investigating the effect of biochar on microbial … › 23962 › 1 › abujabhah_whole...nitrogen...
Post on 05-Jul-2020
6 Views
Preview:
TRANSCRIPT
Investigating the effect of biochar on microbial
activities and biological processes in soil
By
Ibrahim Salim Saad Abujabhah
Master of Agricultural Science
Submitted in fulfilment of the requirements for the Degree
of Doctor of Philosophy
University of Tasmania
Hobart, Australia
October, 2017
ii
Declaration of Originality
This thesis contains no material which has been accepted for a degree or diploma
by the University or any other institution, except by way of background
information and duly acknowledged in the thesis, and to the best of my knowledge
and belief no material previously published or written by another person except
where due acknowledgement is made in the text of the thesis, nor does the thesis
contain any material that infringes copyright.
Signature:
Ibrahim S. Abujabhah
October, 2017
Statement on Authority of Access
This thesis may be made available for loan and limited copying and communication
in accordance with the Copyright Act 1968.
Signature:
Ibrahim S. Abujabhah
October, 2017
iii
Statement regarding published work contained in thesis
The publishers of the papers comprising Chapters 2, 3, 4 and 5 hold the copyright
for that content, and access to the material should be sought from the respective
journals. The remaining non-published content of the thesis may be made available
for loan and limited copying and communication in accordance with the Copyright
Act 1968.
Signature:
Ibrahim S. Abujabhah
October, 2017
iv
Statement of co-authorship
This thesis includes work, which has been published, submitted or to be submitted
for publication in a peer-review journal. More details for each paper are described
in the section of “Publications Arising from the Thesis”. The following people and
institutions contributed to the publication of work undertaken as part of this thesis:
Ibrahim S. Abujabhah, School of Land and Food, University of Tasmania
(Candidate)
John P. Bowman, School of Land and Food, University of Tasmania (Primary
supervisor)
Richard B. Doyle, School of Land and Food, University of Tasmania (Co-
supervisor)
Sally A. Bound, School of Land and Food, University of Tasmania (Co-supervisor)
v
Details of the author roles:
Chapter 2: Effects of biochar and compost amendments on soil physio-chemical
properties and the total community within a temperate apple orchard.
Ibrahim S. Abujabhah (70%) collected and analysed the samples, analysed the data
and wrote the manuscript. John P. Bowman (10%), Sally A. Bound (10%), Richard
B. Doyle (10%) contributed to the experiment and edited the manuscript.
Chapter 3: The effect of biochar loading rates on soil fertility, soil biomass,
potential nitrification and soil community metabolic profiles in three different
soil types.
Ibrahim S. Abujabhah (70%) collected and analysed the samples, analysed the data
and wrote the manuscript. John P. Bowman (10%), Sally A. Bound (5%), Richard
B. Doyle (15%) contributed to the experiment and edited the manuscript.
Chapter 4: Assessment of bacterial community composition, methanotrophic and
nitrogen cycling bacteria in three soils with different biochar application rates.
Ibrahim S. Abujabhah (70%) collected and analysed the samples, analysed the data
and wrote the manuscript. John P. Bowman (20%), Sally A. Bound (5%), Richard
B. Doyle (5%) contributed to the experiment and edited the manuscript.
Chapter 5: Eukaryal community changes and composition in three different soil
induced by short term biochar amendments.
Ibrahim S. Abujabhah (70%) collected and analysed the samples, analysed the data
and wrote the manuscript. John P. Bowman (20%), Sally A. Bound (5%), Richard
B. Doyle (5%) contributed to the experiment and edited the manuscript.
vi
We the undersigned agree with the above stated “proportion of work undertaken”
for each of the above published (or submitted) peer-reviewed manuscripts
contributing to this thesis:
Signed:
(Mr. Ibrahim Abujabhah) (Assoc. Prof. John Bowman)
Candidate: Primary supervisor:
School of Land and Food School of Land and Food
University of Tasmania University of Tasmania
Date: October, 2017
vii
Acknowledgements
Alhamdulillah, finally I have completed writing my thesis but of course would not
have been possible without the assistance, help and support from fantastic people
around me.
First and foremost, I would like to express my sincere gratitude to my supervisor
Associate Professor John Bowman for the continuous support throughout my PhD
study and related research, for his patience, motivation, and immense knowledge.
His guidance helped me in all the time of research and writing of this thesis.
Also I would like to thank my co-supervisors: Dr Richard Doyle and Dr Sally
Bound for their insightful comments, encouragement, enthusiasm and great efforts
to accomplish this thesis which widen my research from various perspectives.
I gratefully thank Mr Stephen Paterson for assistance with the project and Dr David
Ratkowsky for providing valuable advice with the data analysis. Also I would like
to thank all University of Tasmania staff members and the Central Science
Laboratory (University of Tasmania, Hobart) for assistance and technical support.
A special thanks to my entire extended family. Words cannot express how grateful
I am to my mother and sisters for all of the sacrifices that you have made on my
behalf. Your prayers for me were what sustained me thus far. I would also like to
thank all of my friends and colleagues Tuflikha Putri, Ali Al-Naseri, Bianca
Porteus, Colin Steedman, Peipei Zhang, Wossen Mengensha, Akhikun Nahar,
Raihan Mahmud, Kaniz Mohsina, Abdelsalam Abobaker, Ala Alhusban, Shafi
Ansari, Abbas Almajmaie, Hamada Esmaiel, Mohammed El-Astal, Syed Shah,
viii
Tewodros Mesfin and many others for providing a stimulating and fun environment
and supported me to strive towards my goal.
ix
List of abbreviations
16S rRNA 16S ribosomal ribonucleic acid
18S rRNA 18S ribosomal ribonucleic acid
ANOVA Analysis of Variance
AOB Ammonia oxidizing bacteria
AWCD Average well-colour development
BCL Black Clay Loam
BLAST Basic Local Alignment Search Tool
bp Base pair
BSL Brown Sandy Loam
CAP Canonical analysis of principal coordinates
cd-hit-est Cluster Database at High Identity with Tolerance
CEC Cation exchange capacity
CFU Colony forming units
DAS Diagnostic and Analytical Services
DNA Deoxyribonucleic acid
DTPA Diethylenetriamine Pentaacetic Acid
EC
ESEM
Electrical conductivity
Environmental Scanning electron microscopy
GHG Greenhouse gas
L.S.D
LEfSe
Least significant difference
Linear discriminant analysis Effect Size
MANOVA Multivariate analysis of variance
MUB Modified universal buffer
x
NOB Nitrite oxidizing bacteria
OTU Operational Taxonomic Unit
PCR Polymerase Chain Reaction
PERMANOVA Permutation multivariate analysis of variance
QIIME Quantitative Insights Into Microbial Ecology
RL Red Loam
SEM Scanning Electron Microscopy
SSU Small subunit
TEB Exchangeable base cations
TVC Total Viable Count
xi
Table of Contents
Acknowledgements .................................................................................................... vii
List of abbreviations ................................................................................................... ix
Table of Contents ........................................................................................................ xi
List of Tables ............................................................................................................ xvi
List of Figures ......................................................................................................... xviii
Abstract ......................................................................................................................... 1
Publications and conference presentation relevant to the thesis ................................... 4
Chapter 1 ....................................................................................................................... 5
Literature review ........................................................................................................... 5
1. Introduction ........................................................................................................... 5
2. The modification of chemical and physical properties in soil after biochar
application ..................................................................................................................... 8
2.1. Physical properties ...................................................................................... 9
2.2. Chemical properties .................................................................................. 11
3. The effect of biochar addition on biological processes and microbial
communities in soil ..................................................................................................... 12
3.1. Biochar and soil microorganisms ............................................................. 13
3.2. Biochar and microbial nitrogen transformation processes in soil ............ 14
4. The effect of biochar additions to soil on greenhouse gas emissions (GHG) and
carbon sequestration.................................................................................................... 17
4.1. Nitrous oxide (N2O) emissions ................................................................. 17
4.2. Methane (CH4) emissions ......................................................................... 19
4.3. Carbon sequestration and carbon dioxide emissions ................................ 20
5. Thesis Approach and Objectives ......................................................................... 21
Chapter 2 ..................................................................................................................... 24
Effects of biochar and compost amendments on soil physico-chemical properties
and the total microbial community within a temperate agricultural soil .................... 24
Abstract ....................................................................................................................... 24
1. Introduction ......................................................................................................... 25
2. Materials and methods ......................................................................................... 29
2.1. Site characteristics and trial design .......................................................... 29
2.2. Sample collection and preparation ........................................................... 30
xii
2.3. Chemical and physical analysis ................................................................ 31
2.4. Enumeration and assessment of soil biomass ........................................... 31
2.5. Enzyme assays .......................................................................................... 32
2.6. DNA extraction and pyrosequencing ....................................................... 32
2.7. Clustering, ordination and diversity analysis ........................................... 34
3. Results ................................................................................................................. 34
3.1. Chemical and physical properties ............................................................. 34
3.2. Soil biomass .............................................................................................. 37
3.3. Enzyme Activity ....................................................................................... 39
3.4. Microbial Community Structure ............................................................... 41
3.4.1. Effect of carbon amendments on Archaea ............................................... 43
3.4.2. Effect of carbon amendments on Bacteria ............................................... 43
3.4.3. Effect of carbon amendments on Fungi ................................................... 45
3.4.4. Effect of carbon amendments on Metazoa and other Eukarya ................. 47
4. Discussion ............................................................................................................ 50
4.1. Physical and chemical properties ............................................................. 50
4.2. Soil biomass changes ................................................................................ 52
4.3. Enzyme activity ........................................................................................ 53
4.4. Biological community structure alteration ............................................... 53
5. Conclusion ........................................................................................................... 57
Chapter 3 ..................................................................................................................... 58
The effect of biochar loading rates on soil fertility, soil biomass, potential
nitrification and soil community metabolic profiles in three different soils ............... 58
Abstract ....................................................................................................................... 58
1. Introduction ......................................................................................................... 60
2. Materials and methods ......................................................................................... 63
2.1. Soil collection and processing .................................................................. 63
2.2. Biochar specifications ............................................................................... 64
2.3. Experimental design and biochar addition ............................................... 66
2.4. Chemical and physical analyses ............................................................... 66
2.5. Soil biomass assessment ........................................................................... 67
2.6. Potential nitrification assay ...................................................................... 67
2.7. Soil community level metabolic profiles .................................................. 67
3. Results ................................................................................................................. 68
xiii
3.1. Chemical and physical properties ............................................................. 68
3.1.1. Ammonium and nitrate nitrogen in soil .................................................... 69
3.1.2. Total carbon and total nitrogen ................................................................. 71
3.1.3. Colwell phosphorus and potassium .......................................................... 72
3.1.4. Soil pH and electrical conductivity .......................................................... 74
3.1.5. Soil moisture content ................................................................................ 76
3.1.6. Exchangeable cations and cation exchangeable capacity (CEC) ............. 77
3.1.7. Micronutrients .......................................................................................... 79
3.2. Microbial biomass .................................................................................... 81
3.3. Potential nitrification ................................................................................ 83
3.4. Community level metabolic profiles ........................................................ 84
4. Discussion ............................................................................................................ 87
4.1. Soil chemical parameters .......................................................................... 87
4.2. Microbial biomass .................................................................................... 90
4.3. Potential nitrification ................................................................................ 91
4.4. Community Level Metabolic Profiles ...................................................... 92
5. Conclusions ......................................................................................................... 92
Chapter 4 ..................................................................................................................... 94
Assessment of bacterial community composition, methanotrophic and nitrogen
cycling bacteria in three soils with different biochar application rates ...................... 94
Abstract ....................................................................................................................... 94
1. Introduction ......................................................................................................... 95
2. Materials and methods ......................................................................................... 97
2.1. Soil collection and biochar specifications ................................................ 97
2.2. Experimental design and biochar addition ............................................... 98
2.3. Soil and biochar chemical analysis ........................................................... 98
2.4. DNA extraction, 16S rRNA gene amplicon Illumina MiSeq sequencing
and bioinformatics analysis ................................................................................. 99
2.5. Statistical analysis................................................................................... 100
3. Results ............................................................................................................... 100
3.1. Soil and biochar physicochemical properties ......................................... 100
3.2. Microbial diversity ................................................................................. 103
3.3. Bacterial community composition .......................................................... 107
3.4. Ammonia and nitrite oxidizing bacteria ................................................. 110
xiv
3.5. Nitrogen fixing bacteria .......................................................................... 112
3.6. Methane and methanol oxidizing bacteria .............................................. 114
4. Discussion .......................................................................................................... 115
5. Conclusion ......................................................................................................... 120
Chapter 5 ................................................................................................................... 121
Eukaryal community changes and composition induced by short term wood-based
biochar amendments in three different soils ............................................................. 121
Abstract ..................................................................................................................... 121
1. Introduction ....................................................................................................... 122
2. Materials and methods ....................................................................................... 125
2.1. Soil Collection and Biochar Specifications ............................................ 125
2.2. Experiment layout................................................................................... 125
2.3. Soil sampling and chemical analysis ...................................................... 126
2.4. Scanning Electron microscopy analysis ................................................. 126
2.5. DNA extraction and soil biomass assessment ........................................ 127
2.6. 18S rRNA sequencing and bioinformatics analysis ............................... 127
2.7. Statistical analysis................................................................................... 129
3. Results ............................................................................................................... 130
3.1. Soil physicochemical properties ............................................................. 130
3.2. Electron-microscopic analysis of biochar ............................................... 130
3.3. Eukaryotic alpha diversity ...................................................................... 132
3.4. Multivariate analysis of eukaryotic populations ..................................... 136
3.5. Fungal community composition and the effect of biochar loading ........ 138
3.6. Composition of soil metazoa and other eukarya and the effect of biochar
addition .............................................................................................................. 141
4. Discussion .......................................................................................................... 146
5. Conclusion ......................................................................................................... 148
Chapter 6 ................................................................................................................... 150
General discussion and conclusion ........................................................................... 150
1. Overview ........................................................................................................... 150
2. Biochar characteristics and production .............................................................. 151
3. Biochar and soil fertility .................................................................................... 153
4. Research benefits and key findings ................................................................... 157
4.1. Chemical and physical properties ........................................................... 157
xv
4.2. Microbial structure and activity .............................................................. 160
5. Future research and conclusion ......................................................................... 162
Reference .................................................................................................................. 165
xvi
List of Tables
Table 1.1: Mean (±s.e.) for pH, electrical conductivity (EC), ash content, total
carbon and nitrogen contents, and CaCO3 equivalence in 11 biochars (Singh et al.,
2010a). ....................................................................................................................... 7
Table 2.1: Soil chemical characteristics of unamended control, biochar and
compost amended soil, including the Least Significant Difference (L.S.D) and the
p-value...................................................................................................................... 36
Table 2.2: The mean proportion of reads of fungal phyla in an untreated control,
biochar and compost-amended orchard soil. ........................................................... 46
Table 3.1: Chemical analysis showing the specification of biochar produced at
Black Earth Products, QLD Australia ...................................................................... 65
Table 3.2: The effect of biochar loading rates (0 to 10% wt/wt) on exchangeable
cations (Ca, Mg, Na, K, Al), and cation exchange capacity (CEC) in a Black clay
loam (BCL), Red loam (RL) and Brown sandy loam (BSL) soil. ........................... 78
Table 3.3: The effect of biochar loading rates (0 to 10% wt/wt) on soil
micronutrients (Mn, Zn, Cu, Fe, B) in a Black clay loam (BCL), Red loam (RL)
and Brown sandy loam (BSL) soil ........................................................................... 80
Table 4.1: Selected parameters in black clay loam (BCL), red loam (RL) and
brown sandy loam (BSL) soils amended with different rates of biochar (0%, 2.5%,
5% and 10%) and the wood-derived biochar tested in this study. ......................... 102
Table 4.2: Bacterial diversity indices (average ± SD): Shannon index, Operational
Taxonomic Units (OTUs) and the number of sequence reads in black clay loam
(BCL), red loam (RL) and brown sandy loam (BSL) at different loading rates of
biochar.................................................................................................................... 105
xvii
Table 4.3: Correlation of the relative abundances of Proteobacteria classes and
biochar loading rates (0%, 2.5%. 5% and 10%), and the dominant N2-fixing
bacterial groups (Azospirillum, Bradyrhizobium, Rhizobium, Frankia and
Herbaspirillum) in relation to black clay loam (BCL), red loam (RL) and brown
sandy loam (BSL) soil C/N ratios subjected to different biochar loading rates. (*)
Indicates significant correlations. .......................................................................... 109
xviii
List of Figures
Figure 1.1: Scanning electron microscopy (SEM) images of biochar used in this
study showing pore size at ×300 to ×1500 magnifications. ..................................... 10
Figure 2.1: Soil total viable count (TVC) and biomass data for Mountain River
control, biochar and compost amended orchard soils. (A) Average soil bacterial
total viable count, estimated by determining colony number (shown as colony
forming units CFU) on 10% trypticase soy agar. (B) Average concentration of
DNA extracts. Error bars are the standard deviation values. ................................... 38
Figure 2.2: Comparison of enzyme activities between control, biochar and compost
plots from Mountain River orchard soils. Error bars are the standard deviation
values. ...................................................................................................................... 40
Figure 2.3: Canonical analysis of principal coordinate (CAP) plots of microbial
and eukaryotic community structure determined from taxa classifications derived
from 16S and 18S rRNA gene sequence analysis data. Comparisons are shown
between unamended control, biochar and compost-amended soils. The respective
treatment symbols are: ▲ control, ▼biochar, and ■ compost. Each symbol
represents an individual soil sample. The classification of replicate data treatment
for each of the community components was assessed using PERMANOVA.
Significance values for this assessment are shown for five major community
components. ............................................................................................................. 42
Figure 2.4: Averaged proportions of bacterial taxa at the class level in the control,
biochar and compost-amended orchards soils identified using 16S rRNA gene
amplicon sequence analysis. .................................................................................... 44
xix
Figure 2.5: Averaged proportions of dominant soil metazoa at the class level as
determined from 18S rRNA gene amplicon sequence analysis in the control,
biochar and compost-amended orchard soils. .......................................................... 48
Figure 2.6: Averaged proportion of fungal taxa at the class level in the control,
biochar and compost-amended orchard soils as deternmined by 18S rRNA
amplicon sequence analysis. .................................................................................... 49
Figure 3.1: (A) ammonium nitrogen (mg/kg) and (B) nitrate nitrogen (mg/kg) in a
Black clay loam (BCL), Red loam (RL) and Brown sandy loam (BSL) soil
containing different biochar loading rates (0 to 10% wt/wt). Errors bars are
standard deviation from four replicate soil pots. ..................................................... 70
Figure 3.2: (A) Total carbon (%) and (B) total nitrogen (%) in a Black clay loam
(BCL), Red loam (RL) and Brown sandy loam (BSL) soil containing different
biochar loading rates (0 to 10% wt/wt). Errors bars are standard deviation from four
replicate soil pots. .................................................................................................... 71
Figure 3.3: (A) Colwell phosphorus and (B) Colwell potassium (mg/kg) in a Black
clay loam (BCL), Red loam (RL) and Brown sandy loam (BSL) soil containing
different biochar loading rates (0 to 10% wt/wt). Errors bars are standard deviation
from four replicate soil pots. .................................................................................... 73
Figure 3.4: Soil pH (CaCl2) in a Black clay loam (BCL), Red loam (RL) and
Brown sandy loam (BSL) soil containing different biochar loading rates (0 to 10%
wt/wt). Errors bars are standard deviation from four replicate soil pots. ................ 75
Figure 3.5: Electric conductivity (dS/m) in a Black clay loam (BCL), Red loam
(RL) and Brown sandy loam (BSL) soil containing different biochar loading rates
(0 to 10% wt/wt). Errors bars are standard deviation from four replicate soil pots. 75
xx
Figure 3.6: The effect of biochar loading rates (0 to 10% wt/wt) on moisture
content (%) in a Black clay loam (BCL), Red loam (RL) and Brown sandy loam
(BSL) soil. Errors bars are standard deviation from four replicate soil pots. .......... 76
Figure 3.7: Microbial enumeration of bacteria in a Black clay loam (BCL), Red
loam (RL) and Brown sandy loam (BSL) soil containing different biochar loading
rates (0 to 10% wt/wt). Counts are from plates assessed after 1 week and after 2
weeks. Errors bars are from counts from three replicate soil pots. .......................... 82
Figure 3.8: Soil microbial biomass as DNA extracted from a Black clay loam
(BCL), Red loam (RL) and Brown sandy loam (BSL) soil containing different
biochar loading rates (0 to 10% wt/wt) with quantities estimated via the Nanodrop
spectrophotometer. Errors bars are standard deviation from four replicate soil pots.
.................................................................................................................................. 82
Figure 3.9: Potential nitrification rates (ng NO2-N/g Soil/5h) in a Black clay loam
(BCL), Red loam (RL) and Brown sandy loam (BSL) soil containing different
biochar loading rates (0 to 10% wt/wt). Errors bars are standard deviation from four
replicate soil pots. .................................................................................................... 83
Figure 3.10: The effect of biochar loading rates (0 to 10% wt/wt) on carbon source
utilization presented as (A) Shannon–Weaver index (H), (B) Average well-color
development (AWCD) and (C) Richness (R) in a Black clay loam (BCL), Red loam
(RL) and Brown sandy loam (BSL) soil. Errors bars are standard deviation from
three replicates. ........................................................................................................ 85
Figure 3.11: Comparison of total carbon source utilisation between amines &
amides, amino acids, carboxylic & acetic acids, carbohydrates and polymers in (A)
Black clay loam (BCL), (B) Red loam (RL) and (C) Brown sandy loam (BSL) soil
containing different levels of biochar (0 to 10% wt/wt). ......................................... 86
xxi
Figure 4.1: Canonical analysis of principal coordinate (CAP) plots showing impact
of biochar loading rates on bacterial community structure using 16S rRNA gene
sequence analysis data. Comparisons are shown between the initial soil samples,
unamended control, 2.5% biochar, 5% biochar and 10% biochar -amended soils.
