investigating α7 nicotinic receptor stat3 signaling and ...1743/fulltext.pdfinvestigating 7...
Post on 12-Oct-2020
11 Views
Preview:
TRANSCRIPT
1
Investigating 7 nicotinic receptor STAT3
signaling and cell-dependent expression
Thesis Presented
By
Thomas M. Koperniak
To
The Bouve Graduate School of Health Sciences
in Partial Fulfillment of the Requirements for the
degree of Doctor of Philosophy in Pharmaceutical Sciences
with specialization in
Pharmacology
NORTHEASTERN UNIVERSITY
BOSTON, MASSACHUSETTS
2012
ii
Northeastern University
Bouve Graduate School of Health Sciences
Thesis title: Investigating 7 nicotinic receptor STAT3 signaling and cell-dependent
expression
Author: Thomas M. Koperniak
Program: Department of Pharmaceutical Sciences
This project satisfies all research requirements for the Doctoral Degree
Thesis Committee (Chairman) ___________________________Date________
___________________________Date________
___________________________Date________
___________________________Date________
___________________________Date________
Director of Graduate School ___________________________Date________
Dean ___________________________Date________
Copy Deposited at Library ___________________________Date________
iii
Northeastern University
Bouve Graduate School of Health Sciences
Thesis title: Investigating 7 nicotinic receptor STAT3 signaling and cell-dependent
expression
Author: Thomas M. Koperniak
Program: Department of Pharmaceutical Sciences
This project satisfies all research requirements for the Doctoral Degree
Thesis Committee (Chairman) ___________________________Date________
___________________________Date________
___________________________Date________
___________________________Date________
___________________________Date________
Director of Graduate School ___________________________Date________
Dean ___________________________Date________
Copy Deposited at Library ___________________________Date________
iv
LIST OF ABBREVIATIONS
5HT Serotonin
AA Arachidonic acid
BGT -Bungarotoxin
AC Adenylate cyclase
AChBP Acetylcholine binding protein
ACh Acetylcholine
AD Alzheimer’s disease
ADP Adenosine diphosphate
ADSS Aged and diluted sidestream smoke
ANOVA Analysis of variation
AS Antisense
ATP Adenosine triphosphate
BAPTA-AM Bis(2-aminophenoxyl)ethane tetraacetic acid
BATH-42 BTB-associated Traf homology 42
BiP Binding immunoglobulin protein
BLAST Basic Local Alignment Search Tool
bp Base pairs
BSA Bovine serum albumin
CA Constitutively active
cAMP Cyclic adenosine monophosphate
CC Coiled-coil domain
cDNA Complementary DNA
CMV Cytomegalovirus
CNS Central nervous system
CREB cAMP response element-binding
CTZ Coelenterazine
DA Dopamine
DHE Dihydro-beta-erythroidine
DHS Donor horse serum
DMEM Dulbecco’s modified Eagle’s medium
DMSO Dimethyl sulfoxide
DN Dominant negative
dsRNA Double stranded RNA
EGFP Enhanced green fluorescent protein
EGFR Epidermal growth factor receptor
EGTA Ethylene glycol tetraacetic acid
ELISA Enzyme-linked immunosorbent assay
ER Endoplasmic reticulum
ERK Extracellular signal-regulated kinase
FBS Fetal bovine serum
FDA Food and Drug Administration
FGF2 Fibroblast growth factor 2
GABA Gamma-aminobutyric acid
GAPDH Glyceraldehyde phosphate dehydrogenase
GFP Green fluorescent protein
v
Glu Glutamate
HBSS Hank’s balanced salt solution
HEK Human embryonic kidney
hRic3 Human Ric3
HRP Horseradish peroxidase
Hsp90 Heat shock protein 90
IBD Inflammatory bowel disease
IDT Integrated DNA Technologies
IL6 Interleukin 6
IP Intraperitoneal
IP3 Inositol phosphate 3
JAK2 Janus kinase 2
KC Keratinocyte
LBD Ligand binding domain
LD-PCR Long distance-polymerase chain reaction
LPS Lipopolysaccharide
MAPK Mitogen-activated protein kinase
MIP2 Macrophage inflammatory protein 2
ML Metridia luciferase
MLA Methyllycaconitine
Mnmc Manumycin A
mRic3 Mouse Ric3
mRNA Messenger RNA
mTOR Mammalian target of rapamycin
NAc Nucleus accumbens
nAChR Nicotinic acetylcholine receptor
NBM Nucleus basilis of Meynert
NFB Nuclear factor kappa B
NMDA N-Methyl-D-aspartate
NMJ Neuromuscular junction
NNK Nicotine-derived nitrosamine ketone
NNN N'-nitrosonornicotine
NNR Neuronal nicotinic receptor
nSCLC Non-small cell lung cancer
p Probability
P9KB pREP9-kanamycin-blasticidin
P9KG pREP9-kanamycin-geneticin
PBS Phosphate buffered saline
PJAK2 Phosphorylated JAK2
PI3K Phosphoinositol-3 kinase
PKA Protein kinase A
PLC Phospholipase C
PM Plasma membrane
PMSF Phenylmethylsulfonyl fluoride
PNS Peripheral nervous system
PPT Pedunculo-pontine nucleus
vi
PSTAT3 Phosphorylated STAT3
RFP Red fluorescent protein
Ric3 Resistance to inhibitors of cholinesterase-3
RIPA Radio-immunoprecipitation assay
RISC RNAi-induced silencing complex
RNAi RNA interference
ROS Reactive oxygen species
RT Reverse transcriptase
S-rRic3 Serine (absent) rat Ric3
S+rRic3 Serine (present) rat Ric3
SCLC Small cell lung cancer
sdrRic3 Splice-deleted rat Ric3
SEAP Secreted alkaline phosphatase
SEM Standard error of the mean
shRNA Short hairpin RNA
siRNA Small interfering RNA
SMART Switching mechanism at 5’ end of RNA template
SN/SNc Substantia nigra
SOCS3 Suppressor of cytokine signaling 3
SS Signal sequence
STAT3 Signal transducer and activator of transcription-3
STR Striatum
TBS Tris buffered saline
TBS-T Tris buffered saline-Triton
THAL Thalamus
TLR Toll-like receptor
TM Transmembrane domain
TNF Tumor necrosis factor
Tyk Tyrosine kinase
UNC-50 Uncoordinated-like protein 50
UT Untransfected
US United States
Vegf Vascular endothelial growth factor
VGCC Voltage-gated calcium channel
VTA Ventral tegmental area
WT Wild-type
XIAP X-linked inhibitor of apoptosis protein
vii
ABSTRACT
Nicotinic acetylcholine receptors (nAChRs) are pentameric ligand-gated ion channels
consisting of a combination of at least 17 possible subunits. Although most receptor subtypes
are heteromeric, 7 subunits can assemble into homomeric receptors. 7 nicotinic receptors are
the 2nd
most highly expressed nicotinic receptor in the brain, and their high permeability to
calcium ions allows participation in calcium-dependent processes such as neurotransmitter
release and immune modulation. Although these receptors have been well-studied, 7-mediated
STAT3 signaling and 7 maturation remain unclear. The two major hypotheses we are
investigating stem from these issues. The first hypothesis, regarding 7-mediated STAT3
activation, is that 7 drives STAT3 signaling independently of calcium ion flow. The second
hypothesis, regarding 7 maturation, is that rat pituitary-derived GH4C1 cells possess Resistance
to Inhibitors of Cholinesterase 3 (Ric3) to allow surface 7 expression.
The major advancement of this project is the development of a novel STAT3-Metridia
luciferase (ML) signaling assay using heterologous expression systems. To our knowledge, this
is the only study using heterologous expression systems to investigate such signaling. To study
7-mediated STAT3 signaling, human neuroblastoma-derived SHEP1 or GH4C1 cells co-
expressing7 and STAT3-ML were exposed to nicotine following pretreatment with the 7
antagonist, -bungarotoxin (BGT), JAK/STAT inhibitors, the PKA inhibitor, PKI 14-22 amide,
calcium chelators, or calcium-low media. Results suggest 7-mediated STAT3 signaling can
take place independently of calcium influx. Since 7 maturation is a prerequisite for obtaining
7-mediated STAT3 signaling, the STAT3-ML assay provided insight into 7 receptor
maturation and motivated investigation into cell-dependency of Ric3 transfection for surface 7
expression.
viii
Two isoforms of rat Ric3 were cloned from rat brain and designated S-rRic3 and
S+rRic3. S-rRic3 differs from S+rRic3 by three bases due to the absence of a serine residue at
position 173 relative to S+rRic3. Our project addressed the functionality of these while
exploring the possibility of currently unidentified 7 chaperones. Initial 125
I-bungarotoxin
binding assays supported our original hypothesis that GH4C1 cells possess Ric3 to allow surface
7 expression. However, RNAi studies performed alongside dot blot analysis using Ric3
antibodies supported an alternative hypothesis that GH4C1 cells possess 7 chaperones aside
from the currently known functional Ric3 splice variants. To screen for additional chaperones in
GH4C1 cell cDNA, a variation of our novel STAT3-ML assay may be useful. By replacing the
Metrdia luciferase reporter with a gene conferring antibiotic resistance, a STAT3 rescue vector
can be generated and allow isolation of cells expressing unknown 7 chaperones.
ix
Table of Contents Page
List of Abbreviations…………………………………………………………………………… -iv-
Abstract………………………………………………………………………………………….. -vii-
List of Tables………………………………………………………..........................………....... -xi-
List of Figures………………………………………………………………………….……… -xii-
Acknowledgments……………………………………………………………………..……....... -xvi-
Introduction Statement of Problem…………...……………………………………..………….. -1-
Review of the Literature……………………………………...……………………..………….. -7-
A. Nicotinic acetylcholine receptors……………..…………………………………………. -7-
B. 7 nicotinic receptor transcript distribution……………………………………………... -11-
C. Calcium permeability of 7 nicotinic receptors…………………………………………. -12-
D. 7 nicotinic receptors in Alzheimer’s disease…………………………………………… -14-
E. 7 nicotinic receptors in oxidative stress………………………………………………... -18-
F. 7 nicotinic receptors in schizophrenia………………………………………………….. -19-
G. 7 nicotinic receptors in smoking addiction and withdrawal……………………………. -21-
7 nicotinic receptors in cancer………………………………………………………….. -25-
7 nicotinic receptors in anti-inflammation……………………………………………... -28-
J. 7-mediated JAK-STAT signaling …………………………………………………........ -33-
Multiple modes of 7 nicotinic receptor signaling………………………………………. -39-
L. and 42 receptors activate the STAT pathway independently of calcium ion flow.. -41-
M. 7-mediated signaling assay provides insight into cell line-dependency of 7
maturation……………………………………………………………………………….. -45-
N. 7 nicotinic receptor maturation is a process that remains unclear……………………… -46-
O. Ric3 has differential effects on expression of numerous receptors…………………........ -48-
P. Ric3 increases expression of 7 nicotinic receptors……………………………………... -50-
Q. Ric3 mechanism of action and regions of interest……………………………………….. -52-
R. 7 nicotinic receptor expression without Ric3…………………………………………... -57-
S. Exploring the consequences of Ric3 protein knockdown on surface 7 expression……. -59-
Specific AIMS of the thesis…………………………………………………………………….. -62-
Materials and Methods………………………………………………………………………… -64-
Cell culture and transfections……..………………………………………………….………. -64-
Chemicals and plasmids……………………………………………………………..………... -65-
x
Ric3 clones……………………………………………………………………………………. -65-
Radioligand binding………………………………………………………………………….. -66-
Dot blot analysis…………………………………………………………………….………... -66-
NFB and STAT3 reporter assays…………………………………………..…….………….. -67-
Data analysis………………………………………………………………………………….. -68-
Results………………………………………………………………………………………........ -69-
Specific AIM #1……………………………………………………………………………… -69-
Aim 1a) Investigate feasibility of using STAT3-MetLuc signaling assay………………………. -69-
Aim 1b) Validate STAT3-ML signaling assay by measuring IL6-driven signaling of secreted
alkaline phosphatase and luciferase in Invivogen’s HEK-Blue IL6 cells. ……………………… -71-
Aim 1c) Determine ideal conditions for nicotine-induced increases in 7-driven luciferase
expression and establish whether increased luciferase expression is STAT3-attributable………. -75-
Aim 1d) Construct cell lines expressing both 7 and STAT3-driven luciferase plasmids and re-
assess ideal conditions for nicotine-induced increases in 7-driven luciferase expression.........
-81-
Aim 1e) Use STAT3-MetLuc assay to study Ca2+
-dependency of 7-mediated STAT3
signaling ………………………………………………………………………………………... -84-
Aim 1f) Investigate the role of Ric3 in allowing 7-driven STAT3 signaling in non-permissive
cell lines…………………………………………………………………………......................... -88-
Specific AIM #2…………………………………………………………………………....... -90-
Aim 2a) Clone rat Ric3 and investigate functionality of protein………………………………… -90-
Aim 2b) Establish selectivity of Ric3 antibodies and demonstrate cell line-dependency of Ric3
transfection for surface 7 expression………………………………………………………….. -92-
Aim 2c) Test whether RNAi methods that block surface 7 expression in non-permissive cells
fails to block expression in permissive GH4C1 cells…………………………………………… -96-
Aim 2d) Obtain shRNA constructs to investigate alternative splicing, and study Ric3 protein
turnover by determining effects of Ric3 knockdown on 7 expression in cell lines stably
expressing Ric3…………………………………………………………………………………..
-104-
Specific AIM #3……………………………………………………………………………… -119-
Searching for unknown 7 chaperones in GH4C1 cDNA: Expression cloning using the
SMARTer (Switching Mechanism at 5’ end of RNA Template) In-Fusion Cloning Kit
(Clontech)…………………………………………………………………………………………
-120-
Aim 3a) Establish method of plasmid recovery by showing recovery of S ic3/pREP4/hygromycin…………………………………………………………………………..
-123-
Aim 3b) Construct S-rRic3/pREP9/KG using In-Fusion cloning kit (Clontech) and recover
plasmid………………………………………………………………………………………….. -125-
Discussion………………………………………………………………………………………. -127-
Future Directions……………………..………………………………………………...…........ -137-
Conclusions……………………………………………………………………………..………. -141-
References……………………………………………………………………………….…….... -144-
xi
List of Tables
Table Page
1. 7 receptor compounds in clinical development for central nervous
system disorders…………………………………………………………… -24-
2. Examples of conditions in which cholinergic modulation influences
disease state……………………………………………………………….. -31-
3. Ric3 distribution and labeling intensity in rat CNS……………………….. -58-
xii
List of Figures
Figure Page
1. Nicotinic acetylcholine receptor subunit composition…………………………………… -7-
2. Basic structure of nicotinic receptors…………………………………………………..... -8-
3. Lining of the nicotinic receptor pore…………………………………………………….. -9-
4. Proposed model for nicotinic receptor gating mechanism…………………………….... -10-
5. Distribution of 7 transcripts in rat brain………………………………………………... -11-
6. Nicotine-induced currents in the absence or presence of chloride channel blockers……. -12-
7. Nicotine-induced currents show two components when the Na+ and Cl
- reversals are
separated……………………………………………………………………………….... -13-
8. Calcium responses in astrocytes following nicotinic receptor activation ………………. -14-
9. Dependence of the ACh response on extracellular calcium…………………………….. -15-
10. 125I-BGT binding to 7SK-N-MC membranes is blocked by -amyloid filaments….. -16-
11. A1-42 blocks hippocampal 7 noncompetitively……………………………………….. -17-
12. Hypothesized locations and function of CNS 7 receptors in schizophrenia. ………… -20-
13. Antagonism of 7 in the NAc shell increases motivation to self-administer nicotine… -22-
14. 7 activation in the NAc shell decreases motivation to self-administer nicotine……… -23-
15. The diverse functions of 7 and 42………………………………………………….. -26-
16. Nicotinic receptors in non-small cell lung cancer (nSCLC) cells……………………… -27-
17. Cholinergic agonists inhibit LPS-induced TNF synthesis in human macrophages……. -29-
18. In human macrophages ACh inhibits release of pro-inflammatory but not anti-
inflammatory cytokine release…………………………………………………………… -29-
19. A proposed mechanism of inhibition of cytokine release mediated by 7……………… -31-
20. Two signaling pathways of 7…………………………………………………………… -32-
21. Antisense oligonucleotides against 7 prevent nicotine-induced reduction in LPS-
stimulated TNF release…………………………………………………………………... -34-
22. Increased cytokine production in 7-deficient mice during endotoxaemia…………….. -35-
23. Nicotine increases STAT3 phosphorylation and SOCS3 expression……………………. -36-
24. STAT3 phosphorylation by nicotine is prevented by 7-selective nAChR antagonists.. -37-
25. Nicotine-induced STAT3 phosphorylation occurs through activation of JAK2 that is
recruited to the 7……………………………………………………………………….. -38-
26. Alterations in STAT3 expression in KCs exposed to nicotine………………………….. -39-
27. JAK2 inhibition restores LPS-induced NFB signaling in nicotine-treated h42
SHEP1 cells……………………………………………………………………………… -41-
28. STAT3 inhibition restores LPS-induced NFB signaling in nicotine-treated h42
SHEP1 cells……………………………………………………………………………… -42-
xiii
29. 42-mediated inhibition of LPS-induced IBphosphorylation may be calcium-
independent …………………………………………………………………………….. -43-
30. 7-mediated anti-inflammation involves two modes of signaling……………………… -44-
31. Presence of 7 mRNA in all infected cell lines…………………………………………. -45-
32. Cell line-dependent expression of mature 7 receptors…………………………………. -46-
33. Ric3 effects on expression of 5HT3 and glycine receptors………………………………. -49-
34. Differential effects of hRic3 on expression of various nicotinic receptors………………. -50-
35. Effect of hRic3 on 7 receptor membrane insertion…………………………………….. -51-
36. Effect of hRic3 on 7 receptor turnover…………………………………………………. -51-
37. Whole cell currents in oocytes co-expressing 7 and hRic3…………………………...... -52-
38. Co-expression of 7 and hRic3 in Xenopus oocytes…………………………………….. -52-
39. Two proposed models of Ric3 structure…………………………………………………. -53-
40. Residues 1-168 comprise the minimal functional domain of mRic3…………………..... -55-
41. The coiled-coil domain is essential for self-association of mRic3………………………. -56-
42. Analysis of Ric3 transcript localization and 125
IBGT binding. ……………………….. -59-
43. Mechanism of RNA interference in mammalian systems……………………………….. -60-
44. LPS-induced increase in NFB production is mediated by 7 in SHEP1 and GH4C1
cells………………………………………………………………………………………. -70-
45. Construction of STAT3-MetLuc reporter plasmid………………………………………. -71-
46. In HEK-Blue IL6 cells, IL6 stimulation of the STAT3 pathway leads to SEAP
expression………………………………………………………………………………… -72-
47. HEK-Blue IL6 cells treated with IL6 show dose-dependent increase in SEAP
expression ………………………………………………………………………………... -72-
48. IL6 exposure to HEK-Blue IL6 cells transfected with STAT3-ML increases luciferase
expression.……………………………………………………………………………….. -73-
49. IL6 exposure to HEK-Blue IL6 cells produces similar increases in SEAP and luciferase
expression ……………………………………………………………………..………… -74-
50. Nicotine dose-response curve in SHEP1 cells transfected with STAT3-ML……………. -76-
51. Nicotine time course for driving luciferase expression in SHEP1 cells………………..... -77-
52. BGT pretreatment blocks 7-mediated luciferase expression………………………… -78-
53. JAK2 inhibition reduced nicotine-dependent luciferase expression……………………. -79-
54. STAT3 inhibition reduces nicotine-dependent luciferase expression………………….. -80-
55. Nicotine dose-response in SHEP1 cells previously transfected with 7, Ric3, and
STAT3-ML-P9KB………………………………………………………………………. -82-
56. Nicotine time course in STAT3-ML-P9KB SHEP1 cells……………………………….. -82-
57. Inhibitors decrease both SEAP and MetLuc expression………………………………… -83-
58. BAPTA-AM fails to lower nicotine-induced luciferase expression in SHEP1 cells -85-
xiv
previously transfected with 7, Ric3, and STAT3-ML-P9KB………………………….. 59. BAPTA-AM and EGTA fail to lower nicotine-induced luciferase expression in SHEP1
cells previously transfected with 7, Ric3, and STAT3-ML-P9KB……………………. -86-
60. Nicotine-induced luciferase expression in SHEP1 cells previously transfected with 7,
Ric3, and STAT3-ML-P9KB persists in a low-calcium environment………………….. -87-
61. Nicotine-induced luciferase expression in SHEP1 cells previously transfected with 7,
Ric3, and STAT3-ML-P9KB persists with PKA inhibition.…………………………….. -88-
62. Ric3 transfection is required for 7-mediated STAT3 signaling in SHEP1 cells……..... -89-
63. Ric3 transfection is not required for 7-mediated STAT3 signaling in GH4C1 cells….. -90-
64. Rat Ric3 open reading frame and translated protein…………………………………….. -91-
65. S- and S+rRic3 allow surface 7 expression in HEK cells…………………………….. -92-
66. Rat Ric3 isoforms promote surface expression of 7 in SHEP1 cells………………….. -93-
67. Ric3 transfection is not required for surface 7 expression in GH4C1 cells………….... -94-
68. Santa Cruz Ric3 antibodies are dependent on protein conformation but can be used for
dot blots………………………………………………………………………………….. -95-
69. Rat/human Ric3 siRNA sequence synthesized by IDT…………………………………. -97-
70. Ric3 siRNA treatment lowers surface 7 expression in HEK293 cells………………… -98-
71. Ric3 siRNA treatment lowers surface 7 expression in SHEP1 cells………………….. -98-
72. Ric3 siRNA treatment does not reduce surface 7 expression in GH4C1 cells………… -99-
73. Ric3 siRNA partially reduced 7 expression in SHEP1 cell semi-stably expressing S-
rRic3……………………………………………………………………………………… -99-
74. GH4C1, but not SHEP1, cells generate surface 7 receptors in the absence of Ric3
protein…………….………….………….………….………….………….……………… -101-
75. Ric3 siRNA reduces levels of human and splice-deleted rat Ric3 protein upon
transfection in SHEP1 and GH4C1 cells………………………………………………… -102-
76. Ric3 knockdown in GH4C1 cells does not affect surface 7 expression………………. -103-
77. HuSH 29mer shRNA constructs against rat Ric3 obtained from Origene……………..... -104-
78. Rat Ric3 shRNA against exon 5 and 6 reduces S-rRic3 protein while decreasing surface
7 expression in SHEP1 cells co-transfected with 7 and S-rRic3…………….….……. -105-
79. Rat Ric3 shRNA against exon 5 and 6 together reduce S-rRic3 while decreasing surface
7 expression in SHEP1 cells transfected with 7/S-rRic3…………………….….…… -106-
80. Scrambled shRNA does not reduce surface 7 expression nor decrease Ric3 protein
levels in SHEP1 cells co-transfected with 7 and S-rRic3 or hRic3…………………….
-107-
81. Rat Ric3 shRNA against exon 5 reduces rat Ric3 protein levels while not having an
effect on surface 7 expression…………………………………………………………. -108-
82. Semi-stably transfected 7 GH4C1 cells and 7/S-rRic3 GH4C1 cells generate surface
7 receptors while only semi-stably transfected S-rRic3 GH4C1 and 7/S-rCRic3
GH4C1 cells possess detectable levels of Ric3 protein………………………..............
-110-
83. Semi-stably transfected 7/S-rRic3 SHEP1 cells generate surface 7 receptors and
possess detectable levels of S-rRic3 protein…………………………………………….. -110-
84. Semi-stable shRNA transfection decreases surface 7 expression and Ric3 in SHEP1
cells previously semi-stably transfected with 7 and S-rRic3 together………………...
-111-
xv
85. Semi-stable shRNA transfection decreases Ric3 protein but not surface 7 expression in GH4C1 cells previously semi-stably transfected with 7/S-rRic3…………………..
-112-
86. shRNA construct against rat Ric3 exon 2…………………………………………...…… -113-
87. shRNA against rat Ric3 exon 2 diminishes surface 7 expression in SHEP1 cells …..... -113-
88. shRNA against rat Ric3 exon 2 reduces surface 7 expression in SHEP1 cells
transfected with either isoform of rat Ric3………………………………………………. -114-
89. shRNA exon lowers Ric3 protein and 7 expression in SHEP1 cells while having no
effect on hRic3 protein or hRic3-facilitated 7 expression……………………………...
-115-
90. 7 expression persists in GH4C1 cells transfected with shRNA exon 2……………….. -115-
91. In GH4C1 cells, surface 7 expression persists following Ric3 knockdown via shRNA
against exon 2……………………………………………………………………………. -116-
92. S+rRic3 protein levels are lowered by rat Ric3 targeting exon 2……………………….. -117-
93. shRNA against rat exon 6 blocks rat Ric3-induced surface 7 expression in SHEP1
cells.…………………………………………………………………..…………………………… -117-
94. Summary of RNAi studies investigating Ric3 transfection dependency for surface 7
expression. ……………………………………………………………………………….. -118-
95. pREP9 vector…………………………………………………………………………….. -120-
96. SMARTer V Oligo allows selective amplification to yield pure cDNA………………… -121-
97. In-Fusion SMARTer cDNA library construction kit overall procedure………………… -122-
98. Proof-of-concept: During overnight incubation, colonies grew only on plates on which
bacteria transformed with S-rRic3/pREP4/KG was spread……………………………... -124-
99. Proof-of-concept: Agarose gels of Ric3/pREP4 cut with KpnI and XhoI…………….... -124-
100. Proof-of-concept: During overnight incubation, colonies grew only on plates on which
bacteria transformed with S+rRic3/pREP9/KG was spread…………………………….. -125-
101. Proof-of-concept: Agarose gels of Ric3/pREP4 cut with HindIII and XbaI……………. -126-
xvi
ACKNOWLEDGMENTS
This project would not have been possible without guidance and support from several people
who graciously extended their expertise and effort in preparation and completion of this
dissertation. First and foremost, I would like to thank my advisor, Dr. Ralph Loring, for his
continuous support, patience, and hard work throughout the research and writing of this project.
Besides my advisor, I would like to thank the rest of my thesis committee: Dr. Richard Deth, Dr.
John Gatley, Dr. Nina Irwin, and Dr. Wendy Smith for their encouragement and valuable insight.
I would like to thank my friends and family for their love and support.
I gratefully acknowledge financial support from a 2009-2010 American Foundation for
Pharmaceutical Education (AFPE) pre-doctoral fellowship.
1
INTRODUCTION
Statement of the problem:
Nicotinic acetylcholine receptors (nAChRs) are members of the Cys-loop family of
neurotransmitter-gated ion channels. Although most nAChRs are heteromeric, 7, 8, and 9
subunits can assemble into homomeric channels (Millar, 2003). The 7 receptor, for which -
bungarotoxin (BGT) is a specific and high-affinity antagonist, is one of the most abundant
receptor subtypes in the mammalian brain (Dominguez del Toro et al., 1994). It has high Ca2+
permeability (Seguela et al., 1993), and is involved in activation of Ca2+
-dependent processes
such as neurotransmitter release, signal transduction, apoptosis, and immune modulation. 7 has
been an appealing target in drug discovery, as it may play roles in Alzheimer’s disease,
schizophrenia, smoking addiction, Parkinson’s disease, and conditions involving inflammation
(Freedman et al., 1994; Lindstrom, 1997; Lloyd and Williams, 2000). Our understanding of the
link between 7 and inflammation, in particular, has steadily advanced with ongoing research.
Borovikova et al. (2000) described a process called the “cholinergic anti-inflammatory
pathway” by which production of several cytokines, including tumor necrosis factor (TNF), is
decreased by activation of cholinergic receptors on macrophages. The identity of the receptors
involved in this pathway was studied in 2003 when Tracey et al. demonstrated that knockdown
of 7, but not 1 or 10, using antisense oligonucleotides makes macrophages less responsive to
nicotine-induced reductions in lipopolysaccharide (LPS)-stimulated TNF release (Tracey et al.,
2003). Although this implicated a specific receptor in the cholinergic anti-inflammatory
pathway, the signaling mechanism accounting for the ability of receptor activation to reduce
cytokine production remained uncertain. In 2005, De Jonge et al. evaluated the involvement of
the transcription factor STAT3 and demonstrated that nicotinic activation of 7 produces anti-
inflammatory effects in peritoneal macrophages through JAK2-STAT3 signaling. In 2006,
2
Arredondo et al. used pathway inhibitors to provide evidence supporting that nicotinic activation
of 7 drives STAT3 upregulation through the Ras/Raf/MEK/ERK pathway. In 2012, Andersson
and Tracey hypothesized that the cholinergic anti-inflammatory response involves activation of
adenylate cyclase and protein kinase A. The downstream signaling mechanisms contributing to
7-mediated immune modulation remain unclear, and investigations into these mechanisms
should consider the multiple signaling modes of 7 receptors.
7 signals through two distinct pathways. The first pathway, involving cationic flow
through activated ligand-gated channels, is a well-known event. Binding of agonists such as
nicotine or acetylcholine results in conformational changes that allow the flow of positively
charged ions down their electrical gradient. The resulting inward currents trigger depolarization
that is essential for neurotransmitter release and other cellular responses. An interesting feature
of 7 receptors is the rapid desensitization that occurs upon agonist exposure. Despite
continuous agonist application, 7 desensitization prevents further ion flow. Perhaps rapid 7
desensitization serves as protection against neurotoxicity, owing to the high calcium permeability
of the receptor (Seguela et al., 1993). Although ion influx is a very transient event, 7
participates in an additional mode of signaling that is longer-lasting.
A second, lesser-studied mode of 7 signaling involves JAK2 recruitment to activated
receptors and subsequent STAT3 phosphorylation and activation. STAT3 signaling leads to
modulation of genes involved in cell proliferation, apoptosis, and cytokine production (Johnston
and Grandis, 2011). While it is well-established that Ca2+
influx triggers many downstream
signaling events, it remains unclear whether 7-mediated STAT3 signaling can take place
without such ion flow. We are investigating the hypothesis that 7 drives STAT3 signaling
independently of calcium. This hypothesis is supported by several findings. Suzuki et al. (2006)
3
demonstrated that in rat microglia, nicotinic activation of 7 leads to an increase in intracellular
calcium that can take place independently of extracellular calcium levels and can be blocked by
inhibition of Ca2+
release from intracellular stores. This suggested that 7 can drive signaling
involving Ca2+
release from intracellular stores rather than ion flow through open receptors.
Furthermore, Hosur and Loring (2011) showed that in SHEP1 cells expressing 42 nicotinic
receptors, calcium chelation failed to block the effect of nicotine on LPS-induced NFB activity.
However, JAK/STAT inhibition did block the effect of nicotine on LPS-induced NFB activity,
suggesting that the JAK-STAT pathway may play a role in 42-mediated anti-inflammation
independently of calcium (Hosur and Loring, 2011).
A primary objective of this project was to create a novel 7-mediated STAT3-Metridia
luciferase (ML) signaling assay for investigating calcium dependency of 7-mediated STAT3
signaling. By using this assay in human neuroblastoma-derived SHEP1 cells and rat pituitary-
derived GH4C1 cells, we tested the hypothesis that 7-mediated STAT3 signaling can proceed
independently of calcium ion flow. Unlike 7 antagonism and JAK/STAT inhibition, calcium
chelation and maintenance in calcium-low media failed to reduce nicotine-induced luciferase
expression, supporting our hypothesis that 7 mediates STAT3 signaling without calcium ion
flow. Since 7 receptor maturation is a prerequisite for 7-mediated STAT3 signaling, studies
investigating the interplay between calcium influx and STAT3 signaling provided insight into
cell-dependency of 7 maturation, in particular, of the requirement of Resistance to Inhibitors of
Cholinesterase 3 (Ric3) transfection for surface receptor expression. Obtaining a greater
understanding of the mechanistic details allowing receptor expression would have several
important implications in drug discovery.
4
Although there have been reports of surface 7 expression in some mammalian cell lines
(Valles et al., 2009; Williams et al., 2005), surface receptor expression remains a challenge in
several cell types (Sweileh et al., 2000). Achieving functional expression on the surface of the
cell would aid in the development of novel therapies designed to selectively target 7 receptors.
Strategies aimed at increasing the number of surface receptors have included alteration of cell
culture conditions, generation of 7/5HT3 chimeras, and site-directed mutagenesis. These have
resulted in only modest increases in the number of functional receptors or the generation of non-
native receptors, neither of which are ideal for effective drug discovery efforts. Therefore, there
is continued interest in identifying cellular factors allowing expression of functional 7
receptors. Although the mechanisms regulating the localization of 7 to the postsynaptic
membrane have been fairly well-studied (Sanes and Lichtman, 2001), there is much to learn
about regulation of 7 assembly and surface expression. Our initial hypothesis was that GH4C1
cells already possess Ric3 to allow surface receptor expression.
Ric3 was discovered in 1995 during a genetic screen in C. elegans (Nguyen et al., 1995).
Follow-up studies showed that this protein is needed for the maturation of multiple nicotinic
receptor subtypes in C. elegans and oocytes (Halevi et al., 2002). The most notable effect of the
chaperone was found to be its promotion of surface 7 expression in otherwise non-permissive
cells. In several mammalian cell lines, co-expression of 7 with Ric3 facilitates appropriate
folding and functional expression of the receptor (Valles et al., 2009; Williams et al., 2005).
Two isoforms of rat Ric3 were cloned and termed S-rRic3 and S+rRic3. S-rRic3 differs from
S+rRic3 by three bases due to the absence of a serine residue present in S+rRic3. Initial 125
I-
bungarotoxin binding assays demonstrated the functionality of both isoforms and supported our
hypothesis that GH4C1 cells possess Ric3 to allow surface 7 expression. We next investigated
5
whether this discrepancy is due to the presence of endogenous Ric3 in GH4C1 cells or the
promotion of surface expression by unknown 7 chaperones present in this cell line.
To study the necessity of Ric3 transfection for 7 expression, RNAi constructs were
designed against Ric3. Cell line-dependent consequences of Ric3 knockdown justify a search for
novel 7 chaperones in GH4C1 cell cDNA, and we believe a variation of our STAT3 signaling
assay can be useful in searching for such factors. While STAT3-driven luciferase expression
allowed evaluation of 7-mediated STAT3 signaling, an assay utilizing STAT3-driven antibiotic
resistance may facilitate isolation of cells expressing the unknown chaperone. Proof-of-concept
studies involving recovery of transfected cDNA from mammalian cell lines were performed to
test the hypothesis that a variation of the STAT3 reporter assay will be useful for identifying
novel receptor chaperones.
In summary, we tested three hypotheses in this project. The first hypothesis was that 7-
mediated STAT3 signaling takes place independently from calcium ion flow. This hypothesis
rests upon evidence that IL6 receptors can initiate JAK2-STAT3 signaling without calcium
influx, 42 nicotinic receptors can mediate STAT3-driven anti-inflammatory responses without
calcium ion flow (Hosur and Loring, 2011), and 7 receptors activate PLC without ion influx
(Suzuki et al., 2006). Testing this hypothesis provided evidence supporting an additional
hypothesis regarding a separate topic related to 7 receptors. Our second hypothesis was
originally that GH4C1 cells possess an abundance of Ric3 allowing receptor expression. Upon
further investigation, an alternative hypothesis put forward was that GH4C1 cells possess
unknown 7 chaperones aside from the known functional Ric3 splice variants. This alternative
hypothesis is supported by evidence of surface receptors localized in brain regions lacking Ric3
6
mRNA (Halevi et al., 2003). Finally, our third hypothesis is that a variation of the STAT3
signaling assay can serve as a tool in the search for novel 7 chaperones in GH4C1 cell cDNA.
7
I. REVIEW OF THE LITERATURE:
A. Nicotinic acetylcholine receptors:
Nicotinic acetylcholine receptors (nAChRs) are ligand-gated ion channels belonging to
the Cys-loop receptor superfamily. Other members of this family include 5HT3, glycine, and
GABAA receptors. Nicotinic receptors, like other members, are composed of five subunits,
forming a barrel-like transmembrane structure around an aqueous pore permeable to cations.
Each subunit crosses the membrane four times and has a large N-terminal extracellular domain
with a large intracellular loop between the third and fourth membrane-spanning domains.
Receptors can be generated from a wide variety of subunits, and their subunit composition
dictates their pharmacological properties (Millar, 2003). In vertebrates, the assortment of
subunits includes at least 17 types (1-10, 1-4, , , ). Of these, five (1, 1, , , ) can be
found at the neuromuscular junction (NMJ), while the remaining are localized within the central
and peripheral nervous system (Lindstrom, 1997). The neuronal nicotinic receptor subunits (2-
10, 2-4) combine in various ways to form many receptor subtypes (Millar, 2003). The two
main nicotinic acetylcholine receptors found in the brain of vertebrates are 42 and 7 (Herber
et al., 2004). The general subunit composition of these receptors is depicted in Figure 1 (De
Jonge and Ulloa, 2007).
Figure 1: Nicotinic acetylcholine receptor
subunit composition. Receptors may be
composed from a variety of subunits forming
homopentameric receptors, such as 7 receptors
(left), or heteropentameric receptors, such as 42
receptors (right). These possess different
pharmacological characteristics. For example,
-bungarotoxin (BGT) blocks 7 receptors, but
not 42 receptors. Also, nicotine shows low
affinity for 7 receptors and high affinity for
42 receptors (De Jonge and Ulloa, 2007).
