION OF PARP1 WITH AP DNA 149
BIOCHEMISTRY (Moscow) Vol. 76 No. 1 2011
reaction mixtures were incubated for 30 min at 0°C. The
products were analyzed by electrophoresis in 20% poly�
acrylamide gel in the presence of 7 M urea [17] with a
subsequent radioautography. On determination of sub�
strate properties of AP sites within AP DNA containing
analogs of AP sites the APE1 concentration was 3 nM,
and the time was varied from 0.25 to 5 min. On determi�
nation of the substrate properties of AP site analogs the
APE1 concentration was 30 nM, and the time of incuba�
tion is indicated in the caption to Fig. 1. Radioactivity of
the products was measured using a Molecular Imager
device and Quantity One software (BioRad).
Modification of PARP1 by DNA duplexes containingAP sites. Reaction mixtures (10 µl) contained 32P�labeled
AP DNA (0.1 µl), 5 mM EDTA or 5 mM MgCl2/CaCl2,
50 mM Tris�HCl (pH 7.8), 40 mM NaCl, 0.1 mg/ml
BSA, 0.24 µM PARP1, 25 nM APE1. The reaction was
carried out at 37°C for 15 min, then sodium borohydride
was added to the final concentration of 20 mM, and the
incubation was continued on ice for 30 min. The reaction
products were analyzed by electrophoresis in 10% poly�
acrylamide gel in the presence of SDS [18] with subse�
quent radioautography.
Modification of extract proteins by DNA duplexescontaining AP sites. AP DNA extract proteins were mod�
ified as described for recombinant PARP1 (without addi�
tion of BSA) at the extract protein concentrations 1.4 and
0.16 mg/ml for the whole�cell and nuclear extracts,
respectively. The further procedures were similar to those
described above.
Detection of protein–protein interactions by cross�linking with glutaraldehyde. Reaction mixtures (10 µl)
contained 32P�labeled AP DNA (0.1 µM), 0.24 µM
PARP1, 25 nM APE1, 5 mM CaCl2, and also standard
components: 50 mM Tris�HCl (pH 7.8), 40 mM NaCl,
1 mM DTT. The reaction mixtures were incubated at
37°C for 15 min, then glutaraldehyde was added to con�
centration of 0.1%, and incubation was continued at the
same temperature for 10 min. Then to stabilize Schiff
bases the reaction mixtures were supplemented with sodi�
um borohydride to the concentration of 20 mM and incu�
bated for 30 min at 0°C. The reaction products were ana�
lyzed by electrophoresis in 10% polyacrylamide gel in the
presence of SDS [18] with subsequent radioautography.
RESULTS AND DISCUSSION
Non�nucleotide insertions as analogs of AP sites.DNA duplexes were created using 32�meric synthetic
oligonucleotides containing in the middle of the strand
non�nucleotide insertions of THF, DD, and DEG
residues [19, 20]. Analysis of the DNA strand cleavage by
positions of the AP site analogs within the DNA duplexes
DEG�DNA, THF�DNA, and DD�DNA (Fig. 1)
revealed that APE1 hydrolyzed DNA with acyclic analogs
of AP sites (DD and DEG residues) significantly less effi�
ciently than THF�containing DNA. On one hand, DD
and DEG residues can be considered as analogs of AP
sites because APE1 cleaves the DNA strand by their posi�
tions. On the other hand, when DD and DEG residues
are used for imitating AP sites within clustered damages,
the DNA cleavage by their positions is insignificant as
compared to the cleavage in an AP site. Note that as
opposed to natural AP sites these analogs are unable to
produce Schiff bases, and this can be useful in some stud�
ies.
According to the available data, the rate of cleavage
by APE1 of intact or borohydride�reduced AP sites is 50�
80% lower in the presence of oppositely located AP sites
(reduced AP sites) [21�23]. To determine the efficiency of
imitating AP sites within clustered damages by the stud�
ied analogs, we compared the rates of cleavage of AP sites
within DNA containing opposite the AP site the follow�
ing residues: dAMP (AP DNA�A), THF (AP DNA�
THF), DD (AP DNA�DD), and DEG (AP DNA�DEG).