The respective treatment symbols are: ▲ Initial sample, ▼0% biochar, ■ 2.5%
biochar, 5% biochar and 10% biochar. Each symbol represents an individual
soil sample. The assignment of replicates to treatments was assessed using
PERMANOVA in each of the soils. ...................................................................... 106
Figure 4.2: Relative abundances of bacterial phyla in black clay loam (BCL), red
loam (RL) and brown sandy loam (BSL) soils with different biochar amendments
rates. ....................................................................................................................... 108
Figure 4.3: Effect of biochar loading rates (0%. 2.5%. 5% and 10%) on the relative
abundance of dominant known (a) ammonia and nitrite oxidizing bacteria, (b)
nitrogen fixing bacteria and (C) methanol and methane oxidizing bacteria in black
clay loam (BCL), red loam (RL) and brown sandy loam (BSL) soils. The initial
sample is the soil before sieving and biochar addition. ......................................... 111
Figure 4.4: Distance-based redundancy analysis (dbRDA) showing the relationship
between the significant soil chemical parameters and bacterial community in (a)
black clay loam (BCL), (b) red loam (RL) and (c) brown sandy loam (BSL)
amended soils. The respective treatment symbols are: ▼0% biochar, ■ 2.5%
biochar, 5% biochar and 10% biochar. Each symbol represents an individual
soil sample. The best fitted and explained variables are shown with vectors with the
strength of the correlation indicated by the length of the line (circle donates a
correlation of 1.0). The direction of the vector relates the biochar loading level. . 119
xxii
Figure 5.1: Microscopic images from ESEM (a-d) of biochar amended soils and
SEM of biochar separately (e) and biochar mixed with soil (f) at different
magnifications. ....................................................................................................... 131
Figure 5.2: (a) the number of OTUs, (b) Fisher α-diversity (c) Evenness and (d)
Shannon index in black clay loam (BCL), red loam (RL) and brown sandy loam
(BSL) soils in the initial samples and biochar treatment. Error bars present standard
deviation and letters indicate significant differences between treatments among
amended soils. ........................................................................................................ 133
Figure 5.3: Rarefaction curves for total eukaryote communitiy in black clay loam
(BCL), red loam (RL) and brown sandy loam (BSL) in the initial samples and
biochar treatments. ................................................................................................. 135
Figure 5.4: Canonical analysis of principal coordinate (CAP) plots of fungi and
total eukaryote community structure determined from taxa classifications derived
from 18S rRNA gene sequence analysis data. Comparisons are shown between
initial sample before conducting the experiment, unamended control, 2.5% biochar,
5% biochar and 10% biochar -amended soils. The respective treatment symbols are:
▲ Initial sample, ▼0% biochar, ■ 2.5% biochar, 5% biochar and 10% biochar.
Each symbol represents an individual soil sample. The classification of replicate
data treatment was assessed using PERMANOVA in black clay loam, red loam and
brown sandy loam soils. ......................................................................................... 137
Figure 5.5: Abundance of fungal groups at the class level in black clay loam
(BCL), red loam (RL) and brown sandy loam (BSL) in the (a) initial samples and
(b) biochar treatment. ............................................................................................. 140
xxiii
Figure 5.6: Abundance of metazoa and other eukarya groups at the class level in
black clay loam (BCL), red loam (RL) and brown sandy loam (BSL) in the initial
samples and biochar treatments. ............................................................................ 143
Figure 5.7: Phylogenetic distribution of the eukaryotic taxa (domain-genus level)
with distinct relative abundance differences (LDA values of >3.5) in black clay
loam (BCL), red loam (RL) and brown sandy loam (BSL) amended soils. .......... 144
Figure 5.8: Linear discriminant analysis effect size (LEfSe) analysis showing the
most significantly different eukaryotic taxa in terms of relative abundance in black
clay loam (BCL), red loam (RL) and brown sandy loam (BSL) amended soils with
LDA values of 3.5 .................................................................................................. 145
1
Abstract
Soil amendment with biochar has been widely described as a suitable approach to
improve soil fertility, sequester carbon and reduce greenhouse gas (GHG) emissions to
mitigate climate change. The purported benefits of biochar addition to soils include
improved soil physical properties and nutrient retention as well as changes in microbial
composition and abundance which in turn affect nutrient cycling in the biochar
amended soils. However, the impacts of different application rates of biochar and its
interactions with different soils have received less attention and need to be explored.
The aim of this thesis was to investigate the impact of biochar application rates on
microbial activity and related biological processes in a range of different topsoils. This
thesis focuses on understanding the behaviour of soil microbes in relating to soil
biological processes that occur following biochar application and attempts to assess the
relationship between these microbes and the physico-chemical properties that are
altered in soil matrices after biochar application.
Field and laboratory experiments were conducted to examine the effect of biochar
amended-soil on the physico-chemical and biological properties. A field experiment
was conducted for 3.5 years to investigate the impact of biochar and compost
amendments on soil physico-chemical properties and the total microbial community in
a sandy loam apple orchard site at Mountain River in Tasmania, Australia. This was
followed by a 10-month pot trial to determine the effects of biochar application rates on
selected soil parameters, microbial composition and related biological processes in
three topsoils. These included a reactive black clay loam (BCL), a non-reactive red
loam (RL) and a brown sandy loam (BSL) topsoils. In the field experiment, soil pH
2
decreased in both biochar and compost treatments compared to control. However,
significant differences in bacterial and fungal but not archaeal or other eukaryote
community components were observed in the biochar and compost treatments. The
results also indicated that biochar and compost amendments can subtly affect the
community structure of the orchard soils even with active application of inorganic and
organic fertilizers. There were no significant differences across a panel of enzyme
activities among treatments. There were slight increases in alkaline phosphatase while
fluorescein diacetate activity and hydrolysis activity slightly decreased. The overall
effects on fundamental activity however are largely neutral, and likely due to the
enormous structural resilience and functional redundancy present.
The 10 month pot trial showed that biochar additions had a significant impact on NH4
and NO3, total C and N, pH, EC and soil moisture content in both soil types and biochar
loading. There was a relatively limited effect on microbial biomass in amended soils;
however biochar addition reduced the potential nitrification at the higher biochar rate in
the two lighter soils (RL and BSL). The addition of biochar at different loading rates
was reflected in significant differences in the bacterial diversity between biochar
treatments in the BSL and RL soils, while the BCL soil was more resilient to soil
amendment. Complete ammonia oxidizing (Nitrospira spp.) and nitrite oxidizing
bacteria (NOB) were more abundant than standard ammonia oxidizing bacteria (AOB)
in all soils. Increased biochar loading raised the abundance of nitrifying bacteria in BCL
soil while Nitrospira became more abundant in BSL soil. Biochar addition affected the
abundance of certain N2-fixer groups in a soil dependent manner. Strong positive
correlations were observed in Rhizobium (r=0.99) and Azospirillum abundance (r=0.70)
with increased biochar loading rates in BCL. Greater biochar loading also significantly
increased the relative abundance of methanotrophs, especially in BCL soil. The impact
3
of biochar on community structure and nitrogen cycling bacteria depended on soil type
and biochar rates which correlated to the differences in soil properties. Overall, the
abundance of nitrogen cycling bacterial groups seemed to be most affected by the
changes in soil conditions, including aeration, C/N ratio, nutrients and pH in relation to
biochar application in different soils.
4
Publications and conference presentation relevant to the thesis
The work presented in this thesis has so far resulted in the following peer reviewed
publications.
Publications
• Chapter 2: Abujabhah, I.S., Bound, S.A., Doyle, R. and Bowman, J.P., 2016.
Effects of biochar and compost amendments on soil physico-chemical properties
and the total community within a temperate agricultural soil. Applied Soil
Ecology, 98, pp.243-253.
• Chapter 3: Abujabhah, I.S., Doyle, R., Bound, S.A. and Bowman, J.P., 2016.
The effect of biochar loading rates on soil fertility, soil biomass, potential
nitrification, and soil community metabolic profiles in three different soils.
Journal of Soils and Sediments, pp. 2211–2222.
• Chapter 4: Abujabhah, I.S., Doyle, R., Bound, S.A. and Bowman, J.P., 2017.
Assessment of bacterial community composition, methanotrophic and nitrogen
cycling bacteria in three soils with different biochar application rates. Soils
Sediments, pp. 1-11. doi:10.1007/s11368-017-1733-1
• Chapter 5: Abujabhah, I.S., Doyle, R., Bound, S.A. and Bowman, J.P., 2016.
Eukaryal community changes and composition in three different soil induced by
short term biochar amendments.
5
Chapter 1
Literature review
1. Introduction
Biochar is increasingly being used as a soil amendment to improve soil chemical and
biological properties, reduce greenhouse gas (GHG) emissions, and sequester carbon to
help mitigate climate change. However, the interaction between soil microbes, soil
characteristics, and the addition of biochar is not yet well understood (Lehmann et al.,
2011). Recently, there is wide debate about the use of biochar and its agricultural
benefits in soil. Many literature sources indicate that the application of biochar to soil
influences chemical and physical properties as well as the function and structure of
microbial communities in a beneficial way that collectively increases soil fertility.
However, other studies have revealed that biochar addition can also have a negative
impact in agricultural soils. Some biochar products may for example influence the
availability and toxicity of specific elements depending on the source materials used in
its manufacture (Kookana et al., 2011; Beesley et al., 2014). Different types of biochar
have different impacts depending on the feedstock and pyrolysis processes used. There
are a wide range of technical methods to develop biochar from a variety of materials
and under different pyrolysis conditions as well. Steinbeiss et al. (2009) indicated that
every technical method has a specific temperature supply and activation treatment that
results in biochar with different physicochemical properties.
Biochar produced by different methods could therefore have unpredictable effects on
soil functionality and fertility. Empirical studies on biochar in soil trials seem necessary
6
to develop a better understanding of these effects. At a basic level pyrolysis has a
fundamental influence on biochar properties. In a study by Singh et al. (2010b),
increased pyrolysis temperature led to increased ash content, pH, and surface basicity
and decreased surface acidity. The activation treatment had by comparison little effect
on most of the biochar properties. For example, wood biochars have higher total carbon,
lower ash content, lower total N, P, K, S, Ca, Mg, Al, Na, and Cu contents, but lower
potential cation exchange capacity (CEC) and exchangeable cations compared with
manure based biochars. Sludge biochar had the highest rates of total and exchangeable
Ca as well as CaCO3 and CEC, and the lowest total and exchangeable K. Electrical
conductivity (EC) values were also significantly different based on the feedstocks used
to produce biochars. Wood and sludge based biochars had low EC, while manure
biochars showed very high EC values (Singh et al., 2010a). These authors characterised
11 different biochars produced from five feedstocks (Eucalyptus saligna wood,
Eucalyptus saligna leaves, papermill sludge, poultry litter and cow manure) at different
pyrolysis conditions with and without activation, and their results indicated that biochar
properties such as C content, nutrients, and the liming potential of biochars are affected
by different feedstocks and pyrolysis temperature as shown in table (1.1).
7
Table 1.1: Mean (±s.e.) for pH, electrical conductivity (EC), ash content, total
carbon and nitrogen contents, and CaCO3 equivalence in 11 biochars (Singh et al.,
2010a).
Biochar can significantly change soil physical properties, especially porosity due to the
high surface area of the biochar (Kookana et al., 2011). Consequently, biochar
application may influence all the aspects of soil fertility related to physical
characteristics. Biochar produced from the same material might have different specific
surface and porosity features depending on the pyrolysis conditions. The study by
Kookana et al. (2011) showed that specific surface area and porosity were increased
with increasing pyrolysis temperature; however, micropores might be destroyed at
higher temperatures. The difference between biochar and the soil matrix in physical
properties leads to an overall change in soil density and aggregation, hydraulic
conductivity and gas transportation, which in turn affect chemical properties and
microbial activity in soil (Lehmann et al., 2011).
There have been many studies that indicate biochar soil amendment enhances microbial
populations and activity in soil (Kookana et al., 2011). The changes that biochar
applications may cause, such as increasing total N, P, and C, exchangeable cations,
8
CEC etc, would be the most logical reasons for the enhancement of microbial
populations and activity, however the specific changes associated with using different
types of biochar still needs to be considered, especially when considering soils they are
used in (Chan et al., 2008).
Greenhouse gas (GHG) emission has recently received much scientific attention due to
the potential impact on climate change. This includes the release of N2O, CH4 and CO2
from soil. Mitigation of climate change processes is one of the major challenges faced
and many experiments have been conducted to find soil management solutions to
reduce GHG. Most of the current biological and environmental studies have involved
the use of biochar to suppress gas emissions and enhance carbon sequestration (Han et
al., 2016; Hangs et al., 2016; Awasthi et al., 2017; Fidel et al., 2017).
Biochar applications are involved in many aspects related to soil health and quality,
however, the impact on soil microbes and how they interact and adjust within biochar-
modified soil environments is less understood.
2. The modification of chemical and physical properties in soil after biochar application
Biochar application as a soil conditioner has a potential effect on a range of soil
properties, and the addition of biochar to soil could alter the entire agro-ecosystem
depending on the physiochemical properties of the biochar. The impact of biochar
application on soil physical properties including structure, texture, porosity, particle
size and density, collectively may affect soil aeration, water holding capacity and
microbial activity in soil (Atkinson et al., 2010). Likewise, biochar has a substantial
influence on chemical properties in soil, for example, biochar addition can change the
9
pH, electric conductivity (EC), cation exchange capacity (CEC), and nutrient retention
and availability (Gundale and DeLuca, 2007). With this overall potential to change soil
systems, the understanding of the interaction between biochar and soil properties is
required to begin to estimate the behaviour and impact of biochar. Detailed studies may
provide the means to predict impacts of different biochar types in given soils in order to
optimise benefits, be it agricultural production, carbon sequestration or GHG
mitigation.
Biochar is derived from different types of feedstocks under pyrolysis conditions to
produce an organic material containing high and stable organic carbon content. The
physical and chemical properties of the biochar will depend on the source and
feedstocks as well as the pyrolysis processes that are used to produced biochar. Spokas
and Reicosky (2009) studied the impact of using different biochar with different types
of soil, the results indicate that some chemical influences of biochar additions depend
on both biochar properties and soil type. The diversity of biochar and its interaction
with soils could have various impacts on soil properties.
2.1. Physical properties
Biochar physical properties play an important role in changing soil properties. The
specific properties of biochar provide enhanced high porosity and surface area and thus
potentially provide increased habitat for soil microorganisms (Fig. 1.1). Furthermore,
the high CEC enhances binding of cations and anions to increase nutrient retention and
availability to microbes and plants (Atkinson et al., 2010). The application of biochar
could also improve irrigation management and water infiltration and enhance fertiliser
treatment responses in soil. Asai et al. (2009) investigated the effect of biochar on
10
physical properties and rice green yields. The experiments were conducted within
upland conditions at ten sites at application rates from 0-16 t/h, combined with N and P
additions. The results showed an improvement in the hydraulic conductivity and there
were increased rice yields in sites with low P content. There was significant synergistic
response of combining biochar with fertiliser treatments. Hardie et al. (2014) also
showed improved hydraulic conductivity following biochar application in an apple
orchard. Improving hydraulic conductivity and other physical characteristics in soil
provides suitable conditions for chemical interactions and microbial activity.
Furthermore, because biochar has high resistance to microbial degradation; the impact
of biochar addition in soil could persist for a long time.
Figure 1.1: Scanning electron microscopy (SEM) images of biochar used in this study
showing pore size at ×300 to ×1500 magnifications.
11
Soil physical properties are very important to soil fertility and crop production, however
little is known about how this changes after incorporation of biochar. Potentially the use
of biochar could be more beneficial in some soils that have poor physical
characteristics, such as sandy soils. An experiment conducted by Basso et al. (2013)
suggested that biochar addition increased water content in soil by around 23%
compared to the control. The result also showed that bulk density of the control soil
increased during the incubation time of the experiment from 1.41 to 1.45 g/cm3, while
bulk density of biochar-amended soils was 9% less than the control and constantly
stable during incubation time. In a study of sandy loam soil in a new apple orchard
planting, Hardie et al. (2014) reported increased total porosity and saturated water
content associated with a reduction in bulk density. Thus, biochar addition to sandy soil
seems able to increase the soil water holding capacity, which might increase water
availability in agricultural soils. Many studies have shown that biochar contributes to
increased soil stability and aggregation, water management, porosity and surface area.
Understanding biochar functions and effects in soil would better inform biochar choices
in different agricultural soils and provide maximum benefit from using biochar as a soil
amendment (Sohi et al., 2010).
2.2. Chemical properties
In the same way that biochar affects physical properties, biochar additions may alter
soil chemical properties but the impacts could be more complicated. The way biochar
affects soil will likely be dependent on differences in the chemical properties of
biochars (Unger et al., 2011). The feedstock used to produce biochar affects specific
chemical properties. For example Unger et al. (2011) conducted an incubation
12
experiment to determine if biochar produced under different conditions and feedstocks
would differentiate the influence of biochar on soil chemical properties. In this study,
selected parameters measured included total nitrogen, total organic carbon, ammonium
nitrogen (NH4-N) and nitrate nitrogen (NO3-N). The results suggested that the reaction
conditions and organic materials used to produce biochar can differentially affect
specific soil chemical properties.
Biochar additions to soil can increase CEC, thus increasing nutrient holding capacity
and availability of nutrients such as P, Ca, S and N. Furthermore, the increase in soil pH
often observed following biochar application influences nutrient transformations and
plant uptake kinetics (Fowles, 2007). It has been reported that biochar and organic
fertiliser applications in soil will probably increase nutrient storage in the rhizosphere in
an available form for plant roots (Steiner et al., 2007), as well as soil pH due to the
liming effect of biochar (Singh et al., 2010a; Lehmann et al., 2011). Although there is
much evidence of the advantages in using biochar as a soil amendment, the combination
between biochar and soil types needs more investigation to understand the complexity
of biochar reactions in soil.
3. The effect of biochar addition on biological processes and microbial communities in soil
The impact of biochar on biological processes and related microbes has been discussed
recently by many researchers; however, there still remain some limitations, such as the
complexity of agricultural soil systems, on the understanding of the interactions
between biochar amended soil and biological processes, especially the direct impact of
biochar on soil microbes. The main purpose of using biochar as a soil conditioner is to
13
reduce the expense of chemical additions, mitigate climate change-related factors (i.e.
GHG) and improve overall crop production. Biochar application in soil seems to be able
to achieve this partly because of its long term impact on soil systems. It is assumed that
biochar can do this by altering soil biological processes such as N mineralisation and
nitrification by affecting the bacteria involved in these processes through provision of a
suitable environment to increase microbial activity (Berglund et al., 2004).
Biochar has been considered to be a source of highly stable carbon, which potentially
affects microbial activity and nutrient cycling in soil. Due to the connection between
carbon cycle and climate change, biochar has been advocated as a solution to sequester
carbon, while at the same time improving soil fertility (Nguyen et al., 2008). Therefore,
biochar could be a significant source of nutrients and an improved habitat for soil
microbes.
3.1. Biochar and soil microorganisms
Recent studies by environmental scientists and chemists documented that biochar
potentially constitutes a large percentage of the organic carbon in soil but there is still
limited understanding of its impact on microorganisms and biological processes
(Zimmerman, 2010). The inherent chemical and physical properties of biochar have
been shown to increase nutrient retention due to the high exchangeable capacity,
surface area and direct nutrient input after biochar applications (Glaser et al., 2002).
However, there are many aspects relating to biochar use which are still unclear, such as
the relationship between biochar and microbial functions along oxidising biochar
surfaces and releasing nutrients under field conditions. Kolb et al. (2009) studied the
effect of biochar addition on microbial biomass and activity, where biochar was added
14
to four different soils (Mollisol, Alfisol, Entisol, and Spodosol) at five application rates
from 0 to 0.1 kg/kg-1 biochar-soil. The results showed a significant increase in both
microbial biomass and activity with increasing application rates, with the same patterns
observed in all four soils although the microbial response was variable based on the
available nutrient content in each soil.
Previous studies indicate that biochar may create a suitable environment for
microorganisms enabling enhanced population growth and microbial abundance in soil.
A variation in bacterial and fungal population ratios seems to occur because of the
increases in C/N ratio after biochar addition (Kookana et al., 2011). Solaiman et al.
(2010) found that P solubility increased in the presence of biochar and concluded that
this was due to an increase in mycorrhizal colonisation. However, Thies and Rillig
(2009) reported a decrease in microbial respiration with increasing application rates in
biochar amended soil. There are conflicting results between studies, with some showing
the total respiration and respiratory rate increased while mycorrhizal colonization was
reduced after biochar application (Treseder, 2004; Steinbeiss et al., 2009). The
differences in biochars, application rates and soil types may be contributory to various
influences on the microbial community.
3.2. Biochar and microbial nitrogen transformation processes in soil
Many studies indicate that biochar applications increase nitrogen input into the
agricultural ecosystem by increasing biological N2 fixation rates as well as nitrogen
availability to plants. An experiment conducted by Rondon et al. (2006) showed that
biochar addition increased the amount of nitrogen fixed. Their study applied biochar at
15
0, 30, 60 and 90 g/kg of soil, and results indicated that the amount of nitrogen fixed into
soil increased from 50 to 72% with the presence of biochar (greatest at the 90 g/kg
application rate). Soil total nitrogen derived from the atmosphere was significantly
increased by 49% at 30 g/kg biochar and 78% at 60 g/kg whereas this form of fixed
nitrogen declined by 30% at 90 g/kg biochar levels, possibly because of low biomass
production and N uptake (Rondon et al., 2006). The main reason for increased
biological nitrogen fixation after biochar addition was believed to be the availability of
B and Mo, while the availability of K, Ca and P, as well as increased pH and Al content
status might partially contribute. The C/N ratio increased from 16 to 23.7, 28 and 35
respectively depending on the biochar rates. Since biochar seems to have a direct
influence on soil microorganisms its addition may affect the activity of nitrogen fixing
bacterial. Beck (1991b) demonstrated that biochar potentially affects Rhizobium
survival in soil, observing enhanced rhizobial nodulation. Overall, several studies have
demonstrated that biochar has a significant influence on the nitrogen input in soil but
more studies are required to better understand the implications of long term applications
of biochar on biological nitrogen fixation (Gul and Whalen, 2016; Abujabhah et al.,
2017).