8
The high density of nicotinic receptors in the Torpedo electric ray has helped to improve our
understanding of these receptors through the use of electron diffraction analysis. X-ray
crystallography of the snail-derived acetylcholine-binding protein (AChBP) gives even more
detailed information about the structurally similar nicotinic receptor extracellular region (Brejc et
al., 2001; Celie et al., 2005; Hansen et al., 2005). Each nicotinic receptor subunit has four
transmembrane domains in which N- and C-termini are believed to be located outside the cell
(Figure 2). Each subunit has a large N-terminal domain, a variable cytoplasmic domain, and 2 or
5 ligand-binding domains (LBDs) depending on receptor subtype. The transmembrane
conduction channel stretches approximately 160 Å and includes a 20 Å-long ligand-binding
domain. Each subunit in the LBD is organized around two beta-sheets connected by a disulfide
bond forming part of the Cys-loop characteristic of nicotinic receptors (Sharma and
Vijayaraghavan, 2008; Miyazawa et al., 2003).
Figure 2: Basic structure of nicotinic receptors. A) Nicotinic receptor subunits have four
transmembrane domains, with both N- and C-tails located extracellularly. B) Nicotinic receptor
model. The large N-terminal region forms much of the extracellular portion of the receptor. The
distance between residues lining the channel pore narrows deeper within the membrane. The
narrowest point in the pore is lined by a ring of leucine residues, later followed by the
intracellular region. Ligand-binding domains are represented as ovals. PM, plasma membrane
(Sharma and Vijayaraghavan, 2008).
A B
9
The second membrane-spanning domain, M2, lines the lumen of the ion channel. The M2
helices along this pathway extend 40 Å and are slightly kinked at Leu-251 and Pro-265 residues
(Figure 3). M2 helices traverse the cell membrane with similar amino acids at each level so that
distinct rings facing the lumen of the pore are formed (Hucho et al., 1986; Giraudat et al., 1986).
This pore is symmetrical due to equivalent side-to-side hydrophobic interactions between
equivalent surfaces of homologous amino acids (Figure 3). These rings are critical to receptor
function (Imoto et al., 1998). An example is the ring of leucine residues located within the pore.
In Xenopus oocytes, 7 receptors are inhibited by non-selective antagonists, such as curare and
hexamethonium. However, these ligands act as agonists at 7 receptors in which the point
mutation L247T has been introduced into the leucine ring of the M2 domain (Palma et al., 1999).
Figure 3: Lining of the nicotinic receptor pore. A) Amino acids facing the pore of the M2
domain. B) Molecular surface of the pore domain. Red and blue depict regions of high negative
and high positive charge, respectively; yellow represents the hydrophobic zone of the gate; V
and L identify -Val 255 and -Leu 251, respectively. C) Symmetrical arrangement of residues
lining the gate. The blue sphere represents a sodium ion (Miyazawa et al., 2003).
Upon agonist binding to the LBD, nicotinic receptors promote signaling between nerve and
muscle cells by opening and closing the ion channel pore. The pore is lined by an inner ring of
five -helices, as well as an outer ring consisting of fifteen -helices that protect the inner ring
from lipids. The gate is a constricting hydrophobic girdle in the middle of the plasma membrane
A C B
10
that is formed by weak interactions between nearby inner helices. When an agonist interacts
with the ligand-binding domain, a series of rotations of the protein chains on opposite sides of
the entrance to the pore takes place. This conformational change is communicated through the
inner helices, resulting in pore opening. A proposed model for the gating mechanism is shown in
Figure 4.
Figure 4: Proposed model for nicotinic receptor gating mechanism. Acetylchoine-induced
rotations in the subunits are transmitted to the gate through the M2 helices. The rotations
destabilize the gate, causing the helices to become permeable to cations. The helices move freely
during gating because of flexible loops possessing glycine residues. S-S represents the disulfide-
bridge pivot in the ligand-binding domain, which is anchored to the fixed outer shell of the pore.
The relevant moving parts are shaded gray (Miyazawa et al., 2003).
When an agonist enters the ligand-binding domain and triggers conformational changes that lead
to opening of the receptor gate, sodium and calcium ions travel through the pore down their
electrical gradients. This elicits changes in membrane potential and leads to a host of
downstream cellular events, such as neurotransmitter release and gene regulation. Given the
distribution of 7 nicotinic receptors in the brain, these events have implications in several
important processes. 7 subunits, along with 4 and 2, appear to be the most widely expressed
11
nicotinic receptor subunits in mouse and rat brain (Wada et al., 1989; Seguela et al., 1993; Marks
et al., 1992).
B. 7 nicotinic receptor transcript distribution:
Studies evaluating 7 transcript distribution via in situ hybridization have shown broad
localization throughout rat brain (Seguela et al., 1993). A summary of the expression pattern of
7 transcripts is presented in Figure 5. Strong hybridization is present in the primary olfactory
cortex, the endopiriform nucleus, and the claustrum, while moderate signals are observed in
superficial and deep layers of the isocortex from the frontal to the occipital areas (Seguela et al.,
1993). 7 receptors are located in areas of the brain important for cognition and working
memory, such as the hippocampus (Fayuk and Yakel, 2007). In this region, intense
hybridization is seen, particularly in the dentate gyrus and pyramidal cell layers (Seguela, et al.,
1993). In the amygdala, abundant 7 mRNA is observed, while in the hypothalamus, signals are
found in periventricular, medial, and lateral regions. There are moderately high transcript levels
in superior and inferior colliculi, respectively, and in the brainstem, 7 is detected in the central
gray, tegmental nuclei, and lateral lemniscus. There is weak hybridization in the Purkinje layer
of the cerebellum and moderate hybridization in substantia gelatinosa, central gray, and ventral
horn of the spinal cord (Seguela et al., 1993).
Figure 5: Distribution of 7 transcripts in
rat brain. 7 transcripts were found in distinct
locations throughout the brain. A-D) 7 is highly
expressed in olfactory regions as well as the
hippocampus in the dentate gyrus, CA4, CA3,
CA2, and CA1. E) In the brainstem, 7 is
expressed in the central gray, tegmental nuclei,
and raphe nuclei. F) In the spinal cord, 7 is
located in the substantia gelatinosa, central, and
ventral horn (Seguela et al., 1993).
12
The reason some neurons yield functional receptors while others do not may be attributed to a
wide range of factors, one of which involves molecular chaperone-mediated receptor assembly
and trafficking to the plasma membrane. The topic of 7 chaperone activity contributing to
receptor maturation will be one focus of this project. Among the nicotinic receptor subtypes, 7
receptors have the highest Ca2+
permeability and promote rapid cholinergic synaptic
transmission. Another interesting characteristic of these receptors is rapid desensitization
following activation.
C. Calcium permeability of 7 receptors:
Calcium permeability of 7 receptors was investigated in a study showing that
application of the chloride channel blockers, niflumic and fluflenamic acid, lowers nicotine-
induced currents in Xenopus oocytes (Seguela et al., 1993). This reduction, shown in Figure 6,
may have been attributable to direct antagonism of the chloride channel blockers at 7 receptors.
However, a second possibility was that decreases in currents arose from interference of calcium-
activated chloride channels, which are opened by calcium flow through activated 7 receptors.
Figure 6: Nicotine-induced currents in the absence or presence of Ca2+-
activated chloride
channel blockers. Nicotine-induced currents at a holding potential of -60 mV are shown from a
single oocyte expressing 7. A) Nicotine-induced current without niflumic acid and fluflenamic
acid exposure. B) Nicotine-induced current following application of niflumic acid and
fluflenamic acid (Seguela et al., 1993).
To investigate whether direct antagonism of the chloride channel blocker at 7 lowers currents,
the extracellular NaCl concentration was raised to 350 mM to shift the reversal potentials of
13
chloride and sodium in opposite directions. Under these conditions, nicotine-induced activation
of 7 receptors produced an inward current proceeded by a larger outward current (Figure 7).
Treatment with chloride channel blockers only lowered the second outward current, suggesting
that the decrease in current is not due to direct antagonism, but rather to disturbance with
calcium-activated chloride channels. It is likely that 7 receptors are more permeable to calcium
than other subtypes of nicotinic acetylcholine receptors, as 7 receptors have a greater ability to
activate calcium-dependent chloride channels than other subtypes (Decker and Dani, 1990).
Figure 7: Nicotine-induced currents show two components when the Na+ and Cl
- reversals
are separated. A) With increased NaCl outside the cell, nicotine elicits a small inward current
(1) followed by a large outward current (2). Under these conditions, the inward current through
7 activates the outward current through Ca2+
-activated Cl- channels. B) With niflumic acid and
fluflenamic acid pretreatment, the inward current is not diminished (1), but the outward current is
weaker (2). This suggests the nicotine-induced current is mostly a result of activation of Ca2+
-
activated chloride channels (Seguela et al., 1993).
Castro and Albuquerque (1995) also demonstrated that 7 has the highest Ca2+
permeability
among the nicotinic receptors investigated.
Activation of 7 influences a variety of calcium-dependent events, such as apoptosis and
neurotransmitter release (Sharma and Vijayaraghavan, 2001). Mutant 7 that desensitizes less
rapidly may cause abnormal apoptosis due to greater calcium flow through activated receptors
(Orr-Urtregar et al., 2000). To investigate if acetylcholine induces 7-mediated calcium currents
14
in astrocytes, Sharma and Vijayaraghavan (2001) loaded cells with fluo-3 acetoxymethyl ester.
As shown in Figure 8, intracellular calcium increased after acetylcholine treatment, then returned
to baseline over a two-minute period of time. The acetylcholine-induced currents were most
likely attributable to 7 activation, as 10 nM MLA reversibly blocked ion flow (Sharma and
Vijayaraghavan, 2001).
Figure 8: Calcium responses in astrocytes following nicotinic receptor activation. A) Fluo-3
fluorescence of a single astrocyte following 100 M acetylcholine treatment. Images were taken
immediately before, and 1 s, 3 s, 30 s, and 65 s following exposure. (Scale bar= 10 m) B)
Averaged calcium transients from 31 cells (1 M ACh) and 42 (100 M ACh) fluo-3-loaded
astrocytes. C) Calcium response with and without 10 nM MLA. D) Changes in calcium
transients with 100 nM Bgt (Sharma and Vijayaraghavan, 2001).
Pretreatment with the antagonist BGT irreversibly blocked acetylcholine-driven calcium
currents. In the same cells, KCl-induced depolarization resulted in calcium transients,
suggesting that 7 blockade contributes to the reduced response. Modulation of extracellular
calcium concentration provided insight into the nature of 7-dependent calcium influx in
astrocytes.
Decreasing levels of extracellular calcium prevented acetylcholine-induced calcium
currents, indicating the requirement for calcium ion flow into the cell. To investigate whether 7
activation contributed to calcium flow through voltage-gated calcium channels (VGCCs),
acetylcholine-induced calcium currents were measured in the presence of CdCl2 (Figure 9).
15
Since blocking calcium channels did not affect calcium currents, calcium influx through 7
receptors, not VGCCs, contributes more significantly to observed currents (Sharma and
Vijayaraghavan, 2001).
Figure 9: Dependence of the ACh response on
extracellular calcium. A) Response of a single
astrocyte to a 2-s application of 100 M ACh with
2 mM Ca2+
, where external Ca2+
was chelated with
EGTA, and with ACh in 2 mM Ca2+
. Removing
Ca2+
abolished the ACh-induced response.
B) Responses to 2-s application of 100 M ACh
with 100 M CdCl2. ACh responses were seen
with the VGCC blocker (Sharma and Vijayaraghavan, 2001).
Amplification of calcium influx through activated 7 receptors by release from intracellular
calcium stores was evaluated by blocking microsomal calcium pumps with 1 M thapsigargin.
Findings indicated that 7 stimulation results in calcium release from intracellular stores, mainly
through ryanodine-sensitive stores. The ability of 7 to influence intracellular calcium
concentration has implications for regulation of numerous signal transduction cascades, synaptic
plasticity, and memory processes (Fayuk and Yakel, 2007). For example, functional receptors in
the hippocampus regulate Ca2+
-dependent pathways involved in cognition (Levin et al., 2002).
D. 7 nicotinic receptors in Alzheimer’s disease:
Previous studies have implicated 7 function in the cognitive deficits associated with
Alzheimer’s disease (Oddo and LaFerla, 2006), auditory gating deficits of schizophrenia
(Freedman et al., 1994; De Luca et al., 2004), and Down’s syndrome (Deutsch et al., 2003).
Among the nicotinic receptors, 7 has particularly significant implications for AD, as a decline
in receptor function is associated with disease pathology. AD is characterized by progressive
cognitive deterioration, accompanied by loss of neurons and synapses- especially cholinergic
synapses- in the basal forebrain, cerebral cortex, and hippocampus and by a substantial reduction
16
in both muscarinic and nicotinic receptor expression. These deficits appear early in the disease
and correlate with worsening cognitive ability (Nordberg, 1994, 2001; Whitehouse and Kalaria,
1995). In AD patients, 7 protein levels are reduced in the cortex and hippocampus (Burghaus
et al., 2000; Guan et al., 2000).
Although 7 protein loss is evident in AD, reductions in gene expression at the
transcriptional level are less clear, as the 36% reduction in 7 protein levels in the hippocampus
of patients with AD (Guan et al., 2000) does not correlate with a 65% increase in 7 mRNA
expression reported by Hellstrom-Lindahl et al. (1999). Also, 7 contribution to A42 toxicity is
unclear. Wang et al. (2000) report that direct binding of A42 to 7 may be a triggering factor of
neuronal cell death and AD pathology. As shown in Figure 10, A filaments- a hallmark of AD-
bind to 7 receptors with high affinity and displace BGT binding (Wang et al., 2000). While
the manner in which this interaction occurs remains unclear, recent findings, including those in
Figure 11, have suggested that A42 filaments act as non-competitive antagonists (Liu et al.,
2001). This suggests that selective 7 agonists may be neuroprotective and influence memory
and cognition in AD. Since the 7-A42 association may contribute to cell death by inhibiting
acetylcholine release and calcium flux, perhaps this interaction is key to progression of
pathogenesis observed in AD.
Figure 10: 125
I-BGT binding to
7SK-N-MC membranes is blocked
by amyloid peptide. Ligand receptor
binding assay was used to evaluate the
interaction between A peptides and 7.
A1-42, MLA, and epibatidine all blocked 125
I-BGT binding (Wang et al., 2000).
17
Figure 11: A1-42 blocks hippocampal 7 noncompetitively. Cells were tested at
concentrations up to 10 mM ACh ACh before and after application of 10 nM A1-42. Increasing
the concentration of ACh did not overcome the partial block achieved with the concentration of
A1-42 used (Liu et al., 2001).
It is unclear whether A filaments activate or inhibit 7 function (Dineley et al., 2001;
Petit et al., 2001; Spencer et al., 2006). Dziewczapolski et al. (2009) demonstrated that 7
deletion in a mouse model overexpressing mutant human amyloid precursor protein defends
against memory loss and synaptic dysfunction. This suggests it may be useful to develop 7
antagonists for treating Alzheimer’s disease. However, several reports indicate receptor agonists
may have pro-cognitive potential in treating AD (Wehner et al., 2004; Keller et al., 2008; Curzon
et al., 2006; Young et al., 2007). For example, 7 is abundant in regions important for memory
and cognition such as the hippocampus, and several receptor knockdown studies have suggested
normal receptor activity is required for proper learning (Wehner et al., 2004; Keller et al., 2008;
Curzon et al., 2006). Furthermore, a wide range of 7-selecive agonists and allosteric
modulators have been shown to slow cognitive deterioration in AD (Young et al., 2007). The
precise role of 7 in AD pathology remains uncertain, and Lamb et al. (2005) and Small et al.
(2007) contest whether A filaments even bind to 7.
18
E. 7 nicotinic receptors in oxidative stress:
7 receptors are transmembrane proteins embedded within membrane lipids. Proper
functioning of these receptors, like other neurotransmitter receptors, are highly dependent upon
the surrounding makeup of the lipid bilayer (Fong and McNamee, 1986). Destruction of this
bilayer, due to lipid peroxidation for example, can lead to disruptions in normal receptor
function. Since the brain requires great amounts of oxygen and cell membranes in brain tissue
possess high levels of oxyradical-sensitive fatty acids (Choe et al., 1995), the lipids surrounding
7 in these regions are particularly vulnerable to imbalances between free radical accumulation
and anti-oxidative protective defenses. This imbalance, termed oxidative stress, has been
implicated in a host of disease states, including neurodegeneration associated with Alzheimer’s
disease. Oxidative stress has been demonstrated to lead to deficits in 7 signaling in the central
nervous system.
A filaments, widely considered a hallmark of AD, may cause neuronal cell death by
inducing lipid peroxidation (Pedersen et al., 1998), and perhaps the loss of 7 receptors observed
in the disease is triggered by this process (Guan et al., 2001). In support of this hypothesis, some
studies suggest 7 may have anti-oxidative capacity. In PC12 cells, ethanol application elicits
increases in oxidative stress. However, activation of 7 via the selective agonist, anabaseine,
protected against ethanol-induced oxidative stress. Perhaps anti-oxidative protection provided
through 7 stimulation is partially driven by preventing the generation or buildup of reactive
oxygen species (ROS) (Li et al., 2000). In SH-SY5Y cells, RNAi knockdown of 7 results in
increased lipid peroxidation and augmented A toxicity (Qi et al., 2007), possibly implicating
the receptor in anti-oxidative activity that may help to protect against Alzheimer’s disease.
19
F. 7 nicotinic receptors in schizophrenia:
Schizophrenic patients often exhibit cognitive deficiencies in addition to positive
symptoms like delusions and hallucinations. These deficiencies stem from disturbances in a
process called sensory gating, which permits the brain to properly filter sensory stimuli.
Nicotinic receptors play a critical role in controlling sensory gating, and emerging research
exploring their connection to schizophrenia is uncovering a prominent role for 7. Sensory
gating interference in cases of schizophrenia has been linked to chromosome 15q14, near the 7
subunit gene (Freedman et al., 2001). Furthermore, nicotine treatment to patients with
schizophrenia and DBA/2 mouse models improves sensory gating in a mechanism thought to
involve 7 (Adler et al., 1992; Simosky et al., 2003; Levin et al., 1988). Typical antipsychotic
drugs, as well as many atypical antipsychotic drugs, do not have an impact on the P50 Auditory
Gating deficit widely considered to be a trait associated with schizophrenia. However,
clozapine- an atypical antipsychotic- normalizes auditory gating in DBA/2 mice by interacting
with 7 receptors (Simosky et al., 2003).
7 receptors are found in regions of the brain implicated in schizophrenia, such as the
hippocampus, dorsal striatum, nucleus accumbens (NAc), prefontal cortex, the lateral and medial
geniculate nuclei, and reticular nucleus of the thalamus. They have also been implicated in
neuronal populations affected in this disease, such as dopaminergic, serotonergic, glutamatergic,
and GABAergic cells (Kucinski et al., 2011). In the nigrostriatal system in the midbrain,
dopaminergic cells in the SNc project to the dorsal striatum, while ventral tegmental area cells of
the mesolimbic system project to the nucleus accumbens and prefontal cortex (Kucinski et al.,
2011). These regions are negatively affected in schizophrenia, as patients have diminished area
and nerve cell volume in the SNc and VTA (Bogerts et al., 1983, 1992). In the prefontal cortex,
20
patients exhibit reductions in the number and density of neurons, as well as diminished dopamine
and glutamate transmission. The presence of cholinergic signaling in these areas may implicate
7 as a potential target in treating schizophrenia.
In the reticular thalamic nucleus, GABAergic neurons are involved in the regulation of
sensory processing, and their disruption may contribute to aspects of schizophrenia (Kucinski et
al., 2011). 7 may control deficits in sensory gating deficits by stimulating the release of
inhibitory GABA onto thalamic relay cells that enhance random background activity. Interaction
of 7 with glutamatergic neuronal populations may also play a role in schizophrenia, as NMDA
receptors are located on GABAergic neurons of the reticular thalamic nucleus, and 7
stimulation may make up for reductions in NMDA activity by increasing GABA release to
thalamocortical cells (Hajos et al., 2005). 7 is also located on glutamatergic neurons affecting
dopamine output, and nicotine-induced dopamine release in the striatum is attenuated when
either glutamate or 7 receptors are blocked. This suggests NMDA and 7 have comparable
roles in controlling dopamine output in the striatum. 7 modulation of glutamate output in the
cerebral cortex may be responsible for pro-cognitive activity of nicotinic agonists in
schizophrenic patients (Levin and Simon, 2008).
Figure 12: Hypothesized locations
and function of CNS 7 receptors
in schizophrenia. NNR- neuronal
nicotinic receptor; Glu- glutamate;
DA- dopamine; P- pyramidal cell;
STR- striatum; THAL- thalamus;
VTA- ventral tegmental area; SN-
substantia nigra; NBM- nucleus basalis
of Meynert; PPT- pedunculo-pontine
nucleus (Kucinski et al., 2011).
21
Patients with schizophrenia are much more likely to be heavy cigarette smokers than those
without the disorder. They also have a much lower density of 7 receptors in the hippocampus
and singulate cortex (Freedman et al., 1995; Guan et al., 1999). Decreased 7 activity may not
only be linked to schizophrenia, but also nicotine addiction (Brunzell and McIntosh, 2012).
Genetic studies have reported 7 gene polymorphisms may be a common predisposition to both
health issues (Leonard et al., 1996; Freedman et al., 1997; Saccone et al., 2010).
G. 7 nicotinic receptors in smoking addiction and withdrawal:
Nicotine is a highly addictive drug that is the primary contributor to the addictive appeal
of cigarette smoking (FDA, Federal Register, 1996). To more accurately forecast the efficacy of
smoking cessation strategies, understanding the role of nicotine in the initiation and continuation
of cigarette smoking is important (Henningfield et al., 1998). Increasing evidence implicates 7
activity in nicotine reinforcement. Rat and human 7 transcripts are over 90% homologous, and
similar to humans, rats self-administer nicotine (Seguela et al., 1993; Elliott et al., 1996).
Brunzell and McIntosh (2012) investigated whether reduced 7 activity increases nicotine self-
administration using a progressive ratio schedule of reinforcement (PR) in rats. If 7
antagonism in brain regions implicated in drug abuse corresponds with more active lever
pressing for nicotine and breakpoints, perhaps 7 signaling deficits contribute to increased
propensity for cigarette smoking among those with schizophrenia. The selective 7 antagonist,
ArIB -conotoxin, or the selective agonist, PNU282987, was infused into the nucleus accumbens
(NAc) shell or anterior cingulate cortex immediately before PR. If diminished receptor activity
raises nicotine self-administration, stimulating it may lower motivation for self-administration.
Such a finding would have implications for smoking cessation therapies and suggest a link
between cigarette smoking and schizophrenia.
22
Antagonism of 7 in the NAc via ArIB -conotoxin infusion resulted in a dose-
dependent increase in motivation to self-administer nicotine. To control for the potential impact
of 7 activation on locomotor activity, as well as the reinforcing properties of cues, a “CUE
only” control group receiving cues without subsequent nicotine administration was included.
Dose-dependent increases in breakpoint and active lever pressing following ArIB -conotoxin
treatment were only observed in the nicotine group. Since drug exposure did not impact
response accuracy, ArIB -conotoxin-associated increases in lever pressing were not simply
attributable to hyperactive locomotion (Figure 13). Antagonism of 7 in the anterior cingulate
cortex revealed similar dose-dependent findings (Brunzell and McIntosh, 2012).
Figure 13: Antagonism of 7 in the NAc shell increases motivation to self-administer
nicotine. ArIB -conotoxin infusion into the NAc shell led to a dose-dependent increase in A)
breakpoints, or the highest lever depression criterion achieved, and B) active lever pressing.
There was no effect of ArIB -conotoxin infusion on breakpoint or active lever pressing in rats
reinforced with cues but not administered nicotine. C) Response accuracy as measured by %
active lever pressing was not affected by NAc shell infusion of ArIB -conotoxin in either
group. *Significantly different (p<0.05) (Brunzell and McIntosh, 2012).
Activation of 7 in the nucleus accumbens, on the other hand, reduced motivation to self-
administer nicotine. As show in Figure 14, PNU282987 infusion lowered both breakpoint and
active lever pressing during PR in only the group that was administered nicotine. Again, there
was no effect on response accuracy.
23
Figure 14: 7 activation in the NAc shell decreases motivation to self-administer nicotine. PNU 282987 significantly decreased A) breakpoints and B) active lever pressing during a
progressive ratio schedule of reinforcement. There was no effect on breakpoint or active lever
pressing in rats reinforced with cues but no nicotine. C) Response accuracy measured by %
active lever pressing was not affected by -conotoxin in either group. *Significantly different
(p<0.05) (Brunzell and McIntosh, 2012).
Preclinical studies exploring the role of 7 in nicotine addiction have yielded mixed findings.
While the selective 7 antagonist methylconitine (MLA) significantly diminished nicotine self-
administration in an FR1 schedule of reinforcement (Markou and Paterson, 2001), Grottick et al.
(2000) report no effect on self-administration when rats had a 2-day wash-out period between
MLA doses. Given the low affinity of nicotine for 7 and the limited number of nicotine
infusions during PR, it is possible that -conotoxin effects arose from blockade of an
endogenous cholinergic signal rather than blockade of nicotine-induced 7 activation
(Wooltorton et al., 2003; Papke et al., 2010). This hypothesis is strengthened by nicotine
conditioned place preference and nicotine administration experiments showing 7 knockout
mice exhibit normal nicotine reward (Walters et al., 2006; Pons et al., 2008). Results from
Brunzell and McIntosh (2012) suggest that activation of 7 may have potential for drug
development efforts aimed at assisting people achieve smoking cessation.
Although the US Food and Drug Administration-approved smoking cessation drug,
varenicline, is marketed as an 42 partial agonist, it is also a full agonist at 7 receptors
24
(Mihalak et al., 2006). Evidence presented by Brunzell and McIntosh (2012) support the notion
that the therapeutic strength of varenicline requires 7 activation. On a broader level, their
results identify 7 linkage to nicotine addiction and suggest that 7 deficiency may predispose
certain populations to both cigarette smoking and schizophrenic symptoms. Along with genetic
studies (Freedman et al., 1995, 1997; Guan et al., 1999) these findings imply that developing 7-
selective drugs may be a viable strategy to pursue for aiding smoking cessation efforts.
There is much interest in modulating nicotinic receptors to treat a variety of central
nervous system disorders, such as Alzheimer’s disease, schizophrenia, depression, and attention
deficit disorder. Table 1 lists several companies conducting clinical trials investigating the safety
and efficacy of 7-targeting ligands for the treatment of various central nervous system
disorders.
Table 1: 7 receptor compounds in clinical development for central nervous system
disorders (Taly et al., 2009).
25
Cigarette smoking is widely recognized for increasing cancer risk, especially in lung cancer
(Burns, 2003). The finding that 7 receptors govern proliferation, apoptosis, and that nicotine-
derived nitrosamines activate these receptors fueled a fresh approach to conducting cancer
research, and the role of 7 receptors in cancer development and progression is a topic worthy of
discussion (Gotti et al., 1997; Schuller, 1989; Maneckjee and Minna, 1990; Schuller and Orloff,
1998).
H. 7 nicotinic receptors in cancer:
It was previously thought that 7 receptors were only expressed in the central and
autonomic nervous system. However, recent work has shown that these receptors mediate a
number of responses in cancer cells, such as release of angiogenic and neurogenic factors, in
addition to growth and proliferation (Schuller, 2009). The events following receptor activation
in cancer cells are similar to those in healthy cells. Agonist binding elicits conformational
changes, leading to opening of the intracellular gate. Cations flowing through the open channel
into the cell results in membrane depolarization. Membrane depolarization then triggers
subsequent opening of voltage-activated calcium channels, which further reduces the negative
intracellular charge. 7 receptors and voltage-gated calcium channels cooperate to regulate a
broad spectrum of events, such as neurotransmitters release and production of growth factors.
Increased intracellular calcium concentrations brought about by 7 activation and calcium
channel opening leads to signaling cascades implicated in apoptosis, cell proliferation, as well as
other events shown in Figure 15 (Kunzelmann, 2005; Roderick and Cook, 2008).
26
Figure 15: The diverse functions of α7 and α4β2. Both receptors promote dopamine release.
α7 also stimulates the release of the excitatory neurotransmitters glutamate and serotonin, as well
as the neuropeptide bombesin and neurotransmitters, adrenaline and noradrenaline. These agents
stimulate cancer risk by directly activating signaling pathways or indirectly by regulating
epidermal growth factor (EGF), vascular endothelial growth factor (Vegf) and arachidonic acid
(AA) release. α7 also has immune modulatory activity. SCLC, small cell lung cancer; TNFα,
tumour necrosis factor-α (Schuller, 2009).
Given the broad network of events 7 governs, it is highly plausible that long-term
nicotine exposure through cigarette smoking contributes to the risk of developing cancer, along
with numerous other lifestyle factors. The finding that the carcinogenic nicotine derivative NNK
activates 7 receptors with an affinity 1,300 times greater than nicotine (Schuller, 2009) supports
this theory, and suggests that the carcinogenic nature of nicotine may greatly depend upon the
action of nitrosamines displacing it from receptors. Like other agonists, including nicotine, NNK
interaction with 7 triggers calcium ion flow into the cells, leading to subsequent membrane
depolarization and stimulation of voltage-gated calcium channels. NNK exposure also
upregulates 7 receptors. In summary, 7 function following NNK-application is similar to that
following nicotine activation, not only in terms of rapid depolarization and ion influx, but also
downstream signaling. While the role of 7 receptors is thought to vary across different forms
of cancer, the role of nicotinic receptors in non-small-cell lung cancer is illustrated in Figure 16.
27
Figure 16: Nicotinic receptors in non-small-cell lung cancer (nSCLC) cells. NNK (4-
(methylnitrosamino)-1-(3-pyridyl)-1-butanone) and choline bind with high affinity to α7, while
NNN (N-nitrosonornicotine) and nicotine bind to 42. Ca2+
influx leads to EGFR signaling.
This pathway is enhanced by α7-mediated Ras activation through β-arrestin-dependent SRC.
EGFR activates the Akt pathway and downstream effectors, X-linked inhibitor of apoptosis
protein (XIAP), survivin and NFκB. FGF2, fibroblast growth factor 2; Vegf, vascular
endothelial growth factor (Schuller, 2009).
Nicotine also stimulates mesothelioma cells through 7-driven ERK1-ERK2 activation
and inhibition of apoptosis, NFB activation, and BAD phosphorylation (Trombino et al., 2004).
7-mediated activation of ERK1-ERK2 and STAT3 upon nicotine exposure has also been
implicated in bladder cancer cells (Chen et al., 2008). Although the emerging understanding of
nicotinic receptors in cancer opens many new avenues to cancer treatment, the use of nicotinic
antagonists that completely block the receptors is unlikely to succeed, since receptors regulate a
multitude of cellular processes. For example, although application of 7 antagonists to cells in
vitro may effectively block cancer progression, in in vivo models, they may interfere with
28
pathways whose normal function is critical for proper regulation of bodily functions.
Unfortunately, such disturbances may trigger symptoms common to disorders linked with 7
receptors, such as the cognitive decline of Alzheimer’s disease (Gotti et al., 1997; Leonard et al.,
2002). In addition to its involvement with neurological disorders and cancer, 7 receptors have
been shown to influence cytokine production through a process called the “cholinergic anti-
inflammatory pathway.”
I. 7 nicotinic receptors in anti-inflammation:
Until recently, it was believed that the immune system functioned separately from
neuronal control. However, it has been established that numerous systems, including the innate
immune response, are regulated by the nervous system (Tracey et al., 2007). Clinical studies had
indicated that nicotine administration can be effective for treating some cases of inflammatory
bowel disease (IBD) (Guslandi, 1999; Sandborn et al., 1997), and that pro-inflammatory
cytokines are significantly decreased in the colonic mucosa of smokers with inflammatory bowel
disease (Sher et al., 1999). Therefore, Borovikova et al. (2000) reasoned that the cholinergic
parasympathetic nervous system (PNS) may modulate the systemic inflammatory response.
Investigations into the mechanism regulating immune homeostasis have involved the pro-
inflammatory protein, tumor necrosis factor (TNF). In primary human macrophages,
acetylcholine blocked LPS-induced increases in TNF release (Figure 17). Since TNF mRNA in
acetylcholine-treated, LPS-stimulated macrophages was not significantly different from vehicle-
treated, LPS-stimulated macrophages, acetylcholine probably suppresses TNF post-
translationally.
29
Figure 17: Cholinergic agonists inhibit LPS-induced TNF synthesis in human
macrophages. A) Acetylcholine, muscarine, and nicotine block TNF production following 4
hour LPS application. B) Anti-TNF antibody immunostaining revealed lowered LPS-induced (2
hour) TNF activity in macrophages exposed to 100 M acetylcholine (Borovikova et al., 2000).
To examine whether the release of other cytokines may be influenced by ACh,
Borovikova et al. measured the release of other cytokines in macrophages treated with LPS and
acetylcholine. As shown in Figure 18, acetylcholine dose-dependently reduced LPS-induced
increases in the pro-inflammatory cytokine, IL6, while failing to block production of the anti-
inflammatory cytokine, IL10 (Figure 18).
Figure 18: In human macrophages acetylcholine inhibits release of pro-inflammatory, but
not anti-inflammatory, cytokine release. Acetylcholine was applied to LPS-treated (100
ng/ml) human macrophages for 20 hours at various concentrations. A) ACh dose-dependently
lowers IL6 release. IL1 and IL18 were also lowered (not shown). B) ACh fails to block LPS-
induced IL10 release. Data are mean +/- SEM from four separate experiments (Borovikova et
al., 2000).
A B
A B
30
The finding that vagus nerve stimulation influences TNF activity has broad implications. Since
the cholinergic anti-inflammatory pathway proceeds much more rapidly than the humoral anti-
inflammatory cascade, developing compounds to target 7 receptors may be an effective means
of reducing the harmful effects of toxin exposure. Moreover, activation of this endogenous
pathway during times of stress may prevent harmful peripheral immune responses.
Follow-up work showed that vagus nerve-regulation of cytokine production involves 7
receptors more specifically, as 7 knockout mice show less production of cytokines than wild-
type mice in response to nicotine (Tracey et al., 2005). The downstream signaling pathway
responsible for 7-mediated anti-inflammation remains uncertain. Arredondo et al. (2006)
reported that nicotinic activation of 7 on oral keratinocytes leads to STAT3 upregulation
through the Ras/Raf/MEK/ERK pathway, and DeJonge et al. (2005) demonstrated that nicotinic
activation of 7 leads to phosphorylation and activation of STAT3 following interaction between
7 and JAK2. The effects of STAT3 on inflammation are context-dependent, and it possible that
7-mediated STAT3 signaling inhibits inflammatory cytokine production by inhibiting NFB
activity (Johnston and Grandis, 2011). Andersson and Tracey (2012) hypothesized that the 7
anti-inflammatory pathway responsible for reducing TNF generation may involve activation of
adenylate cyclase (AC) and conversion of ATP into cAMP (Figure 19). Increased cAMP
activates PKA, which phosphorylates CREB. Phosphorylated CREB turns on the transcription
of C-fos, which lowers cytokine production by blocking NFB activity. This pathway is
illustrated in Figure 19.
31
Figure 19: Proposed mechanism
of 7-driven cytokine inhibition.
In spleen macrophages, 7
stimulation results in a signaling
cascade ultimately causing
diminished production of
cytokines. Activated 7 interacts
with AC, resulting in increased
levels of intracellular cAMP.
cAMP activates CREB, leading to
increased expression of C-fos
and block of NFB activity
(Andersson and Tracey, 2012).
Although the downstream signaling events responsible for 7-driven anti-inflammation are not
fully understood, the discovery of the cholinergic anti-inflammatory pathway has supported the
development of 7 ligands for conditions involving inflammation. Recently, studies
investigating the utility of compounds affecting 7 signaling have been a major focus in the
development of novel drugs. As shown in Table 2, 7 ligands have been shown to influence the
severity of disease state in a variety of conditions.
Table 2: Examples of conditions in which cholinergic modulation influences disease state.
(Andersson and Tracey, 2012).
32
Nicotinic receptors are thought to be involved in both the motor reflex and the inflammatory
reflex (Figure 20). Heteromeric nicotinic receptors are abundant at the motor neuron and play a
role in the motor reflex. 7 receptors located on macrophages serve a role in the inflammatory
pathway and reduce pro-inflammatory cytokine activity upon the binding of acetylcholine.
Figure 20: Signaling comparison of motor reflex and inflammatory reflexA motor
reflex requires stimulation of sensory neurons projecting to dendrites of interneurons that relay
signals to muscles. Evidence shows there are nicotinic responses at the motor neuron. B) The
inflammatory reflex requires stimulation of sensory neurons in the vagus nerve by infection
(LPS) or inflammation (cytokines). These neurons project to the brainstem nuclei, where
interneurons relay signals to motor nuclei of the vagus nerve. Efferent signals travel to the celiac
ganglion, whose axons project to the splenic nerve. Norepinephrine elicits acetylcholine release,
whose binding to 7 on macrophages decreases the activity of pro-inflammatory cytokines
(Andersson and Tracey, 2012).
