introduction to pr ogramming: perl for biologists · introduction to pr ogramming: perl for...

Introduction to Programming: Perl for Biologists

Timothy M. Kunau

Center for Biomedical Research InformaticsAcademic Health CenterUniversity of Minnesotakunau@umn.edu

Bioinformatics Summer Institute 2007

Introduction to Programming: Day two

Timothy M. Kunau

Center for Biomedical Research InformaticsAcademic Health CenterUniversity of Minnesotakunau@umn.edu

Bioinformatics Summer Institute 2007

•Art and Programming

•Getting Started

•Biology and Computer Science

•Bioinformatics Data

•Perl basics:

•Strings and Variables

•Math and Logic

•Looping, operators, and functions

Day II

•Assignment discussion

•Data from outside the program

•Writing out data

•Data into arrays and hashes

•Array operations

•Scope and Good practices

•RegEx

Day I: assignment review.

1. Calculate the reverse complement of a DNA strand using the tr/// operation.

2. Read about file handling. (Safari on-line documentation is available.)

3. Read about Regular Expressions (regex). (Safari)

4. Find CPAN.ORG and locate a module that would be useful to you as a biologist.

5. Read about that module and email me (kunau@umn.edu) the following details:

1. Name of the module.

2. The name of the person who wrote it.

3. What it does.

4. How it would be useful to you?

Day I: assignment review.

1. Calculate the reverse complement of a DNA strand using the tr/// operation.

•Match and replace what is in the first section, in order, with what is in the second.

• $dna =~ tr/[A-Z]/[a-z]/; # lowercase

• $dna =~ tr/[A-Z]/[B-ZA]/; # shift cipher

• $dna =~ tr/[ACGT]/[TGCA]/; # revcom

• $dna = reverse($dna);

The tr/// operator (translate)

•Allows you to substitute whatever is matched in first section with value in the second section. (See m//.)

• $sport =~ s/football/soccer/g;

• $tdfwinner =~ s/Lance Armstrong/Ivan Basso/g;

s/// operator (substitute)

#!/usr/bin/perl -w# Calculating the reverse complement of a strand of DNA

# The DNAmy $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

print "Here is the starting DNA:\n\n$DNA\n\n";

# Calculate the reverse complementmy $revcom = reverse $DNA;

# The Perl translate/transliterate command is just what we need:$revcom =~ tr/ACGTacgt/TGCAtgca/;

print "Here is the reverse complement DNA:\n\n$revcom\n";

Reverse compliment of a DNA strand

Day I: assignment review, CPAN modules

1. Name of the module.

2. The name of the person who wrote it.

3. What it does.

4. How it would be useful to you.

Getting Data from Files

open(HANDLE, "contig2_MT.fa") || die $!;

while (defined($line = <HANDLE>)) { if( $line =~ /^\>/ ) { print $line, "\n"; }}

close(HANDLE);

% ./file-handles.pl>ContigId:Contig2 AssemblyProcessId:MtSC AssemblyProcessVersion:1

while (<HANDLE>) {

if( $_ =~ /^\>/ ) { # tests first line print $_, "\n"; # prints first line }}

close(HANDLE);

% ./file-handlesII.pl>ContigId:Contig2 AssemblyProcessId:MtSC AssemblyProcessVersion:1

Getting Data from Files

@slurp = <HANDLE>;

print @slurp;

close(HANDLE);

% ./file-handlesIII.pl

>ContigId:Contig2 AssemblyProcessId:MtSC AssemblyProcessVersion:1

GGGTATACTTCCTCCTCCATTGTTTGAGATATCACAAGACTTGAAATTGA

GCACGACCCATATTCTACTTCAAGGCGTTGAAGCAAAAACTCACCATGGG

AAACTAAACAGGTTAGTAAGTAGGCATCACCATCATTTTATATCGATATG

GATAATAATGCACAAGACTTTCAAAGTTATCTTCAGATTCTTCCCCCTGT

TGAGTTTGCTTGCGTTTATGGATCATCTCTTCATCCAACCAATCATGACA

AGACAACCATGGTTGATTATATTCTTGGAGTTTCTGACCCTATACAATGG

CATTCTGAGAATCCGAAAATGAATAAGCATCACTATGCGTCATGGATGGT

GCACCTTGGTGGAGAGAGGCTGATTACCGCAGATGCAGATAAAATTGGTG

TGGGAGTACATTTCAACCCTTTTG

Pass data into a program

while(<STDIN>) {

print “stdin read: $_”;