The form and availability of the nitrogen in soil constantly takes the attention of
scientists due its great importance to soil fertility and agricultural production. The
process of nitrogen transformation in soil is affected by soil characteristics, and any
changes in these transformation steps, including immobilisation, mineralisation,
nitrification and denitrification, will dramatically influence the nitrogen status in soil
(Gul and Whalen, 2016; Wang et al., 2016). Understanding the effect of biochar
addition is required to estimate both positive and negative impacts on the biological
processes in the soil ecosystem.
16
Several studies discuss the impact of biochar on nitrogen transformation but there is
limited information about the interaction between the microbial communities related to
these processes and biochar in soil. The reaction of charcoal derived from fire in forest
soil and the adaptation of microbial communities have been shown to influence N
fixation and N transformation rates, and can immediately increase nitrogen
mineralisation rates in soil (Smithwick et al., 2005). Ball et al. (2010) examined the
influence of fire history in forest soil on the total and potential nitrification rates, and
the nature and abundance of ammonia-oxidizing bacteria in this soil. This study showed
that the relatively recent (12 year old) wildfires resulted in higher content of soil
charcoal and nitrification rates compared with older wildfire events at other sites.
Moreover, it has been noticed that in more recent fire affected sites there was a greater
abundance of ammonia-oxidizing bacteria compared to control soils. The high
abundance of ammonia-oxidizers could be the main reason for increased nitrification
rates in recent wildfire sites (Ball et al., 2010). Many factors may affect the nitrification
rates in soil and the nitrifying bacteria themselves; therefore, the presence of different
rates and types of biochar in soil must be taken into account. For effective plant growth,
adequate nitrogen must be present in soil. Biochar has been shown to increase
nitrification rates (He et al., 2016b) providing nitrate (NO3), which is the best form of
nitrogen for plant uptake (Clough and Condron, 2010), biochar amendment is
considered to be a suitable way to maintain the amount and availability of nitrogen in
soil (López-Cano et al., 2016). Furthermore, biochar addition increases the cation
exchangeable capacity thus increasing the adsorption capacity and ammonium (NH4)
storage in soil. Biochar also participates in mitigating nitrogen loss in the form of N2O
by reducing denitrification rates and improving soil aeration. Singh et al. (2010b)
determined the effect of four different biochars on nitrous oxide emission and nitrate
17
leaching from Alfisol and Vertisol. Their results show that N2O emission and nitrate
leaching was reduced over time because of increased adsorption capacity owing to
oxidative reactions on biochar surfaces as it ages. Since the concentration of the
nitrogen forms in soil, such as ammonium (NH4), nitrite (NO2) and nitrate (NO3) as
well as the emission of nitrous oxide (N2O), completely depends on the biological
processes and activity in soil (Firestone et al., 1980), more studies are required to fully
understand the biochar influence on nitrogen biological processes. Nitrogen cycle and
biological transformation processes could be affected by a wide range of soil properties
which could be modified after the addition of biochar to soil at different loading rates.
4. The effect of biochar additions to soil on greenhouse gas emissions (GHG) and carbon sequestration
The increase in atmospheric GHG concentrations as a result of human activity
contribute to global warming, with the combination of CO2, CH4 and N2O contributing
to 90% of atmospheric global warming (Hansen et al., 2000). Biochar application in soil
has been proposed as a global warming mitigation strategy because of its stable carbon
content and the possible suppressive impact on GHG emissions from soil. Many studies
indicate that charcoal applications in soil might reduce GHG emissions and suggest it as
a possible and easy way to sequester carbon in soil (Aguilar-Chávez et al., 2012).
4.1. Nitrous oxide (N2O) emissions
According to Case et al. (2012), improving soil aeration by using biochar as a soil
amendment may participate in the suppression of GHG emission. This study showed
18
that N2O emissions were decreased consistently following hardwood biochar
amendment at 2% or more in a sandy loam soil. Improving the physical and biological
immobilisation of NO3 could be the reason for N2O suppression (Case et al., 2012).
Aguilar-Chávez et al. (2012) observed that N2O emission declined with increasing
charcoal rates during the first two weeks but no impact was observed after. Zhang et al.
(2010) examined the effect of biochar amendment on N2O emission with and without
nitrogen (N) fertilisation; the biochar amendments reduced N2O emission by 40- 51% in
combination with two rates of N fertilisation, while no difference in N2O reduction was
observed between treatments in the absence of N fertiliser applications.
There is an indirect impact of charcoal applications on N2O emission by influencing the
nitrification and denitrification processes which are more likely to be affected by
oxygen availability and moisture status in soil (Bremner, 1997; Clough and Condron,
2010; Bruun et al., 2011). In irrigated agricultural systems, biochar has the potential to
reduce N2O emission under different moisture conditions by enhancing soil aeration
(Yang et al., 2016). Charcoal applications enhance the cation exchange capacity which
increases ammonium (NH4+) adsorption in soil. In other words, the adsorption of NH4
+
inhibits nitrogen transformations, reducing the loss of N2O which is released during
denitrification (Clough and Condron, 2010). In an aerobic incubation experiment
examining the effect of rice husk biochar added into two paddy soils with and without
N fertilisation, Wang et al. (2011) showed that biochar can significantly reduce N2O
emission due to the reduction of NH4+-N and NO3
- -N content in soil. Another study
conducted by Deng et al. (2016) showed that application of biochar produced at
different temperatures potentially suppressed N2O emission, however, N2O emissions
from high-temperature biochar treatments were greater than low-temperature biochar
amended soils.
19
4.2. Methane (CH4) emissions
Methane (CH4) plays a significant role in the atmospheric chemistry and many studies
illustrate the abundance of methane in the atmosphere is released as a result of
anaerobic environment and methanogenic activity occurring in soil systems including
rice cultivation, wetlands, landfills, and other agricultural practices, such as manure
management (Keppler et al., 2009).
Aguilar-Chávez et al. (2012) demonstrated higher CH4 emission in the first 20 days
after biochar addition than at the end of the experiment, but there was no effect of
treatment within the experiment. Another study by Zhang et al. (2010) indicated that
biochar addition in the field increased total CH4 emission because of the higher water
content, however, after drainage and at low water content, CH4 emission decreased
sharply. In combinations of biochar additions and N fertilisers they reported a
significantly increased impact on the total CH4 emission with varying levels depending
on the biochar amendment rates and interactions with N fertiliser, and concluded that
the impact was most likely to be sensitive to the water regime within a typical rice crop
management.
Decreases in CH4 emission were reported by Rondon et al. (2005) in soil amended with
biochar in both pot and field experiments. However, there is limited information about
the effect of biochar applications on overall CH4 emission from rice soil with high
water content (Zhang et al., 2010). Many studies also reported that charcoal addition
increased CH4 emission from rice soil, whereas the dynamic pattern did not change
significantly compared to the control (Knoblauch et al., 2008; Zhang et al., 2010).
On the other hand, Liu et al. (2011) examined the impact of biochar additions to the soil
through an incubation experiment with and without rice straw. The result of this
20
experiment showed that both treatments reduced CH4 emission, however, the treatment
with the rice straw had a greater effect in reducing CH4 emissions. The reason behind
this reduction may be due to the suppression of methanogenic activity or the
enhancement of methylotrophic activity during the incubation period (Liu et al., 2011).
Therefore, using biochar derived from rice straw as a soil amendment, instead of
returning the straw itself to the soil, could be an effective way to reduce CH4 emissions.
Feng et al. (2012) also stated that biochar application significantly decreased paddy
CH4 emissions which seemed to be due to the increased methanotrophic proteobacterial
abundance and a decrease ratio of methanogenic to methanotrophic abundance in the
biochar amended soil. Therefore, CH4 production and consumption processes seem to
be influenced by differences in moisture levels and microbial communities which may
be affected by biochar application (Yu et al., 2013).
4.3. Carbon sequestration and carbon dioxide emissions
Biochar amendment is known as a suitable method to enhance carbon sequestration
because of the high resistance of biochar to microbial degradation (Woolf et al., 2010).
Spokas et al. (2009) confirmed that biochar application to soil is beneficial in both
reducing GHG and sequestering CO2 via mineralisation processes, but different rates of
C mineralisation have been observed after biochar applications (Zimmerman et al.,
2011).
Galinato et al. (2011) indicated that biochar produced from wood feedstock has 74.5 –
80% carbon content and assumed that 0.61 – 0.80 ton of carbon could be sequestered
from each ton of biochar applied to the soil. Black C derived from biochar could be a
significant long term approach to reduce greenhouse gas emission and enhance carbon
21
sequestration. Converting biomass C to biochar could capture approximately 50% of the
initial carbon compared to the low amount of C normally stored in the soil after burning
(3%) and during biological decomposition (< 10–20% after 5–10 years) of direct land
biomass application (Lehmann et al., 2006).
On the other hand, Rogovska et al. (2011) reported that biochar applications to soil
occasionally increase CO2 emission and soil respiration rates, particularly with manure
application (Rogovska et al., 2011). Yet little is known about the interactions between
biochar and manure mineralization in soil in relation to C sequestration and GHG
emission. Rogovska et al. (2011) estimated that biochar additions to soil considerably
sequestered stable C but increased CO2 emission rates, while the average of CO2
emission were reduced after manure fertiliser applications. Pyrolysis processes, which
are used to convert plant biomass or organic manure into biochar, could be an
appropriate solution to minimise the amount of CO2 in the atmosphere released from
soil (Liu et al., 2011).
5. Thesis Approach and Objectives
This thesis focuses on understanding the behaviour of soil microbes in relation to soil
biological processes that occur following biochar application. This study also attempts
to determine the relationship between these microbes and the physico-chemical
properties that are altered in soil matrices after biochar application.
The aim of this thesis is to more specifically investigate the use of different rates of
biochars as a soil amendment and the subsequent effect on microbial activities and
related processes. It is known that biochar addition has a significant impact on chemical
22
and physical properties which also affect the biochemical processes and microbial
functions in soil. However, the relationships between microbial activity, biological
processes and changes in chemical and physical properties resulting from biochar
addition are still not well understood. This thesis will develop an understanding of the
interactions between chemical and biological factors to devise procedures for using
biochars more effectively to improve soil health and quality combined with efficient
carbon sequestration and minimisation of GHG emissions.
Specific questions that were explored:
• What is the effect of different loading rates of biochar on the microbial
community structure?
• Do the microbial communities in different soil types respond the same way to
biochar applications?
• What effect do biochar loading rates have on the biological properties of
different soil types?
• How does biochar influence nitrogen cycling in different soil types?
• How does biochar affect the nitrogen status in soil and specific microbes
involved in the nitrogen biochemical cycle?
Field and laboratory experiments were conducted to examine the effect of biochar on
soil physico-chemical and biological properties. Various methods were used to address
these questions, including physical and chemical analysis to estimate changes in soil
properties such as EC, pH, CEC, total N and P, total and exchangeable Ca, Mg, Na, and
K. Molecular techniques were applied to determine the microbial community structure
and their functional aspects by use of 454 and Illumina next generation sequencing.
23
Enzyme assays and stable isotope probing were used to measure specific biological
processes, activity and efficiency of microbial components in the amended soils.
Multivariate statistical calculations were applied to the data obtained during the study to
discover correlations between biochar application rates, soil type and consequent effects
on the native microbial population and their functionality.
24
Chapter 2
Effects of biochar and compost amendments on soil
physico-chemical properties and the total microbial
community within a temperate agricultural soil
Abstract
The use of biochar and compost as soil amendments and their comparative effects on
microbial activities and related processes were investigated in an apple orchard site at
Mountain River in Tasmania, Australia. Biochar derived from Acacia green waste was
applied at a rate of 47 tonne ha-1 just before planting and has been in situ for 3.5 years.
Compost produced by the Luebke system was also applied separately at 10 tonne ha-1 as
a top dressing one week after planting. Chemical analysis indicated that there was no
significant impact on total ions by either biochar or compost additions. However,
organic carbon was significantly increased (p=0.009) by 23% for biochar and 55% for
compost treatments. Soil pH decreased in both biochar and compost treatments.
Microbial abundance was improved after the addition of biochar, but the effect of
compost addition was greater. There were no significant differences across a panel of
enzyme activities among treatments. There were slight increases in alkaline
phosphatase while fluorescein diacetate activity and hydrolysis activity slightly
decreased. The entire community of the soil was assessed using 16S rRNA and 18S
rRNA genes amplicon pyrosequencing. Significant differences in bacterial and fungal
but not archaeal or other eukaryota community components were observed. These
results indicated that biochar and compost carbon amendments can subtly affect the
microbial community structure of the orchard soils despite active application of
inorganic and organic fertilizers. The overall effects on fundamental activity are largely
25
neutral, however, likely due to the enormous structural resilience and functional
redundancy present.
1. Introduction
Biochar is an organic material containing a high level of carbon, and is produced by
heating biomass in the absence of oxygen. It has an aromatic structure that makes it
stable and highly resistant to chemical and biological degradation in soil (Atkinson et
al., 2010). Biochar is increasingly being used as a soil amendment with the aim to
improve soil physical, chemical and biological properties, reduce greenhouse gas
emissions, and sequester carbon. Due to the specific properties of biochar, biochar
addition may have significant impacts on soil chemical and physical properties, which
also potentially affect the biochemical processes and microbial functions in soil.
However, the interactions between biochar additions and chemical and biological
properties in soil are not fully understood (Lehmann et al., 2011).
There is widespread debate about the use of biochar and its agricultural benefits in soil.
Many reviews indicate that the application of biochar to soils influences chemical and
physical properties as well as the function and structure of microbial communities that
can be associated with an increase in soil fertility (Lehmann et al., 2011; Liu et al.,
2012a; Partey et al., 2015). However, some studies have revealed that biochar addition
can also have negative impacts on soil properties. Biochar can adsorb agri-chemicals
such as pesticides and also organic matter which can then prevent microbial enzyme
access that are subsequently released from microbial colonies (Kookana et al., 2011;
Zimmerman et al., 2011). Some biochar products may be toxic depending on the source
materials used in its manufacture (Kookana et al., 2011). A comparative study
26
conducted by Paz-Ferreiro et al. (2012) to evaluate the impact of sewage sludge derived
biochar and unpyrolyzed sewage sludge on the biochemical activity on soil showed that
the organic amendments had different impacts on soil biochemical activity, while the
geometric mean of enzyme activities was increased in the higher biochar treatment and
decreased in sewage sludge amended soil. This may indicate that pyrolyzed organic
materials are suitable for enhancement of soil biochemical activity; however, impact on
enzyme activity could be variable and dependent on the soil as well as enzyme (Bailey
et al., 2011).
Due to its high surface area, biochar provides a habitat for soil microorganisms
(Lehmann and Joseph, 2009; Kookana et al., 2011). Consequently, biochar application
may influence all aspects of soil fertility related to the physical characteristics of soil.
Pyrolysis conditions can influence surface area and porosity of biochar. The study by
Kookana et al. (2011) showed that specific surface area and porosity were increased
with increasing pyrolysis temperature; however, micropores might be destroyed at
higher temperatures. The physical difference between biochar and the soil matrix leads
to an overall change in soil density and aggregation, hydraulic conductivity and gas
transportation, which in turn impacts chemical properties and microbial activity in soil
(Lehmann et al., 2011). The application of biochar may also improve irrigation
management and water infiltration and enhance fertiliser treatment response in soil.
Asai et al. (2009) investigated the effect of biochar on soil physical properties and rice
green yields. The results showed an improvement in the hydraulic conductivity and
increased rice yields in sites with low P content and noticeable responses to the fertiliser
treatments. It has been reported that compost amendment and increase soil organic
content can enhance hydraulic conductivity , however the impact might be variable
between different soils and application rates (Aggelides and Londra, 2000; Rawls et al.,
27
2003). Improving hydraulic conductivity and other physical characteristics in soil
provides suitable conditions for chemical interactions and microbial activity.
Furthermore, because biochar has high resistance to microbial degradation, the impact
of biochar addition in soil is presumably persistent for years.
Biochar is more likely to be beneficial in soils that have poor physical characteristics,
such as sandy soils. An experiment conducted by Basso et al. (2013) suggested that
biochar addition to sandy soil increases water holding capacity which might increase
water availability for plant use. Evidence showing the biochar contribution and its
effect on soil stability and aggregation, water management, porosity and surface area
indicate that understanding the biochar functions and effects in soil would assist in
choosing a particular biochar in specific agricultural soils, thus gaining the maximum
benefits from biochar as a soil amendment (Sohi et al., 2010).
Biochar also affects soil chemical properties but the impact could be more complex.
The chemical composition of biochar differs depending on feedstocks. Unger et al.
(2011) conducted an incubation experiment to determine if biochar produced under
different reactions from various feedstocks would differentiate the influence of biochar
on soil chemical properties, Unger et al. (2011) suggested that the reaction conditions
and organic materials used to produce biochar will affect specific soil chemical
properties. Biochar addition to soil can increase cation exchange capacity (CEC) and
thus nutrient holding capacity, potentially resulting in increased availability of soil
nutrients such as potassium (K), calcium (Ca) and nitrogen (N). Also the high cation
exchangeable capacity (CEC) enhances binding cations and anions in soil to increase
nutrient retention and availability to microbes and plants (Atkinson et al., 2010).
Biochar has also been shown to increase soil pH, thus influencing the concentration of
many nutrients in soil and their availability for crop uptake (Fowles, 2007).
28
The impact of biochar on biotic processes and related microbes has been discussed
recently by many researchers; however, there is limited understanding of the
interactions between biochar amended soil and biological processes including the direct
impact of biochar on soil microbes. The main purposes of using biological fertilisers
and soil amendments are to reduce the expense of chemical additions, improve crop
production, and reduce greenhouse gas contributions. Biochar seems to be a beneficial
way to achieve this purpose because of its long term impact on the soil ecosystem.
Theoretically, biochar could alter the biological processes in soil such as N
mineralisation and nitrification by affecting the bacteria which are involved in these
processes as well as providing a suitable environment to increase microbial activity
(Berglund et al., 2004). Several studies indicate that using biochar as a soil amendment
enhances populations and activity in soil by inducing metabolism and growth of soil
microorganisms (Kookana et al., 2011; Tong et al., 2014). However, the impact of
biochar applications on the entire soil microbial community and how soil biota interact
and adjust with carbon-amended soil environments has received little attention.
The study reported here was conducted in an apple orchard that was amended with
either biochar or compost. To date the affects on soil physical charcateristics (Hardie et
al. 2014) and tree growth have been reported (Eyles et al. 2015). The aim of this study
was to (i) understand the impact of biochar and compost on the function of soil
microbes related to the biological processes that occur following application; (ii)
determine the impact of these additions on the entire soil community (archaea, bacteria
and eukaryotes); and (iii) determine how this relates to alterations in soil
physicochemical properties.
29
2. Materials and methods
2.1. Site characteristics and trial design
Soil samples were collected from an established apple orchard trial site at Mountain
River located in the Huon Valley in southern Tasmania (42°57’2.91”S, 147°5’52.13”E).
This site was established in November 2009 during replanting of the orchard. The
experimental design was a randomised complete block with four treatments and five
replicates; trees were blocked on position within the tree-row. Each replicate contained
three trees and plot size was 3.18 meters long and 1 meter wide. The four treatments
were biochar (B), compost (C), biochar + compost (B+C) and untreated control (U); the
biochar+compost treatment (B+C) was excluded and not reported in this study. Biochar
was sourced from Pacific Pyrolysis, Somersby, NSW (Australia); feedstock consisted of
Acacia as a whole tree green waste which had undergone pyrolysis in a continuous flow
kiln at temperatures up to 550 °C for 30-40 minutes. The average pore size of the
biochar, estimated by using scanning electron microscopy, ranged from 0.8 μm to 235
μm. The biochar had a pH of 6.4, contained 8.93% (w/v) organic carbon, 3 mg kg-1
NH4+, 1 mg kg-1 NO3
-, extractable P of 234 mg kg-1 and 1117 mg kg-1 K.
Physicochemical characteristics of the biochar are detailed by Hardie et al. (2014).
Biochar was applied on 2nd November 2009 before tree planting, each replicate received
15 kg biochar, equivalent to 5 kg per tree space or 47 tonne ha-1. The biochar was
spread evenly to a width of 1 m across the tree row and worked into the top 10 cm of
the soil profile. The orchard was replanted with ‘Naga-Fu No 2 Fuji’ trees on M26
rootstock with a ‘Royal Gala’ interstem. Tree spacing was 1.06 m within the row and
4.5 m between rows. The compost (produced by the Luebke system) sourced from
Renew (Plenty, Tasmania, Australia) was composed of 43 % (w/v) organic carbon, 4.5 %
30
total nitrogen (Kjeldahl), 1.8 % water soluble nitrogen and 0.017 % nitrate nitrogen
(Eyles et al., 2015). The compost was applied at 10 tonne ha-1 as a top dressing within
the tree row 1 week after planting on 9th November 2009. Annual fertiliser additions
applied in the field site in October included N-P-K (7:3:22) at 266 kg ha-1 and fresh
fowl manure applied in July at 2 kg per tree. Additional nutrients in the form of calcium
nitrate or potassium nitrate were supplied via fertigation from November to March at 12
kg ha-1 per week, switching to Solu-K (Campbells Fertiliser Australia) in February and
March. In summary, the treatments received approximately 42.5, 6.0, 131.1 and 12.0 kg
ha-1 per year of N, P, K and Ca, respectively. Soils were classified using the Australian
Soil Classification (Isbell, 2002) as a Bleached Mottled Grey Kurosol (texture contrast)
developed on Permian Mudstone with a minor contribution of Jurassic dolerite
colluvium. The soil profile was described according to McDonald et al. (1998) with
chemical analysis conducted by CSBP laboratories, Western Australia. The topsoil is a
dark brown – black sandy loam consisting of 10.4 % clay, 72.8 % sand and 16.8 % silt.
Climate data from a weather station located 7 km away indicated the site had a mean
annual rainfall of 744 mm, mean maximum temperature 17.1 °C, mean minimum
temperature 5.8 °C, and mean annual sunshine of 5.5 hours per day.
2.2. Sample collection and preparation
Soil samples were collected form the top 0-15 cm of the soil surface at two different
times: 28th March 2013 and 17th July 2013. Samples were collected from three
treatments (control, biochar, compost) and each sample divided into 4 replicates in the
first sampling time and 8 replicates in the second time. All samples were placed in
plastic pages, labelled and taken to the laboratory. Soil from each replicate was divided
31
into two parts; the first part was air dried, sieved and stored for chemical analysis and
the other part stored at 4ºC for biological analysis.