7 activity has been implicated in a range of conditions, and gaining a better understanding of
receptor signaling and expression may be useful in the development of more effective treatment
33
strategies. Although 7 receptors have been well-studied, there are several aspects that remain
unclear. Two aspects this project will focus on are: 1) 7-mediated JAK-STAT signaling, and 2)
7 receptor maturation.
J. 7-mediated JAK-STAT signaling:
While ion flow through 7 is a well-established mode of signaling, a less thoroughly
studied signaling pathway involves signal transducer and activator of transcription 3 (STAT3).
STAT3 is a member of a family of 7 proteins that help to communicate signals from activated
cytokine and growth factor receptors on the surface of the cell into the nucleus where gene
transcription occurs (Johnston and Grandis, 2011). STAT3 modulates transcription of genes
involved in regulating a variety of critical functions, such as cell differentiation, proliferation,
apoptosis, angiogenesis, metastasis, and immune responses. Several cancers are linked with
constitutively active STAT3. Since elevated levels of STAT3 hinder apoptosis, allow cell
proliferation and survival, and promote angiogenesis and metastasis, they have been associated
with a poor prognosis for many different cancers (Johnston and Grandis, 2011). Recent studies
have increased our understanding of the anti-inflammatory pathway and implicated 7 and
STAT3 in modulating cytokine production in human and mouse macrophages (Johnston and
Grandis, 2011).
In 2003, Tracey et al. investigated the identity of receptors involved in the cholinergic
anti-inflammatory pathway revealed by Borovikova et al. (2000). To study whether 7 is
required for cholinergic inhibition of TNF release, 7 antisense oligonucleotides were produced,
along with antisense oligonucleotides (AS) to 1 and 10 as controls. Exposure of
lipopolysaccharide (LPS)- a major component of the outer membrane of gram-negative bacteria-
to macrophages elicited an increase in production of the pro-inflammatory cytokine, TNF
34
(Figure 21). Pretreating macrophages with nicotine before LPS exposure reduced TNF
production. The ability of LPS to increase TNF production and effect of nicotine on this event
were already known. Tracey et al. showed that AS7 restored macrophage TNF release in the
presence of nicotine, while under similar conditions, AS1 and AS 10 did not significantly
influence nicotine’s impact on LPS-induced TNF release, demonstrating cholinergic inhibition of
macrophage TNF release depends specifically on 7 receptors.
Figure 21: Antisense oligonucleotides against 7, but not 1 or 10, prevent nicotine-
induced reduction in LPS-stimulated TNF release. Nicotine (1 M) exposure took place 5 to
10 minutes prior to LPS (100 ng/ml) treatment. While AS7 restored LPS-induced TNF
production in the presence of nicotine (A), AS1 (B) and AS10 (C) did not change the effect of
nicotine on TNF generation (Tracey et al., 2003).
To evaluate whether 7 receptors are involved in the regulation of inflammatory cytokine
release in vivo, Tracey et al. (2003) measured TNF production in mice lacking the receptor. As
shown in Figure 22, levels of serum TNF in knockout mice following endotoxin treatment was
significantly greater than that seen in wild-type mice exposed to endotoxin. Similarly, TNF
levels in the liver and spleen were also significantly higher in mice lacking 7, as were levels of
other inflammatory cytokines, such as IL6, and IL1.
35
Figure 22: Increased cytokine produced in 7-deficient mice during endotoxaemia. Mice
were administered LPS (0.1 mg/kg, IP). A) TNF levels in serum; n=6 per group. B) IL1 levels
in serum; n=8 per group. C) IL6 levels in serum; n=9 per group. Asterisk, p< 0.05 versus wild-
type controls. Horizontal lines indicate group means (Tracey et al., 2003).
Tracey et al. (2003) demonstrated that the ability of nicotine to reduce LPS-induced TNF
production was mediated by 7 receptors. However, the downstream signaling events
responsible for this anti-inflammatory effect remained unclear. Since STAT3 was known for
inhibiting inflammatory pathways, De Jonge et al. (2005) investigated the involvement of this
transcription factor in the 7-mediated anti-inflammatory response.
The effects of STAT3 on the inflammatory process are context-dependent. STAT3 and
the tyrosine kinase JAK2, which phosphorylates STAT3, are required for both IL6 receptor and
IL10 signaling. IL6 contributes to the progression of many inflammatory diseases, while IL10 is
an anti-inflammatory cytokine. IL6 receptor signaling is inhibited by SOCS3, whose activity is
increased by STAT3 activation. SOCS3 binds to the gp130 subunit of IL6R and inhibits
activation of STAT3 by IL6R agonists. In 2005, De Jonge et al. demonstrated that stimulation of
7 via nicotine reduces NFB through STAT3 signaling (De Jonge et al., 2005). Consistent
with results from Tracey et al., De Jonge et al. showed that nicotine dose-dependently lowers
LPS-driven production of TNF, MIP2 and IL6, but not IL10 (Figure 23). Furthermore, nicotine
dose- and time-dependently activated STAT3 and SOCS3 in LPS-stimulated peritoneal
macrophages.
A B C
36
Figure 23: Nicotine attenuates peritoneal macrophage activation and induces
phosphorylation of STAT3 and SOCS3 expression. A) ELISA of TNF, MIP2, IL6, and IL10
in macrophages stimulated with LPS in the presence of nicotine. B) Immunoblots for PSTAT3,
STAT3 and SOCS3 in macrophages stimulated with LPS in the presence of nicotine. C)
Immunoblot of PSTAT3 and STAT3 in peritoneal macrophages stimulated with nicotine (De
Jonge et al., 2005).
To determine whether nicotine-induced STAT3 activation required activation of nicotinic
receptors, macrophages were pretreated with nicotinic receptor antagonists before nicotine
exposure. As shown in Figure 24, non-selective antagonists hexamethonium and tubocurarine
blocked nicotine-induced STAT3 phosphorylation. While 7-selective antagonists BGT and
methyllycaconitine diminished nicotine-induced STAT3 activation, DHE, a selective non-7
antagonist, failed to lower STAT3 activation.
37
Figure 24: STAT3 phosphorylation by nicotine is prevented by 7-selective nicotinic
receptor antagonists. Macrophages were exposed to d-tubocurarine, BGT, hexamethonium,
or -methyllycaconitine before nicotine application. Protein lysates were collected for PSTAT3,
STAT3, and actin immunoblotting (De Jonge et al., 2005).
STAT3 activation requires JAK2 activity. To evaluate the dependence of JAK2 recruitment to
7 receptors for STAT3 phosphorylation, immunoprecipitation studies were performed using the
JAK2 inhibitor, AG490 (De Jonge et al., 2005). Phosphorylation of STAT3 following nicotine
exposure was blocked by AG490, confirming necessity of JAK2 activity for STAT3
phosphorylation. AG490 also blocked nicotine-induced reductions in IL6 production in
macrophages exposed to LPS, implicating a role of STAT3 in nicotine-induced alterations of
cytokine release. Immunoprecipitation of JAK2 from untreated peritoneal macrophage lysates
revealed weak associations between JAK2 and 7. However, nicotine application increased
levels of 7 in JAK2 and PJAK2 immunoprecipitates, suggesting JAK2 recruitment to the
receptor and subsequent phosphorylation upon receptor activation. When cells were pretreated
with AG490 before nicotine exposure, reduced levels of PJAK2, but not JAK2, were observed in
7 immunoprecipitates (Figure 25). This implicates JAK2 association with nicotine-stimulated
7 receptors.
38
Figure 25: Nicotine-induced
STAT3 phosphorylation occurs
through activation of JAK2 that
is recruited to the 7.
A) Immunoblot of PSTAT3 and
STAT3 in peritoneal macrophages
incubated with AG490.
B) Immunoblots of peritoneal
macrophages treated with 1 M
nicotine or 1 M nicotine and
100 M AG490
(De Jonge et al., 2005).
In 2006, Arredondo et al. further explored downstream signaling mediated by 7
receptors in oral keratinocytes (KCs). 7-mediated morbidity of tobacco products was
investigated by using RNAi and pathway inhibitors in KCs exposed to aged and diluted
sidestream cigarette smoke (ADSS) or an equivalent concentration of pure nicotine for 24 hours.
Real-time PCR and In-cell Western blotting revealed that KCs exposed to ADSS or 10 M
nicotine produced significantly greater STAT3 protein and mRNA compared to untreated KCs
(Arredondo et al., 2006). As shown in Figure 26, pretreatment with BGT or 7 siRNA
significantly lowered nicotine-driven upregulation of STAT3 levels. Furthermore, Ras/Raf-
1/MEK1/ERK inhibitors demonstrated a potential pathway through which 7-dependent
upregulation of STAT3 takes place (Arredondo et al., 2006).
39
Figure 26: Alterations in STAT3
expression in KCs exposed to nicotine.
The following treatments were
used: 3 µM manumycin A (Mnmc);
3 µM manumycin A on KCs transfected
with constitutively active (CA)-MEK
(CA-MEK+Mnmc); 0.1 µM GW5074;
0.1 µM GW5074 on the CA-MEK
transfected KCs (CA-MEK+GW5074);
1 µM MEK inhibitor I (MEK-Inh);
10 µM U0126; transfection with
dominant negative (DN)-MEK;
transfection with the control, WT
MEK1 mutant (WT-MEK); 1 µM BGT;
transfection with siRNA-7; and co-
transfection with siRNA-7 and CA-MEK
(CA-MEK+siRNA-7), WT-MEK (WT-
MEK+siRNA-7) or DN-MEK (DN-
MEK+siRNA-7)
(Arredondo et al., 2006).
Since STAT3 upregulation in oral keratinocytes treated with nicotine or sidestream nicotine
exposure may rely upon intracellular signaling pathways stemming from 7 activation, targeting
7 receptors may be a promising approach for managing tobacco-related periodontal disease
(Arredondo et al., 2006). Anti-inflammatory effects of 7 suggest that this receptor is a
promising target in a number of additional disorders. For example, inflammatory bowel disease,
osteoarthritis, and sepsis (Marrero and Bencherif, 2009) may be potential candidates for
treatment through modulation of 7 function.
K. Multiple modes of 7 nicotinic receptor signaling
7 nicotinic receptors are among the most extensively studied type of neurotransmitter
receptor, and it is well-established that calcium influx through open receptors triggers a host of
cellular responses. More recently, evidence suggests 7 also drives STAT3 signaling to reduce
40
cytokine production. Although emerging research continues to further our understanding of this
anti-inflammatory pathway, there are several issues that remain uncertain. The primary purpose
of our project is to study the interplay between 7-mediated calcium influx and STAT3
signaling. We aimed to study the relationship between the two modes of signaling and
investigate whether 7-mediated STAT3 signaling can proceed independently of calcium. Our
hypothesis that 7 mediates STAT3 signaling is independent of ion flow is supported by a
number of studies demonstrating signal transduction pathways proceeding independently of
calcium.
Shytle et al. (2004) demonstrated that in rat microglia, nicotinic activation of 7 leads to
an increase in intracellular calcium levels. This increase can take place independently of
extracellular calcium levels and can be blocked by inhibition of Ca2+
release from intracellular
stores. This suggested that 7 can drive signaling involving Ca2+
release from intracellular
stores rather than conventional ion flow through activated receptors. Further evidence
supporting the possibility of a Ca2+
-independent 7-STAT3 signaling pathway is provided by
studies performed by Hosur and Loring (2011). Aside from 7 receptors, 42 nicotinic
receptors also lower cytokine production by activating the JAK-STAT pathway. In SHEP1 cells
expressing human 42, calcium chelation and PKA inhibition failed to block the effect of
nicotine on LPS-induced NFB activity. However, JAK/STAT inhibition did block the effect of
nicotine on LPS-induced NFB activity, suggesting that the JAK-STAT pathway may play a role
in 42-mediated anti-inflammation that is independent of calcium and cAMP (Hosur and
Loring, 2011).
41
L. 7 and 42 receptors activate the STAT3 pathway independently of calcium ion flow:
Hosur and Loring (2011) investigated whether JAK2 is involved in 42 mediated anti-
inflammation in LPS-treated SHEP1 cells expressing human 42 nicotinic receptors.
Observations that AG490 abolished nicotine-induced decreases in LPS-stimulated NFB activity
suggest JAK2 plays a role in reducing inflammation (Figure 27).
Figure 27: Inhibition of JAK2 restores LPS-induced NFB production in h42 SHEP1
cells exposed to nicotine. A) h42 SHEP1 cells transfected with NFB reporter were
pretreated with 30 nM JAK inhibitor I and 300 nM nicotine before 1 g/ml LPS application. B)
h42 SHEP1 cells transfected with NFB reporter were pretreated with nicotine and indicated
concentrations of AG490 for 30 minutes before 1 g/ml LPS treatment. One-way ANOVA
determined statistical differences with p< 0.05 (Hosur and Loring, 2011).
Active JAK2 leads to phosphorylation and translocation of STAT3 into the nucleus where
binding to promoter elements affects gene transcription (Heinrich et al., 2003). Nicotine dose-
dependently increases levels of the active, phosphorylated form of STAT3 (PSTAT3) (De Jonge
et al., 2005). Therefore, Hosur and Loring (2011) examined the anti-inflammatory role of
STAT3 by testing the effects of the STAT3 inhibitor, NSC74859 (S3I-201), on nicotine-induced
inhibition of LPS-stimulated NFB signaling in SHEP1 cells stably expressing h42. As
shown in Figure 28, 30 M NSC74859 at 30 M prevented the effects of nicotine.
B A
42
Figure 28: STAT3 inhibition restores LPS-induced NFB release in h42 SHEP1 cells
exposed nicotine. A) h42 SHEP1 cells transfected with the NFB reporter were exposed to
LPS with or without nicotine and indicated concentrations of NSC74859 pretreatment (Hosur
and Loring, 2011).
LPS-induced cytokine production involves phosphorylation of IB and translocation of NFB
into the nucleus. Since nicotinic activation of 42 reduces LPS-induced NFB activation and
cytokine production, Hosur and Loring (2011) examined whether 42 stimulation impacts
IB phosphorylation. Pretreatment of h42 SHEP1 cells with nicotine by itself lowered
IBphosphorylation, and preincubation with AG490 before nicotine treatment restored NFB
translocation and IB phosphorylation in LPS-stimulated cells, suggesting that nicotine reduces
LPS-elicited inflammation and IB phosphorylation in a JAK2-dependent manner.
Hosur and Loring (2011) then tested the role of calcium on NFB translocation and IB
phosphorylation using BAPTA-AM, an intracellular calcium chelator. As shown in Figure 29,
nicotine reduces LPS-induced IB phosphorylation by approximately 50% of control in
Western blots and by approximately 10% of control in ELISA. The inability of calcium
chelation to diminish the effects of nicotine suggests that 42-mediated reduction of LPS-
induced NFB activation and IB phosphorylation does not depend on calcium.
43
Figure 29: 42-mediated inhibition of LPS-induced IBphosphorylation may be
calcium-independent. h42 SHEP1 cells were pretreated with 5 M BAPTA, then exposed to
300 nM nicotine before LPS application. A) Immunoblot of phospho-IB versus IB.
Nicotine partially blocked LPS-induced IB phosphorylation by approximately 50% of control.
BAPTA failed to block the effects of nicotine. B) Luciferase-linked phospho-IB ELISA.
Nicotine partially blocked LPS-induced IkBa phosphorylation by about 10%. BAPTA failed to
block the effects of nicotine (Hosur and Loring, 2011).
Findings that 42 can mediate STAT3 signaling independently of calcium ion flow (Hosur and
Loring, 2011) motivated us to study 7-mediated STAT3 signaling by disrupting normal calcium
flow through the use of calcium chelators and modified media low in calcium levels. Another
aspect of signal transduction worthy of investigating was protein kinase A (PKA). Hosur and
Loring (2011) demonstrated that PKA inhibition via PKI 14-22 amide failed to block the effect
of nicotine on LPS-induced NFB activity, and Liu et al. (2006) reported that PKA inhibition via
10 M H-89 in HEK293 cells prevented phosphorylation of JAK2 and STAT3. Figure 30
presents several signaling pathways relevant to our project while highlighting our hypothesis that
7-mediates STAT3 signaling independently of calcium.
A
B
44
Figure 30: 7-mediated anti-inflammation involves two modes of signaling. The endotoxin
LPS elicits an increase in TNF production through activation of Toll-like receptor 4. Activated
IKK phosphorylates the inhibitory protein IB, resulting in its subsequent ubiquitination,
dissociation from NFB, and degradation in the proteasome. NFB is then free to translocate
into the nucleus to drive the transcript of pro-inflammatory cytokines, such as TNF. Nicotinic
activation of 7 stimulates several possible pathways that result in the reduction of LPS-induced
TNF activity. One hypothesis is that calcium influx leads to adenylate cyclase activation and
downstream activation of CREB. CREB drives transcription of Fos, which decreases pro-
inflammatory cytokine production by blocking NFB. Another possibility is that ERK
activation results in STAT3 upregulation. Nicotinic stimulation of 7 drives activation and
phosphorylation of STAT3, whose anti-inflammatory effect may result from inhibition of NFB.
Similar to nicotinic stimulation of 7, the cytokine IL6 activates IL6R to drive JAK2-STAT3
signaling. Our hypothesis is that calcium influx through open 7 (1) is not required for 7-
mediated STAT3 signaling (2).
In addition to 7-mediated STAT3 signaling, another aspect of 7 receptors that remains
unclear is receptor maturation. While studying 7-mediated STAT3 signaling, insight was
provided in cell-dependency of receptor maturation, as proper folding and assembly are
prerequisites for driving STAT3 signaling. We will be presenting data in the “Results” section
suggesting 7 requires folding and assembly to drive JAK/STAT signaling. This raised the issue
45
of what is needed for 7 receptor maturation and suggested we could use JAK/STAT signaling
to explore cell-dependent receptor maturation. One aspect of cell-dependent maturation involves
the necessity of molecular chaperones allowing surface receptor expression. In the case of 7, a
chaperone called Resistance to Inhibitors of Cholinesterase 3 (Ric3) has been demonstrated to
have a profound effect on surface expression.
M. Cell line-dependency of 7 maturation:
Ric3 was discovered in 1995 in a genetic screen of C.elegans that confers resistance to
the inhibitor of acetylcholinesterase, aldicarb (Nguyen et al., 1995). Since its discovery, this
protein has been shown to allow surface 7 expression in otherwise non-permissive cells
(Lansdell et al., 2005; Williams et al., 2005). We originally hypothesized that the cell-
dependency of 7 receptor maturation observed by Sweileh et al. (2000) could be accounted for
by discrepancies in Ric3 content across various cell lines. To test the hypothesis that 7 receptor
maturation is a host cell line-dependent process, Sweileh et al. used recombinant adenoviruses
encoding rat 7 in which expression is under the control of a tetracycline-dependent promoter.
Following infection of five cell lines, including SHEP1 and GH4C1 with the a recombinant
adenovirus encoding 7, all five cell lines expressed a 60 kDa protein stained by anti-7
antibodies representative of unassembled 7 subunits. However, although all five cell lines
expressed mRNA for 7 (Figure 31), only GH4C1 and SHEP1 cells expressed surface 7
receptors that bound 125
IBGT (Figure 32).
Figure 31: All cell lines produce 7 mRNA
when transfected. 2 ug RNA extracted was
electrophoresed, blotted, and probed with the
indicated radiolabeled cDNA. Tubulin
mRNA was a control for RNA loading
(Sweileh et al., 2000).
46
Figure 32: Only two cell lines express mature 7
receptors. Specific 125
-BGT binding is indicated.
While only GH4C1 and SHEP1 cells yielded robust
surface binding, GH4C1 cells exhibited ~10-fold greater
surface expression than SHEP1 cells. All five cell lines
infected with 42 expressed mature surface receptors
(not shown)
(Sweileh et al., 2000).
Since radiolabeled BGT lacks the penetrability to go into the cell, it is an ideal compound for
monitoring surface 7 expression. GH4C1 cells expressed over 10-fold more surface 125
I-BGT
binding sites than SHEP1 cells following 7 adenovirus infection, suggesting that the assembly
and membrane insertion of 7 are cell line-dependent. Although GH4C1 cells produced more
surface receptors than SHEP1 cells, the amounts of immunoprecipitable total receptor were
similar, suggesting that GH4C1 cells are more efficient than SHEP1 cells at either assembling
receptor subunits or inserting them into the plasma membrane. If Ric3 allows surface expression
of 7 receptors essential for STAT3-driven luciferase expression in SHEP1 cells, and co-
transfection of GH4C1 cells with 7 and STAT3-ML alone is sufficient to allow robust
luciferase expression upon nicotine application, GH4C1 cells may already possess high levels of
Ric3 promoting 7 expression.
N. 7 nicotinic receptor maturation is a process that remains unclear:
Surface expression of multimeric transmembrane proteins is a multi-step process
involving currently unknown events. The assembly of muscle-type nicotinic receptors is
relatively well-understood and involves a slow process encompassing receptor subunit folding,
assembly, and insertion into the plasma membrane. Before receptor maturation, formation of
47
disulfide bonds, N-linked glycosylation, oligosaccharide trimming, and interaction with
molecular chaperones are some of the events known to take place (Blount et al., 1991; Forsayeth
et al., 1993; Merlie et al., 1992; Wang et al., 1996). While less is known about maturation of
neuronal nicotinic receptors, it is presumable that a complex process such as receptor maturation
may exhibit some degree of cell line-dependence. Increasing evidence suggests that surface
expression of 7 is indeed highly cell line-specific. Despite having comparable levels of 7
mRNA, various types of PC12 cells differ in the amount of surface 7 expressed (Blumenthal et
al., 1997), and of the cell lines examined, only those possessing endogenous 7 were capable of
expressing epitope-tagged 7 receptors upon stable transfection (Cooper and Millar, 1997).
Due to their high calcium permeability and roles in transcription factor activation and
programmed cell death, tight regulation of functional 7 expression is essential (Couturier et al.,
1990). 7 subunits fold and assemble into pentamers in the endoplasmic reticulum (ER) before
being transported through the Golgi apparatus to the plasma membrane. The proper folding and
assembly that precedes export from the ER is believed to be host cell line-dependent and involve
currently unknown cellular machinery (Gu et al., 1991; Green and Millar, 1995). Before
achieving functionality, each subunit must fold properly and undergo a battery of post-
translational alterations, such as glycosylation of extracellular regions (Green and Millar, 1995).
In addition to the requirement for subunits to fold into a correct three dimensional conformation,
they must participate in necessary protein interactions. Evidence has suggested that early stages
of receptor folding typically involve several chaperone proteins.
An important chaperone involved in the maturation of 7 receptors is a protein called
Ric3 (Lansdell et al., 2005; Millar, 2008). Before the discovery of Ric3, the only proteins
implicated in the maturation of muscle nicotinic acetylcholine receptors were BiP, calnexin, and
48
14-3-3n (Gelman et al., 1995; Jeanclos et al., 2001; Blount and Merlie, 1991; Chang et al., 1997).
However, these are required for the maturation of many other proteins and are not specific for
nicotinic acetylcholine receptors (Shaw, 2000; Kleizen and Braakman, 2004). Proteins identified
in C. elegans using a genetic approach are more specific in their effects than those found in
mammalian cells through biochemical testing. Factors allowing successful maturation of
nicotinic receptors probably include both non-specific chaperones, such as BiP and calnexin, and
receptor-specific chaperones similar to those found in C. elegans. However, it is still not known
how many nAChR-specific and 7-specific chaperones exist. In C. elegans, Ric3 is the only
known chaperone to influence expression of all nicotinic receptor subtypes (Halevi et al., 2002).
Mammalian Ric3, like C. elegans Ric3, affects maturation of several mammalian nicotinic
receptor subtypes and 5HT3 receptors, but not other members of the Cys-loop ligand-gated ion
channel family (Treinin, 2008).
O. Ric3 has differential effects on expression of numerous receptors:
While exploring the cell line-dependency of 7 expression, Sweileh et al. (2000)
observed receptor expression in GH4C1 and SHEP1 cells. Although the complex, multi-step
nature of transmembrane maturation was recognized and thought to differ among various cell
lines, at the time it was unclear what might account for cell line-dependency. Perhaps
differences in surface receptor expression in GH4C1 and SHEP1 cells could be attributed to
different post-translational modifications on assembled subunits. Perhaps the turnover rate of 7
receptors in these cells may be lower than that of other cell lines. Another possibility accounting
for cell line-specific 7 maturation is the ability of certain cells to perform some process
downstream from the actual synthesis of receptor subunits. Perhaps cell line-specific molecular
chaperones necessary for such processes are lacking in non-expressing cells.
49
The discovery and characterization of Ric3 helped to further our comprehension of the
cell line-dependent nature of 7 expression. Since its discovery, it has been shown that Ric3
influences surface receptor expression in a manner that depends on receptor subtype and host cell
line, and its influence on receptor maturation is not confined to 7. Ric3 either promotes or
inhibits the activity of numerous receptors depending on the experimental system. For instance,
surface expression of 5HT3 receptors in HEK293 cells is significantly reduced when co-
expressed with human Ric3 (hRic3), while co-expression with 1 glycine has no effect on
glycine-evoked currents (Figure 33). In Xenopus oocytes hRic3 facilitates functional expression
of 5HT3 receptors (Cheng et al., 2005, 2007).
Figure 33: Ric3 effect
on expression of 5HT3
and glycine receptors. A) Effects of hRic3
on whole-cell currents
induced by 100 mM
serotonin or 1 mM
glycine in HEK cells
expressing 5HT3
receptors or human 1
glycine receptors.
B) Summary of peak
current amplitudes
observed in (A) (Halevi et al., 2003).
In HEK293 cells, Ric3 co-expression with 34 and 42 enhances surface expression
(Lansdell et al., 2005). However, as shown in Figure 34, co-expression of hRic3 with either
42 or 34 in Xenopus leavis oocytes results in significantly weaker currents compared to the
control condition without Ric3 (Halevi et al., 2003).
A
B
50
Figure 34: Differential effects of
hRic3 on expression of various
nicotinic receptors. A) Effects of hRic3 co-expression
on whole-cell currents elicited by
1 mM ACh in oocytes. B) Effects
of hRic3 co-expression on BGT
binding in oocytes expressing 7.
C) Summary of peak current
amplitudes observed in (A)
(Halevi et al., 2003).
The differential effects of human Ric3 on 5HT3 and heteromeric nicotinic receptor expression
may be due to the different expression systems involved.
P. Ric3 increases expression of 7 nicotinic receptor:
Among mammalian receptors that have been examined, Ric3 most prominently affects
the expression of 7. Functional 7 is expressed poorly in transfected mammalian cell lines
lacking endogenous receptor expression (Sweileh et al., 2000), but co-expression of Ric3
dramatically boosts levels of surface 7 receptors (Lansdell et al., 2005; Williams et al., 2005).
In 2008, Castelan et al. used this technique to explore the effects of hRic3 on the delivery of
newly assembled 7 receptors to the surface of the cell membrane, as well as their rate of
turnover from the surface. Their results, illustrated in Figures 35 and 36, demonstrate that hRic3
expedites the arrival of new receptors to the cellular surface and lowers their rate of
internalization (Castelan et al., 2008).
51
Figure 35: Effect of hRic3 on 7
receptor membrane insertion. 125
I-BGT
binding assay reveals that hRic3 increases
the rate of arrival of new 7 receptors
to the surface of the cell (Castelan et al., 2008).
Figure 36: Effect of hRic3 on 7 receptor
turnover. 125
I-BGT binding assay shows that
hRic3 lowers the rate of turnover of 7 receptors
from the surface of the cell. Surface turnover
rates were determined by measuring radioligand
released into oocyte culture
medium (Castelan et al., 2008).
Although Ric3 affects surface expression of multiple nicotinic receptor subtypes in C.
elegans, the most profound effect of the chaperone is its ability to allow 7 expression in
otherwise non-permissive cells. HEK293 cells transfected with rat 7 and hRic3 displayed
nicotine-induced inward currents showing the rapid activation and desensitization characteristic
of 7 receptors, while no currents were detected in HEK293 cells transfected with 7 alone
(Williams et al., 2005). Similar findings were observed in HEK293 cells expressing human 7.
As depicted in Figure 37, HEK cells co-transfected with human 7 and hRic3 displayed more
robust currents upon application of 1 mM nicotine than cells transfected with 7 alone (Williams
et al., 2005).
52
Figure 37: Co-expression of 7 and
hRic3 in HEK293 cells. Reponses
to 1 mM ACh applied during the time
indicated by the horizontal bar in two
different oocytes injected with rat 7
(black trace) or rat 7 + hRic3 (gray
trace) (Williams et al., 2005).
Ric3 also influences 7 expression in Xenopus oocytes. As shown in Figure 38, oocytes infected
with 7 and hRic3 exhibited more robust currents upon 1 mM acetylcholine application than
oocytes infected with 7 alone (Williams et al., 2005).
Figure 38: Whole cell currents in
oocytes co-expressing 7 and hRic3. Current responses to 1 mM acetylcholine
applied during the time indicated by the
horizontal bar in mock transfected
(black trace) or transfected with hRic3
(gray trace) (Williams et al., 2005).
Despite variable effects of Ric3 on expression of heteromeric nicotinic receptors, Ric3
promotion of surface 7 expression has been consistently demonstrated. The precise mode of
action by which Ric3 promotes receptor expression remains under speculation.
Q. Ric3 mechanism of action and regions of interest:
Ric3 is a highly charged protein, consisting of 8% aspartic acid, 13% glutamic acid, 10%
lysine and 8% arginine (Altschul et al., 1990). The Ric3 transcript contains 6 exons that code for
a variety of isoforms typically containing approximately 350-400 amino acids (Halevi et al.,
53
2003). Human and mouse Ric3 both have multiple isoforms and two transmembrane domains-
one of which may be a signal sequence. Also, both human and mouse Ric3 have two isoforms
whose identity hinges upon the presence or absence of a serine residue located at an ambiguous
splice in exon 4. Aside from the ambiguous splice site, Ric3 has other notable features which
require further investigation. For example, there is at least one coiled-coil domain which may
(Wang et al., 2009) or may not (Ben-Ami et al., 2005) be essential for functionality. Also, the
issue of Ric3 transmembrane domains- the first of which may (Castelan et al., 2008) or may not
(Wang et al., 2009) be a signal sequence- represents another point of speculation with two
topology predictions shown in Figure 39.
Figure 39: Two models of the transmembrane topology of mouse Ric3. A) A type III protein
that crosses the membrane twice with the N-terminal and C-terminal regions in the cytoplasm.
B) A type I protein having a single transmembrane domain with the N-terminal region in the ER
lumen and the C-terminal region in the cytoplasm. SS, signal sequence; TM, transmembrane
domain; CC, coiled-coil domain (Wang et al., 2009).
The transmembrane topology of Ric3 is currently just one of several characteristics of the protein
that remain unclear.
54
Wang et al. (2009) evaluated several uncertainties regarding mRic3: 1) localization, 2)
transmembrane orientation, 3) the role of the N-terminal sequence in targeting the protein to the
ER, 4) mechanism of facilitating 7 subunit folding and assembly and 5) the role of the coiled-
coil domain. Colocalization studies with ER and Golgi markers demonstrated that in COS cells
mRic3 is localized in the ER (Wang et al., 2009), contesting evidence that Ric3 cycles between
the ER and Golgi (Cheng et al., 2007) or travels to the surface of the cell (Williams et al., 2005).
To investigate the transmembrane orientation of mRic3, Wang et al. (2009) examined whether
consensus sequence sites for N-glycosylation, including a native site and several sites introduced
into various positions, were glycosylated. Neither the native site, nor any site that was
introduced on the C-terminal side of the transmembrane domain, was glycosylated. However, a
site introduced on the N-terminal side of the hydrophobic sequence was glycosylated, indicative
of a single-pass membrane protein whose N-terminal is lumenal.
While studying the role of the N-terminal sequence in targeting mRic3 to the ER, Wang
et al. (2009) demonstrated the first 31 amino acids of the protein act as a cleavable signal
sequence (SS) restricting the protein to ER localization. Elimination of these amino acids
disrupts targeting to the ER and results in diffuse distribution. Furthermore, linking the first 31
amino acids to DsRed, typically found in the cytoplasm, results in ER localization. The finding
that the N-terminal sequence of mRic3 is a signal sequence required for direction to the ER
supports previous findings from Cheng et al. (2007). To define the role of mRic3 domains in
facilitating maturation of 7, mutagenesis studies were carried out. The various Ric3 mutants
investigated are shown in Figure 40.
55
Figure 40: Residues 1-168 comprise
the minimal function domain of mRic3.
A) Mutant mouse RIC-3 protein used
for transfection. B) COS cells were
transfected with h7 cDNA either
alone or with wt or mutated mRic3.
Surface receptor expression was monitored
by 125
I-BGT binding assay.
C) Summary of inward currents upon
3 mM ACh application recorded in
BOSC cells either transfected with h7 or
both 7 and mRIC-3 mutants
(Wang et al., 2009).
Mutagenesis studies revealed several findings regarding the roles of mRic3 domains in
promotion of 7 maturation. First, truncating the N-terminal region greatly diminishes mRic3
functionality (Wang et al., 2009). Since this region possesses the signal sequence directing the
protein to the ER, it appears that ER localization is a requirement for protein function. On the
other hand, mutants with C-terminal deletions display similar activity with respect to surface 7
expression compared to the full-length protein, provided the coiled-coil domain remains intact.
Deletion of all or part of the coiled-coil domain significantly reduced Ric3 activity, contrasting
the finding that the coiled-coil domain is not required for expression of certain C. elegans
receptors (Ben-Ami et al., 2005). Second, elimination of the coiled-coil domain does not abolish
A
56
protein interactions between mRic3 and 7, as similar levels of 7 were co-precipitated with
mRic3 when 7 was co-transfected with either normal or mutant Ric3 without the coiled-coil
domain. Third, a mutant Ric3 lacking the N-terminal domain and largely excluded from the ER
failed to bind 7, suggesting that the coiled-coil domain alone is not sufficient for the binding of
mRic3 to 7. Fourth, to determine whether the coiled-coil domain may be required for Ric3-
Ric3 interactions, mRic3 mutants with partial or complete coiled-coil domain deletions were
investigated using immunoprecipitation studies. A significantly weaker interaction was observed
with mutants missing the second half of the coiled-coil domain, the first half, or the whole
coiled-coil domain (Figure 41). This suggests the coiled-coil domain, expressed in exon 4, is
essential for mRic3 self-association required for functionality (Wang et al., 2009). mRic3
promotes 7 maturation through association between its cytoplasmic coiled-coil domains, and
amino acids 1-168 form the minimal functional domain of mRic3.
Figure 41: The coiled-coil domain is essential for self-association of mRic3. A) Lysates of
cells expressing Ric3 with h7 were immunoprecipitated with Ric3 antibody and probed with 7
antibody. 7 coimmunoprecipitates with both mRic3 and mRic3 (∆ 138-168) but not
mRic3(∆96-367). B) C-terminal myc and GFP tags were fused to mutant Ric3. Lysates of cells
co-expressing tagged proteins were precipitated with myc antibody and probed with anti-GFP
antibody. The myc-tagged and GFP-tagged mRic3 (∆154-168) show weak interaction, and
neither tagged mRic3 (∆138-153) nor tagged mRic3 (∆138-168) co-precipitate (Wang et al.,
2009).
A B
57
Studies elucidating the roles of Ric3 exons in allowing surface 7 expression are
important when considering regions to target for knockdown via RNAi. For example, since no
functional splice variants of Ric3 lacking exon 2 have been shown to impact surface 7
expression, this is an ideal region to target for knockdown. Finally, Wang et al. examined the
role of Ric3 7 maturation in HEK293 cells. Although 7 protein is produced in the absence of
Ric3, surface receptors are undetectable by both 125
IBGT binding and electrophysiological
experiments. Less than 15% of 7 subunits demonstrate BGT binding, indicating that most
subunits are unfolded and unassembled. Therefore, Ric3 probably acts before transport of the
fully assembled receptor to the cell surface. Ric3 transfection marginally raises levels of 7
mRNA, but greatly enhances levels of surface receptors, indicating that the major role of Ric3 is
to facilitate folding and assembly of 7 subunits into complete, pentameric receptors that can be
transported to the surface of the cell. Since Ric3 promotes 7 expression, it is presumable that
Ric3 expression correlates closely with that of surface 7 receptors. However, it has been
shown that this is not always the case.
R. 7 nicotinic receptor expression without Ric3:
In several mammalian cell lines, Ric3 co-transfection with 7 enhances surface receptor
expression (Lansdell et al., 2005; Williams et al., 2005). However, GH4C1 cells infected with
7 alone show robust surface expression detected via 125
I-BGT binding (Cooper and Millar,
1997; Sweileh et al., 2000; Quik et al., 1996). We originally hypothesized that GH4C1 cells
already possess Ric3 to promote surface 7 expression. However, since Ric3 mRNA
localization does not always correlate with levels of 125
IBGT binding, we remained open to the
possibility that these cells may possess an unknown 7 chaperone. Castelan et al. (2008) used
58
an antibody that cross-reacts with human and rat Ric3 protein to localize sites in the rat central
nervous system. Immunoreactive-like staining demonstrated the presence of Ric3 protein in rat
brain, the results of which are summarized in Table 3 (Castelan et al., 2008).
Table 1: Ric3 distribution and labeling intensity in rat CNS. - not detected; + weak signal; ++
moderate signal; +++ intense signal; s.c. scattered cells (Castelan et et al, 2008). As shown in
Figure 15, a different distribution was observed by Halevi et al. in mouse CNS (Halevi et al,
2003).