The results of this comparison presented in Fig. 2 show
that the AP site is not as well imitated by a DD residue as
by residues of THF and DEG, because the efficiency of
hydrolysis of AP sites within AP DNA�DD is higher than
within AP DNA with the two other insertions. As expect�
ed, the cleavage rate was maximal for AP DNA�A con�
taining a single AP site. Thus, considering the decreased
efficiency of hydrolysis of AP sites within AP DNAs con�
taining non�nucleotide insertions and the ability of APE1
to cleave DNA strands at the positions of these groups,
such DNAs can be considered as structures imitating a
particular type of clustered damage. Note that residue
DEG was more resistant to the action of APE1 than
Fig. 1. Substrate features of non�nucleotide insertions as analogs of
AP sites in the reaction catalyzed by APE1. Reaction mixtures
(10 µl) containing standard components, 0.1 µM DNA with non�
nucleotide insertions, and 30 nM APE1 were incubated at 37°C.
The incubation time for DEG�DNA (6�8) was 5, 10, and 15 min
and for THF�DNA (2�4) and DD�DNA (10�12) it was 0.5, 1.0,
and 1.5 min, respectively. 1, 5, 9) Control (incubation without
APE1). The products were separated by electrophoresis in 20%
polyacrylamide gel in the presence of 7 M urea. Arrows with one
and two asterisks indicate cleaved and uncleaved oligonucleotides,
respectively.
THF�DNA
1 2 3 4 5 6 7 8 9 10 11 12
**
*
DEG�DNA DD�DNA
150 KUTUZOV et al.
BIOCHEMISTRY (Moscow) Vol. 76 No. 1 2011
residues DD and THF (Fig. 1), whereas hydrolysis of an
AP site within AP DNA�DEG by AP endonuclease 1 was
also the least efficient.
Interaction of PARP1 and APE1 with AP DNA. We
have earlier shown that PARP1 interacts with AP sites
producing Schiff bases [9] that can be stabilized by reduc�
tion with borohydride. In addition to photoaffinity mod�
ification, this covalent binding of proteins to nucleic acid
can be used in studies of protein–nucleic interactions [9,
11, 12]. To assess the efficiency of the interaction of
PARP1 with AP DNA having different structure and the
influence of APE1 on the interaction of PARP1 with
these DNAs, the levels of AP DNA binding to PARP1
were determined in the presence and in the absence of
APE1. The binding of DNA with PARP1 and APE1 does
not require the presence of bivalent metal ions, but the
ions are necessary for catalytic activity of both proteins
[10, 15, 24�26]. PARP1 can catalyze poly(ADP�ribo�
syl)ation in the presence of Mg2+ and Ca2+ [24], whereas
APE1 does not use Ca2+ as a cofactor in hydrolysis of AP
sites [25]. Therefore, interactions of PARP1 with AP
DNA and influence of APE1 were studied in both the
absence and presence of cofactor ions.
Formation of Schiff bases with AP sites is character�
istic for base excision repair enzymes, such as bifunction�
al DNA glycosylases, where this intermediate is involved
in the catalysis: cleavage of the sugar�phosphate skeleton
of DNA at the AP site through the β�elimination mecha�
nism [2, 12]. But in some cases the formation by proteins
of Schiff bases with AP DNA is not accompanied by
cleavage of the DNA strand. Thus, MutY, unlike other
monofunctional DNA glycosylases, forms such an inter�
mediate with AP DNA but is unable to cleave the DNA
[12]. Incubation of PARP1 with AP DNA under condi�
tions used in the subsequent experiments did not result in
considerable cleavage of AP DNA (data not presented),
which allowed us to use PARP1 cross�linking to AP DNA
for studies on the interaction of the protein with AP
DNA.
The first series of experiments was performed in the
absence of Mg2+ to prevent a possible hydrolysis of AP
sites by APE1. Figure 3 shows radioautographs of gels
upon separation of products of AP DNA binding to
PARP1. Note that in the case of AP DNA�DEG a rather
intensive product of AP DNA cross�linking is observed,
which can be assigned to APE1 by the apparent molecu�
lar weight (7 and 9 in Fig. 3b). Upon prolonged exposure
of the gel with the recording screen, similar but less inten�
sive products are observed for AP DNA�THF and AP
DNA�DD, but not for AP DNA�A. It seems that distor�
tions in the structure of AP DNA duplexes caused by
insertions of analogs of AP site can draw together a lysine
of the enzyme to deoxyribose of AP site. Note that the
formation of Schiff base is not involved in catalysis of
cleavage of AP sites by APE1 [10, 22, 23].