Pass data into a program

open(GREP, “grep ‘>’ $filename”) || die $!;

my $i = 0;

while(<GREP>) { $i++;}

close(GREP);

print “$i sequences in file\n”;

Writing out data

open(OUT, “>outname”) || die $!;

print OUT “sequence report\n”;

close(OUT);

Writing out data

# appending with >>

open(OUT, “>>outname”) || die $!;

print OUT “append this\n”;

close(OUT);

Filehandles as variables

my $var = \*STDIN;

open($fh, “>report.txt”) || die $!;

print $fh “line 1\n”;

open($fh2, “report”) || die $!;

$fh = $fh2;

while(<$fh>) {

something interesting goes here;

Zero based economy...

•The first element is ‘0’ for an index or first character in a string

•computer scientists like it this way

•as do most programming languages, including Perl

•Biologists often number first base in a sequence as ‘1’

•GenBank

•BioPerl

•Interbase coordinates (Kent-UCSC, Chado-GMOD)

Coordinate systems

• Zero based, interbase coordinates

A A T G G G T A G A

0 1 2 3 4 5 6 7 8 9

• 1 based coordinates

A T G G G T A G A

1 2 3 4 5 6 7 8 9

Arrays as Lists

• Lists are sets of items

• Can be mixed types of scalars (numbers, strings, floats)

• Perl uses lists extensively

• Variables are prefixed by @

List operations

• reverse # reverse list order

• $list[$n] # get the $n-th item

• $two = $list[2]; # get which item?

List operations

• reverse # reverse list order

• $list[$n] # get the $n-th item

• $three = $list[2]; # get the third item

List operations

• scalar # get length of array

• $len = scalar @list;

• $last_index = $#list;

• delete $list[10]; # delete entry

Autovivication

• Autovivify : to bring oneself to life.

• Automatically allocates space for an array item element:

$array[0] = ‘apple’;

$array[4] = ‘elephant’;$array[25] = ‘zebra’;

delete $array[25];

pop,push,shift,unshift

# remove last item$last = pop @list;

# remove first item$first = shift @list;

# add to end of listpush @list, $last;

# add to beginning of listunshift @list, $first;

splicing an array

splice ARRAY,OFFSET,LENGTH,LIST

splice ARRAY,OFFSET,LENGTH

splice ARRAY,OFFSET

splice ARRAY

splicing an array

@list = (‘alice’,’chad’,’rod’);

($x,$y) = splice(@list,1,2);

splice(@list, 1,0,(‘marvin’,’alex’));

Sorting with sort

@list = (‘tree’,’frog’, ‘log’);

@sorted = sort @list;

# reverse order@sorted = sort { $b cmp $a } @list;

Sorting with arrays of numbers

@list = (25,21,12,17,9,8);

# sort based on numerics@sorted = sort { $a <=> $b } @list;

# reverse order of sort@revsorted = sort { $b <=> $a } @list;

LAB: files#!/usr/bin/perl -w## Reading protein sequence data file.

# File containing the sequence datamy $fastafilename = 'contig2_MT.fa';

# First we have to "open" the fileopen(FASTAFILE, $fastafilename);

# Read the fastafrom file, and store it# into the array variable @protein@fasta = <FASTAFILE>;

# Print the protein onto the screenprint @fasta;

# Close the file.close FASTAFILE;

% pico files2arrays.pl

LAB: files#!/usr/bin/perl -w## Reading protein sequence data file.

# File containing the sequence datamy $fastafilename = 'contig2_MT.fa';

# First we have to "open" the fileopen(FASTAFILE, $fastafilename) || die $!;

LAB: get a file in FASTA format

http://www.ncbi.nlm.nih.gov/

LAB: navigate to GenBank

LAB: search for your favorite protein

LAB: favorite protein entries, change display

LAB: change display to FASTA

LAB: we return to our

program, already in

progress

% pico kinase.fa

Add the name of the

FASTA file you created to

the program.

Run the program.

#!/usr/bin/perl -w## Reading protein sequence data file.

# File containing the sequence datamy $fastafilename = 'kinase.fa';

# First we have to "open" the fileopen(FASTAFILE, $fastafilename) || die $!;

LAB: break it.

What happens when?:

1. You added the file?

2. Did the error message go away?

3. How would you protect your user from an error like this?

Did you think that was harder than it needed to be?