Table 3: Ric3 distribution and labeling intensity in rat CNS. – not detected; + weak signal;
++ moderate signal; +++ intense signal; s.c. scattered cells (Castelan et al., 2008).
In rat brain, levels of 125
IBGT binding generally correlate with Ric3 transcript localization.
However, in mouse brain, discrepancies between Ric3 mRNA and 125
IBGT binding have been
observed. In situ hybridization experiments using mouse brain demonstrated low Ric3 transcript
levels in parts of the hippocampus (Halevi et al., 2003) where 125
I-BGT binding is robust
(Whiteaker et al., 1999). Evidence suggesting a discrepancy between Ric3 mRNA and
125IBGT binding is presented in Figure 42.
59
Figure 42: Analysis of Ric3 transcript localization and 125
IBGT binding.
A) Bright field image of mouse hippocampus.
B) Dark field image of mouse hippocampus in situ hybridization showing Ric3 mRNA in CA1-
CA3 (red arrow) but not dentate gyrus (Halevi et al., 2003).
C) 125
I-BGT binding in rat dentate gyrus (blue arrow) (Clarke et al., 1985) - similar binding is
found in mouse (Whiteaker et al., 1999).
Evidence of surface 7 expression in a region lacking Ric3 mRNA opposes our initial
hypothesis that GH4C1 cells already possess Ric3 to allow receptor expression and support an
alternative hypothesis that these cells have an unknown 7 chaperone. Since there are multiple
splice variants of Ric3, we used RNAi methods to look at the consequences of knocking down
different Ric3 splice variants on surface 7 expression and determine whether GH4C1 cells may
possess a functional Ric3 splice variant.
S. Exploring the consequences of Ric3 protein knockdown on surface 7 expression:
RNAi is the process by which double-stranded RNA (dsRNA) is processed into small
interfering RNAs (siRNAs) that degrade complementary mRNA transcripts (Kim and Rossi,
2008). The finding that siRNA molecules are endogenously produced and may control gene
expression has led to applications in studies of gene function and disease management. siRNAs
are ~21 bp long sequences that have characteristic 2 nucleotide-long 3’ overhangs enabling them
to be recognized by RNAi processing enzymes. The definitive event in the RNAi process is
homology-dependent degradation of target mRNA (Kim and Rossi, 2008; Ghildiyal and Zamore,
C 125
I-BGT binding
A B C
60
2009). In mammalian cells, siRNAs are produced by cleavage of dsRNA precursors by the
RNase III endonuclease Dicer. Dicer is complexed with RNA-binding proteins, the TAR-RNA-
binding protein, PACT, and Ago-2, which transfers siRNA to the RNA-induced silencing
complex- RISC (Naqvi et al., 2009; Kim and Rossi, 2008). When siRNAs are loaded onto RISC
they are still double-stranded. After Ago-2 cleaves and releases the “passenger” strand, the
active RISC contains a single-stranded “guide” RNA sequence that base pairs to complementary
mRNA sequences. The determination of which strand is the “guide” and which is the
“passenger” is dictated by thermodynamic stabilities of siRNA overhangs (Kim and Rossi, 2008;
Durcan et al., 2008). Ago-2 preferentially binds to the less stable end. Transcripts containing
complementary sequences to the “guide” strand are cleaved by the RNase activity of Ago-2.
Therefore, the functionality of siRNA is the consequence of mRNA cleavage and degradation.
The siRNA pathway is shown in Figure 43 (Aigner, 2006).
Figure 43: Mechanism of RNA
interference in mammalian systems.
(Aigner, 2006).
61
In studies involving RNAi, an important factor determining the mode of gene silencing is
the desired length of the knockdown effect. Short interfering RNA (siRNA) is an effective
method if the objective is to explore the short-term effects of knocking down a gene. However,
since siRNA does not divide in tandem with the cells, its levels become less concentrated as cells
divide (Sandy et al., 2005). Therefore, the silencing effect typically lasts for a relatively short
period of time, and additional transfections are required to prolong the knockdown effect-
especially for proteins with low rates of turnover. If the aim is to achieve long-term knockdown
of a stable protein upon a single transfection, vector-based short hairpin RNA (shRNA) is a more
suitable approach (Sandy et al., 2005). A major advantage of using shRNA is that since the
vector is passed on to daughter cells, the gene silencing effect is inherited. Scrambled shRNA
can be used as a control to investigate off-target effects.
62
II. SPECIFIC AIMS OF THE THESIS
1) Investigate 7-mediated STAT3 signaling in heterologous expression systems.
1a) Investigate the feasibility of using a STAT3-MetLuc signaling assay.
1b) Validate STAT3-ML signaling assay by measuring IL6-driven expression of
secreted alkaline phosphatase and luciferase in Invivogen’s HEK-Blue IL6 cells.
1c) Determine ideal conditions for nicotine-induced increases in 7-driven
luciferase expression and establish whether increased luciferase expression is
STAT3-attributable.
1d) Construct cell lines expressing both 7 and STAT3-driven luciferase
plasmids and re-assess ideal conditions for nicotine-induced increases in 7-
driven luciferase expression.
1e) Use STAT3-MetLuc assay to study Ca2+
-dependency of 7-mediated STAT3
signaling.
1f) Investigate the role of Ric3 in allowing 7-driven STAT3 signaling in non-
permissive cell lines.
2) Test whether Ric3 is the only chaperone for 7 nicotinic receptors by comparing
receptor expression in permissive cells with non-permissive cells before and after knocking
down Ric3.
2a) Clone rat Ric3 from rat brain and investigate functionality of the protein.
2b) Establish selectivity of Ric3 antibodies and demonstrate cell line-dependency
of Ric3 transfection for surface 7 expression.
2c) Test whether RNAi methods that block surface 7 expression in non-
permissive cells fail to block expression in permissive GH4C1 cells.
63
2d) Obtain shRNA constructs to investigate alternative splicing, and study Ric3
protein turnover by determining effects of Ric3 knockdown on 7 expression in
cell lines stably expressing Ric3.
3) Establish a proof-of-principle for functionally cloning additional 7 chaperones
3a) Establish method of plasmid recovery by showing recovery of S-
rRic3/pREP4/hygromycin.
3b) Construct S-rRic3/pREP9/KG using In-Fusion cloning kit (Clontech) and
recover plasmid.
64
III. MATERIALS AND METHODS
I. Cell culture and transfections
All cell lines were grown at 37˚ C in 5% CO 2. SHEP1 cells were grown in Dulbecco’s modified
Eagle’s medium (DMEM) containing 5% heat inactivated Fetal Bovine Serum (FBS) and 10%
Donor Horse Serum (DHS) supplemented with 1% penicillin-streptomycin. Rat pituitary
GH4C1 cells were grown in Ham’s F10 medium supplemented with 10% FBS and 0.5%
penicillin-streptomycin. HEK293 cells were grown in DMEM containing 10% FBS and 1%
penicillin-streptomycin. Cells grown in 75 cm2 or 25 cm
2 cell culture flasks were passaged onto
96-, 24-, or 6-well plates (BD Falcon, San Jose, CA, USA) at seeding densities of 10,000
cells/well, 50,000 cells/well, and 200,000 cells/well, respectively, at least 3 hours before
transfection and approximately 2-3 days prior to binding assay or protein extraction. Cell
counting was done using a hemacytometer. All transfections were performed with FuGeneHD
(Roche, Indianapolis, IN, USA) as indicated by the manufacturer, using 2 g DNA per condition.
During transfections, DNA constructs (aside from empty pREP4 or pREP9 vectors) were used in
equal amounts across all samples. Transfection efficiency was monitored by expression of either
a green or red fluorescent protein construct. SHEP1 and GH4C1 cell lines semi-stably
expressing S-rRic3 with and without 7 were created by passaging transfected cells into vessels
containing hygromycin (EMD Biosciences, La Jolla, CA, USA). To maintain selection pressure,
cells were maintained in 100 g/ml hygromycin. After sufficient selection, these cells were
either stored for future experiments or used to create cell lines semi-stably transfected with
shRNA plasmids. These cells were passaged into vessels containing hygromycin and puromycin
(MP Biomedicals, Solon, OH, USA). Cell lines semi-stably transfected with S-rRic3, 7, and
65
shRNA were maintained in growth media containing 100 g/ml hygromycin and 1 g/ml
puromycin.
II. Chemicals and plasmids
BGT and nicotine tartrate were purchased from Biotoxins Inc. (St. Cloud, FL, USA). Plasmid
expressing human Ric3 was purchased from Origene (Rockville, MD, USA) while the rat Ric3
gene was cloned from total RNA from rat brain prepared by using an Absolutely RNA kit
(Stratagene, Santa Clara, CA, USA). Reverse transcriptase-polymerase chain reaction (RT-PCR)
amplification was performed using the Advantage2 PCR Kit (Clontech Laboratories, Mountain
View, CA, USA) to obtain cDNA which was cloned into the EcoI-XhoI sites of pREP4. siRNA
against human and rat Ric3 was designed and custom synthesized by Integrated DNA
Technologies (Coralville, IA, USA), while rat Ric3 shRNA was purchased from Origene
(Rockville, MD, USA). Human/mouse/rat Ric3 primary antibodies and HRP-conjugated
secondary antibodies were obtained from Santa Cruz Biotechnologies (Santa Cruz, CA, USA).
Ric3 blocking peptide for competition studies was also obtained from Santa Cruz
Biotechnologies. STAT3-MetLuc and STAT3-EGFP reporter vectors were prepared by Dr.
Ralph Loring and Sharath Chandra Madasu. The STAT3 promoter element was excised from a
STAT3 luciferase reporter vector (Panomics, Fremont, CA, USA) and cloned into AgeI and
BsrG1 restriction sites of the pMetLuc reporter vector.
III. Ric3 clones
Primers for cloning full-length rat ric3 were based on sequence XM_001072861–(PREDICTED:
Rattus norvegicus similar to resistance to inhibitors of cholinesterase 3 homolog (LOC687147)).
The forward primer included a NheI site 5’ to the open reading frame with the sequence
TTTTTAGCTAGCATGGCGTACTCCACAGTACA. The reverse primer included an XhoI site
four bases past the stop codon (5’ to 3’ TTTTTTCTCGAGGCTTTCACTCAAAACCCTGG).
66
mRNA purified (Stratagene Absolutely mRNA kit) from flash-frozen rat hippocampus,
cerebellum, and cortex was copied into cDNA using a Superscript II cDNA kit (Invitrogen).
PCR amplicons were cloned into Invitrogen PCDNA3.1/V5-His TOPO TA plasmid, subcloned
into Invitrogen pREP4 episomal plasmid using NheI and XhoI restrictions sites, and then
sequenced. Human Ric3 isoform A was purchased from Origene (Catalog # TC112180) and
subcloned into Invitrogen pREP4 plasmid and sequenced.
IV. Radioligand binding
-BGT was prepared by Dr. Ralph Loring and binding to 7 receptors was performed on live
cells. For our purposes, surface expression was investigated using -bungarotoxin dissolved
in Hank’s buffered saline solution (HBSS). Cells grown in 24-well or 96-well plates were
transfected as described above. After a period of at least 48 hours, each well was washed three
times with ice cold phosphate buffer saline (10 mM sodium phosphate, 0.9% NaCl) and
incubated with 10 nM 125
I -bungarotoxin in the presence and absence of unlabeled -
bungarotoxin for 3 hours on ice. Each well was washed three times with ice cold HBSS before
being solubilized in extraction buffer (0.5 M NaOH, 1% Triton X-100). All binding experiments
with 125
I-BGT were performed in HBSS containing 0.1% bovine serum albumin to reduce non-
specific binding. Radioactivity was measured using a Wallac Wizard gamma counter. Non-
specific binding was determined in the presence of 1 M -bungarotoxin.
Specific 125
I--bungarotoxin binding = Total binding minus Non-specific binding
V. Dot blot analysis
Total protein was extracted from cells grown in 6-well or 24-well plates using RIPA buffer
supplemented with PMSF to inhibit protease activity. After lysates were allowed to sit on ice for
30 min, they were centrifuged at 14,000 g for 10 min at 4˚ C. Supernatant was then aliquoted
into microcentrifuge tubes and stored in -20˚ C until further use. The BCA assay was used to
67
determine total protein levels prior to blotting on nitrocellulose, to which 500 ng total protein
was blotted per sample. After blotting, the membrane was blocked for at least 2 h at room
temperature with 5% BSA in TBS-T (20 mM Tris HCl, 150 mM NaCl, 0.2% Triton X-100), then
incubated for 1 h with anti-Ric3 antibody diluted 1:400 in 5% BSA in TBS-T. After incubation
with the HRP-conjugated secondary antibody diluted 1:1200 in TBS-T at room temperature for 1
h, blots were visualized using the SuperSignal West Pico Chemiluminescent Substrate Kit
(Thermo Fisher Scientific Inc., Rockford, IL, USA). Luminescence was monitored using a
Kodak In-Vivo Imaging System using exposure times ranging from 20 s to 2 min.
VI. NFB and STAT3 reporter assays
NFB reporter assays were performed using the pNFB-MetLuc-reporter vector included in the
Ready-To-Glow Secreted Luciferase Reporter Kit (Clontech Laboratories, Mountain View, CA,
USA). Cells were transfected in a 96-well plate as described above with reporter plasmid, 7,
and Ric3. Approximately 48 h after transfection, cells were exposed to growth media containing
0.3 ng/l lipopolysaccharide (LPS). Nicotine-pretreated cells were exposed to 10 M nicotine 1
h prior to LPS treatment, while BGT-pretreated cells were exposed to the 7 antagonist 1 h
prior to nicotine exposure, followed by LPS exposure 1 h afterwards. After 24 h, 50 l
supernatant was collected from each well, to which 5 l substrate/reaction buffer from the
Ready-To-Glow Secreted Luciferase Reporter Kit was added according to the manufacturer’s
instructions. STAT3 reporter assays were performed using the pMetLuc reporter vector
containing the STAT3 promoter element and prepared by Dr. Ralph Loring and Sharath Chandra
Madasu as described above. Cells were transfected as described above with reporter plasmid,
7, and Ric3. Approximately 48 h after transfection, cells were treated with 10 M nicotine
following exposure to the appropriate STAT3 or JAK2 inhibitor for 1 h. Cells exposed to BGT
68
were also pretreated for 1 h prior to nicotine addition. After 24 h, 50 l supernatant was
collected from each well, to which 5 l substrate/reaction buffer was added as described for
NFB reporter assays. For some STAT3 reporter assays, rather than using substrate/buffer from
Ready-To-Glow Secreted Luciferase Reporter Kit, coelenterazine (CTZ) (NanoLight
Technology, Pinetop, AZ, USA) was used. For each sample, 20 l substrate/reaction buffer (1 l
CTZ:49 l PBS) was added. For both NFB and STAT3 reporter assays, substrate reactions
were carried out in Microlite 1 Luminescence Microtiter 96-well flat-bottom, opaque white
plates (VWR Scientific Products, Batavia, IL,USA) and luminescence was quantified using a
BioTek Synergy MX Microplate Reader.
VII. Data analysis:
SPSS was used for data analysis and results are presented as mean ± standard error of the mean.
Probability (p) <0.05 was considered statistically significant. ANOVA was used for
comparisons among groups.
69
IV. RESULTS
AIM 1
Aim 1a) Investigate the feasibility of using a STAT3-MetLuc signaling assay.
7 receptors signal via influx of calcium ions. Another mode of signaling, involving
STAT3 activation was demonstrated in macrophages (De Jonge et al., 2005) but has not been
studied in heterologous systems. Whether the two signaling pathways proceed independently of
one another is unclear. To explore calcium-dependency for 7-mediated STAT3 signaling, a
novel 7 signaling assay involving a STAT3-driven Metridia luciferase reporter was developed.
Reporter construction began with two commercially available plasmids: an NFB-MetLuc
reporter from Clontech’s Ready-To-Glow Secreted Luciferase Reporter System, and a STAT3-
firefly luciferase plasmid from Panomics. The Ready-To-Glow Secreted Luciferase Reporter
System has several advantages. Since Metridia luciferase is secreted into medium surrounding
cells, the same set of transfected cells can be used for multiple sets of analysis. The assay also
has low background and is more sensitive than fluorescence-based reporter assays (Ready-To-
Glow-Secreted Luciferase Reporter Systems User Manual. 2009. Clontech).
To explore the feasibility of using a STAT3-MetLuc reporter to study 7-mediated
STAT3 signaling, we first monitored levels of NFB in response to the endotoxin
lipopolysaccharide (LPS) using NFB-MetLuc already included in the kit. This plasmid
contains an NFB promoter element upstream of the Metridia luciferase gene (Ready-To-Glow-
Secreted Luciferase Reporter Systems User Manual. 2009. Clontech) and allows LPS-induced
increases in NFB to be monitored by collecting supernatant, adding substrate, and measuring
luminescence. This vector was used by Hosur and Loring (2011) during investigations into
42-mediated effects on NFB activity. NFB-MetLuc-transfected SHEP1 and GH4C1 cells
70
*
*
*
*
*
were exposed to nicotine in the presence of various concentrations of -bungarotoxin. In both
cells, nicotine blocked LPS-induced NFB activation, and 1-hour BGT pretreatment made cells
less responsive to nicotine-induced decreases in LPS-driven NFB production (Figure 44).
Overall, findings supported the viability of a MetLuc reporter for monitoring STAT3 activation.
Figure 44: LPS-induced increase in NFB is mediated by 7 in SHEP1 cells (A) and
GH4C1 cells (B). LPS-induced increase in NFB was blocked by 10 M nicotine, and BGT
blocked nicotine-induced decrease in NFB activity dose-dependently.
A
B
71
Excising the firefly luciferase gene from the Panomics vector and replacing it with the MetLuc
gene from the Clontech plasmid yielded a novel reporter in which STAT3 activation drives
secretion of Metridia luciferase into the medium surrounding transfected cells. The NFB
promoter within NFB-MetLuc has a SacI restriction site before and a HindIII restriction site
after the promoter element. Since these sites are also located before and after the STAT3
promoter element within the vector purchased from Panomics, replacing the NFB promoter in
NFB-MetLuc with a STAT3 promoter was relatively straightforward. A basic diagram of this
procedure- performed by Dr. Ralph Loring and Sharath Chandra Madasu- is shown in Figure 45.
Figure 45: Construction
of STAT3-MetLuc
reporter plasmid.
Replacement of the NFB
promoter in the Clontech
MetLuc plasmid with a
STAT3 promoter from the
Panomics firefly luciferase
plasmid yielded a STAT3-
MetLuc reporter. In this
reporter the Metridia
luciferase reporter gene is
under the control of a
STAT3 promoter.
After constructing the STAT3-ML reporter vector, we needed to validate its ability to monitor
activation of the JAK2-STAT3 pathway. To carry out this validation, we obtained HEK-Blue
IL6 cells from Invivogen.
Aim 1b) Validate STAT3-ML signaling assay by measuring IL6-driven signaling of
secreted alkaline phosphatase and luciferase in Invivogen’s HEK-Blue IL6 cells.
HEK-Blue IL6 cells are a validated reporter system using HEK293 cells stably
transfected with human IL6R cDNA and a STAT3-inducible secreted alkaline phosphatase
(SEAP) reporter. Exposure to IL6 stimulates IL6R and drives activation of STAT3, which
X
X Ligate Cut & discard
Cut & discard
72
0
0.5
1
1.5
2
2.5
3
0 5 10 15 20 25 30 35
Rela
tive
Lu
min
es
ce
nc
e
IL6 (ng/ml)
results in release of SEAP into media surrounding the cells. SEAP can be monitored adding
QUANTI-Blue to collected supernatant and measuring absorbance at 630 nm (Figure 46).
Figure 46: In HEK-Blue IL6 cells, IL6R activation
of the STAT3 pathway leads to SEAP expression.
IL6 is a pro-inflammatory cytokine implicated in the acute
immune response. Upon IL6 binding to the IL6 receptor,
the complex of IL6 and IL6R interacts with and leads to
dimerization of gp130. This leads to the activation and
phosphorylation of JAK1, JAK2, and Tyk2. Activated
JAKs induce the phosphorylation, dimerization, and
translocation of STAT3 into the nucleus, where it drives
expression of secreted alkaline phosphatase (HEK-Blue
IL-6 Cells: Interleukin 6 Sensor Cells, Catalog # hkb-il6).
Preliminary experiments to validate the IL6 reporter system showed that IL6 concentrations of 3
and 10 ng/ml produce the greatest increases in IL6-driven SEAP expression in cells exposed for
24 hours (Figure 47). This was in agreement with the manufacturer’s recommendations.
Furthermore, 24-hour exposure to nicotine up to 100 M did not induce SEAP expression,
demonstrating the lack of nicotinic receptor contributions (not shown).
Figure 47: HEK-Blue IL6 cells treated with IL6 show dose-dependent increase in SEAP
expression. Untransfected HEK-Blue IL6 cells were treated with varying concentrations of IL6
for 24 hours. Following supernatant collection, SEAP activation was monitored via absorbance
at 630 nm (n=4).
**
** **
*
* p < 0.01; ** p < 0.001
73
After confirming the ability of IL6 to increase SEAP expression in the HEK-Blue system, we
sought to validate our own signaling assay by comparing it against Invivogen’s product.
Transfecting HEK-Blue IL6 cells with STAT3-ML allowed comparisons between
STAT3-driven SEAP expression- monitored through absorbance- and STAT3-driven MetLuc
expression- monitored through luminescence. Again, a prime advantage of both signaling assays
is the lack of need to lyse the cells. Since both SEAP and MetLuc are secreted in medium
surrounding cells upon STAT3 activation, supernatant can be collected from the same well of
transfected cells. This allows direct comparison of STAT3-driven MetLuc and SEAP
expression. HEK-Blue IL6 cells transfected with STAT3-ML were exposed to IL6 for 24 hours.
Supernatant was collected and exposed to QUANTI-Blue before monitoring absorbance for
SEAP detection. Additional supernatant from the same wells was collected and treated with
coelenterazine (CTZ) before measuring luminescence to detect MetLuc expression. Initial
experiments using HEK-Blue IL6 cells transfected with STAT3-ML showed IL6-driven
increases in luciferase expression (Figure 48), justifying further validation studies using this cell
line.
Figure 48: IL6 exposure
to HEK-Blue IL6 cells
transfected with STAT3-
ML increases luciferase
expression. HEK-Blue IL6
cells were transiently
transfected with STAT3-ML
approximately 48 hours
before 24-hour application
of IL6. In transfected, but
not untransfected cells, IL6
treatment increased
luciferase expression (n=4).
Transfection: - - STAT3-ML STAT3-ML IL6 (ng/ml): - 10 - 10
*
*p < 0.05
74
0
0.5
1
1.5
2
2.5
3
Re
lati
ve
Ab
so
rba
nc
e (
63
0 n
m)
After observing IL6-elicited increased luciferase expression in HEK-Blue IL6 cells transfected
with STAT3-ML, completion of assay validation was carried out with 7 antagonists and
JAK/STAT inhibitors. If SEAP and luciferase expression increases are attributable to STAT3,
JAK/STAT inhibitors would be expected to diminish both IL6-induced SEAP and luciferase
expression in HEK-Blue IL6 cells transfected with STAT3-ML. As shown in Figure 49, JAK
inhibitior I and the STAT3 inhibitor, S3I-201, lowered IL6-driven SEAP and luciferase
expression to comparable extents. As expected, BGT did not lower reporter expression,
suggesting that IL6-induced reporter expression is attributable to IL6R, not 7, activation.
Figure 49: IL6 exposure to
HEK-Blue IL6 cells produces
similar increases in SEAP and
luciferase expression. HEK-
Blue IL6 cells were transiently
transfected with STAT3-ML
approximately 48 hours before
24-hour application of IL6.
Supernatant from identical
wells was assessed for both
luciferase (A) and SEAP
expression (B). BGT and
JAK/STAT inhibitors were
added 1 hour before nicotine
exposure. JAK/STAT
inhibitors reduced expression
of both reporters, while BGT
had no effect. In UT cells,
IL6 produced increases in
SEAP (bottom) expression but
not luciferase (top) expression
(n=4).
0
0.5
1
1.5
2
2.5
3
3.5
Re
lati
ve
Lu
min
es
ce
nc
e
Transfection: - - STAT3 STAT3 STAT3 STAT3 STAT3 STAT3 IL6 (ng/ml): - 10 - 10 10 10 10 10 [Inhibitor]: - - - - JAK Inh. I AG490 S3I-201 BGT (150 nM) (30 M) (30 M) (20 nM)
Transfection: - - STAT3 STAT3 STAT3 STAT3 STAT3 STAT3 IL6 (ng/ml): - 10 - 10 10 10 10 10 [Inhibitor]: - - - - JAK Inh. I AG490 S3I-201 BGT (150 nM) (30 M) (30 M) (20 nM)
* *
* * *
*p < 0.05
*p < 0.05
A
B
75
By transfecting HEK-Blue IL6 cells with STAT3-ML, treating them with IL6, and monitoring
STAT3-driven increases in SEAP and MetLuc, the effectiveness of the STAT3 luciferase assay
was measured against a previously validated, commercially available system. Exposure to 10
ng/ml IL6 for 24 hours showed comparable increases in SEAP and MetLuc expression.
Furthermore, IL6-driven increases in SEAP and MetLuc were lowered by pretreatment with
JAK/STAT inhibitors. Since STAT3-driven reporter expression was driven by IL6R activation
and not 7-mediated, BGT pretreatment had no effect on expression of either SEAP or
MetLuc. Following validation of the STAT3-ML signaling assay, we determined ideal
conditions for nicotine-induced, STAT3-driven luciferase expression.
Aim 1c) Determine ideal conditions for nicotine-induced increases in 7-driven luciferase
expression and establish whether increased luciferase expression is STAT3-attributable.
In the STAT3-ML signaling assay, nicotinic activation of surface 7 receptors is the first
event in a pathway leading to secretion of luciferase enzyme into the surrounding media.
Therefore, when optimizing this signaling assay, two important parameters to consider were
concentration of nicotine and duration of nicotine exposure. The concentration of nicotine in
smokers’ blood is typically on the order of 200-300 nM (Henningfield et al., 1998). In a mouse
model of multiple sclerosis, similar concentrations of nicotine diminished autoimmune responses
(Shi et al., 2009). At concentrations achieved in smoker’s blood, nicotine attenuates CNS
inflammation as well as autoimmune responses in experimental autoimmune encephalomyelitis,
a mouse model of multiple sclerosis (Shi et al., 2009). Hosur and Loring (2011) reported that
100-300 nM nicotine decreased LPS-induced NFB activity and IL6 generation in SHEP1 cells
expressing human 42. In the current project, initial experiments to determine optimal
concentrations of nicotine for inducing STAT3-driven MetLuc expression showed that 10 M
nicotine induced the greatest increase in luciferase expression following 24-hour exposure.
76
0
0.5
1
1.5
2
2.5R
ela
tive
Lu
min
escen
ce
Treatment
Since 100 M nicotine did not induce a significantly greater increase compared to 10 M
nicotine, we concluded that 10 M was a suitable concentration to use in future experiments.
STAT3-driven luciferase expression appeared to be 7 attributable, as cells transfected with
STAT3-ML alone failed to show increased MetLuc expression upon nicotine application (Figure
50).
Figure 50: Nicotine dose-
response curve in SHEP1
cells transfected with
STAT3-ML. Cells
transfected with 7, S-rRic3
and STAT3-ML were
exposed to nicotine.
Following 24-hour exposure,
10 and 100 M yielded the
greatest increases in
luciferase expression.
STAT3-ML transfection in
the absence of 7 does not
allow nicotine-dependent
luciferase expression (n=4).
After determining the ideal nicotine concentration for inducing STAT3-driven luciferase
expression, time course experiments were performed to investigate whether exposure periods
longer or shorter than 24 hours may yield improved signals. As shown in Figure 51, 24-hour
nicotine exposure evoked the greatest rise in luciferase expression, again resulting in a ~2-fold
increase compared to untreated and untransfected conditions.
Transfection: - 7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3 STAT3 STAT3 STAT3 STAT3 STAT3 STAT3
Nicotine: - - 0.1 M 1 M 10 M 100 M 10 M
** **
*
*p < 0.05; ** p < 0.01 compared to untreated
7/Ric3/STAT3 (blue)
77
0
0.5
1
1.5
2
2.5
UT UT/nic24 hr
a7 10min
a7 1 hra7 2 hra7 4 hra7 8 hr a7 12hr
a7 24hr
Rela
tive L
um
inescence
Nicotine exposure
Figure 51: Nicotine time course for driving luciferase expression in SHEP1 cells. 24-hour
continuous 10 M nicotine exposure yielded the greatest increase in STAT3-driven luciferase
expression. 48-hour exposure resulted in luminescence approximately half that of 24-h condition
(not shown).
After determining that 24-hour exposure to 10 M nicotine yielded the greatest increases in
luciferase expression, experiments were performed to confirm that increased expression was 7-
and STAT3-attributable.
To evaluate whether increased luciferase expression is attributable to 7 activation and
subsequent STAT3 signaling, various 7 and JAK/STAT blockers were used. The first step in
the signaling assay involves the binding of nicotine to 7 receptors. Presumably, if 7 is
blocked and nicotine binding is hindered, STAT3 activation will drop and result in reduced
luciferase expression. Pretreatment with varying concentrations of BGT 1 hour before nicotine
exposure resulted in a dose-dependent decrease in nicotine-induced luciferase expression (Figure
52). Furthermore, nicotine failed to activate the JAK-STAT pathway in cells transfected with
STAT3-ML alone, suggesting that luciferase expression relies on 7 activation. To confirm the
Transfection: - - 7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3 STAT3 STAT3 STAT3 STAT3 STAT3 STAT3 STAT3 Duration: - 24 h 10 m 1 h 2 h 4 h 8 h 12 h 24 h nicotine exposure
*
**
** *p < 0.05; ** p < 0.01 compared to untransfected, 24 hour nicotine exposure (blue)
78
0
0.5
1
1.5
2
2.5
3
UT/UT a7/UT a7/nicnic/2 nM aBGTnic/20 nM aBGTnic/200 nM aBGTnic/2000 nM aBGTSTAT3-MetLuc
Rela
tive L
um
inescence
Treatment
necessity of STAT3 activation for reporter secretion, cells were pretreated with JAK/STAT
inhibitors.
Figure 52: BGT pretreatment blocks 7-mediated luciferase expression. SHEP1 cells
transfected with 7, Ric3, and STAT3-ML were pretreated with BGT for 1 hour before 24-
hour exposure to 10 M nicotine. BGT dose-dependently reduces nicotine-mediated STAT3-
driven luciferase expression (n=4).
Two JAK inhibitors- AG490 and JAK inhibitor I- were used to test JAK2 dependency for
nicotine-mediated STAT3-driven luciferase signaling. Since JAK2 activation drives
phosphorylation and activation of STAT3, inhibiting JAK2 should lower the signal elicited by
nicotine application. SHEP1 cells transfected with 7, Ric3, and STAT3-ML were treated with
10 M nicotine for 24 hours in the presence and absence of JAK inhibitor I or AG490. Hosur
and Loring (2011) showed that JAK2 inhibition using 30 M AG490 restored LPS-induced
NFB signaling in nicotine-treated h42 SHEP1 cells. As shown in Figure 53, 30 M AG490
interfered with nicotine-driven luciferase expression, as luminescence was lowered to levels
similar to those seen for untransfected and untreated conditions.
Transfection: - 7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3 STAT3 STAT3 STAT3 STAT3 STAT3 STAT3 STAT3
Nicotine: - - 10 M 10 M 10 M 10 M 10 M 10 M BGT: - - - 2 nM 20 nM 200 nM 2 M -
**
* *
*p < 0.05; ** p < 0.01
compared to 7/Ric3/STAT3 transfected cells
exposed to 10 M nicotine without BGT (blue)
79
0
0.5
1
1.5
2
2.5
3R
ela
tive
Lu
min
esc
en
ce
Figure 53: JAK2 inhibition reduces nicotine-dependent luciferase expression. SHEP1 cells
transfected with 7, Ric3, and STAT3-ML were exposed to 10 M nicotine for 24 hours.
Nicotine exposure resulted in a ~2-fold increase in luciferase expression compared to
untransfected and untreated conditions. Cells pretreated with 30 M AG490 1 hour before
nicotine exposure showed reduced nicotine-induced luciferase expression (n=4).
Activated JAK2 induces STAT3 phosphorylation, and phosphorylated STAT3 dimerizes
and translocates to the nucleus to bind promoter elements of DNA to induce gene transcription
(Heinrich et al., 2003). De Jonge et al. (2005) demonstrated that nicotine dose-dependently
induces STAT3 phosphorylation, and STAT3 is an essential component of 7-mediated anti-
inflammation. S3I-201 is a STAT3 inhibitor that blocks STAT3 dimer formation and STAT3-
DNA binding. While examining the role of NFB activity in SHEP1 cells stably expressing
human 42, Hosur and Loring (2011) reported that 150 nM S3I-201 (NSC74859) restores LPS-
induced NFB signaling. We demonstrated that the same concentration of S3I-201 lowers
luciferase expression in nicotine-treated SHEP1 cells transfected with 7, Ric3, and STAT3-ML
(Figure 54). Also, DMSO had no effect on reporter activation.
Transfection: - - 7/Ric3 7/Ric3 7/Ric3 7/Ric3 STAT3-ML STAT3-ML STAT3-ML STAT3-ML Treatment: - Nicotine - Nicotine Nicotine Nicotine AG490 DMSO
** **
** p < 0.01 compared to transfected untreated cells (blue)
80
Figure 54: STAT3 inhibition reduces nicotine-dependent luciferase expression. SHEP1 cells
transfected with 7, Ric3, and STAT3-ML were exposed to 10 M nicotine for 24 hours.
Nicotine exposure resulted in a ~2-fold increase in luciferase expression compared to
untransfected and untreated conditions. Cells pretreated with 150 nM S3I-201 1 hour before
nicotine application showed reduced luciferase expression (n=4).
In summary, a novel STAT3 reporter plasmid was created by replacing the NFB
promoter in a Clontech NFB-MetLuc vector with a STAT3 promoter obtained from a Panomics
STAT3-firefly luciferase vector. Validation was carried out using HEK-Blue IL6 cells
expressing IL6R and SEAP under the control of a STAT3 promoter. In SHEP1 cells transfected
with 7, Ric3, and STAT3-ML, nicotine increases luciferase expression. This increase is likely
attributable to 7 activation of the JAK2-STAT3 pathway, since SHEP1 cells transfected with
STAT3-ML alone fail to display nicotine-dependent luciferase expression, the 7 antagonist
BGT dose-dependently reduces luciferase expression in nicotine-treated cells, and JAK2 or
STAT3 inhibitor pretreatment reduces nicotine-driven luciferase expression. The level of
nicotine-driven luciferase expression was typically ~2-fold greater than untreated conditions.
Transfection: - 7/Ric3/STAT3 7/Ric3/STAT3 7/Ric3/STAT3 7/Ric3/STAT3 Treatment: - - Nicotine Nicotine/S3I Nicotine/DMSO
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
2
UT/UT a7/UT Nicotine(10 uM)
S31-201 DMSO
Rela
tive
Lu
min
esce
nce
Treatment
** **
** p < 0.01 compared to transfected untreated cells (blue)
Transfection: - 7/Ric3/STAT3 7/Ric3/STAT3 7/Ric3/STAT3 7/Ric3/STAT3
Treatment: - - Nicotine Nicotine/S3I Nicotine/DMSO
81
We next investigated whether ligating the STAT3-ML sequence into a vector with antibiotic
resistance and selecting transfected cells before nicotine application would increase the signal.
Aim 1d) Construct cell lines expressing both 7 and STAT3-driven luciferase plasmids and
reassess ideal conditions for nicotine-induced increases in 7-driven luciferase expression.
Since the original STAT3-ML plasmid did not have a gene for antibiotic resistance the
studies shown up to this point have involved transient transfections. To create a STAT3-ML
vector possessing antibiotic resistance, Anagha Sawant and Sheba Goklany excised the RFP
gene in a pREP9 vector and replaced it with STAT3-ML, resulting in STAT3-ML-P9KB
(P9=pREP9; K=kanamycin; B=blasticidin). Using this novel plasmid, we reassessed ideal
conditions for obtaining nicotine-induced STAT3 activation. Previous experiments using the
original STAT3-ML plasmid demonstrated that 10 M nicotine applied for 24 hours yields the
largest increase in luciferase expression. Using SHEP1 cells transfected with 7, Ric3, and
STAT3-ML-P9KB before cell selection in antibiotics, two concentrations of nicotine- 10 and
100 M- were tested. As shown in Figure 55, 24-hour treatment of both concentrations yielded
similar increases in reporter activation. Furthermore, the magnitude of nicotine-induced
luciferase expression was increased after cell selection. While increases using the original
STAT3-ML plasmid were roughly 2-fold, the increases using STAT3-ML-P9KB were typically
10-fold following cell selection. To confirm the presence of 7 receptors on the surface of
SHEP1 cells, 125
I-BGT binding assays were carried out. As shown in Figure 56, transfected
cells possessed significantly more binding sites than untransfected cells.