The efficiency of interaction of PARP1 with DNA
was quantitatively characterized by the level of PARP1
modification, which was determined as the fraction of
DNA bound to PARP1 (Table 1). Under certain condi�
tions the level of protein modification makes it possible to
judge its affinity for the DNA duplex. Thus, a positive
correlation between the level of modification and protein
affinity for DNA intermediates of BER with different
structure was demonstrated for DNA polymerase β and
APE1 using photoactivated DNAs and the method of gel
retardation [27]. Considering this, the lowest affinity for
PARP1 should be specific for AP DNA�THF. However, it
may be that the yield of PARP1 cross�linking to AP
DNAs with different structure can depend on conforma�
tion of the PARP1–AP DNA complex. The mutual ori�
entation of acceptor amino acid and deoxyribose of the
AP site can be different in complexes with different AP
DNAs due to distortions in the structure caused by the
analog of the AP site.
The addition of APE1 decreases the level of PARP1
modification for all DNA duplexes. This effect is the most
pronounced in the cases of AP DNA�A and AP DNA�
DD. In the presence of two proteins in the reaction mix�
ture the binding efficiency of each with DNA depends on
the ratio of affinities of these proteins for DNA. In the
presence of APE1, the level of PARP1 modification
decreases differently for all AP DNAs. APE1 competes
more efficiently with PARP1 for binding with AP DNA�
A and AP DNA�DD, whereas AP DNA�THF and AP
Fig. 2. Kinetic curves of cleavage of AP sites within AP DNA by
AP endonuclease 1. Reaction mixtures (10 µl) containing stan�
dard components, 0.1 µM AP DNA with non�nucleotide inser�
tions, and 3 nM APE1 were incubated at 37°C. At the indicated
time intervals, the reaction was stopped, AP sites were reduced
with borohydride (20 mM) at 0°C for 30 min, and the products
were separated by electrophoresis in 20% polyacrylamide gel in
the presence of 7 M urea. 1) AP DNA�A; 2) AP DNA�DD; 3) AP
DNA�THF; 4) AP DNA�DEG. Mean values and standard errors
are presented, n = 3.
1 50
30
2
10
0
3 4
2 4
Time, min
Cle
avag
e d
eg
ree
of
AP
site
s, %
INTERACTION OF PARP1 WITH AP DNA 151
BIOCHEMISTRY (Moscow) Vol. 76 No. 1 2011
DNA�DEG are less efficiently displaced by APE1 from
the complexes with PARP1.
On using DNAs with residues of deoxyribitol (an ana�
log of an AP site) opposite to dAMP or two deoxyribitol
residues opposite to each other, it was shown for APE1 that
insertion into DNA of another analog of the AP site result�
ed in a significant decrease in the affinity of APE1 for
DNA: the value of Kdis increased 70�fold [23]. Overall, this
is consistent with the less pronounced influence of APE1
on the levels of PARP1 modification by AP DNA�THF
and AP DNA�DEG than by AP DNA�A and AP DNA�
DD, based on the suggestion that within the clustered
damage a DD residue does not imitate an AP site as well as
residues of THF and DEG. Note that there are no data in
the literature on the influence of single or multiple AP sites
(or their analogs) on the affinity of DNA for PARP1.
Fig. 3. Modification of PARP1 by AP DNA (a) and the influence of APE1 on modification of PARP1 (b). Reaction mixtures (10 µl) contain�
ing standard components, [32P]AP�DNA (0.1 µM), 0.24 µM PARP1 (where indicated), and 25 nM APE1 (where indicated) were incubated
at 37°C for 15 min. Then the Schiff bases were reduced with sodium borohydride (20 mM) at 0°C for 30 min. The reaction products were sep�
arated by electrophoresis in 10% polyacrylamide gel by the Laemmli method. The arrows with the square and with the dot indicate covalent
adducts PARP1–AP DNA and APE1–AP DNA, respectively.
АР�DNA�А
1 2 3 4 1 2 3 4 5 6 7 8 9 10 11 12
a
АРЕ1
b
АР�DNA�ТНF АР�DNA�DEG АР�DNA�DD
PARP1
АР
DN
A�А
АР
DN
A�Т
НF
АР
DN
A�D
EG
АР
DN
A�D
D
AP DNA
AP DNA�A
AP DNA�THF
AP DNA�DEG
AP DNA�DD
Table 1. Influence of APE1 on level of PARP1 modification
Note: Mean values and standard errors are presented, n = 3.