2.3. Chemical and physical analysis
Soil chemical analysis was conducted by CSBP laboratories, Western Australia.
Properties analysed included soil water content, Colwell phosphorus, Colwell
potassium, sulphur (KCl), organic carbon (Walkley-Black), nitrate nitrogen, ammonium
nitrogen, electrical conductivity, pH (in 1:5 soil:water), pH (1:5 soil:0.1M CaCl2),
micronutrients by DTPA extract for copper, zinc, manganese and iron and
exchangeable cations (calcium, magnesium, sodium, potassium and aluminium).
Chemical and physical results were statistically analysed by ANOVA using SPSS v21
to assess the effect of biochar addition on soil properties compared to an unamended
control and compost addition treatments.
2.4. Enumeration and assessment of soil biomass
Soil bacterial numbers were estimated by determining the total viable count (TVC)
expressed as colony forming units (CFU) on agar plates. A modified method was
conducted as described by Juhnke et al. (1987) using 10 % tryptone soy agar (Sigma-
Aldrich Corp.) and incubated at 25ºC for 21 days. Total biomass was estimated from
extracted DNA (n=8 replicates for each treatment) which was used as an alternative
method to estimate microbial biomass (Marstorp et al., 2000; Bouzaiane et al., 2007)
with quantities estimated via spectrophotometer (NanoDrop 8000 Spectrophotometer,
Thermo Fisher Scientific Inc., Wilmington, DE, U.S.A.).
32
2.5. Enzyme assays
Acid and alkaline phosphatase activities in soil were assayed as described by Tabatabai
and Bremner (1969) using sodium p-nitrophenyl phosphate salt (Sigma-Aldrich Corp.)
as a substrate. Arylsulfatase activity was determined using potassium p-nitrophenyl
sulphate (Sigma-Aldrich Corp.) as a substrate (Tabatabai and Bremner, 1970).
Dehydrogenase and fluorescein diacetate hydrolytic activity were determined by
colorimetric methods using iodonitrotetrazolium chloride and fluorescein diacetate
(Sigma-Aldrich Corp.) respectively as substrates (Von Mersi and Schinner, 1991; Green
et al., 2006). Glucosidase activity in soil was estimated using 4-nitrophenyl-β-D-
glucopyranoside and modified universal buffer (MUB) (Sigma-Aldrich Corp.) as
described by Eivazi and Tabatabai (1988). Amidase and urease activities were
determined using methods developed by Frankenberger and Tabatabai (1980) and
Tabatabai and Bremner (1972), respectively. Formamide (Sigma-Aldrich Corp.) was
used as a substrate for amidase activity and urea used for urease activity assessments.
An ammonia assay kit (Sigma-Aldrich Corp.) was used to determine the ammonia
(NH4-N) derived from amidase and urease activities.
2.6. DNA extraction and pyrosequencing
DNA was extracted from the soil samples using PowerSoil DNA Isolation Kit (MO
BIO Laboratories, Inc) following the manufacturer protocol. DNA purity was measured
using the spectrophotometer described previously at 260/280 nm. 16S and 18S rRNA
gene tag pyrosequencing was applied to 8 to 12 replicate samples collected from the
three soil plots. Tag-encoded FLX amplicon pyrosequencing of the region covered by
33
application of the 28F (GAGTTTGATCNTGGCTCAG) and 519R
(GTNTTACNGCGGCKGCTG) primers for bacteria, 340F
(CCTACGGGGYGCASCAG) and 958R (YCCGGCGTTGAMTCCAATT) for archaea,
and 516F (GGA GGG CAA GTC TGG T) and 1055R (CGG CCA TGC ACC ACC) for
the eukarya using a Roche 454 FLX instrument with Titanium reagents as previously
detailed by Dowd et al. (2008). Approximately 3000 raw reads were obtained per
sample. Sequences were denoised and chimera-filtered through a bioinformatic pipeline
(Lanzén et al., 2011). Briefly, all sequences were organised by read length and de-
replicated using USearch (Edgar, 2010). The seed sequence for each cluster was sorted
by abundance and then clustered again with a 1% divergence cut-off to create
consensus sequences for each cluster. Clusters containing only one sequence or <250 bp
in length were removed. Seed sequences were again clustered at a 5% divergence level
using USearch to confirm whether any additional clusters appeared. Once this process
was completed any reads that failed to have a similar or exact match to seed sequences
(typically poor quality reads) were removed. Chimeras were also removed from the
clustered sequences created during denoising by using UCHIME in the de novo mode
(Edgar et al., 2011). Sequences that yielded matches of <75% were discarded. CDHIT-
454 (Niu et al., 2010) was used to subsequently obtain consensus clusters that were
aligned via CLUSTAL-OMEGA (Sievers et al., 2011) and checked for sequence errors,
chimeric sequence regions, and were taxonomically classified against the Greengenes
database (McDonald et al., 2011). Potential chimeras were rechecked using
Bellerophon (Huber et al., 2004). Chimeric sequences (approx. 4% incidence) were
discarded. Singleton sequences were not assessed.
34
2.7. Clustering, ordination and diversity analysis
To assess community compositions, PRIMER6 and PERMANOVA+ (version 6.1.12
and version 1.0.2; Primer-E, Ivybridge, UK), respectively were used to conduct
permutation multivariate analysis of variance (PERMANOVA) (Anderson et al., 2005),
and canonical analysis of principal coordinates (CAP) (Anderson and Willis, 2003). For
this analysis sequence read data organised at the lowest taxonomic level possible
(usually genus to family) was normalised as percentages, square root transformed and a
resemblance matrix created by calculation of Bray-Curtis coefficients. PERMANOVA
was conducted using default settings with 9999 permutations, while CAP was
conducted using default settings. The PERMANOVA derived significance values were
considered significant when P < 0.01, while 0.01 < to P < 0.05 were considered only
marginally significant.
3. Results
3.1. Chemical and physical properties
There was no significant direct impact on soil nutrient levels, either total or
exchangeable, between treatments (Table 2.1); however, the organic carbon level was
significantly different, increased by 23% (p=0.009) with biochar and 55% with
composted treatments compared to untreated controls. Soil pH was lower in the biochar
and compost treatments compared to the control (Table 2.1). The high fertiliser regime
at this commercial orchard has resulted in a topsoil with high general soil fertility with
moderate to high levels on N, P, K, S and Ca (see Table 2.1). The moisture content in
35
biochar amended soil was overall 13% higher but not significant (p=0.319) in relation
to the control.
36
Table 2.1: Soil chemical characteristics of unamended control, biochar and compost
amended soil, including the Least Significant Difference (L.S.D) and the p-value.
Parameters Control Biochar Compost L.S.D p-Value
Ammonium Nitrogen (mg/Kg) 5.00 5.00 5.75 ns 0.491
Nitrate Nitrogen (mg/Kg) 112.5 81.3 114.8 ns 0.185
Phosphorus Colwell (mg/Kg) 453 393 426 ns 0.675
Potassium Colwell (mg/Kg) 494 497 507 ns 0.938
Sulphur (mg/Kg) 19.55 15.23 18.43 ns 0.323
Organic Carbon (%) 2.19b 2.69b 3.39a 0.65 0.009
Electric Conductivity (dS/m) 0.29 0.23 0.28 ns 0.311
pH Level (CaCl2) 6.00a 5.70b 5.55b 0.2708 0.015
pH Level (H2O) 6.57a 6.35ab 6.15b 0.2584 0.017
DTPA Copper (mg/Kg) 29.32 34.08 25.81 ns 0.198
DTPA Iron (mg/Kg) 128.11 153.18 154.33 ns 0.097
DTPA Manganese (mg/Kg) 4.39 5.05 5.72 ns 0.208
DTPA Zinc (mg/Kg) 13.47 14.17 16.97 ns 0.132
Exc. Aluminium (meq/100g) 0.01 0.02 0.02 ns 0.523
Exc. Calcium (meq/100g) 9.83 9.21 10.54 ns 0.434
Exc. Magnesium (meq/100g) 1.61 1.26 1.53 ns 0.118
Exc. Potassium (meq/100g) 1.02 1.09 1.11 ns 0.538
Exc. Sodium (meq/100g) 0.12 0.09 0.11 ns 0.079
Boron Hot CaCl2 (mg/Kg) 1.37 1.24 1.44 ns 0.582
Water Content (%) 18.07 20.41 19.99 ns 0.319
L.S.D = least significant difference, a,b = differences between means, ns = non-significant
37
3.2. Soil biomass
Soil bacterial numbers and total biomass was estimated by determining the TVC on
agar plates (as colony forming units per gram of soil) and then by the amount of DNA
extracted from the soil samples. Both the plate count and DNA concentration results
showed the same patterns and positively correlated (r=0.89) for the biochar and
compost application impact on the soil biomass. The TVC increased by 15 % in biochar
amended soil (Fig.2.1A) compared with untreated soil, but compost application
increased the TVC by 58 %. The amount of DNA extracted from biochar amended soil
increased by 31% compared to the control whereas compost amended soil resulted in a
greater increase (45%) of extracted DNA (Fig. 2.1B).
38
Figure 2.1: Soil total viable count (TVC) and biomass data for Mountain River control,
biochar and compost amended orchard soils. (A) Average soil bacterial total viable
count, estimated by determining colony number (shown as colony forming units CFU)
on 10% trypticase soy agar. (B) Average concentration of DNA extracts. Error bars are
the standard deviation values.
0
20
40
60
80
100
120
Control Biochar Compost
CFU
×1
04
/ g
dry
So
il
(A) Average soil bacterial total viable count
Control
Biochar
Compost
0
5
10
15
20
25
30
35
Control Biochar Compost
DN
A (
ng
/ul)
(B) Average concentration of DNA extracts
Control
Biochar
Compost
39
3.3. Enzyme Activity
The impact of biochar and compost application on soil enzyme activities was limited
overall as indicated in Fig. 2.2. There was a significant impact on alkaline phosphatase
activity (P=0.002). The highest activity occurred in compost plots followed by biochar
treatments compared to control (Fig.2.2). There was no significant difference in the
other enzyme activities among treatments except the fluorescein diacetate hydrolase
activity, which was slightly decreased in the compost-amended soil.
40
Figure 2.2: Comparison of enzyme activities between control, biochar and compost
plots from Mountain River orchard soils. Error bars are the standard deviation values.
0
0.01
0.02
0.03
0.04
0.05
0.06
0.07
Control Biochar Compost
p-N
itro
ph
eno
l / h
/ g
-So
il
Acid phosphatase
Alkaline phosphatase
0
0.01
0.02
0.03
0.04
0.05
Control Biochar Compost
p-N
itro
ph
eno
l /h
/g-S
oil
Arylsulfatase
Glucosidase
0
0.005
0.01
0.015
0.02
0.025
Control Biochar CompostForm
azan
& F
luo
resc
ein
/h
/ g-
Soil
Dehydrogenase Fluorescein diacetate
0
0.02
0.04
0.06
0.08
0.1
Control Biochar Compost
mg
NH
4/h
/g-S
oil
Ureas Amidase
41
3.4. Microbial Community Structure
PERMANOVA and CAP analysis of the 16S and 18S rRNA pyrosequencing data
indicated significant differences in bacterial and fungal community structures between
treatments (Fig.2.3). The change in fungal community structure was highly significant
(p=0.0004) whereas fewer differences were observed in the bacterial community
structure (p=0.0109) between unamended control, biochar and compost amended soils
as shown in Fig.2.4.
42
Figure 2.3: Canonical analysis of principal coordinate (CAP) plots of microbial and
eukaryotic community structure determined from taxa classifications derived from 16S
and 18S rRNA gene sequence analysis data. Comparisons are shown between
unamended control, biochar and compost-amended soils. The respective treatment
symbols are: ▲ control, ▼biochar, and ■ compost. Each symbol represents an
individual soil sample. The classification of replicate data treatment for each of the
community components was assessed using PERMANOVA. Significance values for
this assessment are shown for five major community components.
-0.4 -0.2 0 0.2 0.4
CAP1
-0.2
0
0.2
0.4C
AP
2
Transform: Log(X+1)
Resemblance: S17 Bray Curtis similarity
Soil amendmentsControl
Biochar
Compost
-0.4 -0.2 0 0.2 0.4
CAP1
-0.4
-0.2
0
0.2
0.4
CA
P2
Transform: Log(X+1)
Resemblance: S17 Bray Curtis similarity
Soil amendmentsControl
Biochar
Compost
-0.4 -0.2 0 0.2 0.4
CAP1
-0.4
-0.2
0
0.2
0.4
CA
P2
Transform: Log(X+1)
Resemblance: S17 Bray Curtis similarity
Soil amendmentsControl
Biochar
Compost
-0.4 -0.2 0 0.2 0.4
CAP1
-0.4
-0.2
0
0.2
0.4
CA
P2
Transform: Log(X+1)
Resemblance: S17 Bray Curtis similarity
Soil amendmentsControl
Biochar
Compost
-0.3 -0.2 -0.1 0 0.1 0.2 0.3
CAP1
-0.3
-0.2
-0.1
0
0.1
0.2
CA
P2
Transform: Log(X+1)
Resemblance: S17 Bray Curtis similarity
Soil amendmentsControl
Biochar
Compost
Metazoa Total Eukaryota
Fungi
p=0.0004
p=0.0720 p=0.0642
p=0.0714 p=0.0109
Archaea Bacteria
43
3.4.1. Effect of carbon amendments on Archaea
Soil archaeal communities, made up nearly completely of ammonia oxidizers of class
Nitrososphaerales (phylum Thaumarchaeota) did not show any statistical changes in
structure between amended and control soils (Fig. 2.3). It however should be pointed
out that the contribution of archaea to the different soils relative to bacteria and eukarya
was not measured in this study.
3.4.2. Effect of carbon amendments on Bacteria
The dominant bacterial group within treatments at the phylum level was Proteobacteria,
which had proportions of 38%, 41% and 46% in control, biochar and compost
treatments, respectively. At the class level (Fig. 2.4), Alphaproteobacteria increased by
12% in the biochar and 47% in the compost treatment compared with the untreated
control, followed by Betaproteobacteria which increased by 11% in biochar and 7% in
compost treatments. Gammaproteobacteria increased by 10% in both biochar and
compost treatments while Deltaproteobacteria increased by 10% and 16% in biochar
and compost treatments compared to the control. Flavobacteriia decreased by 34% in
biochar and 70% in compost treatment compared to control. Acidobacteriia decreased
by 5% in both biochar and compost treatments. Likewise, the proportions of
Sphingobacteriia and Gemmatimonadia decreased, specially in compost treatments (Fig.
2.4). However, Rubrobacteridae increased by 30% in biochar and 48% in compost
compared to control. No significant changes were observed in class Nitrospira in
biochar treatments, while Nitrospira increased by 54% in compost treatments.
44
Figure 2.4: Averaged proportions of bacterial taxa at the class level in the control,
biochar and compost-amended orchards soils identified using 16S rRNA gene amplicon
sequence analysis.
0
10
20
30
40
50
60
70
80
90
100
Control Biochar Compost
Ab
un
dan
ce (
%)
Other
unclassified
Spartobacteria (Veruccomicrobia)
Opitutae (Veruccomicrobia)
Deltaproteobacteria (Proteobacteria)
Gammaproteobacteria(Proteobacteria)
Betaproteobacteria (Proteobacteria)
Alphaproteobacteria (Proteobacteria)
Planctomycetia (Planctomycetales)
Nitrospira (Nitrospirae)
Gemmatimonadia(Gemmatimonadetes)
Dehalococcoidia (Chloroflexi)
Sphingobacteriia (Bacteroidetes)
Flavobacteriia (Bacteroidetes)
Cytophagia (Bacteroidetes)
Chloracidobacteria (Acidobacteria)
Acidobacteriia (Acidobacteria)
Rubrobacteridae (Actinobacteria)
Actinobacteridae (Actinobacteria)
Acidimicrobidae (Actinobacteria)
45
3.4.3. Effect of carbon amendments on Fungi
The impact of biochar and compost addition (p=0.0004) varied between fungal groups
(Table 2.2), some fungal groups became relatively less abundant in the treatments
compared to the control, including Entomophthoromycota, Chytridiomycota and
Basidiomycota, whereas the abundance of Ascomycota, Blastocladiomycota and
Glomeromycota was greater in either the biochar or compost treatments. The
Ascomycota increased by 39% in biochar and 48% in compost compared to control,
while the Glomeromycota (arbuscular mycorrhiza) significantly increased in the
compost compared to control and biochar treatments (Table 2.2). The impact of biochar
and compost additions was greatest on ascomycetes of class Pezizomycetes (apothecial
fungi), which increased by 149% in biochar and 190% in compost compared to the
unamended control. Sordariomycetes (fungi with perithecial fruiting bodies), which was
the most abundant fungal group overall, also increased by 31% and 41% in biochar and
compost treatments (Fig. 2.6).
46
Table 2.2: The mean proportion of reads of fungal phyla in an untreated control,
biochar and compost-amended orchard soil.
Fungal phylum Relative Abundance (% of reads)
Control Biochar Compost
Ascomycota 51.1 71.0 75.5
Basidiomycota 33.9 10.7 10.2
Chytridiomycota 5.6 5.0 3.9
Entomophthoromycota 0.5 0.3 0.3
Blastocladiomycota
Mortierellales
0.3
0.05
0.3
0.05
0.3
0.01
Glomeromycota 0.03 0.05 0.6
Unclassified fungi 8.5 12.7 9.2
47
3.4.4. Effect of carbon amendments on Metazoa and other Eukarya
CAP analysis (Fig. 2.3) showed a slight change in the proportions of soil metazoa in the
biochar and compost treatments compared to the unamended control (p=0.072). The
abundance of the dominant soil metazoa is shown in Fig. 2.5. Addition of biochar
resulted in an apparent increase in soil nematodes compared to control and compost
treatments. The proportion of nematodes of class Chromadorea barely changed in
biochar but decreased in compost treatments by 23%, while nematodes of the class
Enoplea increased by 14% and 25% in biochar and compost treatments respectively.
The relative proportion of reads of Annelida was in general reduced in biochar and
compost treated soil. Arthropods in the class Arachnida were 28% less abundant in the
biochar treatment but 23% higher in the compost treatment compared to the control,
while the abundance of Ellipura, which includes proturan and collembolan arthropods,
was increased in both biochar and compost by 421% and 346% compared to control;
Chilopoda (millipedes and relatives) were most abundant in the compost treatment,
approximately 10% of the total Metazoa in compost amended soil.
48
Figure 2.5: Averaged proportions of dominant soil metazoa at the class level as
determined from 18S rRNA gene amplicon sequence analysis in the control, biochar
and compost-amended orchard soils.
0
10
20
30
40
50
60
70
80
90
100
Control Biochar Compost
Ab
un
dan
ce (
%)
Other
Turbellaria (Platyhelminthes)
Enoplea (Nematoda)
Chromadorea (Nematoda)
Ellipura (Arthropoda)
Chilopoda (Arthropoda)
Arachnida (Arthropoda)
unclassified Annelida
Branchiobdellae (Annelida)
49
Figure 2.6: Averaged proportion of fungal taxa at the class level in the control, biochar
and compost-amended orchard soils as deternmined by 18S rRNA amplicon sequence
analysis.
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
Control Biochar Compost
Ab
un
dan
ce (
%)
Other
Mortierellales (Zygomycota)
Chytridiomycetes (Chytridiomycota)
Basidiomycota incertae sedis(Basidiomycota)
Tremellomycetes (Basidiomycota)
Agaricomycetes (Basidiomycota)
Ascomycota insertae sedis(Ascomycota)
Sordariomycetes (Ascomycota)
Pezizomycetes (Ascomycota)
Leotiomycetes (Ascomycota)
Eurotiomycetes (Ascomycota)
Dothideomycetes (Ascomycota)
50
4. Discussion
4.1. Physical and chemical properties
A prior study of physical properties of the Mountain River orchard site revealed biochar
amendment enhanced near-saturated hydraulic conductivity and reduced bulk density
(Hardie et al., 2014). This was believed to be due to macropores forming due to greater
bioturbation activity (Hardie et al., 2014). However, there was no significant effects on
aggregate stability, drainable porosity (between –1.0 and −10 kPa), water content at
field capacity or permanent wilting point, and hence plant available water capacity
(Hardie et al., 2014). This suggests that direct biochar-influenced soil porosity and
water retention changes are very limited but could suggest indirect impacts on these
properties due to the alteration of the invertebrate abundance and diversity
(McCormack et al., 2013). The different size of biochar pores may make it a habitat
occupied by micro and mesofauna (protozoa, nematodes, mites, collembola and
enchytraeids), which can contribute to soil structure and aggregation, and this may
explain the increase in predominance of nematodes in biochar amended soil. Other
organisms such as macrofauna (earthworms and termites) could create larger pores, and
thus increase the availability of air-water interfaces in the soil (Lee and Foster, 1991).
However, the degree of change in these characteristics is influenced by the type of
biochar added to the soil (Chen et al., 2010), and also the type of soil and other organic
amendments (Hardie et al., 2014).
The biochar treatment but not the compost treatment was found to increase tree girth in
the years one and four following application. However, no effect was found on tree
photosynthetic capacity, leaf nutrient levels, daily water use or fuit yield and quality
(Eyles et al., 2015). These results correlated to findings here that neither biochar nor
51
compost had any direct impact on nutrient availability in the orchard soil itself;
however both biochar and compost amendments had a strong impact on soil organic
carbon levels (Table 1.1). The results support the contention that soil amendments can
compensate for loss of organic matter due to agricultural practices and thus could
potentially assist in improving physical, chemical and biological properties in soil
(Arriagada et al., 2014) indirectly if not directly. The lack of significant changes in any
of the key soil fertility indicators such as Colwell phosphorus and potassium,
extractable sulphur, soluble nitrate and ammonium and base cations may relate to the
regular use of fertigation (weekly) and the annual application of fowl manures to this
commercially managed orchard in which the trial was undertaken. However the
significant increase in the soil organic carbon in both treatments does indicate that the
soil’s capacity to retain and release nutrients has been improved.