LAB: a safer method

% ./files2arrays.pl

Run the program.

#!/usr/bin/perl -w# Reading data from a file using a loop

open(FASTAFILE, $fastafilename) || die $!;

# Read file one line at a time and printwhile ($protein = <FASTAFILE>) { print $protein;}

close FASTAFILE;

breaking it.

Why is this more safe than reading the file into an array?

#!/usr/bin/perl -w# Reading data from a file using a loop

open(FASTAFILE, $fastafilename) || die $!;

# Read file one line at a time and printwhile ($protein = <FASTAFILE>) { print $protein;}

close FASTAFILE;

A brief break

TM proctor & gamble

•Section or subsection of a program where a variable is valid.

•Defined by braces { }

•Use ‘my’ to declare variables.

• use strict; # mandates declaration of variables.

• use warnings; # or ‘-w’ on shebang line

Good practices

• ‘my’ operator declares a variable or a list of variables to be local (private) to the enclosed block, subroutine, or file. It will also be recognized in blocks contained by that region.

• The region in which the private variable is recognized is called its scope, variables declared with ‘my’ are called lexically scoped variables.

• Lexical (private) variables are not recognized outside of their scope.

• A private variable of a function will not be recognized in another function called by that function. If you want that to happen, declare the variable as ‘local’.

• It is recommended that you declare all of your variables with ‘my’.

Someone else’s code

@list = (‘aardvark’, ‘baboon’, ‘cat’, ‘dog’,’lamb’,’kangaroo’);

for $animal ( @list ) { if( length($animal) <= 3 ) { print “$animal is noisy\n”; } else { print “$animal is quiet\n”; }}

Made more safe.

use warnings;use strict;my @list = (‘aardvark’, ‘baboon’, ‘cat’, ‘dog’,’lamb’,’kangaroo’);

for my $animal ( @list ) { if( length($animal) <= 3 ) { print “$animal is noisy\n”; } else { print “$animal is quiet\n”; }}

Associative arrays or Hashes

10 2 3 4 5

Array Hashpear

cherry

‘john’

‘ste

‘aar

‘max

‘juan

‘sue’

Associative arrays or Hashes

• Like arrays, but instead of numbers as indices hashes use strings.

my @array = (‘john’, ‘steve’, ‘aaron’, ‘max’, ‘juan’, ‘sue’);

my %fruithash = ( ‘apple’ => 12, ‘pear’ => 3, ‘cherry’ =>30, ‘lemon’ => 2, ‘peach’ => 6, ‘kiwi’ => 3);

Using hashes

• { } operator

• Set a value

$fruithash{‘cherry’} = 10;

• Access a value

print $fruithash{‘cherry’}, “\n”;

• Remove an entry

delete $fruithash{‘cherry’};

Get the Keys

• ‘keys’ function will return a list of the hash keys

my @keys = keys %fruithash;

for my $key ( keys %fruithash ) { print “$key => $hash{$key}\n”;}

• produces: ‘apple’, ‘pear’, ...

• Order of keys is NOT guaranteed!

Get just the values

•Similarly:

# creates an array of hash values

my @fruitcnt = values %fruithash;

for my $itemcount ( @fruitcnt ) { print “val is $itemcount\n”;}

Iterate through a set

• Order is not guaranteed!

while( my ($key,$value) = each %fruithash){ print “$key => $value\n”;}

References

• Are “pointers” to the data object instead of object itself.

• A shorthand to refer to a variable and pass it around.

•Must “dereference” whatever is pointed at to get its actual value, the “reference” is just a location in memory.

Reference Operators

• \ in front gets its memory location

my $ptr = \@vals;

• Pointers can be assigned directly:

• [ ] for arrays, { } for hashes

my $ptr = [ (‘owlmonkey’, ‘lemur’)];

my $hashptr = { ‘cdrom’ => ‘III’, ‘start’ => 23};

Dereferencing

• Need to cast reference back to datatype:

my @list = @$ptr;

my %hash = %$hashref;

• Can also use ‘{ }’ to clarify

my @list = @{$ptr};

my %hash = %{$hashref};

Really not so hard...

my @list = (‘fugu’, ‘human’, ‘worm’, ‘fly’);

my $list_ref = \@list;

my $list_ref_copy = [@list];

for my $item ( @$list_ref ) { print “$item\n”;}

Why use references?