without Me2+
5.2 ± 0.7
4.0 ± 0.3
4.7 ± 0.6
5.0 ± 1.0
Мg2+
4.6 ± 0.3
4.3 ± 0.5
5.0 ± 1.0
3.6 ± 0.7
Ca2+
3.3 ± 0.6
4.0 ± 0.9
4.1 ± 0.7
2.6 ± 0.1
without Me2+
2.6 ± 0.8
3.7 ± 0.8
3.5 ± 0.6
2.6 ± 0.8
Мg2+
6.2 ± 0.8
6.5 ± 0.4
6.1 ± 0.2
6.0 ± 1.0
Ca2+
6.0 ± 1.0
7.6 ± 0.4
8.0 ± 1.0
6.5 ± 0.1
Level of PARP1 modification, %
in absence of APE1 in presence of APE1
152 KUTUZOV et al.
BIOCHEMISTRY (Moscow) Vol. 76 No. 1 2011
Data on the influence of Ca2+ on the level of PARP1
modification by AP DNA presented in Table 1 indicate an
increase in the efficiency of the interaction of PARP1
with all AP DNAs, but for AP DNAs containing non�
nucleotide insertions this effect is more pronounced.
There is no literature data on the direct influence of Ca2+
on the affinity of PARP1 for DNA, but Ca2+ is a cofactor
in the reaction of autopoly(ADP�ribosyl)ation [24]. The
increase in the PARP1 modification in the presence of
Ca2+ can be caused either by an increase in the protein
affinity for DNA or by conformational changes in the
enzyme complex with DNA leading to optimization of
positions of deoxyribose of the AP site and of the primary
amino acid of the protein. The presence of APE1
decreases the level of PARP1 modification for all AP
DNAs, but the decrease is the most pronounced in the
case of AP DNA�DD. Overall, in the presence of Ca2+
APE1 decreases the level of PARP1 modification a little
more effectively. There is also no literature data on the
influence of Ca2+ on the efficiency of DNA binding with
APE1; therefore, it is difficult to take this factor into con�
sideration. However, because Ca2+ is not a cofactor on
hydrolysis of AP sites by APE1 [25], the decrease in the
level of PARP1 modification in the presence of APE1 is
not associated with cleavage of AP DNA.
The level of AP DNA cross�linking to PARP1 and
the influence of APE1 on this process were also assessed
in the presence of Mg2+. Moreover, in this case the effi�
ciency of hydrolysis of AP sites was also determined.
Overall, the efficiency of PARP1 modification for all AP
DNAs in the presence of Mg2+ is higher than in the
absence of bivalent metal ions, but the difference between
the levels of cross�linking of AP DNAs used is less pro�
nounced. The influence of APE1 is similar: the level of
modification of PARP1 in its presence decreases in the
reaction with any of DNA duplexes used in this work. The
strongest decrease in the level of modification was
observed in the case of AP DNA�DD. When the reaction
is performed in the presence of Mg2+ the conditions are
most similar to physiological ones, but in this case the
cleavage of AP DNA occurs concurrently with the modi�
fication, and this also can influence the level of modifica�
tion of PARP1.
For different DNAs the degree of cleavage of AP
sites by APE1 strongly depends on the presence of PARP1
(Table 2). Under the described conditions, no protective
effect of PARP1 is observed for AP DNA�A and AP
DNA�DD, whereas PARP1 significantly decreases the
efficiency of cleavage of AP sites for AP DNA�THF and
AP DNA�DEG. This is consistent with the hypothesis
that the structure of the DD residue does not imitate an
AP site as well as the structures of the two other non�
nucleotide insertions, because it is known that the pres�
ence of AP sites in complementary DNA strands decreas�
es the rate of AP site hydrolysis by APE1 [23]. The influ�
ence of APE1 varies depending on the conditions of the
experiment and on the type of AP DNA, but it is reason�
able to suppose that APE1 and PARP1 should compete
for binding with AP DNA. However, it may be that for�
mation of the PARP1–APE1–AP DNA triple complex
can be associated with changes in the conformation of
PARP1 leading to a decrease in the number of
PARP1–AP DNA cross�links. Competitive interactions
of PARP1 and APE1 in the presence of DNA duplexes
AP DNA
AP DNA�A
AP DNA�THF
AP DNA�DEG
AP DNA�DD
in absenceof PARP1
94 ± 5
93 ± 8
94 ± 10
93 ± 7
in presenceof PARP1
93 ± 5
62 ± 10
58 ± 12
90 ± 8
Table 2. Influence of PARP1 on level of AP DNA cleav�
age by APE1
Efficiency of AP site cleavageby APE1, %
Note: Efficiency of AP site cleavage by APE1 is determined as the frac�
tion of radiolabeled product corresponding to cleaved oligonu�
cleotide in the total contents of radiolabeled products in the
sample. Mean values and standard errors are presented, n = 3.