While other studies have reported an increase in soil pH following biochar application
(Kimetu et al., 2008), our results showed a decrease in soil pH after the addition of
biochar; and also with compost application. The effect of biochar on soil pH is
dependent on the pH of biochar itself and the liming value, which is dependent on the
feedstock and pyrolysis conditions used for biochar production (Kookana et al., 2011;
Lehmann et al., 2011). As the biochar in this study had a pH of 6.4, it was not
surprising that it did not have a liming effect as has been observed in biochars with high
pH values. An increase in organic matter following the addition of biochar or compost
may also decrease soil pH due to the microbial activity and organic acids released
during organic matter decomposition.
52
4.2. Soil biomass changes
The results of this study indicated that the number of bacteria and the overall biomass
was slightly increased in biochar amended soil compared with untreated soil. The
increase observed in biochar amended soil agrees with the finding of O'Neill et al.
(2009) that microbial abundance is improved after the addition of biochar, however, the
effect of compost addition was greater in comparison to the control and biochar plots.
Many studies indicate that several factors may be involved in affecting microbial
community structure following biochar addition, for example, a shift in pH after biochar
application could alter the biodegradation process and microbial community structures
(Jones et al., 2011). However, previous studies reported that any pH increase or
decrease after biochar application depends on the feedstock and the application rates,
which still needs to be investigated. The enhancement of microbial community structure
is more likely to be due to the physicochemical characteristics of biochar and compost
added to the soil (Saison et al., 2006), although there may also be an indirect impact
resulting from changes in nutrient availability that occurred after treatment applications.
Addition of biochar to the soil often increases nutrient and water retention and provides
suitable habitats for soil microorganisms (Lehmann et al., 2011; Ennis et al., 2012),
however, in this system we show that this is not evident although biological
modification is detectable. Organic matter and its application play an important role on
the soil biodiversity and relevant processes in the soil. Therefore, using biochar as a soil
conditioner is considered to be one of the main aspects which affect the soil food-web
structure (Moore et al., 2004; Brussaard et al., 2007).
53
4.3. Enzyme activity
Biochar and compost applications had a limited effect on soil enzyme activity in
comparison to the control plot. Generally, the changes in enzyme activities might be a
response to carbon and chemical alterations after biochar and compost applications
(Kotroczó et al., 2014). Biomass changes were not sufficient to result in substantial
change to the overall rates. Nevertheless, many factors may be involved as a result of
the wide range of changes in soil chemical and physical properties after biochar
amendment. Bailey et al. (2011) reported that biochar pores and nutrient availability
may improve root growth and P uptake, and this may explain the slight enhancement of
the production of the P mineralising enzyme alkaline phosphatase. Biochar could have a
significant impact on microorganisms related to the nutrient transformations in soil, and
there could be organisms that are also sensitive to the changes in chemical properties
occurring after biochar addition (Lehmann et al., 2011). Although, there were no
significant effects on most enzymes activities, biochar may react differently depending
on initial soil chemical properties such as pH and CEC (Joseph et al., 2010). The data
reflects fundamentally that microbial enzyme function seems to stay relatively stable
despite biochar and compost amendments with any potential initial impact having
dissipated within the 3.5 year period of the trial.
4.4. Biological community structure alteration
The complexity of soil systems in terms of structure and function is related to the
variety of interactions of many taxa including bacteria, archaea, fungi and soil fauna
(Atkinson et al., 2010). These groups have a significant impact on soil health and
54
quality, which also might be affected by addition of organic matter to the soil.
Significant differences in bacterial and fungal community structures were observed in
the orchard soil studied here after the additions of biochar and compost. The alteration
in the fungal community structure was the most highly significant, although a weaker
but significant difference was also observed for the overall bacterial community
structure. The results also suggested that the proportions of soil eukaryote change to an
extent in biochar and compost amended soil. The microbial diversity is rather variable
and dependent on the soil properties, for example, microbial communities in
Amazonian terra preta are relatively disparate despite being heavily influenced by
organic carbon. This is possibly due to temporal and spatial dimensions of the actual
carbon amendment process with the result the microbial community has adapted
accordingly (O'Neill et al., 2009). To some extent the patchiness of soil microbiota
distributions also affect the means by which the sequence data is interpretable (Frey,
2014). This required the application of multivariate analysis and only broad groups
(class, phyla) can be realistically compared.
The results of this study showed that the application of biochar and compost affected
the microbial communities, but bacterial groups seem to have the same general trends
between carbon amendments relative to untreated soil. The changes in the
physiochemical properties after biochar and compost application such as pH, water
content, CEC and especially the organic carbon might be the main reason for changes to
the bacterial populations (Steinbeiss et al., 2009; Lehmann et al., 2011; Kelly et al.,
2014). The decline in Flavobacteriia suggests a change in the accessibility of utilisable
carbon or other nutrient resource in the carbon amended soils. Typically members of
this class are copiotrophic chemoheterotrophs which are well studied in aquatic
ecosystems (Buchan et al., 2014). Increased competition for carbon and other nutrients
55
due to the larger soil biomass in the amended soils could result in this group being
displaced by various Proteobacteria, Spartobacteria, and Rubrobacteridae, which
could be more adept at competing for the altered resource regime. The actual nutrient
alterations rendered are unknown and community analysis insufficiently detailed to
infer what these changes could be. This understanding is also fundamentally hampered
by a general lack of knowledge of soil microbial functionality (He et al., 2012) . More
research is needed to detail community structural changes in relation to functional
changes in biochar treated soils to better ascertain the connection between community
changes, the functional outcomes and the actual consequences to soil biology. This
requires larger number of replicates, deeper sequencing and importantly, more
controlled conditions to account for spatial variability and agricultural management
practices.
Moreover, the addition of biochar appeared to change the relative abundance of various
soil fauna, especially soil nematodes compared to control and compost treatments.
These are even more subject to spatial heterogeneity and the temporal impact produced
by the carbon amendments, thus the significance of changes observed tend to be more
questionable. Much evidence however suggests that biochar can provide a suitable
habitat for certain soil fauna by altering soil porosity and increasing CEC, which
increases nutrient base cation availability (Lehmann and Joseph, 2009; Kookana et al.,
2011). The actual impact of biochar on soil fauna has to date been investigated rather
rarely and has received less attention than microorganisms (Lehmann et al., 2011).
Changes to soil fauna observed here, especially soil nematodes and arthropods, might
be associated with increased overall abundance of biota in the soil, assumed to be
largely bacteria and fungi which are typically prey (Hallmann et al., 1999; Akhtar and
Malik, 2000). Though the proportion of annelid sequences seems to be slightly reduced
56
in the carbon amended soils, it is possible their response could be time dependent. The
suggestion that increased bioturbation occurs in the amended soils (Hardie et al., 2014)
could be a consequence of activities that dissipate over time or could be seasonal in
nature. Thus there is a need to undertake shorter and longer term studies as well as
studies in which amendements are applied at different rates and at multiple times.
In this study any apparent increase in density of soil nematodes and other bacterivorous
and fungivorous fauna would tend to counteract any increases in bacterial and fungal
biomass and activity. This interaction might directly result from predation or indirectly
from changes in the nutrient recycling and competition, dependent on the actual
nematode density within the environment (Traunspurger et al., 1997), which was not
assessed here. The statistical analysis illustrated that the greatest impact occurring from
biochar and compost application was on soil fungal community composition. The
response of soil fungi to biochar application is different depending on the functions and
characteristics of different fungal groups (Atkinson et al., 2010). Generally the biochar
properties improve soil fungi colonization and hyphal growth due to higher porosity,
nutrient retention and water holding capacity (Lehmann and Joseph, 2009; Lehmann et
al., 2011). Previous studies stated that mycorrhizal fungi seemed to be increased after
the addition of biochar (Warnock et al., 2007), observed here for compost but not
biochar, however the mechanism of this enhancement remains unclear. On the other
hand, the biochar and organic application may also cause a decrease in mycorrhizal
fungi due to the increase of nutrient availability, especially phosphorus, and modifying
soil pH (Gaur and Adholeya, 2000; Warnock et al., 2010). Many studies which support
our findings claimed that the compost amendment significantly affected the fungal
community structure in soil (Saison et al., 2006; Farrell et al., 2010) likely due to
57
introduction of labile carbon that is accessible to fungal metabolism, such as complex
polysaccharides and lignocellulosic material present in the humus.
5. Conclusion
The results of this study support our hypothesis or aim suggesting that the application of
biochar and compost seems to subtley influence soil characteristics leading to changes
in bacterial and fungal community structure more than three years after the original
application of the amendments. The changes in eukaryote community structure could be
associated with enhancement in macroporosity and bioturbation in the soils although it
is unknown to what extent the observations change over time and whether the effect of
the amendments is stable or in a process of dissipation. The relatively high fertiliser
input to the field site potentially masks changes to soil chemical properties.
Nevertheless, the application of biochars and composts and their impact on some soil
physical and chemical, but particularly biological properties, is visible despite this. It is
important to consider that many factors are involved in the impact of biochar and
compost application on soil fertility, including the source of organic materials, soil type,
fertiliser rate and biochar application rates. A better understanding of the consequences
of the additions by connecting practices with outcomes, and understanding the
underlying mechanisms driving soil changes over time, will help achieve the maximum
benefits and efficient use of biochar and compost in soil.
58
Chapter 3
The effect of biochar loading rates on soil fertility, soil
biomass, potential nitrification and soil community
metabolic profiles in three different soils
Abstract
Biochar is increasingly being used as a soil amendment to both increase soil carbon
storage and improve soil chemical and biological properties. To better understand the
shorter term (10 months) impacts of biochar, a wide range of loading rates were applied
to investigate its impact on selected soil parameters and biological processes in three
different textured soils. Biochar derived from eucalypt green waste was mixed at 0%,
2.5%, 5%, 10% (wt/wt) with a reactive black clay loam (BCL), a non-reactive red loam
(RL) and a brown sandy loam (BSL) and placed in pots exposed to the natural elements.
After 10 months incubation, analyses were undertaken including estimates of microbial
biomass by total viable counts (TVC) and DNA extraction. Moreover, potential
nitrification rates and community metabolic profiles were assayed to evaluate microbial
function and biological processes in biochar amended soils. The results showed that
biochar additions had a significant impact on NH4 and NO3, total C and N, pH, EC and
soil moisture content in both a soil type and loading dependent manner. In the heavier
and reactive BCL, no significant impact was observed on available P and K levels, nor
total exchangeable base cations (TEB) and CEC. However, in the other lighter soils
biochar addition had a significant effect on exchangeable Al, Ca, Mg and Na levels and
CEC. There was a relatively limited effect on microbial biomass in amended soils;
however, biochar addition and its interactions with different soils reduced the potential
59
nitrification at the higher biochar rate in the two lighter soils. Community metabolic
profile results showed that the effect of biochar on carbon substrate utilisation was both
soil type and loading dependent. The BCL and BSL showed reduced rates of substrate
utilization as biochar loading levels increased while the opposite occurred for the RL.
This research shows that biochar can improve soil carbon levels and raise pH but its
effect is soil type dependent. High biochar loading rates may also influence nitrification
and the function and activity of microbial community in lighter soils.
60
1. Introduction
Biochar has emerged as a commercially available amendment for possible improvement
of soil health, physical properties and chemical fertility. It consists of an aromatic stable
porous carbon structure which is highly resistant to chemical and microbial degradation
compared to other organic materials in soils (Glaser et al., 2001). As such, biochar has
been considered as a mechanism for carbon sequestration applicable in long term
agriculture practices (Rondon et al., 2005). Biochar amendment in soil may affect the
microbial population as a result of changes to microbial activity, biomass and
community structure (Ducey et al., 2013). However, the interaction between different
biochar application rates and soil characteristics still needs to be further explored
(Lehmann et al., 2011). Biochar has a high carbon to nitrogen ratio (C:N ratio) and high
surface area that can increase cation exchangeable capacity (CEC) which in turn may
enhance nutrient retention and water holding capacity, especially in sandy textured soils
(Lehmann et al., 2006).
Biochar characteristics potentially drive changes which occur in soil physical properties
including structure, field-texture, porosity, particle size and density. These in turn may
affect soil aeration, water holding capacity and microbial activity (Atkinson et al.,
2010). Likewise, biochar can influence chemical properties of soil through increased
surface area and added labile nutrients. Biochar addition to soil has been shown to alter
pH, electrical conductivity (EC), cation exchange capacity (CEC), nutrient retention
and nutrient availability (Gundale and DeLuca, 2007). Therefore, with all these possible
changes that can accrue in soil because of biochar addition, understanding the
interaction between biochar loading rates, soil properties and the microbial community
61
therein is needed to better model the effect of biochar and its implications on soil
function.
The high porosity, surface area and CEC of biochar could improve the habitat for soil
microorganisms and plant roots (Atkinson et al., 2010). Application of biochar could
also improve moisture retention in lighter soils and water infiltration in heavier soils.
Improving hydraulic conductivity and other physical characteristics in soil provides
suitable conditions for chemical interactions and subsequent enhancement of microbial
activity (Chen et al., 2017). Furthermore, because biochar has high resistance to
microbial degradation; the impacts of biochar addition could persist in soil for a long
time. The use of biochar should be more beneficial in soils that have poor physical
characteristics such as sandy soils. The available evidence in the literature suggests that
in some situations biochar can contribute to soil structural stability and aggregation,
improve water retention, and increase porosity and surface area. Many studies also
indicate that better understanding of biochar effects in different soil types would assist
in using it for more effective management of different soil properties and so gain the
maximum benefit from its application (Sohi et al., 2010).
The impact of biochar on soil is complicated because of the wide range of biochar
effects on soil chemical properties due to variation in biochar chemical and physical
features. The effect of soil amendment will depend on the type of biochar and the
impact it can achieve in a given timescale (Unger et al., 2011). Biochar amendment and
its high surface area is often correlated with CEC enhancement which may increase the
availability and use efficiency of plant nutrients in some soils depending on biochar
specification. Also biochar can potentially increase pH in soil, which subsequently
influences many of the nutrient transformations and their availability to plants (Fowles,
2007). Soil pH may increase or decrease depending on the inherent pH and lime content
62
of the biochar itself (Lehmann et al., 2011). Biochar and other organic amendments
added to soil will probably increase nutrient storage in the rhizosphere in a form that is
available to plant uptake (Steiner et al., 2007). Biochar could significantly enhance crop
yield and quality by providing nutrient supply and an improved environment to plant
growth (Steiner et al., 2007; Unger et al., 2011). Although there is much evidence
highlighting advantages in using biochar as a soil amendment, the interaction between
biochar and soil needs to be explored to understand the complexity of biochar reactions,
especially in different soils utilised in agricultural regions.
Biochar could alter the biological processes in soil such as N mineralisation and
nitrification by affecting bacterial communities involved in these processes as well as
providing a suitable environment for overall increased microbial activity (Berglund et
al., 2004). It has been documented that biochar constitutes a large percentage of the
organic carbon in various soils but the exact nature of this component is still not well
understood (Zimmerman, 2010). Kolb et al. (2009) studied the effect of biochar
addition on microbial biomass and activity by adding biochar to four different soils
(Mollisol, Alfisol, Entisol, and Spodosol) at five application rates from 0 to 0.1 kg/kg
biochar-soil. The result showed a significant increase in both microbial biomass and
activity with increasing application rates. The study also showed similar patterns of
biochar impact on microbial biomass, microbial activity and nutrient availability in all
four soils but the microbial response was diverse, dependent on the differences of
nutrient availability in each soil (Kolb et al., 2009).
Biochar addition has a significant impact on chemical and physical properties which
also affect the biochemical processes and microbial functions in soil. However, the
relationships between microbial activity, biological processes and changes in chemical
and physical properties resulting from biochar addition are still not well understood.
63
Because biochar may react differently in soils having different physiochemical
properties varying the loading rate ought to show how various soil physiochemical and
biological properties are subsequently impacted. Thus the aim of this study was to
evaluate the effect of different loading rates of biochar in three different soils.
2. Materials and methods
2.1. Soil collection and processing
Three different topsoils (0 – 20 cm depth) were collected for this experiment. Red
Loam Dermosol topsoil (RL: clay 21.61%, silt 22.81% and sand 55.58%) was collected
from a farm near Cambridge, Tasmania (42° 48.11.77’S 147° 26.22.03’E). Brown
Sandy Loam Kurosol topsoil (BSL: clay 10.43%, silt 9.43% and sand 80.14%) was
collected from the headland in an apple orchard at Mountain River, located in the Huon
Valley region of southern eastern Tasmania (42° 57.2.91’S 147° 55.2.13’E). Black Clay
Loam Vertosol (BCL: clay 28.67%, silt 24.35% and sand 46.98%) topsoil was collected
from the forested slopes of Mt Nelson near Bend 3 of Mt Nelson Road, located near the
University of Tasmania in Hobart, Tasmania (42° 54. 25.92' S 147° 19.22.35 ’E). All
soils were placed in plastic containers and taken to the laboratory for immediate water
content measurements. Subsamples of the soils were kept frozen at -20C for biological
analysis. The remaining soils were prepared by removing gravel before being mixed
with biochar for the subsequent pot experiment.
64
2.2. Biochar specifications
Biochar used in this experiment was sourced from eucalypt green waste (Black Earth
Products, Qld, Australia). The biochar was produced in an updraft rotary hearth gasifier
operating with a peak temperature of 650 - 750 °C (feedstock dependant) with oxygen
limited atmosphere and residence times not longer than 3 minutes (most typically
around 100 seconds). A typical chemical profile of this biochar is shown in Table 3.1.
Biochar analysis was conducted by Diagnostic and Analytical Services (DAS) in the
Department of Primary Industries, Wollongbar NSW 2477 Australia.
65
Table 3.1: Chemical analysis showing the specification of biochar produced at Black
Earth Products, QLD Australia
Parameters Value
EC (dS/m) 0.27
pH (CaCl2) 7.3
Total Nitrogen (%) 0.26
Total Carbon (%) 79
KCl Extractable Ammonium-N (mg/kg) <0.3
KCl Extractable Nitrate-N (mg/kg) 0.41
CaCO3 (%) 2.4
Total Phosphorus (mg/kg) 390
Water Soluble Phosphorus (%) 64
Citrate Insoluble Phosphorus (mg/kg) 230
Citrate Soluble Phosphorus (mg/kg) 90
Available Phosphorus (mg/kg) 150
Aluminium (meq/100g) < 0.1
Calcium (meq/100g) 9.2
Potassium (meq/100g) 2.9
Magnesium (meq/100g) 1.8
Sodium (meq/100g) 1.1
CEC (meq/100g) 15
Calcium/Magnesium Ratio 5.2
Boron (mg/kg) 6.1
Chromium (mg/kg) 450
Copper (mg/kg) 12
Iron (%) 0.71
Manganese (mg/kg) 180
Sulfur (mg/kg) 80
Zinc (mg/kg) 200
66
2.3. Experimental design and biochar addition
Biochar was added to the three soils described above at 0%, 2.5%, 5%, 10% (wt/wt),
specifically 0, 32.5, 65 and 130 g biochar to a total of 1300 g soil, thoroughly mixed
and placed into 1.5 litres pots. Each biochar- soil combination was replicated four times
to give a total of 48 pots. Pots were arranged randomly and left exposed to the natural
elements for 10 months outside the teaching glasshouse complex at the School of Land
and Food at UTAS. The annual mean maximum and minimum temperature is 19.9°C
and 8.3°C, respectively, while the mean annual rainfall is 613.3 mm (Hobart Ellerslie
Road Weather Station, Lower Derwent Tasmania).
2.4. Chemical and physical analyses
After 10 months incubation, soil samples were taken from the pots for gravimetric
water content measurements and chemical analysis. Soil chemical analysis was
conducted by CSBP Laboratories, Western Australia. Properties analysed included
organic carbon (Walkley-Black), total nitrogen, available phosphorus (Colwell),
available potassium (Colwell), sulphur (KCl 40), ammonium nitrogen, nitrate nitrogen,
electrical conductivity, pH (H2O) 1:5, pH (CaCl2) 1:5, micronutrients (DTPA: copper,
zinc, manganese, iron) and boron (Hot CaCl2), exchangeable cations (calcium,
magnesium, sodium, potassium, aluminium) and particle size (pipette and sieving
method). Chemical and physical data were statistically analysed by Multivariate
analysis of variance (MANOVA) using SPSS v22 to assess the effect of biochar
addition on soil properties compared to the unamended control treatments.
67
2.5. Soil biomass assessment
Soil bacterial numbers as total viable counts (TVC) were estimated from colony
forming units (CFUs) on 10% tryptone soy agar plates incubated at 25ºC for 21 days
(Juhnke et al., 1987). Soil biomass was estimated from extracted DNA (n=4 replicates
for each treatment) with quantities estimated via the Nanodrop spectrophotometer
instrument (NanoDrop 8000 Spectrophotometer, Thermo Fisher Scientific Inc.,
Wilmington, DE 19810 U.S.A.) which is used as an alternative method to estimate
microbial biomass (Marstorp et al., 2000; Bouzaiane et al., 2007).
2.6. Potential nitrification assay
Potential nitrification was assayed by using ammonium sulphate as a substrate as
described by Kandeler (1995), soil samples from each treatment replicate were
incubated at 25ºC for 5 h. After incubation, the nitrite released during the incubation
was extracted with potassium chloride and determined using spectrophotometry at 520
nm using a SPECTRO star Nano plate reader (BMG Labtech, Mornington, VIC
Australia).
2.7. Soil community level metabolic profiles
Microbial metabolic capacity of the soil communities was determined by examining the
ability to utilize a variety of carbon sources. This was done using Biolog EcoPlates as
described by Garland and Mills (1991) and Frąc et al. (2012). Eco Plates with 96 wells
containing 31 triplicated carbon sources and a control (water) were prepared by
68
suspending 1 g soil in 99 ml sterilised water, and 120 μl of each soil suspension then
aliquoted into each well. Plates were incubated at 25°C for 7 days. Absorbance at 590
nm from all 96 wells was measured daily using a SPECTROstar Nano plate reader. The
data was compiled and analysed in the program PRIMER 6 + PERMANOVA (Primer-
E Ltd, Plymouth UK) using analysis of similarity (ANOSIM), canonical analysis of
principal coordinates (CAP) and permutation analysis of variance (PERMANOVA).