• Simplify argument passing to subroutines

• Allows updating data without making multiple copies.

• What if we wanted to pass in 2 arrays to a subroutine?

sub func { my (@v1,@v2) = @_; }

• How do we know when one stops and another starts?

Why use references?

• Passing in two arrays to intermix.

sub func { my ($v1,$v2) = @_; my @mixed;

while( @$v1 || @$v2 ) { push @mixed, shift @$v1 if @$v1; push @mixed, shift @$v2 if @$v2; } return \@mixed;}

References also allow Arrays of Arrays

my @lst;push @lst, [‘milk’, ‘butter’, ‘cheese’];push @lst, [‘wine’, ‘sherry’, ‘port’];push @lst, [‘bread’, ‘bagels’, ‘croissants’];

my @matrix = [ [1, 0, 0], [0, 1, 0], [0, 0, 1] ];

Hashes of arrays

$hash{‘dogs’} = [‘beagle’, ‘shepherd’, ‘lab’];$hash{‘cats’} = [‘calico’, ‘tabby’, ‘siamese’];$hash{‘fish’} = [‘gold’,’beta’,’tuna’];

for my $key (keys %hash ) { print “$key => “, join(“\t”, @{$hash{$key}}), “\n”;}

Subroutines

•Set of code that can be reused.

•Can also be referred to as procedures and functions.

•Often the result of re-factoring and refining your solution.

•Have little to do with submarines.

Defining a subroutine

• sub routine_name { } # declaring a subroutine

• Calling the routine:

routine_name;

&routine_name; # & is optional

Passing data to a subroutine

• Pass in a list of data

&dosomething($var1,$var2);

sub dosomething { my ($v1,$v2) = @_;}

sub dosomethingelse { my $v1 = shift @_; my $v2 = shift;}

Returning data from a subroutine

• The last line of the routine sets the return value.

sub dothis { my $c = 10 + 20;}

print dothis(), “\n”;

• Better to specify return value and/or a condition to leave routine early.

sub is_stopcodon { my $val = shift @_;

if( length($val) != 3 ) { return -1; } elsif( $val eq ‘TAA’ || $val eq ‘TAG’ || $val eq ‘TGA’ ) { return 1; } else { return 0; }}

Subroutine returns true (1) if codon is a stop codon

(standard genetic code)

LAB: subroutines

% pico subroutine.pl

#!/usr/bin/perl -w# A program with a subroutine to append AAAAT to DNA

# The original DNA$dna = 'CGACGTCTTCTCAGGCGA';

# The call to the subroutine "addPOLYA".# argument passed in is $dna; result is $longer_dna$longer_dna = addPOLYA($dna);

print "I added AAAAT to $dna and got $longer_dna\n\n";

# Here is the definition for subroutine "addPOLYA"sub addPOLYA { my($dna) = @_;

$dna .= 'AAAAT'; return $dna;}

LAB: break it.

Can you?:

1. Create better variable names?

2. Find a potential problem with subroutines and variable scope?

3. Get it to work with GLOBAL variables?

4. Explain why this might be a problem?

LAB: add to it.

Can you?:

1. Find another way to concatenate the strings?

2. Add a subroutine that provides a reverse transcription service?

3. Test for a poly-A tail before adding a poly-A tail and add one only if it isn’t already there?

4. Create a file of FASTA entries and run them through your program?

Funny operators

my @bases = qw(C A G T);

my $msg = <<EOFIn his return from the ship to New York, he was discovered by the enemy as he passed near Governors Island, They took chase and in an effort to escape, Ezra Lee cast off the timed mine, as he imagined it retarded him in the heavy swells of the harbor. He was then spotted by his men waiting for his return on the shore and was safely retrieved. The freed magazine, which was set to go off at one hour, “drifted past Governors Island into the East River where it exploded with great violence, throwing large columns of water and pieces of wood high in the air.”

• Part of “amazing power” of Perl

• Considered by some to be the heart and soul of Perl.

• Provide a set of very powerful and flexible facilities for parsing and manipulating text.

• Syntax can be tricky.

• Worth the effort to learn!

• Do not be afraid.

Regular Expressions (reg’-ex)

• Regular Expressions represent a small, nearly unrelated, programming language within the Perl programming language.

• ‘Regexes’ are symbiotic DNA.

• A state machine operating on strings.

• Do not be afraid.