Fig. 4. Detection of protein–protein interactions of PARP1 and
APE1 using cross�linking with glutaraldehyde. Reaction mixtures
(10 µl) containing 32P�labeled AP DNA (0.1 µM), 0.24 µM
PARP1 (where indicated), 25 nM APE1 (where indicated), 5 mM
CaCl2, and standard components were incubated at 37°C for
15 min, then glutaraldehyde was added (to 0.1%) and incubation
was continued for 10 min at the same temperature. Reduction
with NaBH4 and subsequent analysis were performed as described
in the caption to Fig. 3. Arrows with one and two squares indicate
PARP1–AP DNA and PARP1x2–AP DNA covalent adducts,
respectively.
AP DNA�A
1 2 3 4 5 6 7 8 9 10 11 12
АРЕ1
AP DNA�T
HF
AP DNA�D
EG
AP DNA�D
D
PARP1
INTERACTION OF PARP1 WITH AP DNA 153
BIOCHEMISTRY (Moscow) Vol. 76 No. 1 2011
with an AP site analog cleaved by APE1 have been
demonstrated in some works [27�30]. We have monitored
the existence of PARP1–APE1–AP DNA triple com�
plexes using two approaches: cross�linking with glu�
taraldehyde [31] and coprecipitation with antibodies
against APE1 [29].
Data on the cross�linking of the components of the
complex by glutaraldehyde are presented in Fig. 4. No
product with molecular weight corresponding to the AP
DNA–PARP1–APE1 complex was detected in the gel
radioautograph. However, a product with higher molecu�
lar weight was recorded, the electrophoretic mobility of
which corresponded to a protein with apparent molecular
weight approximately equal to twice the molecular weight
of PARP1. This product is likely to be AP DNA bound to
PARP1 dimer with two protein molecules cross�linked by
glutaraldehyde. It is known that on binding with damaged
DNA PARP1 is dimerized, and then a mutual poly(ADP�
ribosyl)ation of these molecules occurs [32, 33].
Addition of APE1 into the reaction mixture lowers
the total amount of product of PARP1 cross�linking with
AP DNA, and especially of the product assigned to the
catalytically competent PARP1 dimer. Such an influence
of APE1 on PARP1 labeling indicates that these proteins
compete for binding to DNA. The coprecipitation with
antibodies against APE1 also did not reveal PARP1–
APE1–AP DNA complexes (data not presented).
Using photoactive DNA intermediates of BER, we
showed earlier that PARP1 covalently bound to DNA can
undergo poly(ADP�ribosyl)ation, which results in a
decrease in the amount of product of the PARP1 cross�
linking with DNA and in generation of products with the
lower electrophoretic mobility corresponding to the cova�
lent adduct poly(ADP�ribosyl)ated PARP1–DNA [34].
The generation of such products allows us to record the
automodified form of PARP1 and in the case of cellular
extract to identify PARP1�related products among other
protein–DNA cross�links. This property of the protein
was also confirmed for PARP1 covalently bound with AP
DNA�A through Schiff base [9]. A similar property of
PARP1 has also been shown for AP DNAs containing
analogs of AP sites opposite the natural AP site. Figure 5
exemplifies data for AP DNA�THF, PARP1, and the
whole�cell extract of MCF�7.
Automodification of PARP1 is considered to be a
mechanism regulating the interaction of this protein with
DNA due to decrease in the affinity of poly(ADP�ribo�
syl)ated PARP1 for damaged DNA. The weaker binding
of PARP1 with DNA provides for the availability of a
damaged site for enzymes of repair and this, in turn, can
increase the efficiency of consequent stages of repair.
Such regulation has been considered for stages of BER
upon formation of a break in the DNA strand [8]. To elu�
cidate a possible regulatory role of PARP1 in the APE1�
catalyzed processing of AP sites (single and within DNA
with analogs of AP sites), we compared the influences of
PARP1 and its poly(ADP�ribosyl)ated form on the activ�
ity of this enzyme. Results of this comparison are pre�
sented in Fig. 6. Under conditions of PARP1 automodifi�
cation, the depth of cleavage of AP sites by APE1 increas�
es. The effect is maximal for AP DNA�DEG (~25%), for
AP DNA�THF and AP DNA�DD it is 10 and 3�5%,
respectively. Thus, the efficiency of hydrolysis of AP sites
within clustered damages can be regulated by functional
interactions of APE1 with PARP1 and its poly(ADP�
ribosyl)ated form. We showed earlier that PARP1 and its
autopoly(ADP�ribosyl)ation are involved in the regula�
tion of the latest stages of BER, and their influence on the
long�patch pathway is more pronounced. Automodifi�
cation of PARP1 weakens its inhibitory effect and seems
to be a prerequisite for the Pol β�dependent variant of the
long�patch pathway [17, 35, 36].