82
0
2
4
6
8
10
12
14
UT UT/nic STAT3-ML STAT3-ML/10 uMnic
STAT3-ML/100uM nic
Rela
tive L
um
inescen
ce
Treatment
0
2
4
6
8
10
12
14
16
UT a7 2 h 8 h 24 h 48 h
Rela
tive L
um
inescence
Treatment Group
Figure 55: Nicotine dose-response in SHEP1 cells previously transfected with 7, Ric3, and
STAT3-ML-P9KB. SHEP1 cells were transfected with 7, Ric3, and STAT3-ML-P9KB and
selected in antibiotics prior to experimentation. A) Cells were treated with nicotine for 24 hours
at indicated concentrations (n=4). B) 125
I-BGT binding assay showing surface 7 in
transfected SHEP1 cells (n=4).
To investigate whether an alternative duration of nicotine exposure may be optimal, time course
experiments were carried out. Previously transfected SHEP1 cells were exposed to 10 M
nicotine for various periods of time. Again, 24-hour exposure appeared to be ideal, as after this
period of time the signal dropped off, and significant increases were not observed until 8 hours
of exposure (Figure 56).
Figure 56: Nicotine time
course in STAT3-ML-P9KB
SHEP1 cells. SHEP1 cells
transfected with 7, Ric3,
and STAT-ML-P9KB were
selected in antibiotics prior
to experimentation. Results
show 24-hour exposure to
10 M is optimal for
nicotine-induced
STAT3 activation (n=4). Transfection: - 7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3 STAT3 STAT3 STAT3 STAT3 STAT3
Duration: - - 2 h 8 h 24 h 48 h
B
A **
**
*
*
*
**
*p < 0.05; ** p < 0.01 compared to transfected untreated cells (blue)
*p < 0.05; ** p < 0.01 compared to transfected untreated cells (blue)
Transfection: - - 7/Ric3 7/Ric3 7/Ric3 STAT3 STAT3 STAT3
Nicotine: - - - 10 M 100 M
83
0
2
4
6
8
10
12
14
16
18
Re
lati
ve
Lu
min
es
ce
nc
e
Treatment
After determining optimal concentration and duration of agonist exposure, the necessity of 7
and STAT3 activation for increased luciferase expression was verified.
SHEP1 cells previously transfected with 7, Ric3, and STAT-ML-P9KB were exposed to
nicotine for 24 hours in the presence and absence of JAK/STAT inhibitors. Experiments
involving dot blots performed alongside reporter assays revealed that JAK inhibitor I lowered
both nicotine-dependent luciferase expression and protein levels of PSTAT3. At 30 M the
STAT3 inhibitor S3I-201 blocks phosphorylated STAT3 from dimerizing and translocating into
the nucleus. Zhang et al. (2011) demonstrated that S3I-201 requires over 100 M to
significantly block STAT3 phosphorylation by IL6. This may account for the presence of
PSTAT3 protein with reduced luciferase expression. The 7 antagonist, BGT, lowered both
luciferase expression and PSTAT3 protein levels. Again nicotine treatment produced a 10-fold
increase in luciferase expression, possibly due to selection of transfected cells using antibiotics
(Figure 57).
Figure 57: JAK inhibitor I
and BGT block nicotine-
induced increase in
luciferase expression while
reducing activation of
STAT3. SHEP1 cells stably
expressing 7, S-rRic3, and
STAT3-ML-P9KB were
treated with nicotine for
24 hours following exposure
to inhibitor. Protein
extraction was performed
following supernatant
collection from the same
cells (n=4).
Transfection: - - 7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3 STAT3 STAT3 STAT3 STAT3 STAT3 STAT3 Nicotine: - 10 M - 10 M 10 M 10 M 10 M 10 M Inhibitor: - - - - JAK inh. I S3I-201 BGT DMSO (150 nM) (30 M) (20 nM)
STAT3:
PSTAT3:
* * *p < 0.05
compared to transfected untreated cells (blue)
84
Aim 1e) Use STAT3-MetLuc assay to study Ca2+
-dependency of 7-mediated STAT3
signaling.
Following development and validation of the novel STAT3-ML signaling assay, it was
utilized for investigating several questions regarding 7 receptors. One issue to address was the
dependency of calcium influx for STAT3 signaling. 7 receptors signal via two pathways: 1)
ion flow through activated channels, and 2) JAK-STAT signaling through a less-understood
mechanism. Whether these two pathways can take place independently of one another has not
been addressed using heterologous expression systems. Perhaps calcium flow is required for or
enhances JAK-STAT signaling. On the other hand, perhaps JAK-STAT signaling can take place
independently of ion flow. The signaling assay was used to explore if JAK-STAT3 signaling can
take place in conditions unsuitable for proper calcium ion flow. For this purpose, two calcium
chelators were used: BAPTA-AM and EGTA.
Hosur and Loring (2011) used BAPTA when studying calcium-dependency of 42-
mediated anti-inflammation. Bis(2-aminophenoxyl)ethane tetraacetic acid (BAPTA) is very
selective for Ca2+
over Mg2+
and can be used to control calcium levels (Hyrc et al., 2005). The
membrane-permeant version ester- BAPTA-AM- can be used to lower intracellular Ca2+
availability. Ethylene glycol tetraacetic acid (EGTA) is a chelating agent similar to EDTA, but
with a much higher affinity for calcium than magnesium. Unlike BAPTA-AM, which chelates
intracellular calcium, EGTA chelates calcium outside the cell. Using our 7 signaling assay to
investigate calcium dependency for STAT3 signaling, we found that nicotine-treated SHEP1
cells previously transfected with 7, Ric3, and STAT3-ML-P9KB generated greater luciferase
expression compared to untransfected or untreated conditions. Since Hosur and Loring (2011)
showed 5 M BAPTA exposure for 30 minutes was sufficient to block ionomycin-induced Ca2+
85
release, we used these conditions. Pretreatment of 5 M BAPTA-AM for 30 minutes prior to
nicotine exposure had no effect on STAT3-driven luciferase expression (Figure 58).
Figure 58: BAPTA-AM fails to lower nicotine-induced luciferase expression in SHEP1 cells
previously transfected with 7, Ric3, and STAT3-ML-P9KB. Cells were exposed to 10 M
nicotine for 24 hours with and without pretreatment of 5 M BAPTA-AM for 30 minutes.
BAPTA-AM is a membrane-permeant ester capable of chelating intracellular calcium. DMSO
vehicle had no effect on luciferase expression (n=4).
To investigate whether calcium flow into the cell may be needed for 7-mediated STAT3
signaling, stably transfected cells were maintained in EGTA-containing media before nicotine
application.
Under the same conditions as the previous study involving BAPTA-AM, EGTA exposure
failed to lower nicotine-induced STAT3 driven luciferase expression. Cells plated in EGTA-
containing media 24 hours prior to 10 M nicotine exposure exhibited similar increases in
luciferase expression compared to cells maintained in regular media. Furthermore, cells
maintained in EGTA-containing media and exposed to BAPTA-AM before nicotine exposure
exhibited levels of luciferase expression similar to nicotine-treated cells maintained in regular
media (Figure 59).
Transfection: - STAT3 STAT3 STAT3 STAT3
7/Ric3 7/Ric3 7/Ric3 7/Ric3
Nicotine (M): - - 10 10 10 Chelator: - BAPTA-AM - BAPTA-AM DMSO
** ** **
**p < 0.01
86
Figure 59: BAPTA-AM and EGTA fail to lower nicotine-induced luciferase expression in
SHEP1 cells previously transfected with 7, Ric3, and STAT3-ML-P9KB. Cells were
maintained in 2 mM EGTA and exposed to 10 M nicotine for 24 hours with and without
pretreatment of 5 M BAPTA-AM for 30 minutes (n=4).
Experiments with calcium chelators suggest that 7-mediated STAT3 signaling can take place in
the absence of calcium ion flow. To further test this hypothesis, cells were maintained in
modified media low in calcium prior to treatment with calcium chelators and nicotine. As shown
in Figure 60, luciferase expression persisted even under these conditions. In summary, in our
signaling assay SHEP1 cells previously transfected with 7, Ric3, and STAT3-ML-P9KB
exhibited increased luciferase expression in response to 10 M nicotine for 24 hours. This signal
could be blocked by the 7 antagonist, BGT, the STAT3 inhibitor S3I-201, and JAK inhibitors,
AG490 and JAK inhibitor I, suggesting luciferase expression is 7- and STAT3-attributable.
However, exposure to calcium chelators failed to lower nicotine-induced luciferase expression.
7 receptors signal through two modes. One is the canonical pathway requiring ion influx
through opened channels. A second involves STAT3 phosphorylation and activation. Data
Transfection: - - - - STAT3 STAT3 STAT3 STAT3 STAT3
7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3
Nicotine (M): - - - - 10 10 10 10 10 Chelator: - BAPTA-AM EGTA BAPTA-AM - BAPTA-AM EGTA BAPTA-AM EGTA
EGTA DMSO
* * * * *
*p < 0.05
87
STAT3-ML assay using STAT3-ML-P9KB/
a7/Ric3 SHEP1 cells in a 96-well plate
0
2
4
6
8
10
12
14
UT re
gular
UT re
gular/n
ic
UT H
BSS
UT H
BSS/n
ic
STAT3-M
L-P9K
B regu
lar
STAT3-M
L-P9K
B regu
lar/n
ic
STAT3-M
L-P9K
B HBS
S
STAT3-M
L-P9K
B HBS
S/nic
STAT3-M
L-P9K
B HBS
S/BAPTA
STAT3-M
L-P9K
B HBS
S/BAPTA/n
ic
Treatment Group
Rela
tive L
um
inescen
ce
suggests these pathways may be capable of proceeding independently of one another in
heterologous expression systems.
Figure 60: Nicotine-induced luciferase expression in SHEP1 cells previously transfected
with 7, Ric3, and STAT3-ML-P9KB persists in a low-calcium environment. Cells were
maintained in substituted HBSS low in calcium and exposed to 10 M nicotine for 24 hours with
and without pretreatment of 5 M BAPTA-AM and 2 mM EGTA for 30 minutes (n=4).
Andersson and Tracey (2012) hypothesized that the 7 anti-inflammatory pathway leading to
reduced TNF production may involve PKA activation. However, Hosur and Loring (2011)
demonstrated that PKA inhibition via PKI 14-22 amide, unlike JAK/STAT inhibition, failed to
block the effect of nicotine on LPS-induced TNF production in SHEP1 cells expressing human
42 receptors. Therefore, we used PKI 14-22 amide to investigate whether 7-mediated
STAT3 signaling may be dependent upon cAMP. SHEP1 cells transiently transfected with 7,
Ric3, and STAT3-MetLuc were pretreated with the PKA inhibitor prior to nicotine exposure. As
shown in Figure 61, luciferase expression persisted despite PKA inhibition.
Transfection: - - - - STAT3 STAT3 STAT3 STAT3 STAT3 STAT3
7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3 7/Ric3
Nicotine (M): - 10 - 10 - 10 - 10 - 10 Media: Regular Regular HBSS HBSS Regular Regular HBSS HBSS HBSS HBSS Chelator: - - - - - - - - BAPTA-AM BAPTA-AM EGTA EGTA
*
* *
*p < 0.05
88
0
0.5
1
1.5
2
2.5
3
UT UT/nic a7/nic a7/Ric3/nicSTAT3/nic
Re
lative
Lu
min
esce
nce
Treatment Group
0
0.5
1
1.5
2
2.5
3
3.5
UT UT/nic STAT3 STAT3/nicSTAT3/nic/PKI 14-22
Rel
ativ
e Lu
min
esce
nce
Figure 61: Nicotine-induced luciferase expression in SHEP1 cells previously transfected
with 7, Ric3, and STAT3-ML-P9KB persists with PKA inhibition. Cells were exposed to
10 M nicotine for 24 hours with and without 1-hour pretreatment of 30 M PKI 14-22 amide
(n=4).
In summary, we tested whether SHEP1 cells expressing 7 and the STAT3 reporter allow
nicotine-driven signaling in environments with low Ca2+
and Mg2+
. Taken together, evidence
suggests calcium ion flow may not be essential for 7-mediated, STAT3 signaling.
Furthermore, such signaling may take place independently of PKA. These findings support two
separate signaling mechanisms for 7 receptors- one ionotropic and the other metabotropic.
Aim 1f) Investigate the role of Ric3 in allowing 7-driven STAT3 signaling in non-
permissive cell lines.
Aside from allowing investigation of 7-mediated STAT3 signaling, the STAT3-ML
assay provides insight into cell line-dependency of receptor maturation- a process that is a
prerequisite for nicotine-mediated luciferase expression. Binding assays have verified that
STAT3-ML/7/Ric3 SHEP1 cells possess surface 7 receptors. Importantly, co-transfection of
Ric3 was required with 7 to elicit nicotine-induced STAT3 signaling in SHEP1 cells. SHEP1
* *
*p < 0.05
Transfection: - - 7/Ric3/STAT3 7/Ric3/STAT3 7/Ric3/STAT3
Nicotine (M): - 10 - 10 10
PKI 14-22 (M): - - - - 30
89
cells co-transfected with only 7 and STAT3-ML failed to elicit increases in luciferase
expression upon 24-hour exposure to 10 M nicotine (Figure 62). Inclusion of Ric3 with 7 and
STAT3-ML resulted in increased luciferase expression when the cells were treated with nicotine.
Figure 62: Ric3 is required for 7-mediated STAT3 signaling in SHEP1 cells. Transiently
transfected SHEP1 cells were exposed to 10 M nicotine for 24 hours. Nicotine-driven
luciferase expression depends upon transfection of both 7 and Ric3 with STAT3-ML,
suggesting the requirement of Ric3 for surface 7 expression in SHEP1 cells (n=4).
Since Ric3 transfection is required for STAT3-driven luciferase expression in SHEP1 cells, it is
also required for surface expression. As shown in Figure 63, co-transfection of 7 and STAT3-
ML in GH4C1 cells is sufficient to allow nicotine-induced luciferase expression, suggesting that
GH4C1 cells either already possess Ric3 allowing 7 surface expression or express another 7
chaperone aside from Ric3.
Transfection: - - 7/STAT3R 7/Ric3/STAT3R STAT3R Treatment: - Nicotine Nicotine Nicotine Nicotine
*
90
Figure 63: Ric3 is not required for 7-mediated STAT3 signaling in GH4C1 cells.
Luciferase activity, expressed as percentage of constitutive luciferase expression from positive
controls, is dose-dependently driven by nicotine in GH4C1 cells transfected with only 7 and the
STAT3 reporter. At the highest nicotine concentration, 30 M S3I-201 prevents luciferase
expression (Abishek Chandrashekar).
The STAT3-ML signaling assay allowed investigations into calcium dependency of 7-mediated
STAT3 signaling and supported our hypothesis that this signaling can proceed independently of
calcium. It also provided insight into cell-dependent 7 maturation. While transfection of Ric3
appears to be required for surface 7 expression in SHEP1 cells, it may not be necessary in
GH4C1 cells. In Aim 2 we tested the hypothesis that GH4C1 cells possess Ric3 to allow
receptor expression. This work entailed cloning rat Ric3 isoforms and testing their functionality
via 125
IBGT binding assays, followed up with the design of RNAi constructs targeting different
Ric3 exons to investigate the relationship between levels of Ric3 protein and surface 7
expression in SHEP1 and GH4C1 cells. This provided further insight into whether GH4C1 cells
possess unknown chaperone factors allowing surface 7 expression.
AIM 2
Aim 2a) Clone Ric3 from rat brain and investigate functionality of the protein.
We sought to test the hypothesis that GH4C1 cells express more Ric3 protein than
SHEP1 cells to allow greater levels of surface 7 expression. Since the predicted rat Ric3 gene
+ S3I-201
91
had not been previously shown to be functional, we cloned the rat Ric3 gene. Cloning Ric3 from
rat brain was carried out with the assistance of Jay Boltax and Brijesh Garg. The two cloned
isoforms of rat Ric3 correspond to accession numbers AM422212 and AM422213. AM422212
(S-rRic3) encodes a 366-amino acid protein that differs from AM422213 (S+rRic3) by three
bases due to an ambiguous splice site between exons 4 and 5, resulting in the loss of a serine
residue at position 173 relative to AM422213. The rat Ric3 open reading frame is illustrated in
Figure 64.
Figure 64: Rat Ric3 open reading frame and translated protein. Underlined amino acids
indicate transmembrane domains 1 and 2 and the coiled-coil domain, which are each labeled
above the corresponding DNA. Underlined DNA indicates the shRNA and siRNA sequences
used in Aim 2. The six exons are labeled above the DNA, and inverted triangles indicate the
splice boundaries between exons. The box indicates the serine residue and corresponding DNA
at the ambiguous splice site between exons 4 and 5. A dagger (†) indicates the location of the
splice site between exons 5 and 6 in human and mouse Ric3 (Jay Boltax and Brijesh Garg). Rat
Ric3 protein shares 94% homology with mouse Ric3 and 87% homology with human Ric3.
92
0
1
2
3
4
5
6
7
8
9
fmo
le s
pe
cifi
c b
ind
ing/
we
ll
7/GFP 7/S-rRic3 7/S+rRic3
Although Roncarati et al. posted accession numbers AM422212 and AM422213 in 2007, no
published evidence shows these splice variants are functional in heterologous expression
systems. Using 125
IBGT binding to measure surface 7 expression, Brijesh Garg showed that
both rat Ric3 isoforms promote rat 7 surface expression in HEK293 cells (Figure 65).
Figure 65: S- and S+rRic3 both allow surface 7 expression in HEK cells. 125
I-BGT
binding assay was performed in 24-well plates to show surface toxin binding when transfected as
indicated with rat -pREP4 plus either green fluorescent protein (GFP) in pREP4 or S+ or S-
rRic3 in pREP4 in each well. Subsequent experiments failed to show any consistent differences
in surface expression promoted by S+ and S-rRic3 transfections (Brijesh Garg).
Aim 2b) Establish effectiveness of Ric3 antibodies and demonstrate cell line-dependency of
Ric3 transfection for surface 7 expression.
To investigate cell-dependency of 7 maturation, 7 was transfected with and without rat
Ric3 isoforms into SHEP1 and GH4C1 cells before assessing surface 7 expression via
125IBGT binding. As shown in Figure 66, SHEP1 cells transfected with 7 alone yield levels
of 125
IBGT binding comparable to untransfected cells. However, co-transfection with either of
two rat Ric3 isoforms resulted in significant increases in surface binding sites.
93
Figure 66: Rat Ric3 isoforms promote surface 7 expression in SHEP1 cells. SHEP1 cells
were transfected with 7 alone, or 7 with either rat Ric3 isoform. 125
I-BGT binding assay
was performed ~72 hours after transfection. Cells transfected with 7 alone exhibit similar 7
expression compared to untransfected cells, while Ric3 co-transfection increased surface
expression significantly (n=4).
While Ric3 appeared to be necessary for surface expression of 7 in SHEP1 cells, in GH4C1
cells 7 expression was detected without Ric3 transfection. As shown in Figure 67, GH4C1
cells transfected with 7 alone produce significantly greater levels of 125
I-BGT binding sites
than untransfected cells, and Ric3 co-transfection in these cells does not enhance 7 expression.
Initial binding assays studying cell line-dependency of Ric3 transfection for 7 expression
supported findings from STAT3-ML experiments. In SHEP1 cells, the requirement of Ric3
transfection for surface 7 expression was in agreement with findings obtained in STAT3-ML
studies in which Ric3 transfection was necessary for nicotine-induced luciferase expression. In
GH4C1 cells, binding assays showing surface receptor expression without Ric3 transfection were
in agreement with STAT3-ML studies showing robust luciferase expression in this cell line
without Ric3 transfection.
*p < 0.05
94
Figure 67: Ric3 transfection is not required for surface 7 expression in GH4C1 cells.
GH4C1 cells were transfected with 7 alone, or 7 with either Ric3 isoform. 125
I-BGT binding
was performed ~72 hours following transfection. Cells transfected with 7 alone show robust
surface receptor expression (n=4).
Initial binding assays supported our results from STAT3-ML reporter assays. In GH4C1 cells,
co-transfection of 7 with STAT3-ML was sufficient for obtaining nicotine-induced luciferase
expression. In this cell line, transfection with 7 alone was sufficient for detecting surface 125
I-
BGT binding sites. In SHEP1 cells, transfection of Ric3 was required for observing both
nicotine-induced luciferase expression and surface 125
I-BGT binding. If surface receptor
expression is a prerequisite for driving STAT3 signaling, it appears that GH4C1 cells, unlike
SHEP1 cells, do not require Ric3 transfection for generating surface 7 receptors. This result,
along with findings that GH4C1 cells infected with recombinant adenovirus encoding 7
generated significantly greater 125
I-BGT binding sites than SHEP1 cells (Sweileh et al., 2000),
supported our initial hypothesis that GH4C1 cells possess more Ric3 chaperone than SHEP1
cells to allow surface 7 expression. To explore this further, we investigated the relationship
between levels of 7 expression- detected via 125
I-BGT binding- and levels of Ric3 protein-
detected via Ric3 antibodies obtained from Santa Cruz Biotechnology.
*p < 0.05
95
Tests to evaluate the viability of the two antibodies (W-16 and H-282) revealed that
binding of both to rat Ric3 is conformationally-dependent (Figure 68). Boiling protein extracts
from cells transfected with S-rRic3, S+rRic3, or full-length human Ric3 destroyed labeling of
dot blots by both antibodies. Furthermore, under conditions that a glyceraldehyde phosphate
dehydrogenase (GAPDH) antibody shows prominent bands on Western blots, neither Ric3
antibody shows detectable staining.
Figure 68: Santa Cruz Ric3 antibodies are dependent on protein conformation but can be
used for dot blots. A) Protein lysates were boiled at 95˚C for 5 minutes before blotting. For
each Ric3 isoform, boiling samples before blotting abolished the signal. B) Using protein lysates
from SHEP1 cells, under Western blotting conditions in which bands are observed for GAPDH,
no bands are detected for Ric3. C) Ric3 protein is detected in transfected SHEP1 or GH4C1
cells.
Ladder GAPDH Ladder S-rRic3 S+rRic3 Ladder
UT 7 7 7 UT 7 7 7 Buffer S-rRic3 S+rRic3 S-rRic3 S+rRic3
A
B
C SHEP1 GH4C1
96
Therefore, Ric3 protein levels were monitored through dot blot hybridization, rather than
Western blotting. After establishing effectiveness of Ric3 antibodies and demonstrating the cell-
dependent requirement of Ric3 transfection for surface 7 expression, we obtained Ric3 RNAi
constructs to study the effects of knocking down Ric3 protein on receptor expression. The first
RNAi construct we obtained was an siRNA sequence designed to target h/rRic3 exon 4.
Aim 2c) Test whether RNAi methods that block surface 7 expression in non-permissive
cells fails to block expression in permissive GH4C1 cells.
An advantage of siRNA is that since its chemical synthesis is relatively straightforward,
constructs can usually be purchased from a number of vendors (Sandy et al., 2005). Moreover,
several providers are capable of altering them in ways that augment their stability and selectivity.
Before purchasing an siRNA sequence, it is important to perform a homology search of the
predicted target sequence against the GenBank or UniGene databases. For our purposes, the
homology search tool Basic Local Alignment Search Tool (BLAST) was used. This step is
necessary for lessening the likelihood of off-target effects, as it is best to use sequences having
numerous mismatches with genes that are not supposed to be targeted. In designing siRNA
against both human and rat Ric3, a comparison of both genes found a single, common sequence
spanning 25-27 nucleotides that was deemed a suitable target for siRNA knockdown based on
traits associated with siRNA functionality: low G/C content and lack of inverted repeats, for
instance (Reynolds et al., 2004; Ui-Tei et al., 2004). Furthermore, this sequence was predicted to
be capable of knocking down human and both rat Ric3 isoforms by Integrated DNA
Technologies (IDT) RNAi design. The sequence of the human/rat Ric3 siRNA is shown below,
in Figure 69.
97
Figure 69: Rat/human Ric3 siRNA sequence synthesized by Integrated DNA Technologies.
BLAST search yielded a single unique sequence that was common to human and rat Ric3 and
potentially capable of targeting both isoforms. The target sequence is located immediately
upstream from the ambiguous splice site in exon 4.
The efficacy of siRNA hinges, in part, on efficient uptake into the cell. To determine
efficiency of transfection, cells were transfected with EGFP in the presence and absence of
EGFP-siRNA. Fluorescence microscopy revealed a knockdown effect in cells co-transfected
with EGFP and EGFP-siRNA compared to those transfected with EGFP only (not shown). In
non-permissive HEK293 and SHEP1 cells, co-transfection of Ric3 siRNA with splice-deleted rat
Ric3 (S-rRic3) and 7 resulted in a decrease of specific 125
I-BGT binding compared to cells
that were not transfected with Ric3 siRNA. This is indicative of a reduction in the surface
expression of 7 receptors, potentially due to the silencing effect of RNAi on Ric3. The results
of studies using HEK293 and SHEP1 cells are depicted below, in Figures 70 and 71,
respectively. Since S-rRic3 has been shown to allow higher levels of surface 7 expression than
full-length rat Ric3, we chose to work primarily with the splice-deleted isoform.
AGC
98
BGT binding assay using SHEP1 cells in a 96-well plate
Figure 70: Ric3 siRNA treatment lowers
surface expression of 7 in HEK293 cells. 125
I-BGT binding assay in HEK293 cells
showing the effects of Ric3 siRNA on 7
surface expression following transient
transfection. Surface expression of the
receptor was lowered by Ric3 siRNA in a
dose-dependent manner (n=4).
sdrRic3=S-rRic3
Figure 71: Ric3 siRNA treatment
lowers surface expression of 7 in
SHEP1 cells. 125
I-BGT binding assay
in SHEP1 cells following transient
transfection with 7 and S-rRic3- with
or without 30 nM Ric3 siRNA. Similar
to results seen in HEK293 cells, this
concentration of siRNA reduced specific
binding of radioligand to 7 receptors
(n=4).
A decrease in surface expression of 7 receptors was observed following exposure to Ric3
siRNA in HEK293 and SHEP1 cells. However, in permissive GH4C1 cells that have been
shown to carry endogenous Ric3 mRNA, Ric3 siRNA treatment had no effect on 125
I-BGT
binding. This was indicated by 125
I-BGT binding assays in which cells were transfected with
7 in the presence and absence of Ric3 siRNA. Results from these studies, shown in Figure 72,
do not reveal a significant difference in specific binding in the presence or absence of siRNA.
This may indicate that GH4C1 cells possess additional factors allowing 7 receptors to arrive at
the cellular surface. An alternative possibility is that endogenous Ric3 protein persists after
siRNA treatment.
*p < 0.05; ** p < 0.01
*p < 0.05
Transfection: 7 7/Ric3 /Ric3/siRNA
99
Figure 72: Ric3 siRNA treatment does
not reduce surface expression of 7 in
GH4C1 cells. 125
I-BGT binding assay
following transient transfection of GH4C1
cells. Unlike what was observed in SHEP1
cells, 30 nM Ric3 siRNA did not decrease
125I-BGT binding to 7 receptors (n=4).
To investigate rat Ric3 protein stability and explore the possibility that endogenous Ric3
protein may persist after siRNA treatment, SHEP1wt cells were transfected with S-rRic3 in an
episomal pREP4 plasmid expressing hygromycin resistance. One day after transfection, cells
were treated with 1000 g/ml hygromycin and maintained in hygromycin-containing growth
media for three days prior to 7 and siRNA co-transfection. Three days after transfecting
surviving cells with plasmid and Ric3 siRNA, binding assays revealed that Ric3 siRNA only
partially blocked 7 expression (Figure 73). Receptor expression in siRNA-treated cells was
approximately 15% lower than both the wild-type control and scrambled siRNA-treated groups.
This suggests that Ric3 is a relatively stable protein whose endogenous levels persist in the cell
and may allow receptor expression despite the silencing effects elicited by RNAi. If Ric3 is a
stable protein not subject to rapid turnover, it may not be an ideal target for knockdown via
siRNA.
Figure 73: Ric3 siRNA partially reduces
7 expression in SHEP1 cells semi-stably
expressing S-rRic3. 125
I-BGT binding
assay in SHEP1 cells semi-stably expressing
rat Ric3 and transiently transfected with
7 in the presence and absence of siRNA.
Semi-stably transfected SHEP1 cells were
transfected with a pREP4 plasmid
expressing S-rRic3 and containing a gene
for hygromycin resistance. Specific binding
is presented as counts per minute (n=4).
*p < 0.05
100
Given the transient nature of siRNA knockdown and the potentially stable nature of Ric3 protein,
it was desirable to obtain a longer-lasting silencing effect. To accomplish this, cells were
transfected with rat Ric3 shRNA expressed from semi-stably transfected plasmids. However,
before this, it was important to use Ric3 antibodies to determine the effects of siRNA on Ric3
protein levels in a more direct manner, and determine whether 7 surface expression could be
detected in the absence of Ric3 protein.
Radioligand binding assays serve as an indirect means of monitoring Ric3 expression.
BGT is known to specifically bind to 7 receptors with high affinity. Therefore, the problem is
not measuring surface receptor expression, but rather being able to attribute the presence or
absence of such expression with Ric3 protein. Assuming that Ric3 is sufficient to allow 7
surface expression, a lack of specific binding may be correlated with a lack of Ric3 protein. A
more direct approach is to use an antibody specific for the protein. A series of experiments was
performed in which cells derived from a single flask were seeded onto 2 plates. Cells from both
plates were co-transfected with Ric3 and 7 in the presence or absence of siRNA. However,
while cells from one plate were used to perform binding assays, cells from the other were
extracted for dot blot analysis. By comparing levels of Ric3 protein seen in dot blot analysis
with the levels of 7 expression observed in binding assays, an investigation into the necessity of
Ric3 for surface receptor expression was performed.
Initial studies not involving siRNA revealed a contrast between levels of specific BGT
binding and Ric3 protein, especially in GH4C1 cells, in which no protein was detected under
conditions that were permissive to 7 surface expression. As shown in Figure 74, SHEP1 cells
not transfected with Ric3 do not display levels of the protein sufficient for detection. This
correlated to lower specific binding compared to SHEP1 cells that were transfected with 7 and
101
7
Ric3:
Ric3: (blocking peptide)
Ric3. Both human and rat Ric3 were detected via dot blot analysis in these cells, and this
correlated with a significantly greater level of specific binding (Figure 74). However, this was
not the case for 7-transfected GH4C1 cells, which exhibited similar levels of specific binding in
the absence of Ric3 protein. Before doing similar studies involving RNAi, it was necessary to
evaluate the efficacy of our siRNA sequence.
Figure 74: GH4C1, but not SHEP1, cells generate surface 7 receptors in the absence of
detectable Ric3 protein. A) 125
I-BGT binding assay results. Binding assay and protein
extraction were performed three days following transient transfection (n=4). B) Ric3 dot blot
analysis (top), including blocking peptide in 100-fold excess to primary antibody (bottom) (n=4).
To establish the effectiveness of the siRNA sequence against human and rat Ric3, non-
permissive SHEP1 and permissive GH4C1 cells were transfected with human or S-rRic3 in the
presence and absence of Ric3 siRNA. After protein extraction was performed two days
following transfection, dot blot analysis revealed that cells transfected with siRNA possessed
less human and splice-deleted rat Ric3 protein than those not transfected with siRNA (Figure
75). This suggested that Ric3 siRNA was targeting both human and rat Ric3 and effectively
A
B
Transfection: 7 7 7 7 S-rRic3 hRic3 Cell line: SHEP1 SHEP1 SHEP1 GH4C1
*p < 0.05
102
S-rRic3
in SHEP1
S-rRic3
in GH4C1
hRic3 in
SHEP1
hRic3
in GH4C1
+ siRNA
- siRNA
knocking down both isoforms following transfection into either GH4C1 or SHEP1 cells. After
establishing siRNA efficacy, the consequences of Ric3 protein knockdown on surface 7
expression were investigated using radioligand binding assays.
Figure 75: Ric3 siRNA (30 nM) reduces levels of human and splice-deleted rat Ric3 protein
upon transfection in SHEP1 and GH4C1 cells. A) SHEP1 cells transfected with S-rRic3 with
siRNA (top) and without siRNA (bottom). B) GH4C1 cells with S-rRic3 and siRNA (top) and
without siRNA (bottom). C) SHEP1 cells transfected with human Ric3 with siRNA (top) and
without siRNA (bottom), and D) GH4C1 cells transfected with human Ric3 with siRNA (top)
and without siRNA (bottom). Blots were performed 2 days following transient transfection.
It is not possible to perform radioligand binding assays and protein extraction on identical wells
of transfected cells. Therefore, two plates of SHEP1 and GH4C1 cells were transfected- one pair
to be used for 125
I-BGT binding assays and the other to be used for dot blot analysis. Results
from these studies, shown in Figure 76, reveal two important findings. First, in SHEP1 cells, a
decrease in Ric3 protein levels corresponds to a reduction in 7 surface expression. Second, in
GH4C1 cells, a decrease in Ric3 protein levels does not significantly affect 7 surface
expression. This discrepancy may be explained by unknown chaperone proteins in GH4C1 cells
allowing 7 surface expression in the absence of Ric3. Another possibility is the existence of
inhibitory factors in SHEP1 cells not present in GH4C1 cells.
A B C D
103
Figure 76: Ric3 knockdown in SHEP1 and GH4C1 cells has cell-dependent consequences
on surface 7 expression. 125
I-BGT binding assays (n=4) and Ric3 dot blot analysis in
SHEP1 (A) and GH4C1 (B) cells. Binding assays and protein extractions were performed two
days following transient transfection.
Initial RNAi studies may justify a search for novel 7 chaperones in GH4C1 cells. This search
will be carried out by screening a cDNA library obtained from this cell line for expression of
surface receptors. To screen the expression library for 7 expression, it will be necessary to
Ric3:
Ric3:
*p < 0.05
A
B
SHEP1
GH4C1
104
create conditions under which a non-permissive cell line is semi-stably transfected with RNAi
against Ric3, resulting in long-term knockdown of the protein and preventing re-cloning of rat
Ric3. This can be accomplished using rat Ric3 shRNA constructs. First, it is necessary to
confirm efficacy of the constructs by repeating the siRNA experiments with shRNA. Obtaining
shRNA constructs against other Ric3 exons will also allow investigation into unknown Ric3
splice variants.
Aim 2d) Obtain shRNA constructs to investigate alternative splicing, and study Ric3
protein turnover by determining effects of Ric3 knockdown on 7 expression in cell lines
stably expressing Ric3.
Before selecting candidate rat Ric3 shRNA sequences purchased from Origene, a
homology search was done to establish which ones contain the greatest number of mismatches to
human Ric3. Two candidate shRNA sequences, shown in Figure 77, were found to possess at
least four mismatches. It is desirable to use sequences having at least three mismatches to any
gene other than the one being targeted (Sandy et al., 2005). Also, it is important to avoid
stretches of four or more thymine nucleotides to avoid early termination of transcription by
Polymerase III (Sandy et al., 2005).
shRNA against exon 5: GGCAAGTTCATTGACACATCTCCAGAGAA
shRNA against exon 6: GCAGATGGCTACAGTGAGCAAGAGGAAGC
Figure 77: HuSH 29mer shRNA constructs against rat Ric3 obtained from Origene.
To validate the selectivity and efficacy of shRNA silencing, SHEP1 cells were
transfected with 7 and human or splice-deleted rat Ric3 in the presence or absence of rat Ric3
shRNA constructs against exon 5 or 6. Scrambled shRNA was included as a control. Three days
following transfection, 125
I-BGT binding assays and dot blot analysis were performed. Results
from studies utilizing shRNA targeting exon 5 and 6 are shown in Figure 78. Dot blots involving
105
8
A
7/S-rRic3
7/hRic3/
shRNA
7/hRic3
Buffer 7
7/S-rRic3/
shRNA
7/S-rRic3/
shRNA
7/S-rRic3
7/hRic3/
shRNA
7/hRic3
Buffer 7
7 7 7 7 7 7 7
hRic3 hRic3 hRic3 S-rRic3 S-rRic3 S-rRic3
shRNA scr.shRNA shRNA scr.shRNA Transfection:
7 7 7 7 7 7 7
hRic3 hRic3 hRic3 S-rRic3 S-rRic3 S-rRic3
shRNA scr.shRNA shRNA scr.shRNA Transfection:
the scrambled shRNA treatment groups were performed in a later experiment, the results of
which are shown in Figure 80.
Figure 78: Rat Ric3 shRNA against exon 5 (top) or exon 6 (bottom) reduces S-rRic3 protein
while decreasing surface expression of 7 in SHEP1 cells co-transfected with 7 and S-
rRic3. SHEP1 cells were transfected with human or splice-deleted rat Ric3 in the presence or
absence of rat Ric3 shRNA. A, C) 125
I-BGT binding assay. Binding assay and protein
extraction were performed three days following transient transfection (n=4). B, D) Dot blot
analysis.
*p < 0.05; **p < 0.01
*p < 0.05; **p < 0.01
A
C
B
D
106
Buffer
7
7/hRic3
7/hRic3/
shRNA
7/S-rRic3
7/S-rRic3/
shRNA
7/S-rRic3
7/hRic3/
shRNA
7/hRic3
7/S-rRic3/
shRNA
Buffer
7
Transfection:
7 7 7 7 7 7 7
hRic3 hRic3 hRic3 S-rRic3 S-rRic3 S-rRic3
shRNA scr.shRNA shRNA scr.shRNA
Rat Ric3 shRNA against either exon 5 and 6 reduced surface 7 expression in SHEP1 cells
transfected with splice-deleted rat Ric3, but did not have an effect on expression in cells
transfected with human Ric3. Scrambled shRNA did not decrease 7 expression in either
treatment group. This suggests that both rat Ric3 shRNA constructs selectively target rat Ric3
and not human Ric3.