For this the data was square root transformed and converted to Bray-Curtis similarity
values. ANOSIM was used for a priori analysis of factors (biochar loading, soil type,
time of incubation) followed by PERMANOVA analysis using unrestricted permutation
of the data with 9999 permutations assuming a type III (unbalanced) design. The rate
and pattern of the overall microbial carbon source utilisation was expressed by the
average well-colour development (AWCD), richness (R) and Shannon–Weaver index
(H) (Garland, 1997; Gomez et al., 2004). To reduce the complexity of interpreting the
data, carbon substrates were divided into five groups: (1) carbohydrates; (2) carboxylic
and acetic acids; (3) amino acids; (4) polymers; and (5) amines and amides according to
Weber and Legge (2009) and presented as a percentage of the total absorbance values
for each treatment.
3. Results
3.1. Chemical and physical properties
The addition of different rates of biochar to different soils had a significant impact on
selected chemical and physical properties in soil. These differences were dependent on
the soil type and the amount of biochar added to that soil.
69
3.1.1. Ammonium and nitrate nitrogen in soil
The interaction between soil type and biochar loading rate had a significant negative
impact on exchangeable ammonium (p=0.02) and positive impact on soluble nitrate
(p=0.012) contents. In the BCL, exchangeable ammonium decreased by 32%, 53% and
61% respectively with increasing biochar loading rates (2.5%, 5% and 10%) compared
to the untreated control as shown in Fig. 3.1A. The NO3-N content increased
dramatically by 103%, 110% and 207% with increasing biochar loading rates (Fig.
3.1B). To a lesser extent the same trends were observed with the BSL and RL soils,
especially when the ammonium levels were higher in the 10% biochar applications.
However, no significant differences in soluble nitrate contents were observed between
the biochar treatments in the BSL or RL topsoils.
70
Figure 3.1: (A) ammonium nitrogen (mg/kg) and (B) nitrate nitrogen (mg/kg) in a
Black clay loam (BCL), Red loam (RL) and Brown sandy loam (BSL) soil containing
different biochar loading rates (0 to 10% wt/wt). Errors bars are standard deviation from
four replicate soil pots.
0
5
10
15
20
25
30
35
0% 2.5% 5% 10%
Am
mo
niu
m N
itro
gen
(m
g/K
g)
Biochar loading rates (%)
A
Black Clay Loam
Red Loam
Brown Sandy Loam
0
5
10
15
20
25
30
35
0% 2.5% 5% 10%
Nit
rate
Nit
roge
n (
mg/
Kg)
Biochar loading rates (%)
B
Black Clay Loam
Red Loam
Brown Sandy Loam
71
3.1.2. Total carbon and total nitrogen
Biochar loading rates had a very significant effect on the total carbon in all three soils
(p<0.001). Total carbon increased with increasing amount of biochar added to each soil
as shown in Fig. 3.2A. There was no significant effect on total nitrogen in the BCL or
the BSL after the biochar applications, whereas the results illustrated that the additions
of different loading rates of biochar to the RL significantly reduced total nitrogen
(p=0.007) content after 10 months (Fig. 3.2B).
Figure 3.2: (A) Total carbon (%) and (B) total nitrogen (%) in a Black clay loam
(BCL), Red loam (RL) and Brown sandy loam (BSL) soil containing different biochar
loading rates (0 to 10% wt/wt). Errors bars are standard deviation from four replicate
soil pots.
0
2
4
6
8
10
12
14
0% 2.5% 5% 10%
Tota
l Car
bo
n (
%)
Biochar loading rates (%)
A
Black Clay Loam
Red Loam
Brown Sandy Loam
0
0.1
0.2
0.3
0.4
0.5
0.6
0% 2.5% 5% 10%
Tota
l Nit
roge
n (
%)
Biochar loading rates (%)
B
Black Clay Loam
Red Loam
Brown Sandy Loam
72
3.1.3. Colwell phosphorus and potassium
There was no significant impact of biochar loading rate on Colwell phosphorus or
potassium in the RL, however biochar addition did affect phosphorus in the BSL
(p=0.041) and potassium in the BCL (p=0.028) (Fig. 3.3). In the BSL, Colwell
phosphorus decreased with the 2.5% and 5% biochar treatments but increased with the
10% biochar treatment compared to the untreated control (Fig. 3.3A). Colwell
potassium content in the BCL increased gradually from 174 mg/kg in the control
treatment (biochar 0%) to reach 204 mg/kg at the highest level of biochar loading
(10%).
73
Figure 3.3: (A) Colwell phosphorus and (B) Colwell potassium (mg/kg) in a Black clay
loam (BCL), Red loam (RL) and Brown sandy loam (BSL) soil containing different
biochar loading rates (0 to 10% wt/wt). Errors bars are standard deviation from four
replicate soil pots.
0
2
4
6
8
10
12
14
16
18
20
0% 2.5% 5% 10%
Ph
osp
ho
rus
Co
lwe
ll (m
g/kg
)
Biochar loading rates (%)
A
Black Clay Loam
Red Loam
Brown Sandy Loam
0
100
200
300
400
500
600
700
800
0% 2.5% 5% 10%
Po
tass
ium
Co
lwe
ll (m
g/kg
)
Biochar loading rates (%)
B
Black Clay Loam
Red Loam
Brown Sandy Loam
74
3.1.4. Soil pH and electrical conductivity
Soil pH (Fig. 3.4) was significantly increased in the BSL, increasing from pH (CaCl2)
4.50 in the control treatment to 4.60, 4.72 and 4.83 at the 2.5%, 5% and 10% biochar
loading rates respectively (p=0.001). The same pattern was found in the RL where pH
level was 4.60, 4.67, 4.90 and 4.98 at the 0%, 2.5%, 5% and 10% biochar rates,
respectively (p<0.001). In the BCL the effect of biochar loading rate was less
significant (p=0.037) compared to the BSL and RL soils. The pH level increased from
4.90 at the 0% biochar treatment to 5.00 at the higher loading rates 10% biochar. No
significant differences were observed in EC in the BCL or the BSL while a slight
decrease was observed in the RL within the biochar treatments (p=0.049) as shown in
Fig. 3.5.
75
Figure 3.4: Soil pH (CaCl2) in a Black clay loam (BCL), Red loam (RL) and Brown
sandy loam (BSL) soil containing different biochar loading rates (0 to 10% wt/wt).
Errors bars are standard deviation from four replicate soil pots.
Figure 3.5: Electric conductivity (dS/m) in a Black clay loam (BCL), Red loam (RL)
and Brown sandy loam (BSL) soil containing different biochar loading rates (0 to 10%
wt/wt). Errors bars are standard deviation from four replicate soil pots.
y = 0.0325x + 4.85R² = 0.786
y = 0.135x + 4.45R² = 0.9529
y = 0.11x + 4.3875R² = 0.9979
4.1
4.2
4.3
4.4
4.5
4.6
4.7
4.8
4.9
5
5.1
0% 2.5% 5% 10%
pH
Le
vel (
CaC
l2)
Biochar loading rates (%)
Black Clay Loam
Red Loam
Brown Sandy Loam
0
0.01
0.02
0.03
0.04
0.05
0.06
0.07
0.08
0.09
0.1
0% 2.5% 5% 10%
EC (
dS/
m)
Biochar loading rates (%)
Black Clay Loam
Red Loam
Brown Sandy Loam
76
3.1.5. Soil moisture content
There was a significant impact of different biochar levels on water content in all three
soils (p=0.016), especially at 10% biochar application in the RL and BSL (Fig. 3.6).
Soil water content was increased by 10% in the BCL at the higher rate of biochar, while
no significant increase was observed at 2.5% and 5% biochar. The BSL and RL showed
the same trend where the water content was increased by 22% in the BSL and by 19%
in the RL at 10% biochar compared to the corresponding control.
Figure 3.6: The effect of biochar loading rates (0 to 10% wt/wt) on moisture content
(%) in a Black clay loam (BCL), Red loam (RL) and Brown sandy loam (BSL) soil.
Errors bars are standard deviation from four replicate soil pots.
0
5
10
15
20
25
30
35
40
45
0% 2.5% 5% 10%
Mo
istu
re c
on
ten
t (%
)
Biochar loading rates (%)
Black Clay Loam
Red Loam
Brown Sandy Loam
77
3.1.6. Exchangeable cations and cation exchangeable capacity (CEC)
The results in Table 3.2 show no significant effects were measured in the level of
exchangeable cations in the BCL except for potassium which increased significantly by
8% and 16% at 5% and 10% biochar application levels (p=0.001). On the other hand,
exchangeable aluminium, calcium and sodium were significantly affected by the
addition of different biochar levels in both the BSL and the RL. Exchangeable calcium
and sodium were increased by 19% and 28% in the BSL and by 9% and 14% in the RL
respectively at 10% biochar application levels, whereas exchangeable aluminium
decreased by 68% in the BSL and by 66% in RL at 10% biochar rates compared to the
untreated control. Exchangeable magnesium increased (p=0.02) in the RL soil with the
higher biochar loading rates, but no significant impact was found in either the BCL or
the BSL. The results in Table 3.2 also indicated that biochar addition had a potential
impact on the CEC. The main differences were found in the BSL where the CEC
increased by 4% at 2.5% biochar treatment, 7% at 5% biochar and 14% at 10% biochar
loading rate. CEC was slightly increased in the RL mainly in the 10% biochar treatment
while no differences were found between biochar application rates in the BCL.
78
Table 3.2: The effect of biochar loading rates (0 to 10% wt/wt) on exchangeable cations (Ca, Mg, Na, K, Al), and cation exchange capacity
(CEC) in a Black clay loam (BCL), Red loam (RL) and Brown sandy loam (BSL) soil.
Soil Type Biochar loading
rates (%)
Exc. Al
(meq/100g)
Exc. Ca
(meq/100g)
Exc. Mg
(meq/100g)
Exc. K
(meq/100g)
Exc. Na
(meq/100g)
CEC
(meq/100g)
BCL 0% 0.119 21.01 9.43 0.42 0.29 31.14
2.5% 0.108 20.71 9.29 0.42 0.26 30.67
5% 0.111 20.67 9.27 0.45* 0.25 30.65
10% 0.097 21.11 9.29 0.48** 0.26 31.14
RL 0% 0.158 8.99 2.68 1.51 0.14 13.33
2.5% 0.085** 9.42 2.74 1.48 0.14 13.77
5% 0.089** 9.44 2.80** 1.53 0.15 13.93*
10% 0.054** 9.81** 2.77* 1.51 0.16* 14.24**
BSL 0% 0.186 2.91 1.34 0.21 0.07 4.54
2.5% 0.134** 3.05 1.37 0.23 0.08 4.73
5% 0.091** 3.19** 1.37 0.23 0.09** 4.88**
10% 0.060** 3.48** 1.39 0.23 0.09** 5.19**
** High significant between means (p<0.01), * significant between means (p<0.05)
79
3.1.7. Micronutrients
The manganese level (Table 3.3) was decreased by biochar application in BCL (p=0.044) and
in the BSL (p<0.001). Biochar addition had no significant impact on manganese in the RL.
Zinc increased with increasing biochar level in both the black clay and sandy loams (p<0.001)
but no differences were observed in the RL. Copper and iron content in soils varied
dependent on soil type and biochar level. In the BCL, no significant impact was found for
copper while iron was significantly different between biochar treatments as shown in Table
3.3. Iron increased by 6% in the 2.5% biochar treatment and decreased by 13% at 10%
biochar rates (Table 3.3). Significant differences were found for copper (p=0.019) and iron
(p=0.002) in the BSL, copper decreased by 16% while iron decreased by 19% at 10% biochar
level compared to the control. No significant effect was found on iron content in the RL,
however slight differences in copper were found (p=0.038) between biochar treatments, with
copper reduced by 10% in the RL at 10% biochar treatment compared to the untreated control
(Table 3.3). Biochar loading rate had a highly significant impact (p<0.001) on boron in the
BSL but no differences were found in the other two soils. The results in Table 3.3 show that
boron increased by 19% at 2.5 biochar, 32% at 5% biochar and by 40% at 10% biochar
application in the BSL.
80
Table 3.3: The effect of biochar loading rates (0 to 10% wt/wt) on soil micronutrients (Mn,
Zn, Cu, Fe, B) in a Black clay loam (BCL), Red loam (RL) and Brown sandy loam (BSL) soil
Soil Type Biochar
loading rates
(%)
DTPA
Mn
(mg/kg)
DTPA
Zn
(mg/kg)
DTPA
Cu
(mg/kg)
DTPA
Fe
(mg/kg)
Hot CaCl2
B
(meq/100g)
BCL 0% 58.07 20.93 2.71 191.09 1.05
2.5% 45.51 21.98 2.66 201.88 0.97
5% 40.71 23.21 3.01 191.93 1.06
10% 34.12* 25.81** 3.08 167.18* 1.05
RL 0% 37.06 6.23 3.19 197.78 0.97
2.5% 35.43 11.84 3.23 204.54 0.96
5% 34.27 9.45 3.08 212.79 0.95
10% 32.23 18.04 2.86* 190.81 1.01
BSL 0% 9.43 2.68 2.62 108.39 0.29
2.5% 7.41* 3.74 2.26 100.47 0.34*
5% 6.49** 4.26* 2.21* 98.15 0.38*
10% 5.43** 6.38** 2.20* 87.37* 0.40**
** High significant between means (p<0.01), * significant between means (p<0.05)
81
3.2. Microbial biomass
The total viable count (TVC) results (Fig. 3.7) showed no significant effect of biochar
loading rate for the BCL. Furthermore, no effect was observed on TVCs in BSL at the two
lower biochar rates but the addition of biochar at 10% reduced TVCs compared to controls.
On the other hand, biochar addition enhanced TVCs at 2.5% and 5% but not the 10% biochar
levels in the RL compared to the untreated control. The higher rate of biochar reduced TVC
in the BSL soil.
Soil microbial biomass was also estimated from the amount of DNA extracted at the
beginning of the experiment and after 10 months incubation with the different levels of
biochar (Fig. 3.8). The amount of DNA extracted from the BCL and BSL was higher in the
10% biochar (approximately 21 ng /µl for both soils) compared to initial samples (17.6 ng /µl
from BCL and 13.0 ng /µl from BSL) and 0% biochar treatments (19.2 ng /µl from BCL and
16.32 ng /µl from BSL). The amount of DNA extracted from the RL soil was significantly
higher compared to the BCL and BSL, the higher quantity of DNA was observed in soil taken
from the 0% biochar (25.0 ng /µl) to 5% biochar (26.2 ng /µl) compared to initial samples.
82
Figure 3.7: Microbial enumeration of bacteria in a Black clay loam (BCL), Red loam (RL)
and Brown sandy loam (BSL) soil containing different biochar loading rates (0 to 10%
wt/wt). Counts are from plates assessed after 1 week and after 2 weeks. Errors bars are from
counts from three replicate soil pots.
Figure 3.8: Soil microbial biomass as DNA extracted from a Black clay loam (BCL), Red
loam (RL) and Brown sandy loam (BSL) soil containing different biochar loading rates (0 to
10% wt/wt) with quantities estimated via the Nanodrop spectrophotometer. Errors bars are
standard deviation from four replicate soil pots.
55.5
66.5
77.5
88.5
99.5
Log
CFU
/g s
oil
Biochar level in soil (plate count incubation time)
Black Clay Loam
Red Loam
Brown Sandy Loam
0
5
10
15
20
25
30
35
Zero time Biochar 0% Biochar 2.5% Biochar 5% Biochar 10%
DN
A q
uan
tity
(n
g/u
l)
Biochar loading rates (%)
Black Clay Loam
Red Loam
Brown Sandy Loam
83
3.3. Potential nitrification
Biochar and its interaction with the different soils had a significant impact on potential
nitrification, which was used to estimate the abundance and activity of the ammonium
oxidizer bacteria and archaea (p=0.011). Generally, the BSL showed the highest nitrification
rates compared to BCL and RL except at the 10% biochar treatment level (Fig. 3.9). Potential
nitrification seemed to have the same patterns in the RL and BSL where nitrification rates
increased at the 2.5% biochar treatments compared to control (0% biochar). However, no
significant differences were observed between different biochar loading rates in the BCL.
Figure 3.9: Potential nitrification rates (ng NO2-N/g Soil/5h) in a Black clay loam (BCL),
Red loam (RL) and Brown sandy loam (BSL) soil containing different biochar loading rates
(0 to 10% wt/wt). Errors bars are standard deviation from four replicate soil pots.
0
500
1000
1500
2000
2500
3000
3500
4000
4500
5000
Biochar 0% Biochar 2.5% Biochar 5% Biochar 10%
Po
ten
tial
nit
rifi
cati
on
(n
g N
O2-
N/g
So
il/5
h)
Biochar loading rates (%)
Black Clay Loam
Red Loam
Brown Sandy Laom
84
3.4. Community level metabolic profiles
Biolog Ecoplates were used to evaluate whether biochar loading rate and soil type influence
microbial communities in the utilization rates of different carbon substrates. PERMANOVA
analysis revealed significant differences between substrate utilisation in relation to biochar
loading rates in a soil-type dependent manner. Both biochar loading rate and soil type
strongly interacted (p=0.0001, F=5.59) while no interaction occurred with time of incubation
(p >0.13). The BCL and BSL showed reduced rates of substrate utilization as biochar loading
levels increased while the opposite occurred for the RL. In the latter case, there was
pronounced increase in the utilisation of plant decomposition substrates and lipid analogs,
including α-cyclodextrin, cellobiose, xylose, methyl-β-glucoside, Tween 40 and Tween 80.
The AWCD (Fig. 3.10B) and R (Fig. 3.10C) showed the same patterns where the utilisation
of C substrates declined with increasing biochar loading rates in the BCL and BSL compared
to the control, however, C utilisation in the RL increased with increasing rate of biochar
compared to the control. No significant differences were observed between treatments in
terms of number of substrates utilised estimated from the Shannon–Weaver index (H) in all
the trial soils (Fig. 3.10A), however, there was strong correlation between H, AWCD and R
in the BCL (r= 0.65-0.92). There was also strong correlation between AWCD and R in the
RL (r=0.91) and BSL (r=0.98). A comparison between the major five carbon substrate groups
as shown in Fig. 3.11 indicated that the carbon utilisation had the same patterns among
treatments in all soils, suggesting that there are no large changes occurring in the microbial
community. However, there are difference in carbon utilisation especially in the amines and
amides in BCL (Fig. 3.11A) and polymers in the RL (Fig. 3.11B) compared to the control
which may indicate that biochar addition changes the functional diversity among treatments.
85
Figure 3.10: The effect of biochar loading rates (0 to 10% wt/wt) on carbon source
utilization presented as (A) Shannon–Weaver index (H), (B) Average well-color development
(AWCD) and (C) Richness (R) in a Black clay loam (BCL), Red loam (RL) and Brown sandy
loam (BSL) soil. Errors bars are standard deviation from three replicates.
0
1
2
3
4
5
6
7
Biochar 0% Biochar 2.5% Biochar 5% Biochar 10%
Shan
no
n–W
eav
er
ind
ex
(H)
A
Black Clay Loam
Red Loam
Brown Sandy Loam
0
0.005
0.01
0.015
0.02
0.025
Biochar 0% Biochar 2.5% Biochar 5% Biochar 10%
AW
CD
B
Black Clay Loam
Red Loam
Brown Sandy Loam
0
5
10
15
20
25
30
35
Biochar 0% Biochar 2.5% Biochar 5% Biochar 10%
Ric
hn
ess
(R
)
C
Black Clay Loam
Red Loam
Brown Sandy Loam
86
Figure 3.11: Comparison of total carbon source utilisation between amines & amides, amino
acids, carboxylic & acetic acids, carbohydrates and polymers in (A) Black clay loam (BCL),
(B) Red loam (RL) and (C) Brown sandy loam (BSL) soil containing different levels of
biochar (0 to 10% wt/wt).
0
20
40
60
80
100
Biochar 0% Biochar 2.5% Biochar 5% Biochar 10%Tota
l car
bo
n s
ou
rce
uti
lisat
ion
(%
)
A
Amines & amides
Amino acids
Carboxylic & acetic acids
Carbohydrates
Polymers
0
20
40
60
80
100
Biochar 0% Biochar 2.5% Biochar 5% Biochar 10%Tota
l car
bo
n s
ou
rce
uti
lisat
ion
(%
)
B
Amines & amides
Amino acids
Carboxylic & acetic acids
Carbohydrates
Polymers
0
20
40
60
80
100
Biochar 0% Biochar 2.5% Biochar 5% Biochar 10%Tota
l car
bo
n s
ou
rce
uti
lisat
ion
(%
)
C
Amines & amides
Amino acids
Carboxylic & acetic acids
Carbohydrates
Polymers
87
4. Discussion
Although only one biochar type was examined in this study, the results have shown that
biochar loading rate can affect soil physical, chemical and biological properties, but is also
influenced by soil type.
4.1. Soil chemical parameters
Biochar application had a significant impact on soluble ammonium and nitrate content in the
three soils as measured at the end of the 10 month experiment. The ammonium decreased
while nitrate increased with increasing biochar rate. This might be explained by improved
soil conditions in the 10% biochar loading, including measured improvements in soil pH and
soil moisture content, resulting in little mineralisable ammonium present after 10 months as it
was all converted to nitrate. While a potential nitrification test showed that the highest
biochar rates had significantly lower nitrification rates in the two lighter soils, nitrification
was otherwise unaffected or increased with biochar. Biochar produced by higher temperature
(> 600 °C) has the potential to adsorb both NH4+ and NO3
- ions due to net negative and
positive surface charges on biochar (Dempster et al., 2012b). However, it is commonly
reported that most biochars have a dominantly negative surface charge and hence NH4+
retention capacity (Lehmann et al., 2011). The ability of biochar to adsorb elements will more
likely depend on the nutrients and biochar properties (Yao et al., 2012).
The increase in total carbon with increasing application rates in all soils was predictable as a
result of the high C input with biochar application having a C:N ratio of 303. According to
Lehmann et al. (2011) and Nelson et al. (2011), addition of biochar tends to rapidly increase
decomposition rates of labile soil carbon, which requires utilisation of soil N; this may be the
88
reason for the observed reduction in total N in the RL. There was also a significant decrease
in the organic carbon, as measured by Walkley-Black method, in the BC at all rates of
biochar.