Interaction of AP DNA with proteins of cell extracts.The finding of interactions of recombinant PARP1 with
AP sites within clustered damage has stimulated ques�
tions whether such interactions can occur in the presence
of other cell proteins, e.g. in cell extracts. Data on AP
DNA cross�linking with proteins of extracts from some
cultured cell lines are presented in Fig. 7. These experi�
ments were performed in the absence of Mg2+ to prevent
Fig. 5. Poly(ADP�ribosyl)ation of PARP1 covalently bound to AP
DNA�THF. Reaction mixtures (10 µl) containing 32P�labeled AP
DNA�THF (0.1 µM), proteins of extract from MCF�7
(1.4 mg/ml), or 0.4 µM PARP1, and standard components were
incubated at 37°C for 15 min, then 0.5 mM NAD+ and 10 mM
MgCl2 were added and the incubation was continued for 5 min at
the same temperature. Reduction by NaBH4 and subsequent
analysis were performed as described in the caption to Fig. 3. The
arrow with square indicates a covalent PARP1–AP DNA adduct.
1 2 3 4
MCF�7 PARP1
{
Mg2+ + – + –NAD+ + – + –{
154 KUTUZOV et al.
BIOCHEMISTRY (Moscow) Vol. 76 No. 1 2011
the cleavage of AP sites by endogenous AP nucleases of
the extracts. The labeling of the extract proteins unam�
biguously indicates that PARP1 efficiently interacts with
AP DNA in the presence of other proteins of the cells.
It should be noted that the amount of product of AP
DNA cross�linking corresponding to PARP1 widely
varies depending on the cell type. Addition of Mg2+
decreases the level of modification of all proteins (data
Fig. 6. Effect of PARP1 automodification on cleavage of AP sites within AP DNA. Reaction mixtures (10 µl) containing 32P�labeled AP DNAs
(0.1 µM), 25 APE1 (where indicated), 0.24 µM PARP1 (where indicated), 0.2 mM NAD+ (where indicated), 5 mM MgCl2, and standard
components were incubated at 37°C for 15 min. Reduction by NaBH4 and subsequent analysis were performed as described in the caption to
Fig. 2. Arrows with one and two asterisks indicate cleaved and uncleaved oligonucleotides, respectively.
АР DNA�А
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
**
АРЕ1
АР DNA�ТНF АР DNA�DEG АР DNA�DD
PARP1
*
NAD+
Fig. 7. Modification of extract proteins by DNA duplexes containing an AP site. Reaction mixtures (10 µl) contained 32P�labeled AP DNAs
(0.1 µM), extract proteins (1.4 mg/ml for whole�cell extracts and 0.16 mg/ml for nuclear extracts). Other conditions were similar to those
described in the caption to Fig. 3. a) Whole�cell extracts, cell type is indicated under the radioautograph. b) Nuclear extract from the K�562
cells. Samples corresponding to 1, 3, and 5 additionally contained 0.1 µM recombinant PARP1. Arrows with square and diamond indicate
PARP1–AP DNA and Ku80–AP DNA covalent adducts, respectively.
АР DNA�А
1 2 3 4 5 6 7 8 9 10 11 12 1 2 3 4 5 6
a b
АР DNA�ТНF АР DNA�DEG
PARP1
АР
DN
A�А
АР
DN
A�Т
НF
АР
DN
A�D
D
He
La
He
La
He
La
MC
F�7
H.f
ibro
BL�
2
MC
F�7
H.f
ibro
BL�
2
MC
F�7
H.f
ibro
BL�
2
INTERACTION OF PARP1 WITH AP DNA 155
BIOCHEMISTRY (Moscow) Vol. 76 No. 1 2011
not presented). The identification of a designated product
of AP DNA cross�linking with proteins is based on the
apparent molecular weight of the product determined by
its electrophoretic mobility and also on the partial disap�
pearance of this product accompanied by concurrent
appearance of products with higher molecular weight
during the modification of proteins of AP DNA extracts
in the presence of NAD+ and Mg2+ (data not presented).