SHEP1 cells were transfected with 7 and human or rat Ric3 in the presence or absence
of a combination of shRNA constructs. Again, scrambled shRNA was included as a control.
Three days following transfection, 125
I-BGT binding assays and dot blot analysis were
performed, the results of which are shown in Figure 79.
Figure 79: Rat Ric3 shRNA against exons 5 and 6 together reduce S-rRic3 protein while
decreasing surface expression of 7 in SHEP1 cells co-transfected with 7 and S-rRic3. SHEP1 cells were transfected with human or splice-deleted rat Ric3 in the presence or absence
of rat Ric3 shRNA against exon 5 or 6. A) 125
I-BGT binding assay. Binding assay and protein
extraction were performed three days following transient transfection (n=4). B) Dot blot
analysis. C) Dot blot analysis with blocking peptide in 100-fold excess to primary antibody.
A *p < 0.05
B
C
107
A
7 7 7 7 7 7 7 7 7
S-rRic3 S-rRic3 S-rRic3 S-rRic3 hRic3 hRic3 hRic3 hRic3
shRNA ex5 shRNA ex6 scr.shRNA shRNA ex5 shRNA ex6 scr.shRNA
A combination of shRNA sequences targeting exons 5 and 6 reduced surface expression of 7 in
SHEP1 cells transfected with splice-deleted rat Ric3 without affecting expression of 7 in cells
transfected with human Ric3. As shown in Figure 80, scrambled shRNA did not lower receptor
expression or Ric3 protein levels in either treatment group. Results suggest that both rat Ric3
shRNA constructs, or a combination of the two, selectively target rat Ric3 and not human Ric3.
Figure 80: Scrambled shRNA does not reduce surface expression of 7 receptors nor
decrease Ric3 protein levels in SHEP1 cells co-transfected with 7 and S-rRic3 or hRic3.
A) 125
I-BGT binding assay. Binding assay and protein extraction were performed three days
after transient transfection (n=4). B) Dot blot analysis. C) Dot blot analysis including blocking
peptide in 100-fold excess to primary antibody.
7/S-rRic3/
scr. shRNA
7/hRic3/
scr. shRNA
7 7/S-rRic3
7/S-rRic3/
shRNA
exon 5
7/S-rRic3/
shRNA
exon 6
7/hRic3/
shRNA
exon 6
7/hRic3/
shRNA
exon 5
7/hRic3
B
C 7/S-rRic3
7/S-
rRic3/
shRNA
exon 5
7/S-rRic3/
shRNA
exon 6
7/hRic3
7/hRic3/
shRNA
exon 5
7/hRic3/
shRNA
exon 6
7 7/hRic3/
scr. shRNA
7/S-rRic3/
scr. shRNA
Blocking peptide
*p < 0.05
108
B
EGFP
7/S-rRic3
7/S-rRic3/
shRNA
C EGFP 7/S-rRic3 7/ S-rRic3/
shRNA
Taken together, the series of shRNA transient transfections in SHEP1 cells shows that both
constructs selectively reduce protein levels of rat Ric3 while lowering surface 7 expression.
Furthermore, shRNA against exon 5 may diminish rat Ric3 levels to a greater extent than shRNA
targeting exon 6, while also having less of an impact on human Ric3. Unlike SHEP1 cells,
GH4C1 cells are a permissive cell line that has been shown to possess Ric3 mRNA. GH4C1
cells were transiently transfected with 7 and splice-deleted rat Ric3 in the presence or absence
of Ric3 shRNA targeting exon 5. As shown in Figure 81, shRNA did not have a significant
effect on surface expression of 7, despite reducing levels of Ric3 protein. After establishing the
ability of shRNA to knock down Ric3 protein without affecting 7 expression in GH4C1 cells
transiently co-transfected with Ric3 and 7, the next step was to repeat this study using a cell
line already generating Ric3 protein, as well as one in which Ric3 protein production is
disrupted. Given the potentially stable nature of Ric3 protein, studies performed on cells already
containing the protein could provide further insight into its stability. If surface 7 receptors are
detected in cells lacking Ric3, it may suggest the involvement of additional chaperones allowing
receptor expression.
Figure 81: Rat Ric3 shRNA against exon 5 reduces rat Ric3 protein levels while having no
effect on surface 7 expression. GH4C1 cells were transfected with S-rRic3 in the presence or
absence of rat Ric3 shRNA exon 5. Cells in the EGFP control group were transfected with
EGFP only. A) 125
I-BGT binding assay. Binding assay and protein extraction were performed
three days after transient transfection (n=4). B) Dot blot analysis. C) Dot blot analysis with
blocking peptide in 100-fold excess to primary antibody.
A *p < 0.05
109
To create cell lines already possessing Ric3 protein, GH4C1 and SHEP1 cells were
transfected with either: 1) 7, 2) splice-deleted rat Ric3, or 3) 7 and splice-deleted rat Ric3
together. Both 7 and S-rRic3 are expressed within a pREP4 vector containing a gene of
resistance against hygromycin. The pREP4 vector is episomal and replicates when the cell
divides but is seldom incorporated into the genome. Transfected cells were exposed to 400
g/ml hygromycin before being maintained in 100 g/ml solution to sustain selection pressure.
These semi-stably transfected cells were plated for radioligand binding assays and dot blot
analysis. As shown in Figure 82, GH4C1 cells semi-stably transfected with 7 alone or with 7
and S-rRic3 together produced surface 7 receptors, while wild-type cells and those semi-stably
transfected with S-rRic3 alone did not. Dot blot analysis revealed the presence of Ric3 protein in
cells semi-stably transfected with either S-rRic3 alone or with 7 and S-rRic3 together. By
demonstrating that it is possible to detect surface 7 receptors in GH4C1 cells in the absence of
Ric3, this study may support the hypothesis that GH4C1 cells possess factors aside from Ric3
allowing surface expression of receptors. As shown in Figure 83, SHEP1 cells semi-stably
transfected with 7 and S-rRic3 together showed significantly greater 125
I-BGT specific
binding than both wild-type cells and cells that were semi-stably transfected with S-rRic3 alone.
Dot blot analysis revealed the presence of Ric3 protein in cells semi-stably transfected with
either S-rRic3 alone, or with 7 and S-rRic3 together. The next objective was to transfect these
semi-stably transfected, hygromycin-resistant SHEP1 and GH4C1 cells with either rat Ric3
shRNA exon 5 or scrambled shRNA.
110
SHEP1 UT SHEP1 S-rRic3 SHEP1
7/S-rRic3
Ric3:
GH4C1 UT GH4C1 GH4C1 GH4C1
7 S-rRic37/S-rRic3
Ric3:
Figure 82: Semi-stably transfected 7 GH4C1 cells and 7/S-rRic3 GH4C1 cells generate
surface receptors, while only S-rRic3 GH4C1 and 7/S-rRic3 GH4C1 cells possess
detectable levels of Ric3 protein. A) 125
I-BGT binding assay (n=4). B) Dot blot analysis.
Figure 83: Semi-stably transfected 7/S-rRic3 SHEP1 cells generate surface 7 receptors
and possess detectable levels of S-rRic3 protein. A) 125
I-BGT binding assay (n=4). B) Dot
blot analysis.
shRNA exon 5 and scrambled shRNA are expressed in vectors conferring puromycin
resistance. Hygromycin-resistant SHEP1 and GH4C1 cells from the studies involved in Figures
82 and 83, as well as wild-type GH4C1 and SHEP1 cells, were transfected with either of these
constructs and exposed to 10 g/ml puromycin and 400 g/ml hygromycin to select for
successfully transfected cells. These cells were grown in puromycin- and hygromycin-
containing media for eight days before being plated for radioligand binding assays and dot blot
analysis. Selection pressure was maintained by growing cells in media containing 100 g/ml
A
B
A
B
*p < 0.05
*p < 0.05
111
S-rRic3
S-rRic3/
scr. shRNA
UT
scr. shRNA
7/S-rRic3
7/S-rRic3/
scr. shRNA
shRNA
exon 5
S-rRic3/
shRNA
exon 5
7/S-rRic3/
shRNA
exon 5
hygromycin and 1 g/ml puromycin. Red fluorescent protein expressed by shRNA vectors was
monitored to assess transfection efficiency, and a control group exposed only to hygromycin and
not containing an shRNA construct was included for comparison. As shown in Figure 84,
specific binding of 125
I-BGT to SHEP1 cells semi-stably transfected with 7 and S-rRic3 was
significantly greater than specific binding to cells semi-stably transfected with 7, S-rRic3, and
shRNA. However, results shown in Figure 85 illustrate that GH4C1 cells semi-stably transfected
with 7 and shRNA or with 7, S-rRic3, and shRNA retained the ability to produce surface
receptors.
Figure 84: Semi-stable shRNA transfection decreases both surface 7 expression and Ric3 protein
levels in SHEP1 cells previously semi-stably transfected with 7 and S-rRic3 together. A) 125
I-
BGT binding assay (n=4). B) Dot blot analysis. sdrRic3=S-rRic3
A
B
*p < 0.05
112
Figure 85: Semi-stable shRNA transfection decreases Ric3 protein levels but not 7 surface
expression in GH4C1 cells previously semi-stably transfected with 7 and S-rRic3 together.
A) 125
I-BGT binding assay (n=4). B) Dot blot analysis.
Overall, RNAi constructs targeting either rat Ric3 exon 4, 5, or 6 yielded similar findings. In
SHEP1 cells, Ric3 knockdown corresponded with a reduction in surface 7 expression.
However, in GH4C1 cells, surface receptors were detected under conditions in which Ric3
7/S-rRic3
S-rRic3/
shRNA
exon 5
7/shRNA
exon 5
7
S-rRic3 UT
shRNA
exon 5
7/S-rRic3/
scr. shRNA
S-rRic3/
scr. shRNA
7/scr.
shRNA
scr. shRNA
B
7/S-rRic3/
shRNA exon 5
A *p < 0.05
113
protein was knocked down. Although a plausible explanation was the presence of unknown
chaperone factors in GH4C1 cells allowing receptor expression, the possibility remained that a
functional splice variant of Ric3 not detectable by available Ric3 antibodies promotes 7
expression in this cell line. To further investigate this possibility, shRNA was designed against
rat Ric3 exon 2. Exon 2 codes for transmembrane domain that is required in C. elegans for
expression of 7-like receptors (Halevi et al., 2002). The shRNA construct against exon 2,
shown in Figure 86, contains blasticidin and kanamycin resistant genes, as well as GFP for
monitoring transfection efficiency.
Figure 86: shRNA construct against rat Ric3 exon 2.
Notable features include GFP under the control of a
CMV promoter, a blasticidin gene for mammalian
resistance, and a kanamycin gene for bacterial
resistance. This construct was obtained from Origene
and is designed to target rat, and not human, Ric3.
Initial experiments using shRNA against exon 2 were performed in SHEP1 cells. Approximately
72 hours following transfection, 125
I-BGT binding assays were carried out to investigate RNAi
functionality. As show in Figure 87, no 7 expression was detected in untransfected cells or
those transfected with 7 alone. As expected, co-transfection of S-rRic3 with 7 increased
BGT binding. When shRNA exon 2 was transfected with S-rRic3 and 7, levels of surface 7
receptors were significantly reduced compared to conditions involving only 7 and S-rRic3.
Figure 87: shRNA against rat Ric3
exon 2 diminishes surface 7 expression
in SHEP1 cells. 125
I-BGT binding assay
(n=4).
*p < 0.05
114
Since most experiments have involved the use of S-rRic3 rather than S+rRic3, we repeated this
experiment while including S+rRic3. Findings showed that co-transfection of either S-rRic3 or
S+rRic3 with 7 significantly increased surface 7 expression in SHEP1 cells, and that shRNA
against exon 2 lowered BGT binding when transfected with 7 and either isoform of rat Ric3
(Figure 88).
Figure 88: shRNA against rat Ric3 exon 2 reduces surface 7 expression in SHEP1 cells
transfected with either isoform of rat Ric3. Binding assay was performed three days
following transient transfection. 125
I-BGT binding assay (n=4).
Rat Ric3 shRNA against exon 2 was not designed to target human Ric3. To establish selectivity
of this RNAi construct, SHEP1 cells were co-transfected with 7 and either S-rRic3 or hRic3 in
the presence and absence of shRNA. Approximately 72 hours following transfection, binding
assays and dot blotting were carried out to investigate the relationship between Ric3 knockdown
and receptor expression. As shown in Figure 89, rat Ric3 shRNA against exon 2 simultaneously
lowered S-rRic3 protein and surface 7 levels, while having no effect on hRic3 protein levels or
7 expression in hRic3-transfected cells. Results suggest shRNA against exon 2 selectively
targets rat and not human Ric3.
*p < 0.05
115
Figure 89: shRNA exon lowers Ric3 protein and 7 expression in SHEP1 cells while having
no effect on hRic3 protein or hRic3-facilitated 7 expression. 125
I-BGT binding assay was
performed three days following transient transfection (n=4).
After performing RNAi studies in SHEP1 cells to establish efficacy and selectively of rat Ric3
shRNA against exon 2, experiments were executed to study the effects of protein knockdown in
GH4C1 cells. First, acute experiments were carried out in which binding assays were performed
72 hours after transfection. As shown in Figure 90, in GH4C1 cells, 7 expression persisted
even in the presence of shRNA.
Figure 90: 7 expression persists
in GH4C1 cells transfected with
shRNA targeting exon 2. 125
I-BGT binding assay was
performed three days following
transient transfection (n=4).
*p < 0.05
*p < 0.05
Ric3:
116
Ric3:
After establishing the ability of shRNA exon 2 to knock down Ric3 protein without affecting 7
expression in GH4C1 cells transiently co-transfected with Ric3 and 7, the next step was to
repeat this experiment in a cell line already generating Ric3 protein, as well as one in which
protein production is prevented. To create a GH4C1 cell line already expressing Ric3 protein,
cells were transfected with either: 1) S-rRic3, 2) S-rRic3 and 7, 3) S-rRic3, 7, and scrambled
shRNA expressing GFP and blasticidin resistance, or 4) S-rRic3, 7, and shRNA expressing
GFP and blasticidin resistance. Since both 7 and S-rRic3 are expressed in a pREP4 vector
possessing a hygromycin gene of resistance, all cells were exposed to hygromycin (100 g/ml).
Since shRNA constructs contain a blasticidin gene of resistance, cells with shRNA were exposed
to 10 g/ml blasticidin in addition to hygromycin for cell selection. Following 10 days in
antibiotics, virtually all surviving cells transfected with shRNA constructs exhibited robust green
fluorescence, indicating survival of properly transfected cells and destruction of non-transfected
cells. Surviving cells were plated for binding assay and dot blot hybridization. As shown in
Figure 91, Ric3 protein was detected in all conditions except where shRNA against exon 2 was
transfected. Furthermore, aside from untransfected S-rRic3 GH4C1 cells, all conditions showed
7 expression, including shRNA-treated cells lacking detectable Ric3 protein.
Figure 91: In GH4C1 cells, surface 7
expression persists following Ric3
knockdown via shRNA against exon 2.
GH4C1 cells previously transfected with
S-rRic3 were transfected with indicated
components and maintained in hygromycin
before being subjected to binding assay and
dot blot analysis. Detectable Ric3 protein
was observed in each condition aside from
shRNA-treated cells, yet 7 expression
persisted in all conditions with 7
transfection (n=4).
*p < 0.05
117
0
0.2
0.4
0.6
0.8
1
1.2
1.4
fMo
le b
ou
nd
/we
ll
Transfections:
Ric3
dot blots:
*
*
Since most RNAi studies investigated the ability of siRNA or shRNA to target S-rRic3, the
effects of shRNA on S+rRic3 protein levels was also examined. SHEP1 cells were transiently
transfected with S+rRic3 with or without shRNA targeting exon 2. As shown in Figure 92,
shRNA reduced S+rRic3 protein levels, suggesting that RNAi effects on 7 expression would
probably not be unique to cells transfected with S-rRic3.
Figure 92: S+rRic3 protein levels are lowered by rat
Ric3 targeting exon 2. Protein was extracted from
SHEP1 cells two days following transfection. RIPA
buffer was included as a control.
Finally, shRNA targeting exon 6 was used to study the consequences of knocking down rat Ric3
protein on surface 7 expression. SHEP1 cells were transfected with 7 and Ric3 with and
without shRNA constructs. Co-transfection with shRNA blocked surface 7 expression only in
cells co-transfected with S-rRic3, but not hRic3. Dot blots confirmed that S-rRic3 protein is
knocked down by shRNA. However, scrambled shRNA had no effect on surface 7 expression
in cells transfected with 7 and S-rRic3 (Figure 93).
Figure 93: shRNA against rat
exon 6 blocks rat Ric3-induced
surface 7 expression in SHEP1 cells.
Cells transfected with 7 and hRic3 or
S-rRic3 support surface 7
expression measured by 125
IBGT
but not in the absence of Ric3.
Co-transfection with anti-exon 6
shRNA blocks surface 7 expression
only in cells co-transfected with
S-rRic3 but not hRic3. Dot blots
confirm shRNA knocks down S-rRic3.
Scrambled shRNA has no effect on
surface 7 expression. *p 0.001
between data sets as shown.
Buffer S+rRic3 S+rRic3/shRNA
7 7/hRic3 7/hRic3 7/hRic3 7/S-rRic3 7/S-rRic3 7/S-rRic3 shRNA scr.shRNA shRNA scr.shRNA
118
Major findings of Aim 2 are summarized in Figure 94. Results demonstrate successful
RNAi knockdown of Ric3 protein by constructs targeting exons 2, 4, 5, and 6. Ric3 protein
knockdown showed cell line-dependent consequences on 7 expression. In SHEP1 cells, Ric3
knockdown following treatment with RNAi targeting either exon 2, 4, 5, or 6 brought about
concomitant decreases in 7 expression. Under similar conditions in GH4C1 cells, surface 7
expression persists. Scrambled constructs had no effect on either protein or surface 7
expression.
Figure 94: Summary of RNAi studies investigating Ric3 dependency for surface 7
expression. In SHEP1 cells, Ric3 protein knockdown following treatment with RNAi targeting
exons 2, 4, 5, and 6 correlated with reductions in 7 surface expression. In GH4C1 cells, Ric3
protein knockdown under similar conditions did not correlate with reductions in surface 7
expression.
shRNA exon 6
Cell line Ric3 protein
7 expression
SHEP1 ↓ ↓
GH4C1 ↓ -
119
Taken together, results suggest the possibility of chaperone factors aside from currently known
Ric3 splice variants allowing surface 7 expression in GH4C1 cells. Aim 2 has provided data
justifying a search of novel 7 chaperones from a GH4C1 cDNA library. Aim 3 involves proof-
of-concept studies to investigate the feasibility of using a variation of the STAT3-ML assay to
identify 7 chaperones.
AIM 3
In Aim 1, a novel 7-mediated STAT3 signaling assay was developed and utilized to
investigate calcium dependency of STAT3 signaling. It also provided evidence suggesting cell
line-dependence of Ric3 for surface 7 expression in SHEP1 and GH4C1 cells. To further
investigate the necessity of Ric3 for 7 expression, Aim 2 involved designing RNAi constructs
against Ric3 and investigating the relationship between Ric3 protein levels and 7 surface
expression. Results suggested the possibility of additional 7 chaperones aside from Ric3 in
GH4C1 cells. We believe a variation of our STAT3-ML signaling assay- one in which STAT3
activation drives antibiotic resistance rather than luciferase expression- will be helpful in
identifying the unknown chaperones that are suggested by the results of Aim 2. There are
numerous possible techniques for identification of unknown chaperones, such as siRNA library,
differential display, yeast-two-hybridization, and expression cloning. All of these techniques
have advantages and disadvantages. For example, the expensive nature of using an siRNA
library is one of the factors prohibiting us from choosing this method, and yeast-two-
hybridization requires knowledge of the important parts of the molecule. In our case, searching
for unknown 7 chaperones will utilize expression cloning.
120
Searching for unknown 7 chaperones in GH4C1 cDNA: Expression cloning using the
SMARTer (Switching Mechanism at 5’ end of RNA Template) In-Fusion Cloning Kit
(Clontech).
Expression cloning allows identification of a gene within a cDNA library based on its
function or phenotype without awareness of its nucleic acid sequence. Therefore, quality cDNA
expression libraries lacking the non-coding and regulatory elements characteristic of genomic
DNA are valuable tools for functional analysis. For our purposes, mature mRNA isolated from
GH4C1 cells will serve as the template for cDNA library construction using the SMARTer In-
Fusion Cloning Kit from Clontech. This PCR-based method has several qualities that are
advantageous for this project. First, the SMARTer In-Fusion Cloning Kit will allow cDNA
library fragments to be inserted into pREP9 vectors, shown in Figure 95, possessing a neomycin-
resistant gene without using restriction enzymes. Avoiding the use of restriction enzymes is
necessary due to the possibility of restriction sites within the unknown gene of interest.
Figure 95: pREP9 vector. This is the
vector into which cDNA fragments from
the cDNA library will be directionally
inserted by the In-Fusion SMARTer cDNA
Library Construction Kit (Clontech).
Another benefit of the SMARTer In-Fusion Cloning Kit is selective amplification.
During PCR amplification reactions, if reverse transcriptase dissociates from RNA before the
whole mRNA sequence is transcribed, the 5’ ends will not be represented in the cDNA library.
This scenario is particularly relevant with longer mRNA sequences (Gubler et al., 1983; Zhu et
121
al., 2001). The In-Fusion SMARTer method overcomes this by incorporating synthetic adaptors
on the 5’ and 3’ ends of cDNA during first-strand synthesis. Only cDNA sequences possessing
these adaptors at the 5’ end are capable of undergoing amplification in subsequent PCR
reactions, and since the adaptor is only incorporated if reverse transcriptase reaches the 5’ end of
the mRNA sequence, amplification of truncated transcripts is prevented (Chenchik et al., 1998;
Zhu et al., 2001). The result of this selective amplification is a cleaner and more fully
representative cDNA library. The use of the adaptors, called SMARTer V Oligos, is illustrated
below in Figure 96 (In-Fusion SMARTer cDNA Library Construction Kit User Manual. 2010.
Clontech).
Figure 96: SMARTer V Oligo allows selective amplification to yield a pure cDNA product.
An oligo(dT) primer is involved in the first-strand cDNA synthesis reaction, and the SMARTer
V Oligo serves as a short, extended template at the 5’ end of the mRNA. When RT reaches the
5’ end, the enzyme’s terminal transferase adds a few nucleotides to the 3’ end of the cDNA. An
extended template is generated when the SMARTer V Oligo base-pairs with these nucleotides.
RT then switches templates and replicates to the end of the oligonucleotide. The resulting full-
length ss cDNA contains the complete 5’ end of the mRNA, as well as the sequence
complementary to the SMARTer V Oligo, which is a priming site during LD-PCR (In-Fusion
SMARTer cDNA Library Construction Kit User Manual. 2010. Clontech).
122
Although other methods are available to avoid the issue of truncated fragment amplification,
many involve extensive manipulation of mRNA before cDNA construction and require a large
quantity of starting material- sometimes on the order of 5-100 g. The In-Fusion SMARTer
method allows cDNA construction beginning with 0.002-1 g of total RNA. A basic procedural
outline for cDNA construction via the SMARTer cDNA Library Kit is provided in Figure 97 (In-
Fusion SMARTer cDNA Library Construction Kit User Manual. 2010. Clontech).
Figure 97: In-Fusion SMARTer cDNA
library construction kit overall procedure.
With less than 1 g total RNA, the LD-PCR
method can be performed. Along with elimination
of contamination by genomic DNA or poly-A
RNA, the low required starting material is a major
advantage of using this cDNA construction kit
(In-Fusion SMARTer cDNA Library
Construction Kit User Manual. 2010. Clontech).
123
In summary, the In-Fusion SMARTer cDNA Construction Kit enables the generation of a cDNA
library containing a high yield of full-length clones without the use of restriction enzymes and
beginning with a small quantity of starting material. These qualities make this construction
method an ideal technique to use for screening GH4C1 cDNA for unknown 7 chaperones.
However, before cDNA construction and screening can take place, proof-of-concept studies must
be performed to assess the feasibility of using the 7 signaling assay to identify chaperones.
These studies were performed as Aim 3 experiments.
Aim 3a) Establish a method of plasmid recovery by showing recovery of S-
rRic3/pREP4/hygromycin.
Identification of unknown chaperone(s) will require recovery of cDNA following a
screen for 7 expression. Therefore, it was necessary to demonstrate the feasibility of
recovering transfected plasmid DNA allowing antibiotic survival in mammalian cells. To
accomplish this, GH4C1 cells were transfected with readily available S-rRic3/pREP4 possessing
bacterial ampicillin and mammalian hygromycin resistance. Untransfected cells were included
as a negative control. Transfected cells were maintained in antibiotics for selection, after which
cDNA was extracted using a modified miniprep method that has been shown to yield miniprep
products in similar quantities and less time than traditional time- and resource-extensive methods
(Hirt, 1967; Siebenkotten et al., 1995; Bowers et al., 1999). When miniprep product was
separated on an agarose gel following restriction digestion with KpnI and XhoI, no bands were
observed. E. coli was transformed with 5 l or 10 l miniprep product from either untransfected
or transfected conditions before plating on ampicillin plates. This large volume was used
because it was so dilute compared to normal. During overnight incubation, colonies grew only
on plates that had been spread with bacteria transformed with miniprep product from transfected,
but not wild-type cells (Figure 98).
124
Figure 98: During overnight incubation,
colonies grew only on plates on which
bacteria transformed with S-rRic3/pREP4/
KG was spread. A) Kanamycin plate on which
5 l miniprep product from transfected cells was
spread. B) Kanamycin plate on which 10 l
miniprep product from transfected cells was spread.
C) Kanamycin plate on which 5 l miniprep
product from UT cells was spread. D) Kanamycin
plate on which 10 l miniprep product from UT
cells survived.
Two colonies from each plate were picked, and E. coli was once again transformed before DNA
extraction via miniprep. Restriction digestion of miniprep product, once again with KpnI and
XhoI, yielded bands of the expected size (Figure 99). Additional sequencing confirmed recovery
of transfected plasmid DNA from mammalian cells that provided antibiotic resistance.
Figure 99: Agarose gels of Ric3/pREP4 cut with KpnI and XhoI. Restriction digestion using
KpnI and XhoI failed to show bands following first miniprep procedure (left). However,
following further amplification steps, restriction digestion using the same enzymes yielded band
of the expected size (right). sdrRic3=S-rRic3
Screening for novel 7 chaperones will rely on the ability of unknown chaperones to
promote expression of surface 7 receptors that will mediate STAT3-driven antibiotic survival.
Success of this screen requires the ability to recover plasmid DNA from a cDNA library
containing the chaperone of interest. Like the S-rRic3/pREP4 vector previously recovered, the
A B
C D
125
gene-of-interest will allow survival of transfected cells in antibiotics. Therefore, by
demonstrating the recovery of S-rRic3/pREP4 transfected into GH4C1 cells, an aspect of the
screening process has been validated. S-rRic3/pREP4 was initially used since it was readily
available. However, actual screening will involve SHEP1 cells transfected with pREP9
expressing cDNA fragments obtained from GH4C1 cells. Since construction of the cDNA
library will involve the In-Fusion Cloning Kit (Clontech), the next proof-of-concept study began
with construction of S+rRic3/pREP9 using this kit. This vector has genes for bacterial
kanamycin resistance and mammalian geneticin resistance. By demonstrating the recovery of
this plasmid following transfection into GH4C1 cells, cDNA library construction using this kit
was justified.
Aim 3b) Construct S-rRic3/pREP9/KG using In-Fusion cloning kit (Clontech) and recover
plasmid.
Following transfection of GH4C1 cells with S+rRic3/pREP9, geneticin was applied for
cell selection. Untransfected GH4C1 cells, treated and untreated with geneticin, were included
as controls. cDNA from surviving cells was extracted using the same modified miniprep method
used to recover S-rRic3/pREP4. Restriction digestion of miniprep product using HindIII and
XbaI revealed no bands. Since both 5 l and 10 l of miniprep product of cells transfected with
Ric3/pREP4 yielded similar results, only 5 l of miniprep product was used for transformation of
E.coli. After incubation, bacteria was spread on kanamycin plates. During overnight incubation,
colonies grew only on the plate on which bacteria transformed with S+rRic3/pREP9/KG was
spread (Figure 100).
Figure 100: During overnight
incubation, colonies grew only on
plate on which bacteria transformed
with S+rRic3/pREP9/KG was
spread. A) UT B) S+rRic3-P9KG
A B
126
Three colonies were selected from this plate and once again transformed into E.coli. Restriction
digestion of extracted DNA using HindIII and XbaI yielded bands of the expected size (Figure
101). Plasmid DNA conferring survival in antibiotics had been successfully recovered.
Figure 101: Agarose gels of Ric3/pREP9/KG cut with HindIII and XbaI. Restriction
digestion using HindIII and XbaI failed to show bands following first miniprep procedure (left).
However, following further amplification steps, restriction digestion using the same enzymes
yielded band of the expected size (right).
By demonstrating the recovery of S+rRic3/pREP9/KG from GH4C1 cells, another aspect of the
screening method- the use of the In-Fusion cloning kit to construct a cDNA library and insert
fragments of this library into pREP9- was demonstrated.
In summary, Aim 3 studies represent a starting point for establishing the feasibility of
screening novel chaperones using the 7 signaling assay developed during Aim 1. During Aim
1 studies, nicotine-induced, 7 mediated, STAT3-driven increases in luciferase expression using
a MetLuc plasmid containing a STAT3 promoter was exhibited. To recover 7 chaperones, a
STAT3 rescue vector in which nicotine induces STAT3-driven antibiotic resistance will be
constructed. Before this can be performed, additional proof-of-concept studies must be carried
out. The first will demonstrate the feasibility of STAT3-driven antibiotic survival using a
STAT3 rescue vector. This will involve construction of a STAT3 rescue vector followed by its
transfection into SHEP1 cells. After exposure to antibiotics, cDNA from surviving cells will be
127
extracted and the STAT3 rescue vector recovered. The second and final proof-of-concept
experiment will require recovery of hRic3/pREP9 diluted into varying concentrations of pREP9.
The gene-of-interest allowing 7 expression may be a poorly expressed gene, and by recovering
hRic3 diluted into pREP9, a threshold for being able to recover rare genes will be investigated.
V. DISCUSSION
Calcium is one of the most versatile signal transduction components, and its intracellular
concentration impacts a wide variety of cellular processes including cell cycle, differentiation,
and proliferation. Regulation of calcium levels is an intricate process involving balances
between cation release through ryanodine receptors and inositol triphosphate receptors on the
ER, and calcium influx through several voltage-gated ion channels and ligand-gated receptors.
Calcium pumps and ion exchangers also aid in regulating intracellular calcium concentration.
Since Ca2+
controls many cellular signaling cascades, imbalances in its homeostasis may be
present in a variety of disorders. For example, several forms of cancer are associated with
abnormal activity of Ca2+
channels and binding proteins important for maintaining normal
intracellular Ca2+
levels (Schuller, 2009). Calcium levels are also implicated in neurological
disorders, as ion flow into the neuron triggers depolarization essential for neurotransmitter
release. Ca2+
influx through 7 in chick ciliary ganglion or cultured rat hippocampal neurons
initiates Ca2+
-dependent signaling pathways while altering gene expression and synaptic
plasticity (Chang and Berg, 2001). Among the neuronal nicotinic receptors, 7 receptors are the
most highly permeable to Ca2+
. This characteristic contributes to its appeal as a target for drug
development efforts.
By influencing intracellular Ca2+
levels, 7 receptors help to regulate numerous signaling
pathways, synaptic plasticity, and cognitive processes (Quick and Lester, 2002). Although
128
nicotinic receptors are traditionally recognized as ligand-gated ion channels, nicotine-activated
7 receptors participate in STAT3 signaling that is part of the cholinergic anti-inflammatory
pathway (De Jonge et al., 2005). STAT3 modulates the transcription of genes involved in
regulating cell differentiation, proliferation, apoptosis, angiogenesis, metastasis, and immune
modulation. Elevated levels of activated STAT3 have been associated with a poor outcome in
cancer, as STAT3-activated genes block apoptosis and inhibit antitumor events while promoting
angiogenesis and metastasis (Johnston and Grandis, 2011). Modification of STAT3 activity is a
widely accepted anticancer strategy.
Observations that metabotropic IL6 receptors mediate STAT3 signaling independently of
ion flow and that nicotinic 42 receptors can mediate such signaling without Ca2+
influx (Hosur
and Loring, 2011) fueled our interest in studying the dependency of ion flow for 7-mediated
STAT3 signaling. Using a custom reporter with a Metridia luciferase reporter gene downstream
from a STAT3 promoter, we investigated whether 7 heterologously expressed in mammalian
cells can drive STAT3 signaling in an environment lacking normal Ca2+
, Mg2+
, and Na+ flow.
Validation of the STAT3-ML assay involved transfection into Invivogen’s HEK-Blue IL6 cells
driving secreted alkaline phosphatase (SEAP) upon IL6 application. Since IL6 simultaneously
raised expression of SEAP and luciferase, and IL6-driven reporter expression was blocked by
150 nM JAK inhibitor I, 30 M AG490, or 30 M S3I-201, it was likely that nicotine-driven
luciferase expression was attributable to STAT3 activation. Following assay optimization and
validation, experiments were performed to study whether 7-mediated, nicotine-driven STAT3-
driven signaling can take place in heterologous expression systems modified to possess greatly
reduced ion flow.
129
To study the necessity of cation influx for-mediated STAT3 signaling, experiments
were performed with reduced calcium and magnesium ions. To lower Ca2+
levels, cells were
pretreated with the intracellular calcium chelator, BAPTA-AM, and the extracellular calcium
chelator, EGTA, prior to nicotine application. Under these conditions, luciferase expression
indicative of STAT3 activation was similar in amplitude compared to conditions with normal
levels of calcium. Maintenance of cells in substituted HBSS lacking calcium before chelator
application did not abolish STAT3-driven luciferase expression, providing further evidence that
7-mediated STAT3 signaling may not require calcium ion flow. Further work is required for
determining if 7-STAT3 signaling is metabotropic and occurs in the absence of ion flow.
If no ion flow is required for 7-mediated STAT3 signaling, 7 nicotinic receptors may
have two distinct signaling mechanisms: one ionotropic, and the other metabotropic. This would
have several implications for drug discovery. For example, since STAT3 activity is elevated in
many cancers, it is possible that nicotine increases cancer risk in a different way than
contributing to the widely-established addictive nature of cigarette smoking. Results may also
have implications for desensitized 7 receptors in drug development. Previous reports show
nicotinic receptors interact with G proteins, arrestins, and protein kinases (Lee et al., 2008;
Buccafusco et al., 2009; Lefkowitz et al., 2006; Kihara et al., 2001; Buckingham et al., 2009).
These findings, in addition to our results, suggest that in the case of 7, there may be more to
desensitization than solely preventing further ion flow. Perhaps slower metabotropic signaling
trails an rapid initial stage of ionotropic signaling after desensitization.
Findings from this project further highlight the signaling diversity associated with
nicotinic activation of 7 receptors. The anti-inflammatory role of 7 demonstrated by Tracey
et al. (2003) was found to similarly occur in mouse brain via microglial 7 receptors (Shytle et
130
al., 2004). Additionally, nicotine-driven, 7-mediated protection of cortical neurons was
reported to occur via the PI3K/Akt pathway (Kihara et al., 2001), and 7 signaling in microglia
may involve PLC activation and increased intracellular calcium levels through ion release from
intracellular storage compartments rather than canonical ion flow through activated receptors
(Suzuki et al., 2006). The wide variety of potential 7 signaling modes may be partially due to
multiple receptor isoforms. At least two isoforms of rat 7 receptors have been reported
(Severance et al., 2004), and additional isoforms may be involved in mediating the lesser-known
signaling pathways elicited by nicotine binding.
One drawback of the STAT3-MetLuc assay is that it does not offer insight into whether
open or desensitized receptors are responsible for mediating downstream signaling. It is likely
that JAK2 binding to 7 depends upon conformational changes in the receptor following
activation, since competitive and noncompetitive antagonists block nicotine-induced decreases in
NFB and cytokine activity (Hosur et al., 2009). However, whether JAK2 associates with the
open or higher-affinity desensitized form of the receptor is undecipherable from the STAT3-
MetLuc assay. Despite this shortcoming, there are many facets of 7 signaling that can be
investigated using this assay. For example, whether other subtypes of nicotinic receptors, or
even other types of Cys-loop receptors, possess immune modulatory capability can be
investigated. Although 7 and 42 share an ability to mediate STAT3 signaling, they share
little homology, particularly in the large intracellular loop between the third and fourth
transmembrane domains of receptor subunits where JAK2 interaction may occur (Hosur and
Loring, 2011). The most highly homologous regions are the intracellular loop bridging the first
and second transmembrane domains of subunits, and the end of the intracellular loop between
the third and fourth transmembrane domains (Hosur and Loring, 2011). With this in mind,
131
perhaps other receptors can bind to and activate JAK2 despite differences in amino acid
sequence. Also, the STAT3-MeLuc assay can be used to examine if 7-mediated STAT3
immune suppression takes place in other types of cells. Studies have suggested the 42-driven
anti-inflammatory response is limited to peripheral macrophages (Matsunaga et al., 2001; van
der Zanden et al., 2009), but the localization of these receptors to neuronal and non-neuronal
cells may implicate them in immune modulation effects in the brain (Gahring et al., 2004).