The results also showed an improvement in CEC after biochar addition in the two lighter
soils (RL and BSL) which has been reported in the literature (Uzoma et al., 2011). However,
there was no consistent improvement in available soil phosphorus and potassium with biochar
amendment. The effect of biochar on nutrient availability is influenced by biochar types
(feedstock and pyrolysis time and temperature) and its interaction with different soils. An
experiment conducted by Uzoma et al. (2011) to investigate the impact of cow manure
biochar on maize yield, nutrient uptake and physio-chemical properties of a dryland sandy
soil showed that cow manure biochar significantly increased soil pH, total C, total N, Oslen-P,
exchangeable cations and CEC in the soil. The lack of any consistent positive impacts of
biochar loading rate on available P and K levels observed in our study probably relates to the
initial P and K content in this soil and the low P and K levels in the biochar.
It is been widely documented that biochar amendment increases soil pH (Kimetu et al., 2008;
Chintala et al., 2014). The results of this study indicated that biochar additions increased soil
pH with increased loading rates, especially in the RL and BSL soils. This increase in soil pH
with increasing biochar application rates was expected due to the alkalinity of the biochar
used in this study (Chintala et al., 2014). Biochar amendment had no impact on EC except for
the strongly structured RL where EC was consistently reduced. This supports our suggestion
of greater leaching potential in the more strongly structured soils, i.e., ammonium leaching.
The impact of biochar and its interactions depend on biochar types and reactions in different
soils (Kookana et al., 2011; Lehmann et al., 2011) and its capacity to adsorb selective
nutrients (Novak et al., 2009a). The biochar additions may affect micronutrient content in soil
89
due to their sensitivity to changes in soil pH, soil porosity and aeration. Soil aggregation may
benefit from biochar additions to clay soils while sandy soils are also improved by the surface
area increases associated with biochar (Basso et al., 2013; Ulyett et al., 2014).
Our data showed that both available Fe and Mn generally decreased in the soils with
increasing biochar applications. These decreasing trends where most significant in the heavier
BCL and BSL soils, and this may relate to improved aeration and drainage in the soil as
biochar rates increased causing soluble iron and manganese oxides to precipitate. Also
Kumar and Babel (2011) indicated that micronutrients correlated positively with organic C in
soil but negatively with CaCO3 and soil pH. The biochar used in this experiment is both
alkaline and slightly calcareous.
Both copper and zinc were increased at the higher biochar application rates in the BCL soil.
Zinc also increased in both RL and BSL at all rates, but not copper. In fact copper was
reduced in those soils with the greatest pH increase. Zinc levels were 200 mg/kg in the
biochar and this might well explain the uniform increases measured. We interpret the mixed
story of some increases and some decreases in micro-nutrients as relating to the relative
impacts of biochar induced changes in pH, carbon and calcium carbonate levels as well as the
unmeasured impacts on the soils aeration and porosity. Hence it is not unreasonable to expect
that the modifications were induced by biochar amendments as they modify the soil
environment and the content and availability of micronutrients in soil.
90
4.2. Microbial biomass
Previous studies demonstrated that biochar addition to soil enhances microbial abundance
and activity (O'Neill et al., 2009; Bamminger et al., 2014; Gomez et al., 2014). However, our
results showed limited impact of biochar on microbial biomass, at least in the short term.
Noyce et al. (2015) studied soil microbial responses over 1 and 2 years following biochar
addition to a temperate forest soil, indicating that biochar had an inconsequential impact on
bacterial and fungal community composition, fungi/bacteria ratios, and microbial biomass.
The increase of soil pH after biochar addition normally is expected to enhance microbial
abundance in soil (Lehmann et al., 2011), however, biochar addition at high application rates
seemed to reduce microbial biomass which may be related to the reductions in organic matter
decomposition and N availability (Dempster et al., 2012a). The finding of this experiment
showed a reduction in N content with increasing biochar loading rates in RL which might be
as a result of N consumption by microorganisms during organic matter decomposition
(Lehmann et al., 2011; Nelson et al., 2011). The initial decomposition might be increased
after biochar addition to soil due to additional C and higher pH, then was limited by N
deplete by soil microorganism. While there is no fertiliser input, the nutrient content might be
reduced in soil and affect microbial abundance and activity. There are many factors involved
in the impact of biochar on microbial abundance and activity in addition to biochar C in
amended soil (Gomez et al., 2014). Carbon input following biochar application proportionally
affects microbial growth and activity; but the degree of change is likely to be dependent on
the initial soil nutrient content and C levels. This would explain the difference on biochar
effects observed in the different soils studied.
91
4.3. Potential nitrification
It has been well documented that biochar amendment to soil has the potential to improve
nitrification and consequently increase N availability to plants (Berglund et al., 2004; Ball et
al., 2010; Prommer et al., 2014). However, there is a risk of losing NO3- through leaching
from soil and denitrification activity. Biochar is considered to be beneficial in stimulating
nitrification and at the same time reducing N loss due to its physical and chemical
specifications (Dempster et al., 2012b; Yao et al., 2012). Our findings support this with
potential nitrification increased in biochar amended soils, especially in the BSL soil at the 2.5%
and 5% biochar loading rates. The nitrification enhancement and the biochar sorption
capacity are likely to have contributed to the reduction in NH4 and increase in NO3 with
increasing biochar loading rates. Nitrification seemed to be inhibited at the higher level of
biochar amendment which may be related to the high C/N ratio (Bengtsson et al., 2003)
followed biochar amendment which in turn led to inorganic N immobilisation and reduction
of ammonium oxidation activity (Song et al., 2014). The impact of biochar on the C and N
pools in soil may vary depending on the biochar properties. As stated by Zhang et al. (2015),
biochar produced at high temperature (> 400°C), such as used in this study, has the potential
to add more stable C to the soil thus decreasing CO2 emission, and increasing NH4 sorption
capacity and soil pH and CEC. However, biochar produced at lower temperatures provides
labile C useable by microorganism and that may temporarily enhance biological N
transformation. Therefore, biochar specifications should be taken into consideration to
maximise the benefit of biochar when used as a soil amendment. Biochar produced at high
temperature may improve N usage efficiency, nutrient retention and alter N and C
transformations (Zhang et al., 2015).
92
4.4. Community Level Metabolic Profiles
It has been well documented that carbon availability plays an important role in microbial
growth and activity (Alden et al., 2001; Yoshitake et al., 2007). Therefore, application of
organic amendments not only affects the soil chemical and physical properties, it also
enhances microbial function and activity related to nutrient cycling (Ros et al., 2006).
Biochar is a very stable form of carbon which is resistant to microbial degradation, thus the
available carbon used by soil microorganisms is more likely to be from different sources. A
study conducted by Dempster et al. (2012a) showed that the addition of 25 t ha-1 biochar
altered the community metabolic profiles, however, the change in the ammonia oxidising
bacterial community occurred only when a source of N was combined with biochar
application. The results here showed a decrease in microbial activity through the reduction of
organic matter decomposition and N mineralisation in soil, which might be due to the
decrease in microbial biomass. This may explain the decline in the C source utilisation in the
BCL and BSL soils. However, the metabolic profile in the RL increased with increasing
biochar rates, possibly due to the presence of other complex carbon sources present in this
soil. The native grass and root residues in the RL soil might explain the enhancement in C
substrate utilisation. Baudoin et al. (2003) stated that the root exudates stimulate bacterial
growth and increase microbial community. Different plant species and residues as organic
compounds in soil may increase the potential metabolic diversity (Baudoin et al., 2003).
5. Conclusions
The results of this study indicate that the interaction between different soil types and biochar
loading rates had a significant impact on the NH4-N and NO3-N content, especially in BCL
93
soil. A highly significant effect was observed on total C in all three soils with no impact
observed on total N except in the RL soil. Soil pH was significantly increased with increasing
biochar loading rates. No significant impact was observed on P and K availability, total
exchangeable base cations (TEB) and CEC in BCL. However, biochar addition had a
significant effect on exchangeable Al, Ca, Mg and Na in both the BSL and the RL soils.
Biochar addition had a limited effect on microbial biomass, however, the interaction between
biochar and different soils significantly affected the potential nitrification especially in RL
and BSL soils. There were significant differences in C substrates utilisation among biochar
treatments in the three different soils. The BCL and BSL showed reduction in substrate
utilization rates as biochar levels increased while the opposite occurred for the RL soil, which
indicated that biochar may influence the function and activity of the microbial community.
These results show that biochar can improve soil carbon content and increase pH but these
vary in different soils. High biochar loading rates may also influence nitrification and the
function and activity of microbial community in lighter soils. More studies are required for
better understanding of the interaction between biochar application and soil fertility under
different conditions and variables including biochar types and application rates, different soils,
fertiliser inputs and long-term application.
94
Chapter 4
Assessment of bacterial community composition,
methanotrophic and nitrogen cycling bacteria in three soils
with different biochar application rates
Abstract
The increased use of biochar as a soil amendment to alleviate the impact of agricultural
practices on climate change has been a motivation for many studies to determine the effects
of biochar on soil properties, particularly the abundance and activities of soil microbes and
related biological processes. This study investigates the impact of different application rates
of wood-derived biochar on community structure, nitrogen cycling and methanotrophic
bacteria in three soil types.
Biochar was added at 0%, 2.5%, 5% and 10% wt/wt to black clay loam (BCL, Vertosol), red
loam (RL, Dermosol) and brown sandy loam (BSL, Kurosol) soils. Soil chemical analysis
and 16S rRNA gene amplicon sequencing using the IIlumina Mi-Seq platform were
conducted on initial samples and after 10 months incubation.
The results indicated that the addition of biochar loading levels to the different soils had a
significant impact on NH4 and NO3, total C and N, pH, EC and soil moisture content. These
changes were reflected in significant differences in the bacterial diversity between biochar
treatments in the BSL and RL soils, while the BCL soil was more resilient to change.
Complete ammonia oxidizing (Nitrospira) and nitrite oxidizing bacteria (NOB) were more
abundant than standard ammonia oxidizing bacteria (AOB) in all soils. Increased biochar
loading raised the abundance of nitrifying bacteria in BCL soil while Nitrospira became more
95
abundant in BSL soil. Biochar addition affected the abundance of certain N2-fixer groups in a
soil dependent manner. Strong positive correlations were observed in Rhizobium (r=0.99) and
Azospirillum abundance (r=0.70) with increased biochar loading rates in BCL. Greater
biochar loading also significantly increased the relative abundance of methanotrophs,
especially in BCL soil.
The impact of biochar on community structure and nitrogen cycling bacteria depended on soil
types and biochar rates which correlated to the differences in soil properties. Overall, the
abundance of nitrogen cycling bacterial groups seemed to be most affected by the changes in
soil conditions, including aeration, C/N ratio, nutrients and pH in relation to biochar
application in different soils. These changes show short term biochar loading influences
community structure and leads to increases in populations of methanotrophic and nitrifying
bacteria.
1. Introduction
The increased use of biochar as a soil amendment to alleviate the impact of agricultural
practices on climate change has been a motivation for many studies to determine the positive
and negative impacts of biochar on soil properties, particularly the abundance and activities
of soil microbes and related biological processes (Lehmann et al., 2011). The main benefit of
biochar application is the ability to increase carbon storage and enhance soil fertility (Glaser
et al., 2002). However, understanding the interaction between biochar and biological
processes including the direct impact on soil microbes is still limited. Biochar may
significantly change the surface area, porosity and sorption capacity of soil (Kookana et al.,
2011), which alters appropriate habitats for soil microorganisms.
96
Previous studies indicated that biochar amendment enhances microbial populations and
activity in soil (Kookana et al., 2011; Abujabhah et al., 2016a), although these effects are
likely to be associated with changes in soil properties, specially soil pH, C/N ratio and CEC
after biochar application. The addition of different biochars also needs to be considered
(Chan et al., 2008). Specific biochars can influence physical and chemical characteristics in
soil (Gundale and DeLuca, 2007; Atkinson et al., 2010), which may affect the abundance and
activity of soil microbes. The complexity of all these factors involved requires a better
understanding in order to estimate the behaviour and reaction of soil microbes to better
inform biochar related applications. The impact of biochar addition on soil quality varies
depending on soil types and application rates. Kolb et al. (2009) studied the effect of biochar
addition on microbial biomass and activity in four different soils (Mollisol, Alfisol, Entisol,
and Spodosol) at five different rates from 0 to 0.1 kg/kg-1 biochar-soil. Their results indicated
that biochar increased the biomass and activity with increasing biochar loading. However, the
impact was still variable among the different soils tests, which was correlated with the
nutrient availability in each soil.
Different biochars, application rates and soil types may have various influences on microbial
communities. Biochar also may enhance the nitrogen input in soil by affecting biological
nitrogen fixation. Beck (1991a) demonstrated that biochar potentially affects Rhizobium
survival in soil and enhanced the growth and nodulation of plants by Rhizobium in biochar
amended soil.
The forms and availability of the nitrogen play an important role in soil fertility and
agricultural production. Nitrogen transformation processes in soil (immobilisation,
mineralisation, nitrification and denitrification) ordinarily are affected by microbes, and
changes in soil microbial community structure and activity can dramatically influence the
nitrogen status in soil. Ball et al. (2010) conducted an experiment to examine the influence of
97
fire history on the total and potential nitrification rates and the nature and abundance of
ammonia oxidizing bacteria in forest soil. This study showed that a 12 year old wildfire
resulted in higher content in soil charcoal and also nitrification rates compared with soils
impacted by older wildfires in other sites. Greater abundances of ammonia oxidizing bacteria
were also observed compared with control soils, which might be the main reason for
increased nitrification rates. Biochar can alter the biological processes related to the nutrient
cycles by affecting the microorganisms involved in these processes as well as providing
suitable environments that result in increased microbial activity (Berglund et al., 2004).
The aim of this study was to determine the impact of biochar loading rates on bacterial
communities in different soils and to better understand the interactions between different
factors involved in the biology and fertility of biochar-amended soils. To do this a pot
experiment was conducted to investigate the impacts of biochar on selected soil parameters
and biological processes in three different textured soils. Previous results from this
experiment (Abujabhah et al., 2016b) indicated that biochar can improve soil carbon content
and increase pH but results differed with soil type. High biochar loading rates also influenced
nitrification and the function and activity of microbial communities, especially in the lighter
black sandy loam soil (Abujabhah et al., 2016b). This work investigates the impact of biochar
application rates on bacterial community composition, methanotrophic and nitrogen cycling
bacteria in the three different amended soils.
2. Materials and methods
2.1. Soil collection and biochar specifications
Soil samples were collected from a previous experiment conducted by Abujabhah et al.
(2016b) to investigate the impact of different loading rates of biochar in three different acidic
98
topsoils: black clay loam Vertosol (BCL), loamy red Dermosol (RL) and brown sandy loam
Kurosol (BSL). Biochar used in this experiment was sourced from eucalypt green waste
(Black Earth Products, Qld). The biochar was produced in an updraft rotary hearth gasifier
operating with a peak temperature of 650 - 750 °C (feedstock dependant) with oxygen limited
atmosphere and residence times not longer than 3 minutes (most typically around 100
seconds).
2.2. Experimental design and biochar addition
Biochar was added at 0%, 2.5%, 5%, 10% (wt/wt) to the three different soils (BCL, RL and
BSL), specifically 0, 32.5, 65 and 130 g to total of 1300 g soil. The biochar and soil
combination was mixed and filled into 1.5 litres pots exposed to the natural elements for 10
months. The annual mean maximum and minimum temperatures were 19.9°C and 8.3°C
respectively, while the mean annual rainfall is 613.3 mm according to Hobart (Ellerslie Road)
Weather Station, Lower Derwent, Tasmania. Each biochar- soil treatment was replicated four
times and randomly arrayed in a total of 48 pots.
2.3. Soil and biochar chemical analysis
Soil samples were taken from the pots after 10 months incubation for instant water content
measurements and chemical analysis. Soil chemical analysis was conducted by CSBP
laboratories, Western Australia. Selected soil parameters were analysed including C
(Walkley-Black extract), total N (Elemental Analyser - Leco), available P and K (Colwell
extract), S (KCl at 40°C extract), NH4-N, NO3-N, EC, pH (1:5 Soil:H2O extract), pH (0.01 M
99
CaCl2), micronutrients (DTPA extract) and B (Hot CaCl2 extract), exchangeable cations and
particle size (pipette and sieving method) to estimate the potential changes in the three soils
after biochar amendments. These results were reported previously in Abujabhah et al.
(2016b). Biochar analysis was conducted by Diagnostic and Analytical Services (DAS) in the
Department of Primary Industries, Wollongbar NSW 2477 Australia.
2.4. DNA extraction, 16S rRNA gene amplicon Illumina MiSeq sequencing and bioinformatics analysis
DNA was extracted from soil at the initial time before incubation and after 10 months using
PowerSoil DNA Isolation Kit (MO BIO Laboratories, Inc) by following the provided
protocol. Extracted DNA (n=4 replicates for each treatment) was checked for quality at
260/280 nm and quantified via Nanodrop spectrophotometer (NanoDrop 8000
Spectrophotometer, Thermo Fisher Scientific Inc., Wilmington, DE 19810 U.S.A.). Sequence
analysis was performed at the Ramaciotti Centre for Genomics (Kensington, NSW, Australia)
where the 16S rRNA genes were amplified using 12 bp tagged universal primers 27F
(AGAGTTTGATCMTGGCTCAG) -519R (GWATTACCGCGGCKGCTG) (Lane et al.,
1985; Lane, 1991; Caporaso et al., 2012). Sequencing was performed using the Illumina
MiSeq platform according to standard protocols generating 300 bp pair-ended reads. All
reads were filtered based on quality scoring, trimmed of the tag regions, chimera checked
using QIIME. 16S rRNA gene sequence reads were classified and binned using the
BaseSpace cloud server (https://basespace.illumina.com/) 16S rRNA Metagenomics App
(Illumina Corp. Proprietary 15055860A). In this process reads were classified systematically
to phylum, class, order, family, genera and species against the curated Greengenes 16S rRNA
reference (McDonald et al., 2011) database – May 2013 update using an adaptation of the
100
Bayesian algorithm devised by Wang et al. (2007). The sequence data obtained in this study
were deposited in the EMBL database under the accession number: PRJEB8837.
2.5. Statistical analysis
Soil chemical parameters were statistically tested using SPSS v22 to assess the effect of
biochar additions on soil properties comparing to an unamended control treatment. PRIMER6
and PERMANOVA+ (version 6.1.12 and version 1.0.2; Primer-E, Ivybridge, UK),
respectively were used to conduct permutation multivariate analysis of variance
(PERMANOVA) (Anderson et al., 2005), and canonical analysis of principal coordinates
(CAP) (Anderson and Willis, 2003). Distance-based linear models (DistLM) and distance-
based redundancy analysis (dbRDA) were also used to assess the microbial community
compositions and the interaction with soil parameters in biochar amended soils. For sequence
read analysis, the data was organised at the lowest taxonomic level possible (usually genus to
family) and normalised as percentages, square root transformed and a resemblance matrix
created by calculation of Bray-Curtis coefficients. PERMANOVA was conducted using
default settings with 9999 permutations, while CAP was conducted using default settings.
The PERMANOVA derived significance values were considered significant when P < 0.01,
while 0.01 < P < 0.05 were considered only marginally significant.
3. Results
3.1. Soil and biochar physicochemical properties
Soil sample analysis previously investigated in experiments detailed by Abujabhah et al.
(2016b) focussed on changes in soil chemistry and broad biological factors (soil biomass and
101
substrate utilisation). The essential findings indicated that the addition of different rates of
biochar to different soils had a significant impact on NH4 and NO3, total C and N, pH, EC
and soil moisture content. No significant impacts were observed on soluble P and K or
exchangeable cations or CEC in BCL soil except exchangeable K; however; biochar addition
had a significant effect on exchangeable Al, Ca, Mg and Na in BSL and RL soils (Abujabhah
et al., 2016b). Basic parameters of the soil and biochar used in this study are illustrated in
Table (4.1).
102
Table 4.1: Selected parameters in black clay loam (BCL), red loam (RL) and brown sandy
loam (BSL) soils amended with different rates of biochar (0%, 2.5%, 5% and 10%) and the
wood-derived biochar tested in this study.
Total N
(%)
Total C
(%)
NH4-N
(mg/Kg)
NO3-N
(mg/Kg)
pH
(CaCl2)
EC
(ds/m)
CEC
(meq/100g)
BCL-0% 0.51 9.03 21.5 7.5 4.9 0.080 31.14
BCL-2.5% 0.51 9.60* 14.5 15.2** 4.9 0.078 30.67
BCL-5% 0.51 9.94** 10** 15.8** 4.9 0.074 30.65
BCL-10% 0.50 10.82** 8.25** 23** 5.0* 0.077 31.14
RL-0% 0.48 4.87 3 1 4.6 0.057 13.33
RL-2.5% 0.47 5.09* 4.25 1 4.7* 0.052 13.77
RL-5% 0.48 5.33* 4 1 4.9** 0.048* 13.93*
RL-10% 0.47 5.68** 5.25 1.5* 4.9** 0.040* 14.24**
BSL-0% 0.18 2.42 2 1 4.5 0.026 4.54
BSL-2.5% 0.19 2.65* 2 1 4.6* 0.023 4.73
BSL-5% 0.18 2.66* 2.5 1 4.7** 0.024 4.88**
BSL-10% 0.18 2.95** 2.5 1 4.8** 0.025 5.19**
Biochar 0.26 79 0.3 0.41 7.3 0.27 15
** Highly significant between means (p<0.01), * significant between means (p<0.05)
103
3.2. Microbial diversity
A total of 7,320,603 sequence reads for 16S rRNA Illumina pyrosequencing were obtained
from the soil with an average of 122,010 per sample. The bacterial diversity (Shannon index)
was higher in the initial sample compared to the control and biochar treatments in all three
soils (Table 4.2). Significant differences were observed in the bacterial diversity between
biochar treatments in the BSL and RL soils and slightly in BCL. However, Shannon index
values show that the diversity increased in the BSL soil with increasing biochar loading rates
compared to the control (0% biochar). The number of OTUs was higher in the RL soil with
an average of 1075 per sample compared to the BCL and BSL soils with an average of 951
and 929 respectively. Similar to Shannon index data, the numbers of OTUs were higher in the
initial samples compared to the biochar treatments as shown in Table 4.2. No differences
were observed in the number of OTUs between the biochar treatments and the control except
in BSL where the OTU numbers increased in the highest level (10%) of biochar addition
compared to the control. PERMANOVA and CAP analysis as shown in Fig. 4.1 indicated
that biochar application rates significantly affect the bacterial community structure in RL
(F=4.5601, p=0.0005) and BSL (F=2.4464, p=0.0005), however, less impact was observed in
BCL (F=1.8054, p=0.0136) compared to the other amended soils. Selected soil parameters
measured in the amended soils explained the total variation in the microbial community by
44.2% in BCL, 51% in RL and 35.1% in BSL soil (Fig.4.4). The changes in the microbial
community were strongly correlated to the selected soil chemical properties (R2=0.76 in BCL,
R2=0.87 in RL and R2=0.68 in BSL) in all amended soils. However, the soil variables seemed
to be more associated with the microbial community changes induced by biochar treatments
compared to the control in the lighter BSL soil, especially with pH (CaCl2), total C, C:N ratio
and CEC. While in the heavier soils the microbial community strongly correlated to NH4,
NO3 and pH (CaCl2) in the BCL and NH4, total C, pH (CaCl2) in the RL amended soil.