As noted above, this approach can be used for discrimi�
nating products of PARP1 cross�linking with AP DNA
from products of modification of other proteins. Note
that in the extracts the levels of PARP1 modification for
AP DNA�DEG and AP DNA�THF are higher than for
AP DNA�A (compare 1�4 with 5�8 and 9�12 in Fig. 7a),
as differentiated from specimens with recombinant
PARP1 (Fig. 3 and Table 1). Such differences can be due
to influences of cell proteins, which can either compete
with PARP1 or promote its more efficient interaction
with DNA. In similar experiments with addition of
nuclear extract from K�562 cells, some of the reaction
mixtures were supplemented with recombinant PARP1
(1, 3, and 5 in Fig. 7b). The same tendency was observed
without addition of PARP1: endogenous PARP1 binds to
AP DNAs with analogs of AP sites more efficiently than
to AP DNA�A (compare 2 with 4 and 6 in Fig. 7b). Upon
addition of PARP1, the amount of the corresponding
product increases (compare 1, 3, 5 with 2, 4, 6 in Fig. 7b)
and the intensity of the product with the lower molecular
weight decreases. This product was earlier identified by us
as Ku80, a subunit of Ku�antigen, which is a multicopy
nuclear protein possessing a high affinity for double�
stranded termini of DNA [11]. Note that for AP DNA�A
Ku80 is the major product of modification in extracts
from all cells except BL�2 (1�3 in Fig. 7a and 2 in Fig.
7b), as shown earlier for some extracts including those
used in the present work [11]. The observed type of pro�
tein labeling suggests a competition of PARP1 with Ku�
antigen for binding with DNA. However, it may be that a
protein from the extract unable to form cross�linking with
AP DNA influences the binding of PARP1 with AP DNA
and promotes its more efficient interaction with AP
DNAs containing analogs of AP sites in the complemen�
tary strand.
Thus, PARP1 can interact with both single AP sites
and AP sites within clustered damages. PARP1 and its
automodification seem to be involved in the regulation of
hydrolysis of AP sites by APE1 within definite types of
clustered damages. This regulation is especially impor�
tant for minimizing formation of double�strand breaks,
which are the most toxic for cells [3]. Double�strand
breaks can arise under spontaneous or BER enzyme�cat�
alyzed cleavage of AP sites within clustered damages.
These results are consistent with the revealed ability of
PARP1 to decrease formation of double�strand breaks in
cellular DNA under conditions of intensive oxidative
damage of DNA [37] when AP sites are often produced as
intermediates. Moreover, PARP1 is also known as a pro�
tein involved in determination of cell sensitivity to ioniz�
ing radiation [38], whereas clustered damages are a spe�
cific type of DNA damage caused by ionizing radiation
and some radiomimetics used as antitumor preparations
[3].
This work was supported by the Russian Foundation
for Basic Research (project Nos. 09�04�93106 and 10�04�
01083), the programs “Molecular and Cell Biology”
(project No. 6.5) and OFINN (project No. 21.68) of the
Russian Academy of Sciences, and the Integration proj�
ect No. 76 and the Lavrentiev grant for young scientists of
the Siberian Branch of the Russian Academy of Sciences.
REFERENCES
1. Lindahl, T. (2000) Mutat. Res., 462, 129�135.
2. Boiteux, S., and Guillet, M. (2004) DNA Repair, 3, 1�12.
3. Sung, J. S., and Demple, B. (2006) FEBS J., 273, 1620�
1629.
4. Lomax, M. E., and Gulston, M. K. (2002) Radiat. Prot.
Dosimetry, 99, 63�68.
5. David�Cordonnier, M. H., Cunniffe, S. M., Hickson, I.
D., and O’Neill, P. (2002) Biochemistry, 41, 634�642.
6. Gulston, M., de Lara, C., Jenner, T., Davis, E., and
O’Neill, P. (2004) Nucleic Acids Res., 32, 1602�1609.
7. Shall, S., and de Murcia, G. (2000) Mutat. Res., 460, 1�
15.
8. Lindahl, T., Satoh, M. S., Poirier, G. G., and Klungland,
A. (1995) Trends Biochem. Sci., 20, 405�411.
9. Khodyreva, S. N., Ilina, E. S., Sukhanova, M. V., Kutuzov,
M. M., and Lavrik, O. I. (2010) Dokl. Akad. Nauk, 431,
132�135.
10. Wilson, D. M., III, and Barsky, D. (2001) Mutat. Res., 485,
283�307.