Findings demonstrating 7 involvement with anti-inflammatory pathways in the brain would
have numerous implications in further justifying drug therapies aimed at targeting this receptor.
Although JAK2-STAT3 signaling has typically been associated with decreasing
generation and activity of pro-inflammatory cytokines, in some cases it may actually enhance
production of pro-inflammatory cytokines (Kox et al., 2009). JAK2-STAT3 signaling has also
been shown to either increase or decrease NFB activity. While De Jonge et al. (2005)
demonstrated STAT3 is a component of 7-mediated anti-inflammatory effects in macrophages,
and Chen et al. (2008) showed that nicotine-driven STAT3 activation leading to increased NFB
activation, Marrero and Bencherif (2009) reported that in PC12 cells, 7-dependent STAT3
signaling increases NFB activity. Another unresolved aspect of STAT3 signaling is the role of
phosphorylated versus nonphosphorylated STAT3. Although phosphorylated STAT3 has
commonly been regarded as the active form, some reports suggest the nonphosphorylated protein
modulates the immune response in macrophages (Pena et al., 2010). Further research is needed
to elucidate how STAT3 signaling elicits both pro-inflammatory and anti-inflammatory effects
depending on the context. Findings from the current project demonstrate that 7 can promote
anti-inflammatory events following nicotine application in our particular heterologous
expression system. However, it is possible that 7-mediated pro-inflammatory effects may be
132
observed in a different system. The context-dependence of STAT3 signaling warrants further
investigation.
The initial objective of the current project was to study 7-mediated STAT3 signaling.
While investigating calcium dependency of7-mediated STAT3 signaling, we observed cell
line-dependent requirements of Ric3 transfection for nicotine-induced 7-mediated STAT3
expression, indicative of surface 7 expression. Ric3 was discovered during a genetic screen in
C. elegans for mutants that could survive in the acetylcholinesterase inhibitor, aldicarb (Nguyen
et al., 1995). It promotes surface expression of several nicotinic receptor subtypes in C. elegans
and allows surface 7 expression in oocytes and several mammalian cell lines (Halevi et al.,
2002). However, it does not affect surface expression of glutamate or GABA receptors (Lansdell
et al., 2005). The most prominent effect of Ric3 activity appears to be its enhancement of surface
7 expression. Non-permissive HEK293 cells fail to generate surface 7 receptors detected by
125I-BGT binding without Ric3 transfection (Williams et al., 2005). However, co-transfection
of Ric3 with 7 significantly enhances toxin binding. While SHEP1 and HEK293 cells
transfected with 7 alone produce low levels of surface receptors (Sweileh et al., 2000) that can
be increased by Ric3 co-transfection, GH4C1 cells produce surface 7 receptors without Ric3
transfection. It was initially postulated that greater levels of 7 receptors in GH4C1 cells could
be accounted for by greater amounts of Ric3. Our original hypothesis was that knocking down
Ric3 protein in GH4C1 cells lowers surface 7 expression. To test this hypothesis, the
relationship between Ric3 protein levels- determined using Santa Cruz antibodies- and surface
receptor levels was investigated.
Findings that SHEP1 and GH4C1 cells (Williams et al., 2005) express low levels of Ric3
mRNA, and that neither shows significant Ric3 antibody staining without prior transfection
133
suggest there may be additional chaperones allowing 7 expression. The Santa Cruz antibodies
against Ric3 recognize proprietary epitopes in rat Ric3 exons 5 and 6 (Santa Cruz Biotechnology
Technical Support) and our findings suggest that binding of these antibodies to Ric3 is
conformation dependent. Although antibodies exhibit staining in lysates from Ric3-transfected
cells that is prevented by a blocking peptide, the existence of multiple human and Drosophila
Ric3 splice variants (Halevi et al., 2003; Seredenina et al., 2008) raises the possibility that our
antibodies may not recognize all functional rat Ric3 splice variants. To investigate the
possibility of unknown rat Ric3 splice variants and explore whether specific exons may facilitate
maturation, we tested the effects of knocking down each targetable rat Ric3 exon. Several
exons targeted for knockdown coded for functionally significant regions of the protein.
The sequence and short length of rat Ric3 exon 1 renders it unsuitable for RNAi
knockdown. However, exon 2- a region encoding a critical transmembrane domain present in all
currently known Ric3 splice variants that influence 7 expression- is a suitable region to target
for knockdown. In SHEP1 cells transfected with 7 and rat Ric3, but not hRic3, shRNA against
rat Ric3 exon 2 prevented surface 7 expression and knocked down Ric3 protein. However,
under similar conditions in GH4C1 cells, shRNA against exon 2 had no effect on surface 7
expression despite Ric3 protein knockdown. Another important region of Ric3 is the coiled-coil
domain in exon 4 of mouse, rat, and human isoforms, as all known functional Ric3 splice
variants possess this domain. Using siRNA against exon 4, Ric3 knockdown correlated with
reductions in 7 expression in SHEP1 cells co-transfected with 7 and Ric3. However, under
similar conditions in GH4C1 cells, 7 expression persisted despite Ric3 knockdown. shRNA
constructs against exons 2, 5, and 6 were also obtained. Each construct lowered 7 expression in
SHEP1 cells co-transfected with 7 and rat Ric3, but failed to affect surface 7 expression in
134
GH4C1 cells. RNAi targeting a broad range of the Ric3 transcript yielded similar findings.
Taken together, results suggest that while Ric3 protein is obligatory for robust 7 expression in
SHEP1 cells, GH4C1 cells do not need currently known splice variants of rat Ric3 protein to
yield surface 7 receptors.
The major finding from Ric3 knockdown experiments is the cell line-dependent
requirement for Ric3 facilitation of surface 7 expression. However, these studies also provided
insight into the stability of Ric3 protein, suggesting a half-life of a few days. A ten-day period in
antibiotics was the minimum time to allow sufficient selection against cells not expressing
shRNA. Furthermore, it was unlikely that cell line-dependent consequences of Ric3 protein
knockdown on 7 expression arose from cell line-dependent discrepancies in susceptibility to
RNAi, as both SHEP1 and GH4C1 cells pre-transfected with rat Ric3 and maintained in
antibiotics for 10 days after transfection with shRNA, but not scrambled shRNA, did not possess
detectable Ric3 protein. Although protein was not detectable, it is important to note that the
sensitivity of detection for Ric3 was not established.
While evidence suggests GH4C1 cells have unknown 7 chaperones aside from Ric3,
other scenarios involving protein-protein associations are possible. For example, perhaps Ric3
interactions with other proteins in GH4C1 cells allow low amounts of Ric3 to promote surface
7 expression. In oocytes, Ric3 is one of three chaperones necessary for expression of C.
elegans levamisole-sensitive nicotinic receptors (Boulin et al., 2008). Although Ric3 does not
appear to influence expression of nicotinic receptors by itself, surface expression is increased
when it is combined with Unc-50 and Unc-74 (Eimer et al., 2007; Lewis et al., 1980). Also, it is
possible that proteins may interact with Ric3 to interfere with its ability to promote 7
maturation in GH4C1 cells. In C. elegans, BATH-42 blocks Ric3 promotion of nicotinic
135
receptor expression by targeting it for degradation following strong interaction with the C-
terminus of the 7 chaperone (Shteingauz et al., 2009).
While knocking down Ric3 reduces surface 7 expression in non-permissive SHEP1 and
HEK293 cells, overexpressing Ric3 has been shown to be detrimental to receptor expression as
well. Results from Shteingauz et al. (2009) indicate that Ric3 expression leads to accumulation
of protein aggregates that may associate with nicotinic receptor subunits and reduce the amount
of subunits free to be assembled into mature receptors. BATH-42 regulates levels of Ric3 by
targeting excess protein for proteasomal degradation, and loss of BATH-42 actually interferes
with 7 activity (Shteingauz et al., 2009). While the implications of controlling 7 expression
have been major topics underscoring the significance of our project, it is also important to
acknowledge the importance of regulating levels of Ric3. The 7 chaperone is not exclusive in
its overexpression being detrimental to functionality. Overexpression of UNC-45, a myosin
chaperone, results in reduced activity and disturbance with myosin construction (Hoppe et al.,
2004). Although Ric3 is necessary for surface 7 expression in some cases, Ric3 aggregates
stemming from overexpression may pull receptor subunits away from the assembly process.
Therefore, normal receptor signaling may require proper Ric3 regulation.
Experiments investigating cell line-dependency of surface 7 expression have broader
repercussions beyond the mechanistic details of receptor function. Evidence supporting cell line-
dependency of unknown 7 chaperones for successful surface expression has implications
stretching across the entire nervous system. If neurons that do not express surface receptors can
somehow be engineered to generate functional receptors, the ability of altering 7 activity by
targeting chaperone activity may be of interest for a wide range of drug development efforts. If
all neurons already possess an intrinsic, controllable ability to produce surface receptors, the
136
regulation of expression in a novel fashion may be of particular interest to those attempting to
manage diseases by altering receptor activity. Results implicating receptor signaling through
both ionotropic and metabotropic modes further strengthens the utility of developing 7-specific
agents.
Ongoing research continues to improve our understanding of the roles of 7 receptors in
the development and progression of a wide range of disorders. As more work is done, it appears
that solely activating or inhibiting 7 to treat diseases may be an overly simplistic approach,
given the multitude of cellular pathways affected by these receptors. Targeting voltage-gated
calcium channel blockers and developing allosteric modulators may be more promising
strategies (Schuller, 2009). For some cancers, determining 7 expression may be useful,
especially if supplemented with knowledge of cAMP levels. Drugs that raise cAMP, like
phosphodiesterases, may help people with elevated 7 expression and low cAMP. An
alternative strategy would be to compensate for high 7 expression by adjusting receptor
expression. Our project supports the potential of modulating receptor levels by targeting
molecular chaperones. Recent work has led to the emergence of molecular chaperones as targets
for drug discovery. One example is heat shock protein 90 (Hsp90).
Hsp90 is a molecular chaperone involved in the folding of many proteins. Several Hsp90
inhibitors have been developed and studied in clinical trials (Petrikaite and Matulis, 2011). Most
candidates are being examined for anti-cancer effects (Ortiz and Salcedo, 2010; Banerji, 2009).
However, there are also ongoing clinical trials investigating their potential for treating
neurodegenerative diseases, such as Alzheimer’s disease (Luo et al., 2010), Parkinson’s disease,
multiple sclerosis, Huntingtons’s disease (Peterson and Blagg, 2009), rheumatoid arthritis (Rice
et al., 2008), and cystic fibrosis (Jouret and Devuyst, 2009). Although Hsp90 inhibitors target a
137
specific protein, their action affects numerous signaling pathways. This may be particularly
useful for treating cancer, as Hsp90 inhibitors may circumvent the genetic plasticity that lets
cancer cells evade the cytotoxicity of other compounds. The development of drugs targeting
Hsp90 and other chaperones, including Ric3, requires a thorough understanding of their actions.
Although Ric3 transfection was necessary for robust 7 expression in non-permissive
HEK293 and SHEP1 cells, its requirement for surface 7 expression in GH4C1 cells was not
observed. Since Ric3 knockdown achieved through RNAi constructs targeting several exons
along the transcript failed to reduce 7 expression in GH4C1 cells, 7 expression in this cell line
may rely on an unknown functional Ric3 splice variant or an alternative chaperone present in
GH4C1 cells but absent in SHEP1cells. In mouse dentate gyrus, 125
I-BGT binding in the
absence of Ric3 mRNA expression suggests additional factors may promote 7 maturation
(Halevi et al., 2003). Our findings suggest that mouse models lacking Ric3 may still show
BGT binding in this region. Results also justify future screens for novel 7 chaperones in a
cDNA library obtained from GH4C1 cells using a variation of the 7 signaling assay initially
developed to explore calcium dependency of STAT signaling. In our STAT3-ML assay, nicotine
application to cells expressing surface 7 receptors produced robust increases in STAT3-driven
luciferase expression that were blocked by 7, JAK2, and STAT3 inhibitors. An assay utilizing
a STAT3 rescue vector in which nicotine treatment allows 7-expressing cells to survive in the
presence of antibiotics through STAT3 activation will be useful for identifying unknown 7
chaperones.
VI. FUTURE DIRECTIONS
There are two major routes of future research our project can open. One area of future
work involves using the current STAT3-ML assay to further explore 7 signaling. Another
138
possibility involves using a modified version of the STAT3-ML signaling assay to search for
unknown 7 chaperones in GH4C1 cell cDNA. A variation of this assay in which 7-dependent
STAT3 activation drives antibiotic resistance, rather than luciferase expression, may be useful
for screening a cDNA expression library for unknown 7 chaperones. Initial proof-of-concept
studies were carried out and supported the feasibility of constructing a cDNA library with the In-
Fusion Cloning kit (Clontech) and screening it for 7 chaperones. Before pursuing these
endeavors, it may be useful to carry out several experiments that would have implications for
both the current STAT3-ML signaling assay and a modified version for chaperone screening.
Both avenues of future research would benefit from greater signal-to-noise ratio of our
assay. Experiments using the original STAT3-ML plasmid without cell selection yielded ~2-fold
increases in luciferase expression, while studies using STAT3-ML-P9KB with cell selection
showed ~10-fold increases. Perhaps designing a positive feedback loop by which STAT3
activation leads to more STAT3 activation will further increase the signal. The signal-to-noise
ratio may also be improved by using a suppressor of cytokine signaling 3 (SOCS3) inhibitor.
STAT3 activation increases SOCS3 activity, which acts in a negative feedback loop to suppress
further STAT3 activation. Perhaps inhibiting this protein would increase the signal-to-noise
ratio further. Increased STAT3-driven luciferase expression would be a useful improvement of
the current signaling assay, while increased STAT3-driven antibiotic resistance would make
isolation of cells expressing unknown 7 chaperone cDNA more effective.
Most studies performed in this project involved either SHEP1 cells maintained in DMEM
or GH4C1 cells maintained in Ham’s F10. Future studies should be carried out to investigate the
possibility that differences in media are biasing the results. Ham’s F10 contains various
components, such as hypoxanthine, that are not found in DMEM. Maintaining cells in modified
139
media prior to experimentation may provide insight into the impact media components may have
on the results. Another factor worthy of investigation is which 7 agonist to use for driving
STAT3 activation. Although nicotine was used to stimulate 7-driven STAT3 signaling
throughout this project, it may be useful to explore the use of alternative agonists, such as
acetylcholine. The cell permeability of nicotine may skew the results somewhat by binding to
unassembled 7 subunits within the cell. A non-permeant agonist may be better suited for
exploring activation of only fully assembled receptors that have arrived at the cellular surface.
After addressing the signal-to-noise ratio, media bias, and type of agonist, further investigations
into 7 signaling can be carried out.
Future studies using the current STAT3-ML assay can address a host of features
surrounding 7-dependent STAT3 signaling, such as the interaction between the receptor and
JAK2. Perhaps conformational changes in the intracellular loops, communicated across the
plasma membrane after agonist interaction with the ligand-binding domain, trigger JAK2
interaction and activation. JAK2 mediates signaling stemming from activation of G-protein
coupled receptors (Ahr et al., 2005) and receptor tyrosine kinases (Pelletier et al., 2006).
Another aspect of 7-driven STAT3 signaling that warrants further investigation is the
involvement of open versus desensitized receptors. A disadvantage of the current STAT3-
MetLuc signaling assay is that it does not decipher whether it is the open, or the high-affinity
desensitized receptor that is responsible for interacting with JAK2. Perhaps co-transfecting cells
with STAT3-ML and mutated 7 less inclined to desensitize would provide insight into whether
desensitized receptors can drive STAT3 signaling. It would also be worthwhile to examine if
other types of receptors in the Cys-loop family of receptors are capable of eliciting pro-
inflammatory or anti-inflammatory responses. Whether 7 has the capacity to influence immune
140
processes in other cell lines is another question worthy of investigation. If 7-mediated anti-
inflammatory effects occur in the brain, this may have major implications for drug development.
While the current STAT3-ML assay has further utility, another major route of future work
involves constructing a STAT3 rescue vector in which STAT3 activation drives antibiotic
resistance. This will serve as tool for screening GH4C1 cell cDNA for 7 chaperones.
Following cDNA library construction, screening for 7 chaperones will involve several
transfections. First, non-permissive SHEP1 cells will be transfected with a HuSH 29mer short
hairpin RNA (shRNA) construct against rat Ric3 in a pRFP-C-RS vector. This will prevent the
re-cloning of Ric3 protein. The pRFP-C-RS vector has a CMV promoter region that
constitutively drives the expression of red fluorescent protein (RFP) in mammalian cells (HuSH
shRNA Plasmid Panels Application Guide. 2009. Origene), as well as a puromycin-resistant
gene. Following shRNA transfection, dot blot analysis will confirm the absence of Ric3 and red
fluorescent protein will indicate the extent of transfection. Transfected cells will be grown and
maintained in media containing puromycin to sustain selection pressure. Cells lacking Ric3
protein will then be transfected with three constructs: 1) an /pREP4 vector possessing a
hygromycin-resistant gene, 2) a cDNA library containing pREP9 episomal replicating vector
with a neomycin-resistant gene, and 3) a STAT3-driven selection vector conferring zeocin
resistance. Transfected cells will be grown and maintained in media containing hygromycin,
neomycin, and puromycin to sustain selection pressure. Cells possessing functional 7 receptors
will be selected using the STAT3-driven selection vector, whether it involves EGFP for cell
sorting, or survival via zeocin resistance. In the latter case, cells will be treated with 10 M
nicotine, while being exposed to zeocin at an appropriate time following nicotine exposure, to
stimulate 7 receptors to activate STAT3-driven antibiotic resistance and allow the survival of
141
7-producing cells. Under these conditions, cells that survive in the presence of antibiotics each
vector confers resistance to are those that have been successfully transfected and are activating
STAT3 via stimulation of surface receptors in the absence of Ric3 or genes that directly
activate STAT3. A second screen will remove those genes directly activating STAT3 using 125
I-
-bungarotoxin binding assays for 7 expression in the SHEP1 cell subclones. The number of
false positives may be previewed by treating transfected cells with zeocin without a nicotine
pretreatment. Cells surviving zeocin in the absence of nicotine are likely to represent false
positive, but those genes should be eliminated by the binding screen. Therefore, the remaining
cells should contain additional chaperones aside from Ric3 allowing 7 expression. cDNA
plasmids from these cells will be extracted, transformed into bacteria, purified, sequenced, and
BLAST screened.
VII. CONCLUSIONS
7 nicotinic receptors participate in two distinct modes of signaling. One involves
calcium flow into the cell that triggers a host of cellular responses but is transient due to rapid
desensitization (Seguela et al., 1993). The second is a longer-lasting process by which 7
receptors mediate STAT3 signaling (Borovikova et al., 2000; Tracey et al., 2003; De Jonge et al.,
2005). The primary purpose of this project was to develop a signaling assay for investigating the
relationship between these two modes of signaling. To accomplish this, a novel STAT3-ML
reporter plasmid was constructed and co-transfected with 7 into SHEP1 or GH4C1 cells.
Pretreating cells with calcium chelators prior to nicotine exposure allowed investigations into
calcium-dependency of 7-driven STAT3 signaling. To our knowledge, this is the only study
investigating nicotinic STAT3 signaling in a heterologous expression system.
142
This project was driven by recent work showing IL6-driven STAT3 signaling can take
place independently of calcium flow, and that activation of 42 nicotinic receptors can reduce
NFB activity by activating STAT3 without calcium (Hosur and Loring, 2011). Furthermore,
microglial 7 activation leads to increased intracellular Ca2+
that takes place independently of
extracellular Ca2+
and that can be blocked by inhibition of Ca2+
release from intracellular stores
(Suzuki et al., 2006). Studies using the STAT3-ML signaling assay provided further evidence of
calcium-independent signaling, as pretreatment with calcium chelators and maintenance in
calcium-low media failed to reduce nicotine-induced STAT3 activation. Aside from allowing
investigations into 7-mediated STAT3 signaling, the STAT3-ML assay provided insight into
cell-dependency of 7 maturation, as the 7 chaperone Ric3 was required for 7-driven STAT3
activation in SHEP1 but not GH4C1 cells. These findings motivated the design of RNAi
constructs to explore the necessity of Ric3 for surface 7 expression.
A series of RNAi constructs were designed to target various exons along the Ric3
transcript. In SHEP1 cells, Ric3 protein knockdown by each RNAi construct tested resulted in
reduced surface 7 expression. However, in GH4C1 cells, Ric3 protein knockdown by each
construct had no impact on receptor expression. Taken together, results suggest the possibility
that GH4C1 cells possess 7 chaperones aside from the known functional Ric3 splice variants.
To investigate the identity of these chaperones, a variation of the 7 signaling assay used to
study 7-STAT3 signaling can be developed. In this assay, 7 activation would drive antibiotic
resistance, rather than luciferase expression, and allow 7 producing cells lacking Ric3 to
survive in the presence of antibiotics. GH4C1 cDNA fragments obtained from surviving cells
can be further analyzed for the unknown chaperones. Proof-of-concept studies were carried out
to assess the feasibility of using this method to screen for 7 chaperones and provided evidence
143
supporting the practicality of using the In-Fusion Cloning Kit (Clontech) to generate a cDNA
library from GH4C1 cells and screen it for 7 chaperones using a STAT3 rescue vector.
144
VIII. REFERENCES
1. Adler LE, Hoffer LJ, Griffith J, Waldo MC, Freedman R. (1992). Normalization of
nicotine of deficient auditory sensory gating in the relatives of schizophrenics. Biol
Psychiatry, 32(7):607-616.
2. Ahr B, Denizot M, Robert-Hebmann V, Brelot A, Biard-Piechaczyk M. (2005).
Identification of the cytoplasmic domains of CXCR4 involved in JAK2 and STAT3
phosphorylation. J Biol Chem, 280(8):6692-6700.
3. Aigner A. (2006). Gene silencing through RNA interference (RNAi) in vivo: strategies
based on the direct application of siRNAs. Journal of Biotechnology, 124(1):12-25.
4. Altschul SF, Gish W, Miller W, Myers EW, Lipma DJ. (1990). Basic local alignment
search tool. J. Mol. Biol, 215(3):403-410.
5. Andersson U, Tracey KJ. (2011). Principles of immunological homeostasis. Annu. Rev.
Immunol, 30:313-335.
6. Arredondo J, Chernyavsky AI, Grando SA. (2007). SLURP-1 and -2 in normal,
immortalized and malignant oral keratinocytes. Life Sci, 80(24-26):2243-2247.
7. Arredondo J, Chernyavsky AI, Jolkovsky DL, Pinkerton KE, Grando SA. (2006).
Receptor-mediated tobacco toxicity: cooperation of the Ras/Raf-1/MEK1/ERK and JAK-
2/STAT-3 pathways downstream of 7 nicotinic receptor in oral keratinocytes. FASEB,
20:2093-2099.
8. Banerji U. (2009). Heat shock protein 90 as a drug target: some like it hot. Clin Cancer
Res, 15(1):9-14.
145
9. Ben-Ami HC, Yassin L, Farah H, Michaeli A, Eshel M, Treinin M. (2005). RIC-3 affects
properties and quantity of nicotinic acetylcholine receptors via a mechanism that does not
require the coiled-coil domains. Journal of Biological Chemistry, 280(30):28053-28060.
10. Bencherif M, Fowler K, Lukas R, Lippiello PM. (1995). Mechanisms of up-regulation of
neuronal nicotinic acetylcholine receptors in clonal cell lines and primary cultures of fetal
rat brain. J Pharmacol Exp Ther, 275(2):987-994.
11. Bezprozvanny I, Mattson MP. (2008). Neuronal calcium mishandling and the
pathogenesis of Alzheimer's disease. Trends Neurosci, 31(9):454-463.
12. Biala Y, Liewald JF, Ben-Ami HC, Gottschalk A, Treinin M. (2009). The conserved
RIC-3 coiled-coil domain mediates receptor-specific interactions with nicotinic
acetylcholine receptors. Mol Biol Cell, 20(5):1419-1427.
13. Blount P and Merlie JP. (1990). Assembly intermediates of the mouse muscle nicotinic
acetylcholine receptor in stably transfected fibroblasts. J. Cell Biol, 111(6 Pt 1):2601-
2611.
14. Blount P, Merlie JP. (1991). BIP associates with newly synthesized subunits of the mouse
muscle nicotinic receptor. J. Cell Biol, 113(5):1125-1132.
15. Blumenthal EM, Conroy WG, Romano SJ, Kassner PD, Berg DK. (1997). Detection of
functional nicotinic receptors blocked by alpha-bungarotoxin on PC12 cells and
dependence of their expression on post-translational events. J. Neurosci, 17(16):6094-
6104.
16. Bogerts B, Hantsch J, Herzer M. (1983). A morphometric study of the dopamine-
containing cell groups in the mesencephalon of normals, Parkinson patients, and
schizophrenics. Biol. Psychiatry, 18(9):951-969.
146
17. Bogerts B, Lieberman JA, Bilder RM, Ashtari M, Degreef G, Lerner G, Johns C, Masiar
S. (1992). A volumetric MRI study of limbic structures in chronic schizophrenia-
relationship to psychopathology. Clin. Neuropharmacol. 15(Suppl 1) Pt A, 112A-113A.
18. Borovikova LV, Ivanova S, Zhang M, Yang H, Botchkina GI, Watkins LR, Wang H,
Abumrad N, Eaton JW, Tracey KJ. (2000). Vagus nerve stimulation attenuates
the systemic inflammatory response to endotoxin. Nature, 405(6785):458-462.
19. Brejc K, van Dijk WJ, Klaassen RV, Schuurmans M, van Der Oost J, Smit AB, Sixma
TK. (2001). Crystal structure of an ACh‑binding protein reveals the ligand‑binding
domain of nicotinic receptors. Nature, 411(6835):269-276.
20. Boulin T, Gielen M, Richmond JE, Williams DC, Paoletti P, Bessereau JL. (2008). Eight
genes are required for functional reconstitution of the Caenorhabditis elegans
levamisole-sensitive acetylcholine receptor. Proc Natl Acad Sci, 105(47):18590-18595.
21. Bowers MT, Ramachandran S, Yu BW. (1999). Modified miniprep method for the rapid
recovery of episomes from transfected breast epithelial cells. Biotechniques, 26(2):276-
80.
22. Brunzell DH, McIntosh JM. (2012). Alpha 7 nicotinic acetylcholine receptors modulate
motivation to self-administer nicotine: implications for smoking and schizophrenia.
Neuropsychopharmacology, 37(5):1134-1143.
23. Buccafusco JJ, Beach JW, Terry AV Jr. (2009). Desensitization of nicotinic acetylcholine
receptors as a strategy for drug development. J. Pharmacol.Exp. Ther, 328(2):364-370.
24. Buckingham SD, Jones AK, Brown LA, Sattelle DB. (2009). Nicotinic acetylcholine
receptor signaling: roles in Alzheimer’s disease and amyloid neuroprotection. Pharmacol.
Rev, 61(1):39-61.
147
25. Burghaus L, Schutz U, Krempel U, de Vos RA, Jansen Steur EN, Wevers A, Lindstrom J,
Schroder H. (2000). Quantitative assessment of nicotinic acetylcholine receptor proteins
in the cerebral cortex of Alzheimer patients. Brain Res Mol Brain Res, 76(2):385-388.
26. Burns DM. (2003). Tobacco-related diseases. Semin. Oncol. Nurs, 19(4):244-249.
27. Castelan F, Castillo M, Mulet J, Sala S, Sala F, Dominguez del Toro E, Criado M.
(2008). Molecular characterization and localization of the RIC-3 protein, an effector of
nicotinic acetylcholine receptor expression. Journal of Neurochemistry, 105(3):617-627.
28. Castillo M, Mulet J, Gutierrez LM, Ortiz JA, Castelan F, Gerber S, Sala S, Sala F, Criado
M. (2005). Dual role of the RIC-3 protein in trafficking of serotonin and nicotinic
acetylcholine receptors. The Journal of Biological Chemistry, 280(29):27062-27068.
29. Castro NG, Albuquerque EX. (1995). -Bungarotoxin-sensitive hippocampal nicotinic
receptor channel has a high calcium permeability. Biophysical Journal, 68(2):516-524.
30. Celie PH, Klaassen RV, van Rossum-Fikkert SE, van Elk R, van Nierop P, Smit AB,
Sixma TK. (2005). Crystal structure of acetylcholine binding protein from Bulinus
truncatus reveals the conserved structural scaffold and sites of variation in nicotinic
acetylcholine receptors. J. Biol. Chem, 280(28):26457-26466.
31. Chang W, Gelman MS, and Prives JM. (1997). Calnexin-dependent enhancement of
nicotinic acetylcholine receptor assembly and surface expression. J. Biol. Chem,
272(46):28925-28932.
32. Chernyavsky AI, Arredondo J, Galitovskiy V, Qian J, Grando SA. (2010). Upregulation
of NF-B expression by SLURP-1 is mediated by alpha7 nicotinic acetylcholine receptor
and involves both ionic events and activation of protein kinases. Am J Physiol Cell
Physiol, doi: 10.1152/ajpcell.00216.2010.
148
33. Chen R, Ho Y, Guo H, Wang Y. (2008). Rapid activation of Stat3 and ERK1/2 by
nicotine modulates cell proliferation in human bladder cancer cells. Toxicol. Sci, 104(2):
283-293.
34. Chenchik A, Zhu Y, Diatchenko L, Li R, Hill J, Siebert P. (1998). Generation and use of
high-quality cDNA from small amounts of total RNA by SMART PCR. In RT-PCR
Methods for Gene Cloning and Analysis, Eds. Siebert, P. & Larrick, J. (BioTechniques
Books, MA), pp. 305-319.
35. Cheng A, Bollan KA, Greenwood SM, Irving AJ, Connolly CN (2007). Differential
subcellular localization of RIC-3 isoforms and their role in determining 5-HT3 receptor
composition. J Biol Chem, 282(36):26158-26166.
36. Cheng A, McDonald NA, Connolly CN. (2005). Cell surface expression of 5-
hydroxytryptamine type 3 receptors is promoted by RIC-3. J Biol Chem, 280(23):22502-
22507.
37. Chevalier J, Yi J, Michel O, Tang X. (1997). Biotin and Digoxigenin as Labels for Light
and Electron Microscopy in Situ Hybridization Probes: Where Do We Stand? Journal of
Histochemistry and Cytochemistry, 45:481-492.
38. Clarke PB, Schwartz RD, Paul SM, Pert CB, Pert A. (1985). Nicotinic binding in rat
brain: autoradiographic comparison of [3H]acetylcholine, [3H]nicotine, and [125I]-alpha-
bungarotoxin J. Neurosci, 5(5):1307-1315.
39. Corringer PJ, Le Novere N, Changeux JP. (2000). Nicotinic receptors at the amino acid
level. Annu Rev Pharmacol Toxicol, 40:431-458.
40. Choe M, Jackson C, Yu BP. (1995). Lipid peroxidation contributes to age-related
membrane rigidity. Free Radic Biol Med, 18(6):977-984.
149
41. Conejero-Goldberg C, Davie P, Ulloa L. (2008). 7 nicotinic acetylcholine receptor: A
link between inflammation and neurodegeneration. Neurosci Biobehav Rev, 32(4):693-
706.
42. Cooper ST, Millar NS. (1997). Host-cell-specific folding and assembly of the neuronal
nicotinic acetylcholine receptor 7 subunit. J. Neurochem, 68(5):2140-2151.
43. Court JA, Martin-Ruiz C, Graham A, Perry E. (2000). Nicotinic receptors in human
brain: topography and pathology. J Chem Neuroanat, 20(3-4):281-298.
44. Couturier S, Bertrand D, Matter JM, Hernandez MC, Bertrand S, Millar N, Valera S,
Barkas T, Ballivet M. (1990). A neuronal nicotinic acetylcholine receptor subunit (7) is
developmentally regulated and forms a homo-oligomeric channel blocked by alpha-BTX.
Neuron, 5(6):847-856.
45. Curzon P, Anderson DJ, Nikkel AL, Fox GB, Gopalakrishnan M, Decker MW, Bitner
RS. (2006). Antisense knockdown of the rat 7 nicotinic acetylcholine receptor produces
spatial memory impairment. Neurosci. Lett, 410(1):15-19.
46. D’Alessio JM, Gerard GF. (1988). Second-strand cDNA synthesis with E. coli DNA
polymerase I and RNase H: The fate of information at the mRNA 5’ terminus and the
effect of E.coli DNA ligase. Nucleic Acids Res, 16(5):1999-2014.
47. Decker ER, Dani JA. (1990). Calcium permeability of the nicotinic acetylcholine
receptor: the single-channel calcium influx is significant. J Neurosci, 10(10):3413-3420.
48. De Jonge WJ, van der Zanden EP, The FO, Bijlsma MF, van Westerloo DJ, Bennink RJ,
Berthoud HR, Uematsu S, Akira S, van den Wijngaard RM, Boeckxstaens GE. (2005).
Stimulation of the vagus nerve attenuates macrophage activation by activating the Jak2–
STAT3 signaling pathway. Nat. Immunol, 6(8):844-851.
150
49. De Jonge WJ, Ulloa L. (2007). The 7 nicotinic acetylcholine receptor as a
pharmacological target for inflammation. Br J Pharmacol, 151(7):915-29.
50. De Luca V, Wong A, Muller DJ, Wong G, Tyndale RF and Kennedy JL. (2004).
Evidence of association between smoking and 7 nicotinic receptor subunit gene in
schizophrenia patients. Neuropsychopharmacology, 29(8):1522-1526.
51. Deutsch SI, Rosse RB, Mastropaolo J, Chilton M. (2003). Progressive worsening of
adaptive functions in Down syndrome may be mediated by the complexing of soluble A
peptides with the 7 nicotinic acetylcholine receptor: therapeutic implications. Clin
Neuropharmacol, 26:277-283.
52. Dineley KT, Westerman M, Bui D, Bell K, Ashe KH, Sweatt JD. (2001). ‑amyloid
activates the mitogen-activated protein kinase cascade via hippocampal 7 nicotinic
acetylcholine receptors: in vitro and in vivo mechanisms related to Alzheimer’s disease. J.
Neurosci.,21(12):4125-4133.
53. Dominguez del Toro E, Juiz JM, Peng X, Lindstrom J, Criado M. (1994).
Immunocytochemical localization of the alpha7 subunit of the nicotinic acetylcholine
receptor in the rat central nervous system. J. Comp. Neurol, 349(3):325-342.
54. Durcan N, Murphy C, Cryan SA. (2008). Inhalable siRNA: Potential as a Therapeutic
Agent in the Lungs. Molecular Pharmaceutics, 5(4):559-566.
55. Dziewczapolski G, Glogowski CM, Masliah E, Heinemann SF. (2009). Deletion of the
7 nicotinic acetylcholine receptor gene improves cognitive deficits and synaptic
pathology in a mouse model of Alzheimer’s disease. J. Neurosci, 29(27):8805-8815.
56. Eddins D, Lyford LK, Lee JW, Desai SA, Rosenberg RL. (2001). Permeant but not
impermeant divalent cations enhance activation of nondesensitizing 7 nicotinic
receptors. Am J Physiol Cell Physiol, 282:C796-C804.
151
57. Eimer S, Gottschalk A, Hengartner M, Horvitz HR, Richmond J, Schafer WR, Bessereau
JL. (2007). Regulation of nicotinic receptor trafficking by the transmembrane Golgi
protein UNC-50. EMBO J, 26(20):4313-4323.
58. Elliott KJ, Ellis SB, Berckhan KJ, Urrutia A, Chavez-Noriega LE, Johnson EC,
Velicelebi G, Harpold MM. (1996). Comparative structure of human neuronal alpha 2-
alpha 7 and beta 2-beta 4 nicotinic acetylcholine receptor subunits and functional
expression of the alpha 2, alpha 3, alpha 4, alpha 7, beta 2, and beta 4 subunits. J Mol
Neurosci, 7(3):217-228.
59. Fayuk D, Yakel JL. (2007). Dendritic Ca2+
signaling due to activation of 7-containing
nicotinic acetylcholine receptors in rat hippocampal neurons. J Physiol, 582(2):597-611.
60. Fernandes CC, Pinto-Duarte A, Ribeiro JA, Sebastiao AM. (2008). Postsynaptic action of
brain-derived neurotrophic factor attenuates 7 nicotinic acetylcholine receptor-mediated
responses in hippocampal interneurons. Journal of Neuroscience, 28(21):5611-5618.
61. Ficklin MB, Zhao S, Feng G. (2005). Ubiquilin-1 regulates nicotine-induced up-
regulation of neuronal nicotinic acetylcholine receptors. Journal of Biological Chemistry,
280 (40):34088-34095.
62. Fong TM, McNamee MG. (1986). Correlation between acetylcholine receptor function
and structural properties of membranes. Biochemistry, 25(4):830-840.
63. Forsayeth JR, Gu Y, Hall ZW. (1992). BiP forms stable complexes with unassembled
subunits of the acetylcholine receptor in transfected COS cells and in C2 muscle cells, J.