Regular Expressions: the secret

if( $fruit eq ‘apple’ || $fruit eq ‘Apple’ || $fruit eq ‘pear’) { print “ matched fruit $fruit\n”;}

# becomes this

if( $fruit =~ /[Aa]pple|pear/ ){ print “matched fruit $fruit\n”;}

A simple regex

• use the =~ operator to match

• if( $var =~ /pattern/ ) {} # scalar context

• my ($a,$b) = ( $var =~ /(\S+)\s+(\S+)/ );

• if( $var !~ m// ) { } # true if pattern doesn’t

• m/REGEXPHERE/ # match

• s/REGEXP/REPLACE/ # substitute

• tr/VALUES/NEWVALUES/ # translate

Regular Expression syntax

• aMino - {A,C}, Keto - {G,T}

• puRines - {A,G}, prYmidines - {C,T}

• Strong - {G,C}, Weak - {A,T}

• H (Not G)- {ACT}, B (Not A), V (Not T), D(Not C)

$str =~ tr/acgtrymkswhbvdnxACGTRYMKSWHBVDNX/tgcayrkmswdvbhnxTGCAYRKMSWDVBHNX/;

DNA ambiguity chars: (reverse compliment)

• Search a string for a pattern match

• If no string is specified, will match $_

• Pattern can contain variables which will be interpolated (and pattern recompiled)

while (<>) { print if /$pat/; }

while (<>) { print if /$pat/o; }

m// operator (match)

• /i # case insensitive

• /g # global match (more than one)

• /x # extended regex (comments and whitespace)

• /o # compile regex once

Pattern extras: suffixes

Regex Operators

\ escape character - used to a metacharacter like a period, brackets, etc.. (period) match any character except newlinex ! match any instance of x^x ! match any character except x[x] ! match any instance of x in the bracketed range - [abxyz] will match any

instance of a, b, x, y, or z| (pipe) an OR operator - [x|y] will match an instance of x or y() ! used to group sequences of characters or matches{} ! used to define numeric quantifiers{x} ! match must occur exactly x times{x,} !match must occur at least x times{x,y} !match must occur at least x times, but no more than y times? ! preceding match is optional or one only, same as {0,1}* ! find 0 or more of preceding match, same as {0,}+ ! find 1 or more of preceding match, same as {1,}^ ! match the beginning of the line$ ! match the end of a line

Regex: Character Operators

\d !matches a digit, same as [0-9]\D !matches a non-digit, same as [^0-9]\s ! matches a whitespace character (space, tab, newline, etc.)\S !matches a non-whitespace character\w !matches a word character\W !matches a non-word character

Regex: POSIX Operators

[:alnum:] !alphabetic and numeric characters[:alpha:] ! alphabetic characters[:blank:] ! space and tab[:cntrl:] ! control characters[:digit:] ! digits[:graph:] ! non-blank (not spaces and control characters)[:lower:] ! lowercase alphabetic characters[:print:] ! any printable characters[:punct:] ! punctuation characters[:space:] ! all whitespace characters (includes [:blank:], newline, carriage return)[:upper:] ! uppercase alphabetic characters[:xdigit:] ! digits allowed in a hexadecimal number (i.e. 0-9, a-f, A-F)

Regex: Additional Modules, 180+ found

POSIX::RegexOO interface for the gnu regex enginePOSIX-Regex-0.89 - 18 Aug 2006 - Paul Miller

Regexp::CommonProvide commonly requested regular expressionsRegexp-Common-2.120 - 15 Mar 2005 - Abigail

Regexp::Common::CCprovide patterns for credit card numbers.Regexp-Common-2.120 - 15 Mar 2005 - Abigail

Regexp::Common::IRCprovide patterns for parsing IRC messagesRegexp-Common-IRC-0.02 - 18 Dec 2005 - Chris Prather

Regexp::Common::URIprovide patterns for URIs.Regexp-Common-2.120 - 15 Mar 2005 - Abigail

Regexp::Common::numberprovide regexes for numbersRegexp-Common-2.120 - 15 Mar 2005 - Abigail

Regexp::Common::profanityprovide regexes for profanityRegexp-Common-2.120 - 15 Mar 2005 - Abigail

Regexp::EnglishPerl module to create regular expressions more verboselyRegexp-English-1.00 - 10 Jul 2005 - chromatic

Regexp::EthiopicRegular Expressions Support for Ethiopic Script.Regexp-Ethiopic-0.15 - 22 Nov 2006