11. Ilina, E. S., Lavrik, O. I., and Khodyreva, S. N. (2008)
Biochim. Biophys. Acta, 1784, 1777�1785.
12. Zharkov, D. O., and Grollman, A. P. (1998) Biochemistry,
37, 12384�12394.
13. Levina, E. S., Bavykin, S. G., Shick, V. V., and Mirzabekov,
A. D. (1981) Analyt. Biochem., 110, 93�101.
14. Takeshita, M., Chang, C. N., Johnson, F., Will, S., and
Grollman, A. P. (1987) J. Biol. Chem., 262, 10171�10179.
15. Erzberger, J., and Wilson, D., III. (1999) J. Mol. Biol., 290,
447�457.
16. Lebedeva, N. A., Khodyreva, S. N., Favre, A., and Lavrik,
O. I. (2003) Biochem. Biophys. Res. Commun., 300, 182�
187.
17. Sukhanova, M. V., Khodyreva, S. N., and Lavrik, O. I.
(2004) Biochemistry (Moscow), 69, 558�568.
18. Bradford, M. M. (1976) Analyt. Biochem., 72, 248�254.
19. Pyshnaya, I. A., Pyshnyi, D. V., Lomzov, A. A., Zarytova, V.
F., and Ivanova, E. M. (2004) Nucleosides, Nucleotides and
Nucleic Acids, 23, 1065�1071.
20. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular
Cloning: A Laboratory Manual, 2nd Edn., Cold Spring Harbor,
Cold Spring Harbor Laboratory Press, New York.
21. Laemmli, U. K. (1970) Nature, 277, 680�685.
156 KUTUZOV et al.
BIOCHEMISTRY (Moscow) Vol. 76 No. 1 2011
22. Chaudhry, M. A., and Weinfeld, M. (1997) J. Biol. Chem.,
272, 15650�15655.
23. McKenzie, J. A., and Strauss, P. R. (2001) Biochemistry,
40, 13254�13261.
24. Kun, E., Kirsten, E., Mendeleyev, J., and Ordahl, C. P.
(2004) Biochemistry, 43, 210�216.
25. Beernink, P. T., Segelke, B. W., Hadi, M. Z., Erzberger, J.
P., Wilson, D. M., III, and Rupp, B. (2001) J. Mol. Biol.,
307, 1023�1034.
26. Barzilay, G., Mol, C. D., Robson, C. N., Walker, L. J.,
Cunningham, R. P., Tainer, J. A., and Hickson, I. D.
(1995) Nature Struct. Biol., 2, 561�568.
27. Dyrkheeva, N. S., Khodyreva, S. N., and Lavrik, O. I.
(2008) Biochemistry (Moscow), 73, 261�272.
28. Sukhanova, M. V., Khodyreva, S. N., Lebedeva, N. A.,
Prasad, R., Wilson, S. H., and Lavrik, O. I. (2005) Nucleic
Acids Res., 33, 1222�1229.
29. Cistulli, C., Lavrik, O. I., Prasad, R., Hou, E., and Wilson,
S. H. (2004) DNA Repair, 3, 581�591.
30. Peddi, S. R., Chattopadhyay, R., Naidu, C. V., and Izumi,
T. (2006) Toxicology, 224, 44�55.
31. Enguita, F. J., Liras, P., Leitao, A. L., and Martin, J. F.
(1996) J. Biol. Chem., 271, 33225�33230.
32. Mendoza�Alvarez, H., and Alvarez�Gonzalez, R. (1993) J.
Biol. Chem., 268, 22575�22580.
33. Pion, E., Ullmann, G. M., Ame, J. C., Gerard, D., de
Murcia, G., and Bombarda, E. (2005) Biochemistry, 44,
14670�14681.
34. Lavrik, O. I., Prasad, R., Sobol, R. W., Horton, J. K.,
Ackerman, E. J., and Wilson, S. H. (2001) J. Biol. Chem.,
276, 25541�25548.
35. Sukhanova, M. V., Khodyreva, S. N., and Lavrik, O. I.
(2006) Biochemistry (Moscow), 71, 736�748.
36. Sukhanova, M., Khodyreva, S., and Lavrik, O. (2010)
Mutat. Res., 685, 80�89.
37. Woodhouse, B. C., Dianova, I. I., Parsons, J. L., and
Dianov, G. L. (2008) DNA Repair, 7, 932�940.
38. Jorgensen, T. J. (2009) Cancer Bio. Ther., 8, 665�670.
top related