Cell Biol, 117(4):841-847.
64. Freedman R, Adler LE, Bickford P, Byerley W, Coon H, Cullum CM. (1994).
Schizophrenia and nicotinic receptors. Harvard Rev Psychiatry, 2:179-192.
152
65. Freedman R, Hall M, Adler LE, Leonard S. (1995). Evidence in postmortem brain tissue
for decreased numbers of hippocampal nicotinic receptors in schizophrenia. Biol
Psychiatry, 38(1):22-33.
66. Freedman R, Coon H, Myles-Worsley M, Orr-Urtreger A, Olincy A, Davis A,
Polymeropoulos M, Holik J, Hopkins J, Hoff M, Rosenthal J, Waldo MC, Reimherr F,
Wender P, Yaw J, Young DA, Breese CR, Adams C, Patterson D, Adler LE, Kruglyak L,
Leonard S, Byerley W. (1997). Linkage of a neurophysiological deficit in schizophrenia
to a chromosome 15 locus. Proc Natl Acad Sci USA, 94(2):587-592.
67. Freedman R, Leonard S. (2001). Genetic linkage to schizophrenia at chromosome 15q14.
Am. J. Med. Genet, 105(8):655-657.
68. Gahring LC, Persiyanov K, Dunn D, Weiss R, Meyer EL, Rogers SW. (2004).
Mouse strain-specific nicotinic acetylcholine receptor expression by inhibitory
interneurons and astrocytes in the dorsal hippocampus. J Comp Neurol, 468(3):334-
346.
69. Gelman MS, Chang W, Thomas DY, Bergeron JJM, Prives JM. (1995). Role of the
endoplasmic reticulum chaperone calnexin in subunit folding and assembly of nicotinic
acetylcholine receptors. J Biol Chem, 270(25):15085-15092.
70. Gelman MS, Prives JM. (1996). Arrest of subunit folding and assembly of nicotinic
acetylcholine receptors in cultured muscle cells by dithio-threitol. J. Biol. Chem,
271(18):10709-10714.
71. Ghildiyal M, Zamore PD. (2009). Small silencing RNAs: an expanding universe. Nat Rev
Genet, 10(2):94-108.
153
72. Giraudat J, Dennis M, Heidmann T, Chang JY, Changeux JP. (1986). Structure of the
high affinity binding site for noncompetitive blockers of the acetylcholine receptor:
Serine-262 of the subunit is labeled by [3H]
chlorpromazine. Proc. Natl Acad. Sci. USA,
83(8):2719-2723.
73. Gotti C, Fornasari D, Clementi F. (1997). Human neuronal nicotinic receptors. Prog.
Neurobiol, 53(2):199-237.
74. Green WN, Millar NS. (1995). Ion-channel assembly. Trends Neurosci, 18(6):280-287.
75. Grottick AJ, Trube G, Corrigall WA, Huwyler J, Malherbe P, Wyler R, Higgins GA.
(2000). Evidence that nicotinic 7 receptors are not involved in the hyperlocomotor and
rewarding effects of nicotine. J Pharmacol Exp Ther, 294(3):1112-1119.
76. Gu Y, Forsayeth JR, Verrall S, Yu XM, Hall ZW. (1991). Assembly of the mammalian
muscle acetylcholine receptor in transfected COS cells. J. Cell Biol, 114(4):799-807.
77. Guan ZZ, Zhang X, Blennow K, Nordberg A. (1999). Decreased protein level of nicotinic
receptor 7 subunit in the frontal cortex from schizophrenic brain. Neuroreport,
10(8):1779-1782.
78. Guan ZZ, Zhang X, Ravid R, Nordberg A. (2000). Decreased protein levels of nicotinic
receptor subunits in the hippocampus and temporal cortex of patients with Alzheimer's
disease. J Neurochem, 74(1):237-243.
79. Guan ZZ, Zhang X, Mousavi M, Tian JY, Unger C, Nordberg A. (2001). Reduced
expression of neuronal nicotinic acetylcholine receptors during the early stages of
damage by oxidative stress in PC12 cells. J Neurosci Res, 66(4):551-558.
80. Gubler U, Hoffman BJ. (1983). A simple and very efficient method for generating cDNA
libraries. Gene, 25(2-3):263-269.
154
81. Guslandi M. (1999). Nicotine treatment for ulcerative colitis. Br. J. Clin. Pharmacol,
48(4):481-484.
82. Hajos M, Hurst RS, Hoffmann WE, Krause M, Wall TM, Higdon NR, Groppi VE.
(2005). The selective 7 nicotinic acetylcholine receptor agonist PNU-282987 [N-[(3R))-
1-Azabicyclo[2.2.2]oct-3-yl]-4-chlorobenzamide hydrochloride] enhances GABAergic
synaptic activity in brain slices and restores auditory gating deficits in anesthetized rats.
J. Pharmacol. Exp. Ther, 312(3):1213-1222.
83. Halevi S, McKay J, Eshel M, Jorgensen E, Treinin M. (2002). The C. elegans ric-3 gene
is required for maturation of nicotinic acetylcholine receptors. The EMBO Journal,
21(5):1012-1020.
84. Halevi S, Yassin L, Eshel M, Sala F, Sala S, Criado M, Treinin M. (2003). Conservation
within the RIC-3 gene family. Journal of Biological Chemistry, 278, 36(36):34411-
34417.
85. Hansen SB, Sulzenbacher G, Huxford T, Marchot P, Taylor P, Bourne Y. (2005).
Structures of Aplysia AChBP complexes with nicotinic agonists and antagonists reveal
distinctive binding interfaces and conformations. EMBO J, 24(20):3635-3646.
86. Harkness PC, Millar NS. (2002). Changes in conformation and subcellular distribution of
42 nicotinic acetylcholine receptors revealed by chronic nicotine treatment and
expression of subunit chimeras. J Neurosci, 22(23):10172-10181.
87. Heinrich PC, Behrmann I, Haan S, Hermanns HM, Muller-Newen G, Schaper F.
(2003). Principles of interleukin (IL)-6-type cytokine signaling and its regulation.
Biochem J, 374(Pt 1):1-20.
155
88. Hellstrom-Lindahl E, Mousavi M, Zhang X, Ravid R, Nordberg A. (1999). Regional
distribution of nicotinic receptor subunit mRNAs in human brain: comparison between
Alzheimer and normal brain. Brain Res Mol Brain Res, 66(1-2):94-103.
89. Henningfield JE, Benowitz NL, Slade J, Houston TP, Davis RM, Deitchman SD. (1998).
Reducing the addictiveness of cigarettes. Tobacco Control, 7(3):281-293.
90. Herber DL, Severance EG, Cuevas J, Morgan D, Gordan MN. (2004). Biochemical and
histological evidence of nonspecific binding of 7 nAChR antibodies to mouse brain
Tissue, 52(10):1367-1375.
91. Hernandez CM, Kayed R, Zheng H, Sweatt JD, Dineley KT. (2010). Loss of 7 nicotinic
receptors enhances A oligomer accumulation, exacerbating early-stage cognitive decline
and septo-hippocampal pathology in a mouse model of Alzheimer's disease. J. Neurosci,
17; 30(7):2442-2453.
92. Hirt B. (1967). Selective extraction of polyoma DNA from infected mouse cell cultures.
J. Mol. Biol, 36:365-369.
93. Hoppe T, Cassata G, Barral JM, Springer W, Hutagalung AH, Epstein HF, Baumeister R.
(2004). Regulation of the myosin-directed chaperone UNC-45 by a novel E3/E4-
multiubiquitylation complex in C. elegans. Cell, 118(3):337-349.
94. Hosur V, Leppanen S, Abutaha A, Loring RH. (2009). Gene regulation of 42 nicotinic
receptors: microarray analysis of nicotine-induced receptor up-regulation and anti-
inflammatory effects. J Neurochem, 111(3):848-858.
95. Hosur V, Loring RH. (2011). 42 nicotinic receptors partially mediate anti-
inflammatory effects through Janus Kinase 2-Signal Transducer and Activator of
Transcription 3 but not calcium or cAMP signaling. Mol Pharmacol, 79(1):167-174.
156
96. Hucho FL, Oberthur W, Lottspeich F. (1986). The ion channel of the nicotinic
acetylcholine receptor is formed by the homologous helices MII of the receptor subunits.
FEBS Lett, 205(1):137-142.
97. Hughes JR, Hatsukami DK, Mitchell JE, Dahlgren LA. (1986). Prevalence of smoking
among psychiatric outpatients. Am J Psychiatry, 143(8):993-997.
98. HuSH shRNA Plasmid Panels Application Guide. (2009). Origene.
99. Hyrc KL, Bownik JM, Goldberg MP. (2005). Ionic selectivity of low affinity ratiometric
calcium indicators: mag-fura-2, fura-2FF and BTC. Cell Calcium, 27(2):75-86.
100. Imoto K, Busch C, Sakmann B, Mishina M, Konno T, Nakai J, Bujo H, Mori Y, Fukuda
K, Numa S. (1988). Rings of negatively charged amino acids determine the acetylcholine
receptor channel conductance. Nature, 335(6191):645-648.
101. In-Fusion SMARTer cDNA Library Construction Kit User Manual. (2010). Clontech.
102. Jeanclos EM, Lin L, Treuil MW, Rao J, DeCoster MA, Anand R. (2001). The chaperone
protein 14-3-3n interacts with the nicotinic acetylcholine receptor 4 subunit. J Biol
Chem, 276(30):28281-28290.
103. Johnston PA, Grandis JR. (2011). STAT3 Signaling: Anticancer Strategies and
Challenges. Molecular Interventions, 11(1):18-26.
104. Jouret F, Devuyst O. (2009). CFTR and defective endocytosis: new insights in the renal
phenotype of cystic fibrosis. Pflugers Arch, 457(6):1227-1236.
105. Keller JJ, Keller AB, Bowers BJ, Wehner JM. (2005). Performance of 7 nicotinic
receptor null mutants is impaired in appetitive learning measured in a signaled nose poke
task. Behav. Brain Res. 162(1):143-152.
157
106. Kihara T, Shimohama S, Sawada H, Honda K, Nakamizo T, Shibasaki H, Kume T,
Akaike A. (2001). 7 nicotinic receptor transduces signals to phosphatidylinositol 3‑
kinase to block A‑amyloid‑induced neurotoxicity. J. Biol. Chem. 276(17):13541-
13546.
107. Kim DH, Rossi JJ. (2008). RNAi mechanisms and applications. Biotechniques, 44(5):
613-616.
108. Kleizen B, Braakman I. (2004). Protein folding and quality control in the endoplasmic
reticulum. Curr Opin Cell Biol, 16(4):343-349.
109. Kox M, van Velzen JF, Pompe JC, Hoedemaekers CW, van der Hoeven JG,
Pickkers P. (2009). GTS-21 inhibits pro-inflammatory cytokine release independent
of the Toll-like receptor stimulated via a transcriptional mechanism involving
JAK2 activation. Biochem Pharmacol, 78(7):863-872.
110. Kucinski AJ, Stachowiak MK, Wersinger SR, Lippiello PM, Bencherif M. (2011). 7
neuronal nicotinic receptors as targets for novel therapies to treat multiple domains of
schizophrenia. Current Pharmaceutical Biotechnology, 12(1):437-448.
111. Kunzelmann K. (2005). Ion channels and cancer. J. Membr. Biol, 205(3):159-173.
112. Lamb PW, Melton MA, Yakel JL. (2005). Inhibition of neuronal nicotinic acetylcholine
receptor channels expressed in Xenopus oocytes by ‑amyloid1–42 peptide. J. Mol.
Neurosci, 27(1):13-21.
113. Lansdell S, Gee V, Harkness PC, Doward AI, Baker ER, Gibb AJ, Millar NS. (2005).
RIC-3 enhances functional expression of multiple nicotinic acetylcholine receptor
subtypes in mammalian cells. Mol Pharmacol, 68(5):1431-1438.
158
114. Lee Y, Rudell J, Yechikhov S, Taylor R, Swope S, Ferns M. (2008). Rapsyn carboxyl
terminal domains mediate muscle specific kinase‑induced phosphorylation of the muscle
acetylcholine receptor. Neuroscience, 153(4):997-1007.
115. Lein ES. (2007). Genome-wide atlas of gene expression in the adult mouse brain. Nature,
445(7124):168-176.
116. Lefkowitz R J, Rajagopal K, Whalen EJ. (2006). New roles for ‑arrestins in cell
signaling: not just for seven‑transmembrane receptors. Mol. Cell, 24(5):643-652.
117. LeNovere N, Corringer PJ, Changeux JP. (2002). The diversity of subunit composition in
nAChRs: evolutionary origins, physiologic and pharmacologic consequences. J
Neurobiol, 53(4):447-456.
118. Leonard S, Mexal S, Freedman R. (2007). Smoking, genetics and schizophrenia:
evidence for self medication. J Dual Diagn, 3(3-4):43-59.
119. Levin ED, Ellison GD, Salem C, Jarvik M, Gritz, E. (1988). Behavioral effects of acute
hexamethonium in rats chronically intoxicated with nicotine. Physiol. Behav, 44(3):355-
359.
120. Levin ED, Simon BB. (1998). Nicotinic acetylcholine involvement in cognitive function
in animals. Psychopharmacology, (Berl). 138(3-4):217-230.
121. Lewis JA, Wu CH, Berg H and Levine JH. (1980). The genetics of levamisole resistance
in the nematode Caenorhabditis elegans. Genetics, 95(4):905-928.
122. Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X.
(1997). Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex
initiates an apoptotic protease cascade. Cell, 91(4):479-489.
159
123. Li Y, King MA, Meyer EM. (2000). 7 nicotinic receptor-mediated protection against
ethanol-induced oxidative stress and cytotoxicity in PC12 cells. Brain Res, 861(1):165-
167.
124. Lindsten T, Zong WX, Thompson CB. (2005). Defining the role of the Bcl-2 family of
proteins in the nervous system. Neuroscientist, 11(1):10-15.
125. Lindstrom J. (1997). Nicotinic acetylcholine receptors in health and disease. Mol
Neurobiol, 15(2):193-222.
126. Liu AM, Lo RKH, Wong CSS, Morris C, Wise H, Wong YH. (2006). Activation of
STAT3 by Gs distinctively requires protein kinase A, JNK, and phosphatidylinositol 3-
kinase. JBC, 281 (47):35812-35825.
127. Liu Q, Kawal H, Berg DK. (2000). -Amyloid peptide blocks the response of 7-
containing nicotinic receptors on hippocampal neurons. Proc Natl Acad Sci, 98(8):4734-
9.
128. Lloyd GK, Williams M. (2000). Neuronal nicotinic acetylcholine receptors as novel drug
targets. J Pharmacol Exp Ther, 292(2):461-467.
129. Luo W, Sun W, Taldone T, Rodina A, Ciosis G. (2010). Heat shock protein 90 in
neurodegenerative diseases. Mol Neurodegener, 5:24.
130. Maneckjee R, Minna JD. (1990). Opioid and nicotine receptors affect growth regulation
of human lung cancer cell lines. Proc. Natl Acad. Sci. USA, 87(9):3294-3298.
131. Markou A, Paterson NE. (2001). The nicotinic antagonist methyllycaconitine has
differential effects on nicotine self administration and nicotine withdrawal in the rat.
Nicotine Tob Res, 3(4):361-373.
160
132. Markova SV, Golz S, Frank LA, Kalthof B, Vysotski ES. (2004). Cloning and expression
of cDNA for a luciferase from the marine copepod Metridia longa. J. Biol. Chem,
279(5):3212-3217.
133. Marks MJ, Pauly JR, Gross SD, Deneris ES, Hermans-Borgmeyer I, Heinemann SF,
Collins AC. (1992). Nicotine binding and nicotinic receptor subunit RNA after chronic
nicotine treatment. J Neurosci, 12(7):2765-2784.
134. Marrero MB, Bencherif M. (2009). Convergence of 7 nicotinic acetylcholine receptor-
activated pathways for anti-apoptosis and anti-inflammation: Central role for JAK2
activation of STAT3 and NFB. Brain Research, 1256:1-7.
135. Matsunaga K, Klein TW, Friedman H, Yamamoto Y. (2001). Involvement of
nicotinic acetylcholine receptors in suppression of antimicrobial activity and cytokine
responses of alveolar macrophages to Legionella pneumophila infection by
nicotine. J Immunol, 167(11):6518-6524.
136. Merlie JP, Sebbane R, Tzartos S, Lindstrom J. (1982). Inhibition of glycosylation with
tunicamycin blocks assembly of newly synthesized acetylcholine receptor subunits in
muscle cells. J. Biol. Chem, 257(5):2694-2701.
137. Merlie JP, Lindstrom J. (1983). Assembly in vivo of mouse muscle acetylcholine
receptor: identification of a subunit species that may be an assembly intermediate. Cell,
34(3):747-757.
138. Mihalak KB, Carroll FI, Luetje CW. (2006). Varenicline is a partial agonist at 42 and
a full agonist at 7 neuronal nicotinic receptors. Mol Pharmacol, 70(3):801-805.
139. Millar NS. (2003). Assembly and subunit diversity of nicotinic acetylcholine receptors.
Biochem Soc Trans, 31(Pt 4):869-874.
161
140. Millar NS. (2008). RIC3: a nicotinic acetylcholine receptor chaperone. British Journal of
Pharmacology, 153:S177-S183.
141. Miller AD. (1997). Development and applications of retroviral vectors. In Retroviruses, J.
M. Coffin, S. H. Hughes and H. E. Varmus (Eds.), pp. 437-473. Cold Spring Harbor
Laboratory Press, Plainview, NY.
142. Miyazawa A, Fujiyoshi Y, Unwin N. (2003). Structure and gating mechanism of the
acetylcholine receptor pore. Nature, 423, 26:949-955.
143. Mukherjee J, Kuryatov A, Moss SJ, Lindstrom JM, Anand R. (2009). Mutations of
cytosolic loop residues impair assembly and maturation of 7 nicotinic acetylcholine
receptors. J Neurochem, 110(6):1885-1894.
144. Naqvi AR, Islam N, Choudhury NR, Mohd Q. (2009). The fascinating world of RNA
interference. International Journal of Biological Sciences, 5(2):97-117.
145. Naviaux RK, Costanzi E, Haas M, Verma IM. (1996). The pCL vector system:rapid
production of helper-free, high-titer, recombinant retroviruses. J Virol, 70(8):5701-5.
146. Ngyuen M, Alfonso A, Johnson CD, Rand JB. (1995). Caenorhabditis elegans mutants
resistant to inhibitors of acetylcholinesterases. Genetics, 140(2):527-535.
147. Nordberg A. (1994). Human nicotinic receptors-their role in aging and dementia.
Neurochem Int, 25(1):93-97.
148. Nordberg A. (2001). Nicotinic receptor abnormalities of Alzheimer's disease: therapeutic
implications. Biol Psychiatry, 49(3):200-210.
162
149. Numa S, Noda M, Takahaski H, Tanabe T, Toyosato M, Furutani Y, Kikyotani S. (1983).
Molecular structure of the nicotinic acetylcholine receptor. Cold Spring Harb. Symp.
Quant. Biol, 48(Pt 1):57-69.
150. Oddo S, LaFerla FM. (2006). The role of nicotinic acetylcholine receptors in Alzheimer’s
disease. J Physiol Paris, 99:172-179.
151. Orr-Urtregar A, Broide RS, Kasten MR, Dang H, Dani JA, Beaudet AL, Patrick JW.
(2000). Mice homozygous for the L250T mutation in the 7 nicotinic acetylcholine
receptor show increased neuronal apoptosis and die within 1 day of birth. J Neurochem,
74(5):2154-2166.
152. Ortiz AG, Salcedo JM. (2010). Heat shock proteins as targets in oncology. Clin Transl
Oncol, 12(3):166-173.
153. Palma E, Fucile S, Barabino B, Miledi R, Eusebi F. (1999). Strychnine activates neuronal
7 nicotinic receptors after mutations in the leucine ring and transmitter binding site
domains. PNAS, 96 (23):13421-13426.
154. Papke RL, Dwoskin LP, Crooks PA, Zheng G, Zhang Z, McIntosh JM, Stokes C. (2008).
Extending the analysis of nicotinic receptor antagonists with the study of 6 nicotinic
receptor subunit chimeras. Neuropharmacology, 54(8):1189-1200.
155. Papke RL, Wecker L, Stitzel JA. (2010). Activation and inhibition of mouse muscle and
neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes. J Pharmacol
Exp Ther, 333(2):501-518.
156. Pavlov VA, Wang H, Czura C, Friedman SG, Tracey KJ. (2003). The cholinergic anti-
inflammatory pathway: A missing link in neuroimmunomodulation. Molecular Medicine,
9(5-8):125-134.
163
157. Pedersen WA, Fu W, Keller JN, Markesbery WR, Appel S, Smith RG, Kasarskis E,
Mattson MP. (1998). Protein modification by the lipid peroxidation product 4-
hydroxynonenal in the spinal cords of amyotrophic lateral sclerosis patients. Ann Neurol,
44(5):819-824.
158. Pelletier S, Gingras S, Funakoshi-Tago M, Howell S, Ihle JN. (2006). Two
domains of the erythropoietin receptor are sufficient for Jak2 binding/activation
and function. Mol Cell Biol, 26(22):8527-8538.
159. Pena G, Cai B, Liu J, van der Zanden EP, Deitch EA, de Jonge WJ, Ulloa L.
(2010). Unphosphorylated STAT3 modulates 7 nicotinic receptor signaling
and cytokine production in sepsis. Eur J Immunol, 40(9):2580-2589.
160. Peterson LB, Blagg BS. (2009). To fold or not to fold: modulation and consequences of
Hsp90 inhibition. Future Med Chem, 1(2):267-283.
161. Petrikaite V, Matulis D. (2011). Binding of natural and synthetic inhibitors to human heat
shock protein 90 and their clinical application. Medicina, 47(8):413-420.
162. Pettit DL, Shao Z, Yakel JL. (2001). ‑amyloid(1–42) peptide directly modulates
nicotinic receptors in the rat hippocampal slice. J. Neurosci, 21, RC120.
163. Pons S, Fattore L, Cossu G, Tolu S, Porcu E, McIntosh JM, Changeux JP, Maskos U,
Fratta W. (2008). Crucial role of 4 and 6 nicotinic acetylcholine receptor subunits
from ventral tegmental area in systemic nicotine self-administration. J Neurosci,
28(47):12318-12327.
164
164. Qi XL, Nordberg A, Xiu J, Guan ZZ. (2007). The consequences of reducing expression
of the 7 nicotinic receptor by RNA interference and of stimulating its activity with an
7 agonist in SH-SY5Y cells indicate that this receptor plays a neuroprotective role in
connection with the pathogenesis of Alzheimer’s disease. Neurochem Int, 51(6-7):377-
383.
165. Quick MW, Lester RA. (2002). Desensitization of neuronal nicotinic receptors. J
Neurobiol, 53(4):457-478.
166. Quik M, Choremis J, Komourian J, Lukas RJ, Puchacz E. (1996). Similarity between rat
brain nicotinic alpha-bungarotoxin receptors and stably expressed alpha-bungarotoxin
binding sites. J Neurochem, 67(1):145-54.
167. Ready-To-Glow-Secreted Luciferase Reporter Systems User Manual. (2009). Clontech
Laboratories Inc.
168. Reynolds A, Leake D, Boese Q, Scaringe S, Marshall WS, Khvorova A. (2004). Rational
siRNA design for RNA interference. Nat Biotechnol, 22(3):326-30.
169. Rice JW, Veal JM, Fadden RP, Barabasz AF, Partridge JM, Barta TE, Dubois LG, Huang
KH, Mabbett SR, Silinski MA, Steed PM, Hall SE. (2008). Small molecule inhibitors of
Hsp90 potently affect inflammatory disease pathways and exhibit activity in models of
rheumatoid arthritis. Arthritis Rheum, 58(12):3765-3775.
170. Roderick HL, Cook SJ. (2008). Ca2+
signaling checkpoints in cancer: remodeling Ca2+
for
cancer cell proliferation and survival. Nature Rev. Cancer, 8(5):361-375.
171. Saccone NL, Schwantes-An TH, Wang JC, Grucza RA, Breslau N, Hatsukami D,
Johnson EO, Rice JP, Goate AM, Bierut LJ. (2010). Multiple cholinergic nicotinic
receptor genes affect nicotine dependence risk in African and European Americans.
Genes Brain Behav, 9(7):741-750.
165
172. Sandborn WJ, Tremaine WJ, Offord KP, Lawson GM, Petersen BT, Batts KP, Croghan
IT, Dale LC, Schroeder DR, Hurt RD. (1997). Transdermal nicotine for mildly to
moderately active ulcerative colitis. A randomized, double-blind, placebo-controlled trial.
Ann. Intern. Med, 126(5):364-371.
173. Sandy P, Ventura A, Jacks T. (2005). Mammalian RNAi: a practical guide.
BioTechniques, 39(2):215-224
174. Sanes JR, Lichtman JW. (2001). Induction, assembly, maturation and maintenance of a
postsynaptic apparatus. Nat Rev Neurosci, 2(11):791-805.
175. Schuller HM. (1989). Cell type specific, receptor-mediated modulation of growth kinetics
in human lung cancer cell lines by nicotine and tobacco-related nitrosamines. Biochem.
Pharmacol, 38(20):3439-3442.
176. Schuller HM, Orloff M. (1998). Tobacco-specific carcinogenic nitrosamines. Ligands for
nicotinic acetylcholine receptors in human lung cancer cells. Biochem. Pharmacol,
55(9):1377-1384.
177. Schuller HM. (2009). Is cancer triggered by altered signaling of nicotinic acetylcholine
receptors? Nature Rev. Cancer, 9(3):195-205.
178. Seguela P, Wadiche J, Dineley-Miller K, Dani JA, Patrick JW. (1993). Molecular
cloning, functional properties, and distribution of rat brain7: a nicotinic cation channel
highly permeable to calcium. J Neurosci, 13(2):596-604.
179. Seredenina T, Ferraro T, Terstappen GC, Caricasole A, Roncarati R. (2008). Molecular
cloning and characterization of a novel human variant of RIC-3, a putative chaperone of
nicotinic acetylcholine receptors. Biosci Rep, 28(6):299-306.
166
180. Severance EG, Zhang H, Cruz Y, Pakhlevaniants S, Hadley SH, Amin J, Wecker L, Reed
C, Cuevas J. (2004). The 7 nicotinic acetylcholine receptor subunit exists in two
isoforms that contribute to functional ligand-gated ion channels. Mol Pharmacol,
66(3):420-429.
181. Sharma G, Vijayaraghavan S. (2001). Nicotinic cholinergic signaling in hippocampal
astrocytes involves calcium-induced calcium release from intracellular stores. PNAS,
98(7):4148-4153.
182. Sharma G, Vijayaraghavan S. (2008). Nicotinic receptors containing the 7 subunit: A
model for rational drug design. Curr Med Chem, 15(28):2921-2932.
183. Shaw A. (2000). The 14-3-3 proteins. Curr Biol, 10:R400.
184. Sher ME, Bank S, Greenberg R, Sardinha TC, Weissman S, Bailey B, Gilliland R,
Wexner SD. (1999). The influence of cigarette smoking on cytokine levels in patients
with inflammatory bowel disease. Inflamm. Bowel Dis, 5(2):73-78.
185. Shteingauz A, Cohen E, Biala Y, Treinin M. (2009). The BTB-MATH protein BATH-42
interacts with RIC-3 to regulate maturation of nicotinic acetylcholine receptors. J Cell
Sci, 122(6):807-812.
186. Shytle RD, Mori T, Townsend K, Vendrame M, Sun N, Zeng J, Ehrhart J, Silver AA,
Sanberg PR, Tan J. (2004). Cholinergic modulation of microglial activation by7
nicotinic receptors. J Neurochem, 89(2):337-343.
187. Siebenkotten G, Leyendeckers H, Christine R, Radbruch A. (1995). Isolation of plasmid
DNA from mammalian cells with QIAprep. Qiagen News, 2:11-13.
167
188. Simosky JK, Stevens KE, Adler LE, Freedman R. (2003). Clozapine improves deficient
inhibitory auditory processing in DBA/2 mice via a nicotinic cholinergic mechanism.
Psychopharmacology (Berl.), 165(4):386-396.
189. Small DH, Maksel D, Kerr ML, Ng J, Hou X, Chu C, Mehrani H, Unabia S, Azari MF,
Loiacono R, Aguilar MI, Chebib M. (2007). The ‑amyloid protein of Alzheimer’s
disease binds to membrane lipids but does not bind to the 7 nicotinic acetylcholine
receptor. J. Neurochem, 101(6):1527-1538.
190. Soneoka Y, Cannon PM, Ramsdale EE, Griffiths JC, Romano G, Kingsman SM,
Kingsman AJ. (1995). A transient three-plasmid expression system for the production of
high titer retroviral vectors. Nucleic Acids Res, 23(4):628-633.
191. Spencer JP, Weil A, Hill K, Hussain I, Richardson JC, Cusdin FS, Chen YH, Randall
AD. (2006). Transgenic mice over‑expressing human ‑amyloid have functional
nicotinic 7 receptors. Neuroscience, 137(3):795-805.
192. Smith, MM, Lindstrom J, Merlie JP. (1987). Formation of the -bungarotoxin binding
site and assembly of the nicotinic acetylcholine receptor subunits occur in the
endoplasmic reticulum. J. Biol. Chem, 262(9):4367-4376.
193. Sumikawa K, Gehle VM. (1992). Assembly of mutant subunits of the nicotinic
acetylcholine receptor lacking the conserved disulfide loop structure. J. Biol. Chem,
267(9):6286-6290.
194. Suzuki T, Hide I, Matsubara A, Hama C, Harada K, Miyano K, Andra M, Matsubayashi
H, Sakai N, Kohsaka S, Inoue K, Nakata Y. (2006). Microglial 7 nicotinic acetylcholine
receptors drive a phospholipase C/IP3 pathway and modulate the cell activation toward a
neuroprotective role. Journal of Neuroscience Research, 83(8):1461-1470.
168
195. Sweileh W, Wenberg K, Xue J, Forsayeth J, Hardy S, Loring RH. (2000). Multistep
expression and assembly of neuronal nicotinic receptors is both host-cell and subtype-
dependent. Molecular Brain Research, 75(2):293-302.
196. Taly A, Corringer PJ, Guedin D, Lestage P, Changeux JP. (2009). Nicotinic receptors:
allosteric transitions and therapeutic targets in the nervous system. Nature Reviews,
8(9):733-750.
197. Tracey KJ, Wang H, Yu M, Ochani M, Amella CA, Tanovic M, Susarla S, Li JH, Wang
H, Yang H, Ulloa L, Al-Abed Y, Czura C. (2003). Nicotinic acetylcholine receptor 7 is
an essential regulator of inflammation. Nature, 421:383-388.
198. Treinin M. (2008). RIC-3 and nicotinic acetylcholine receptors: biogenesis, properties,
and diversity. Biotechnol J, 3(12):1539-1547.
199. Trombino S, Cesario A, Margaritora S, Granone P, Motta G, Falugi C, Russo P. (2004).
7-Nicotinic acetylcholine receptors affect growth regulation of human mesothelioma
cells: Role of mitogen-activated protein kinase pathway. Cancer Research, 64:135-145.
200. Ui-Tei K, Naito Y, Takahashi F, Haraguchi T, Ohki-Hamazaki H, Juni A, Ueda R, Saigo
K. (2004). Guidelines for the selection of highly effective siRNA sequences for
mammalian and chick RNA interference. Nuclei Acids Res, 32(3):936-48.
201. US Department of Health and Human Services. The health consequences of smoking:
nicotine addiction. A report of the Surgeon General, 1988. Rockville, Maryland: Public
Health Service, Centers for Disease Control, Office on Smoking and Health, 1988.
(DHHS Publication No (CDC) 88-8406.)
169
202. US Food and Drug Administration. Regulations restricting sale and distribution of
cigarettes and smokeless tobacco products to protect children and adolescents; final rule.
Federal Register 1995;60(Aug 11):41314-75, 41453-787. 12 US Food and Drug
Administration. 21 CFR Part 801, et al. Regulations restricting sale and distribution of
cigarettes and smokeless tobacco products to protect children and adolescents; final rule.
Federal Register 996;61(Aug28):44395-618.
203. Valles AS, Roccamo AM, Barrantes FJ. (2009). Ric-3 chaperone-mediated stable cell-
surface expression of the neuronal alpha7 nicotinic acetylcholine receptor in mammalian
cells. Acta Pharmacol, 30(6):818-827.
204. van der Zanden EP, Snoek SA, Heinsbroek SE, Stanisor OI, Verseijden C, Boeckxstaens
GE, Peppelenbosch MP, Greaves DR, Gordon S, De Jonge WJ. (2009).
Vagus nerve activity augments intestinal macrophage phagocytosis via nicotinic
acetylcholine receptor 42. Gastroenterology, 137(3):1029-1039.
205. Vig M, Kinet J. (2009). Calcium signaling in immune cells. Nat Immunol, 10(1):21-27.
206. ViraPort cDNA Library Retroviral Supernatants Instruction Manual. (2009). Agilent
Technologies Inc.
207. Wada E, Wada K, Boulter J, Deneris E, Heinemann S, Patrick J, Swanson LW. (1989).
Distribution of alpha-2, alpha-3, alpha-4, and beta-2 neuronal nicotinic receptor subunit
mRNAs in the central nervous system: A hybridization histochemical study in the rat. J
Comp Neurol, 284(2):314-335.
208. Walters CL, Brown S, Changeux JP, Martin B, Damaj MI. (2006). The 2 but not 7
subunit of the nicotinic acetylcholine receptor is required for nicotine-conditioned place
preference in mice. Psychopharmacology (Berl), 184:339-344.
170
209. Wang H, Lee DHS, D’Andrea MR, Peterson PA, Shank RP, Reitz AB. (2000). -
Amyloid1-42 binds to 7 nicotinic acetylcholine receptor with high affinity. Journal of
Biological Chemistry, 275, 8:5626-5632.
210. Wang H, Lee DHS, Davis CB, Shank RP. (2000). Amyloid peptide A1-42 binds
selectively and with picomolar affinity to 7 nicotinic acetylcholine receptors. Journal of
Neurochemistry, 75(3):1155-1161.
211. Wang H, Liao H, Ochani M, Justiniani M, Lin X, Yang L. (2004). Cholinergic agonists
inhibit HMGB1 release. Mol. Brain Res, 75:293-302.
212. Wang Y, Yao Y, Tang XQ, Wang ZZ. (2009). Mouse RIC3, an endoplasmic reticulum
chaperone, promotes assembly of the 7 acetylcholine receptor through a cytoplasmic
coiled-coil domain. J Neurosci, 29(40):12625-12635.
213. Wehner JM, Keller JJ, Keller AB, Picciotto MR, Paylor R, Booker TK, Beaudet A,
Heinemann SF, Balogh SA. (2004). Role of neuronal nicotinic receptors in the effects of
nicotine and ethanol on contextual fear conditioning. Neuroscience, 129(1):11-24.
214. Wellenreuther R, Schupp I. (2005). SMART™ cDNA amplification combined with size
fractionation efficiently enriches for large full-length clones. Clontechniques, (2):24.
215. Whiteaker P, Davies AR, Marks MJ, Blagbrough IS, Potter BV, Wolstenholme AJ,
Collins AC, Wonnacott S. (1999). An autoradiographic study of the distribution of
binding sites for the novel alpha7-selective nicotinic radioligand [3H]-methyllycaconitine
in the mouse brain. Eur. J. Neurosci, 11(8):2689-2696.
216. Whitehouse PJ, Kalaria RN. (1995). Nicotinic receptors and neurodegenerative
dementing diseases: basic research and clinical implications. Alzheimer Dis Assoc
Disord, 9 Suppl, 2:3-5.
171
217. Williams ME, Burton B, Urrutia A, Shcherbatko A, Chavez-Noriega LE, Cohen CJ,
Aiyar J. (2005). Ric-3 promotes functional expression of the nicotinic acetylcholine
receptor 7 subunit in mammalian cells. Journal of Biological Chemistry, 280(2):1257-
1263.
218. Wooltorton JR, Pidoplichko VI, Broide RS, Dani JA. (2003). Differential desensitization
and distribution of nicotinic acetylcholine receptor subtypes in midbrain dopamine areas.
J. Neurosci, 23(8):3176-3185.
219. Yang S, Delgado R, King SR, Woffendin C, Barker CS, Yang ZY, Xu L, Nolan GP,
Nabel GJ. (1999). Generation of retroviral vector for clinical studies using transient
transfection. Hum Gene Ther, 10(1):123-32.
220. Young JW, Crawford N, Kelly JS, Kerr LE, Marston HM, Spratt C, Finlayson K,
Sharkey J. (2007). Impaired attention is central to the cognitive deficits observed in 7
deficient mice. Eur. Neuropsychopharmacol, 17(2):145-155.
221. Zhang S, Zheng M, Kibe R, Huang Y, Marrero L, Warren S, Zieske AW, Iwakuma T,
Kolls, Cui Y. (2011). Trp53 negatively regulates autoimmunity via the STAT3-Th17
axis. FASEB J, 25:2387.
222. Zhu YY, Machleder EM, Chenchik A, Li R, Siebert PM. (2001). Reverse transcriptase
template switching: A SMART™ approach for full-length cDNA library construction.
BioTechniques, 30(4):892-897.
top related