Simple regex

my $line = “aardvark”;

if( $line =~ /aa/ ) { print “has a double aa\n” }if( $line =~ /(a{2})/ ) { print “has double aa\n” }if( $line =~ /(a+)/ ) { print “has 1 or more a\n” }

Matching gene names

# YFL001C YAR102W - yeast ORF names# let-1, unc-7 - worm names

# ENSG000000101 - human Ensembl gene names

while(<IN>) {

if( /^(Y([A-P])(R|L)(\d{3})(W|C)(\-\w)?)/ ) {

printf “yeast gene %s, chrom %d,%s arm, %d %s strand\n”,

$1, (ord($2)-ord(‘A’))+1, $3, $4;

} elsif( /^(ENSG\d+)/ ) { print “human gene $1\n” } elsif( /^(\w{3,4}\-\d+)/ ) { print “worm gene $1\n”; }

Regex GenBank record into FASTA components

my ($anno, $dna) = ($rec =~ /^(LOCUS.*ORIGIN\s*\n)(.*)\/\/\n/s);

LOCUS appears at the beginning of the GenBank record,

followed by any number of characters including newlines

with .*, followed by the string ORIGIN, followed by possibly

some whitespace with \s*, followed by a newline \n.

This matches the annotation part of the GenBank record.

A parser for output from a gene prediction program

Putting it together

GlimmerM (Version 3.0)Sequence name: BAC1Contig11Sequence length: 31797 bp

Predicted genes/exons

Gene Exon Strand Exon Exon Range Exon # # Type Length

1 1 + Initial 13907 13985 79 1 2 + Internal 14117 14594 478 1 3 + Internal 14635 14665 31 1 4 + Internal 14746 15463 718 1 5 + Terminal 15497 15606 110

2 1 + Initial 20662 21143 482 2 2 + Internal 21190 21618 429 2 3 + Terminal 21624 21990 367

3 1 - Single 25351 25485 135

4 1 + Initial 27744 27804 61 4 2 + Internal 27858 27952 95 4 3 + Internal 28091 28576 486 4 4 + Internal 28636 28647 12 4 5 + Internal 28746 28792 47 4 6 + Terminal 28852 28954 103

5 3 - Terminal 29953 30037 85 5 2 - Internal 30152 30235 84 5 1 - Initial 30302 30318 17

while(<>) { if(/^(Glimmer\S*)\s+$(.+)$/ { $method = $1; $version = $2; } elsif( /^(Predicted genes)|(Gene)|(\s+\#)/ || /^\s+$/ ) { next } elsif( # glimmer 3.0 output /^\s+(\d+)\s+ # gene num (\d+)\s+ # exon num ([\+\-])\s+ # strand (\S+)\s+ # exon type (\d+)\s+(\d+) # exon start, end \s+(\d+) # exon length! /ox ) {

my ($genenum,$exonnum,$strand,$type,$start,$end, $len) = ( $1,$2,$3,$4,$5,$6,$7); }}

Putting it together

Day II: assignment.

1. Modify one of your existing programs to do something useful using a Regular Expression. (see the last lab)

2. Read about Perl DBI. (Safari on-line documentation is available.)

3. Read about BioPerl. (Safari and CPAN)

4. Write a paragraph describing what you hope to do with Perl in your BSI project and email it to me. (kunau@umn.edu)

If you remember nothing else

•Biology is hard and messy: better tools will help.

•The key problems are social.

•Together we are smarter than any one of us.

•Technology is easy by comparison.

Questions?

Thank You.

introduction to pr ogramming: perl for biologists · introduction to pr ogramming: perl for...

Documents

wittlich – trier – perl streckenfahrplan wittlich trier...

innovations - biotech-go · in a scripting language, for...

perl for biologists - cornell...

perl for biologists - cornell...

for biologists

unix and perl primer for biologists

notable biologists

perl and r scripting for biologists - wordpress.com · perl...

perl programming for biologists part 2: tue aug 28 th 2007

unix and perl primer for biologists - korf lab

perl for biologists - cornell...

perl for biologists - cornell...

perl - tmtowtdi 宋政隆 perl user. outline what is perl?...

perl for biologists -...

readme - ibm · 2016. 7. 1. · openldap openssh...

computational methods iii: sequence analysis with perl...

unix and perl - korf...

1 why to become a pyologist perl is for plumbers – python...

lane medical library & knowledge management center perl...

perl 4: applied perl - o’reilly...