104
Overall, the results of DistLM and dbRDA analysis indicated that changes in microbial
community structure were strongly associated with the selected soil chemical parameters in
the amended soils.
105
Table 4.2: Bacterial diversity indices (average ± SD): Shannon index, Operational
Taxonomic Units (OTUs) and the number of sequence reads in black clay loam (BCL), red
loam (RL) and brown sandy loam (BSL) at different loading rates of biochar.
Soil Treatments Shannon Species Diversity OTUs Number of reads
BCL Initial sample 2.51 (±0.09) 1010 (±17) 122176 (±18396)
Biochar 0% 2.49 (±0.05) 934 (±20) 120964 (±11690)
Biochar 2.5% 2.47 (±0.02) 924 (±27) 115849 (±9514)
Biochar 5% 2.44 (±0.04) 946 (±29) 134840 (±26244)
Biochar 10% 2.40 (±0.04) 943 (±13) 127991 (±7564)
RL Initial sample 2.64 (±0.06) 1133 (±40) 125078 (±13755)
Biochar 0% 2.41 (±0.03) 1048 (±14) 126008 (±8759)
Biochar 2.5% 2.44 (±0.03) 1073 (±41) 133759 (±10894)
Biochar 5% 2.44 (±0.06) 1061 (±47) 129274 (±11344)
Biochar 10% 2.42 (±0.03) 1062 (±17) 124339 (±10520)
BSL Initial sample 2.46 (±0.04) 972 (±35) 114210 (±13489)
Biochar 0% 2.25 (±0.03) 915 (±21) 120166 (±8245)
Biochar 2.5% 2.27 (±0.02) 889 (±24) 114221 (±12268)
Biochar 5% 2.31 (±0.06) 894 (±27) 107040 (±10021)
Biochar 10% 2.41 (±0.04) 977 (±6) 114236 (±4679)
106
Figure 4.1: Canonical analysis of principal coordinate (CAP) plots showing impact of
biochar loading rates on bacterial community structure using 16S rRNA gene sequence
analysis data. Comparisons are shown between the initial soil samples, unamended control,
2.5% biochar, 5% biochar and 10% biochar -amended soils. The respective treatment
symbols are: ▲ Initial sample, ▼0% biochar, ■ 2.5% biochar, 5% biochar and 10%
biochar. Each symbol represents an individual soil sample. The assignment of replicates to
treatments was assessed using PERMANOVA in each of the soils.
(a) Black Clay Loam
(F=1.8054, p= 0.0136)
-0.4 -0.2 0 0.2 0.4 0.6
CAP1
-0.4
-0.2
0
0.2
0.4
0.6C
AP
2
(b) Red Loam
(F=4.5601, p= 0.0005)
-0.6 -0.4 -0.2 0 0.2 0.4 0.6
CAP1
-0.6
-0.4
-0.2
0
0.2
0.4
0.6
CA
P2
(c) Brown Sandy Loam
(F=2.4464, p= 0.0005)
-0.6 -0.4 -0.2 0 0.2 0.4 0.6
CAP1
-0.6
-0.4
-0.2
0
0.2
0.4
0.6
CA
P2
107
3.3. Bacterial community composition
The dominant bacterial group found at the phylum level was Proteobacteria in all soil groups,
with proportions ranging between 33- 36% as shown in Fig 4.2. The other dominant bacterial
phyla found were Actinobacteria (15-22%), Acidobacteria (11-14%) and Verrucomicrobia
(4-13%). No significant differences were found with Proteobacteria relative abundance
among the biochar treatments in all soils except at the higher biochar level (10%) in BSL soil
where it increased in relative abundance by 8-11% compared to the 0% biochar treatment.
Actinobacteria increased in relative abundance by 51% at 2.5% biochar and 28% at 10%
biochar in the RL soil, however decreased in the BCL and BSL soils by 18% at 10% biochar
compared to the control. The phylum Nitrospirae increased in the BCL soil by 51% and 29%
at 2.5% and 10% biochar treatments and also increased by 64% in the BSL soil at 2.5%
biochar. However, Nitrospirae decreased in the RL soil by 10% and 35% at the higher
biochar levels (5% and 10% biochar) compared to the control. The same trend was observed
with the Verrucomicrobia, which increased by 65% in the BCL at 5% biochar and by 61-63%
in BSL at 2.5% and 10% biochar level respectively but decreased in the RL soil by 55-67% in
biochar treatments compared to the control. The most dominant class of Proteobacteria
observed was Alphaproteobacteria with an average of 18-21% relative abundance in the BCL
soil, 17- 22% in the RL soil and 17- 23% in BSL soils, Betaproteobacteria made up 5-7%
reads and 4-6% for both Gammaproteobacteria and Deltaproteobacteria. Betaproteobacteria
correlated positively with the higher C/N ratio in the BCL soil while a negative correlation
was observed in the BSL soil (Table 4.3). No significant correlations were observed in RL
soil except for Deltaproteobacteria which correlated negatively with the C/N ratio after
biochar additions as shown in Table 4.3. Moreover, there was a correlation between the
Alphaproteobacteria and the increased C/N ratio in the BSL after biochar applications.
108
Figure 4.2: Relative abundances of bacterial phyla in black clay loam (BCL), red loam (RL)
and brown sandy loam (BSL) soils with different biochar amendments rates.
0 20 40 60 80 100
BCL-initial sample
BCL-Biochar 0%
BCL-Biochar 2.5%
BCL-Biochar 5%
BCL-Biochar 10%
Relative Abundance (%)
aAcidobacteriaActinobacteriaArmatimonadetesBacteroidetesChloroflexiCyanobacteriaFirmicutesGemmatimonadetesNitrospiraePlanctomycetesProteobacteriaTenericutesThermodesulfobacteriaThermotogaeVerrucomicrobiaUnclassifiedOthers
0 20 40 60 80 100
RL-initial sample
RL-Biochar 0%
RL-Biochar 2.5%
RL-Biochar 5%
RL-Biochar 10%
Relative Abundance (%)
b AcidobacteriaActinobacteriaArmatimonadetesBacteroidetesChloroflexiCyanobacteriaFirmicutesGemmatimonadetesNitrospiraePlanctomycetesProteobacteriaTenericutesThermodesulfobacteriaThermotogaeVerrucomicrobiaUnclassifiedOthers
0 20 40 60 80 100
BSL-initial sample
BSL-Biochar 0%
BSL-Biochar 2.5%
BSL-Biochar 5%
BSL-Biochar 10%
Relative Abundance (%)
cAcidobacteriaActinobacteriaArmatimonadetesBacteroidetesChloroflexiCyanobacteriaFirmicutesGemmatimonadetesNitrospiraePlanctomycetesProteobacteriaTenericutesThermodesulfobacteriaThermotogaeVerrucomicrobiaUnclassifiedOthers
109
Table 4.3: Correlation of the relative abundances of Proteobacteria classes and
biochar loading rates (0%, 2.5%. 5% and 10%), and the dominant N2-fixing
bacterial groups (Azospirillum, Bradyrhizobium, Rhizobium, Frankia and
Herbaspirillum) in relation to black clay loam (BCL), red loam (RL) and brown
sandy loam (BSL) soil C/N ratios subjected to different biochar loading rates. (*)
Indicates significant correlations.
Bacterial group C/N ratio
BCL RL BSL
Alphaproteobacteria -0.37501 -0.63178* 0.85628*
Betaproteobacteria 0.82165* 0.46612 -0.72806*
Gammaproteobacteria -0.16598 0.55539 0.06865
Deltaproteobacteria 0.02249 -0.93857* -0.20887
N2-fixing bacterial groups Biochar loading rates (%)
BCL RL BSL
Azospirillum 0.7043* 0.2567 0.2967
Bradyrhizobium 0.0036 0.3634 0.3506
Rhizobium 0.9926* 0.1829 0.1848
Frankia
Herbaspirillum
0.0133
0.0139
0.1943
0.2902
0.0407
0.0341
110
3.4. Ammonia and nitrite oxidizing bacteria
The results showed that in all soils at different loading levels of biochar contained bacterial
nitrifiers that were mainly nitrite- or complete ammonia-oxidizing bacteria (Fig. 4.3a),
especially Nitrobacter and Nitrospirae-related groups. No significant differences were found
in the proportions of these groups among treatments in RL soil. However, nitrite oxidizing or
complete ammonia-oxidizing bacterial relative abundance increased along with the increasing
level biochar amendments compared to the control and the initial samples before biochar
applications. In particular, Nitrobacter in BCL increased by 50% and 53% at 2.5% and 10%
biochar levels respectively, whereas Nitrospira spp. were found to be 152% more abundant in
BCL at 2.5% and 337% and 92% in BSL soil at 2.5% and 10% biochar application rates
compared to the control. However, in the BCL soil Nitrospira were comparatively more
abundant in the initial sample compared to the biochar treatments. On the other hand, the
dominant ammonia oxidizing bacteria (AOB) detected included Nitrosococcus spp. followed
by Nitrosovibrio spp. and Nitrosospira spp., respectively. In the BCL and RL soils
Nitrosococcus spp. was higher in abundance in 5% and 10% biochar treatments compared to
the control and the initial sample as shown in Fig 4.3a, while the opposite was observed in
BSL soil except at higher levels of biochar application. Similarly, the relative abundance of
Nitrosovibrio spp. increased by 48%, at 5% biochar in BCL soil, by 73% in the RL soil at 2.5%
biochar and by 91-93% in the BSL at 5% and 10% biochar rates compared to the control. The
proportion of Nitrosospira spp. increased in the BCL soil at 5% biochar and in the BSL at 2.5%
and 10% biochar while this group decreased in the RL soil with biochar loading rates. Overall,
the nitrifying bacteria were mainly affected by biochar applications in the higher N-content
BCL and the BSL soils but not in RL soil.
111
Figure 4.3: Effect of biochar loading rates (0%. 2.5%. 5% and 10%) on the relative abundance of dominant known (a) ammonia and nitrite
oxidizing bacteria, (b) nitrogen fixing bacteria and (C) methanol and methane oxidizing bacteria in black clay loam (BCL), red loam (RL) and
brown sandy loam (BSL) soils. The initial sample is the soil before sieving and biochar addition.
0 20 40 60 80 100
BCL-intial sample
BCL-Biochar 0%
BCL-Biochar 2.5%
BCL-Biochar 5%
BCL-Biochar 10%
RL-initial sample
RL-Biochar 0%
RL-Biochar 2.5%
RL-Biochar 5%
RL-Biochar 10%
BSL-initial sample
BSL-Biochar 0%
BSL-Biochar 2.5%
BSL-Biochar 5%
BSL-Biochar 10%
Relative abundance (%)
a
Nitrobacter
Nitrosococcus
Nitrosospira
Nitrosovibrio
Nitrospira
0 20 40 60 80 100
Relative abundance (%)
b
Azospirillum
Bradyrhizobium
Rhizobium
Frankia
Herbaspirillum
0 20 40 60 80 100
Relative abundance (%)
c
Methylobacterium
Methylocaldum
Methylocella
Methylomicrobium
Methylopila
Methylosinus
112
3.5. Nitrogen fixing bacteria
The dominant discernible nitrogen fixing bacterial groups were in order of relative abundance
Bradyrhizobium spp., Azospirillum spp., Rhizobium spp., Frankia spp. and Herbaspirillum
spp. in the three soils. The results in Fig 4.3b showed that there was a reduction in Rhizobium
spp. between the initial sample and biochar treatments in the BCL after 10 months incubation,
yet Rhizobium correlated significantly (r=0.99) with biochar application rates in BCL as
shown in Table 3. In the RL soils, there was no difference between the initial sample and the
control while Rhizobium spp. decreased at 5% biochar levels by 39% compared to the control
(Fig. 4.3b). Compared to the control Rhizobium increased by 135% at 10% biochar in BCL
soil, while in BSL soil Rhizobium increased by 96%, 45% and 58% at 2.5%, 5% and 10%
biochar levels after 10 months incubation (Fig. 4.3b). Bradyrhizobium spp. were the
dominant nitrogen fixing bacterial group in all biochar amended soils, no difference was
found between the initial sample and the biochar treatments in the BCL as shown in Fig 4.3b.
Bradyrhizobium spp. was higher in the initial sample in the RL soil (Fig. 4.3b), while no
significant difference was found between the other biochar treatments and the control (0%
biochar). In the BSL soils, Bradyrhizobium spp. was more abundant in the 2.5% and 10%
biochar treatments by 50% and 61% respectively compared to the control (Fig. 4.3b). There
were only negligible changes in abundance of Azospirillum spp. in the BCL (Fig. 4.3b) and
RL soils (Fig. 4.3b), however, Azospirillum relative abundance correlated positively (r=0.70)
with biochar loading rates in the BCL soil (Table 4.3). By comparison, in BSL soils the
proportion of Azospirillum spp. increased by 185% and 202% at 2.5% and 10% biochar
treatments while in the control there was no difference from the initial sample following 10
months incubation time (Fig. 4.3b). Frankia spp. increased by 379% and 269% with
increasing biochar loading rates at 2.5% and 10% in the RL soil (Fig. 4.3b) and by 162% at 5%
113
biochar treatment in BSL soil but not in BCL compared to the controls (Fig. 4.3b), however
the abundance was higher in the initial samples than the amended soils. The abundance of
Herbaspirillum spp. was higher at 5% biochar rates in the BCL and BSL soils compared to
the control while no significant differences were observed in the RL amended soil. The
results suggest that biochar addition affects the abundance of N2-fixers; however the effects
are focused on certain groups in a soil dependent manner.
114
3.6. Methane and methanol oxidizing bacteria
The data indicated that methane and methanol-oxidizing bacterial relative abundance was
collectively higher in the BSL soil compared to the BCL and RL soils; however the three
soils were dominated by the facultative methylotroph Methylobacterium, which was the most
affected by the biochar application (Fig. 4.3c). The impact of biochar additions on this genus
was higher in the BCL compared to other soils. The relative abundance of Methylobacterium
increased significantly with increasing biochar loading rates by 54%, 89% and 122%
respectively in BCL compared to control. A slight increase was also observed in BSL while
no significant differences were observed in the RL after biochar application. Likewise, the
type II methanotrophs Methylocella and Methylosinus increased in relative abundance with
increased biochar levels (2.5%, 5% and 10% biochar) in the BCL and BSL compared to the
control and the initial samples. Methylocella increased by 23%, 39% and 48% in the BCL
and 11% in BSL with increasing biochar rates. A similar but less significant increase was
observed for Methylosinus in BCL and BSL where the abundance increased by 10-20% with
increasing biochar application rates. Relative abundance of Methanotrophic bacteria was also
higher overall in BCL and BSL biochar amended soils compared to the control and the initial
samples except in the RL soil where these groups seemed to be more abundant in the initial
sample than the other treatments. The less abundant taxa (Methylocaldum, Methylomicrobium
and Methylopila) showed the same response to the biochar additions in the three amended
soils. In particular, Methylomicrobium increased significantly in the RL by 100%, 150% and
250% among the increased biochar rates as shown in Fig. 4.3c; Methylopila increased by
133-167% with increasing biochar rates in the BCL and BSL soils. Overall, biochar additions
seemed to cause detectable increases in the proportion of type I and II methanotrophs as well
as methanol oxidizing bacteria in BCL and BSL soils but not in RL soils.
115
4. Discussion
Biochar application has the potential to change the physico-chemical properties which may
alter the microbial composition and the related biological processes in soil (Steinbeiss et al.,
2009; Lehmann et al., 2011). The result of this study indicated that different application rates
of biochar to different soils had a significant impact on NH4/NO3 ratios, total C and N, pH,
EC and soil moisture content in a short term experiment (Abujabhah et al., 2016b). The
impact of biochar varied between soils and at different application rates. Overall, the lighter
soils were more affected by the addition of biochar than the heavier clay soil (Uzoma et al.,
2011; Abujabhah et al., 2016b). It has been widely stated that biochar may increase the
abundance of the microbial community in soil, agreeing with the results observed in this
study, especially in BSL amended soil (O'Neill et al., 2009; Abujabhah et al., 2016a). The
potential positive impact of biochar addition on soil characteristics and bacterial community
structure may reduce NO3-N leaching by reducing nitrification and enhance the biological
nitrogen input by increasing immobilisation in soil (Güereña et al., 2015; Xu et al., 2016). A
study conducted by Ball et al. (2010) illustrated that soils exposed to fire had a higher
abundance of AOB than control soils due to the increased charcoal content. Despite the
presence of other AOB, such as archaea in soil, bacteria are more likely to contribute to
ammonia oxidation in agricultural soils (Di et al., 2009; Jia and Conrad, 2009). Data from a
previous study of Tasmanian soil (Abujabhah et al., 2016a) indicated that archaeal ammonia
oxidizers were not substantially influenced by biochar or compost treatments; however this
group was not assessed in this study. Our results here instead showed an increase in the
abundance of AOB especially in BCL soils with increasing biochar application rates.
However, greater changes in the relative abundance of NOB and complete-ammonia-
oxidizing bacteria (Daims et al., 2015; van Kessel et al., 2015; Nunes-Alves, 2016) were
observed than for AOB. This response may be due to the improvement of physical properties
116
and pH of BCL soils. Nitrifiers are chemoautotrophs which mean that these bacteria are
sensitive to the changes in aeration conditions, nutrient availability and pH caused by biochar
application in soils (Banning et al., 2015; Che et al., 2015; Hanan et al., 2016). Many studies
indicate that biochar addition affects the abundance and activity of nitrifying bacteria and
stimulates potential nitrification rates thus increasing N availability in soil (Berglund et al.,
2004; Ball et al., 2010; Prommer et al., 2014; Sorrenti et al., 2017); however, this impact
might be diverse, dependent on soil type and biochar application rates (Abujabhah et al.,
2016b; He et al., 2016a). Furthermore, recent studies stated that members of the genus
Nitrospira are capable of carrying out both ammonia and nitrite oxidation in one step referred
to as complete nitrification (Daims et al., 2015; van Kessel et al., 2015). Our findings showed
that the genus Nitrospira was the most abundant and biochar affected group of nitrifiers,
especially in the BSL soil, previously shown to have a high nitrification potential (Abujabhah
et al., 2016b) , and could be driving changes and availability of nitrogen in the biochar
amended soils.
The form of nitrogen in soil is very important in terms of its availability for plant uptake.
Since atmospheric N2 cannot be used, biological nitrogen fixation plays an important role in
nitrogen availability, input and retention in agricultural soils. It has been documented that
biochar application can improve biological nitrogen fixation rates in soil and enhance the
activity of nitrogen fixing bacteria (Rondon et al., 2007; Güereña et al., 2015). However, the
mechanism and functionality of biochar impact on biological nitrogen fixation and related
microbes is still not clear due to the complexity of the soil ecosystem. Biochar addition may
directly affect the growth of specific bacterial groups related to the nitrogen fixation (Beck,
1991a), and also because of the changes in soil properties induced after biochar amendment.
Chen et al. (2017) reported that the impact of biochar on microbial population abundance,
structure and enzyme activity depended on particle size and application rates, which might be
117
more noticeable in lighter textured soils, such as the BSL Kurosol studied here. The increased
C/N ratio and nutrient availability, especially B and Mo, after biochar application has the
potential to improve biological nitrogen fixation in soil (Rondon et al., 2007). The changes in
microbial community could be strongly linked to the soil physiochemical properties (Fig. 4)
induced by biochar additions (Yao et al., 2017). The findings of this study showed that the
relative abundance of nitrogen-fixing microbial taxa differs depending on biochar application
rates and soil type; this may be explained by the differences in the initial and amended soil
properties following biochar application in different soils. Generally, biochar application
seemed to increase the abundance of specific nitrogen related bacteria which correlated to the
different soil properties in biochar treatments and soil types (Ducey et al., 2013). The
addition of biochar may enhance nitrification especially in heavier soils (BCL) by improving
soil properties and affecting nitrifying bacteria which may reduce NH4 and increase NO3 in
soil (Abujabhah et al., 2016b). The reduction in NH4 may stimulate symbiosis N2-fixing
bacteria (Rhizobia) to restore the lack of available NH4 in soil. Moreover, the addition of
biochar may improve soil physical characteristics such as aeration which would improve the
abundance and activity of free-living diazotrophs such as Azospirillum.
Many studies have illustrated that the amount of methane in the atmosphere released as a
result of the methanogenic activity in soil is controlled by a combination of microbial and
physical processes (Keppler et al., 2009). Biochar potentially reduces the amount of methane
released from amended soils (Rondon et al., 2005), possibly due to the reduction of
abundance of methanogens by enhanced soil physico-chemical characteristics and increased
methane oxidizing bacteria (methanotrophs) in soil. Our results indicated that biochar
significantly increased the abundance of methanotrophs with increased application rates,
especially in BCL soil. The increased abundance of methanotrophs potentially decreases the
amount of methane produced in soil (Feng et al., 2012). The improved soil properties
118
including pH, aeration and nutrient availability and more importantly the soil moisture
content may enhance the CH4 sink in soil by inhibiting methanogens and/or stimulating
methylotrophic activities (Liu et al., 2011; Yu et al., 2013). Methanotrophs could also be
using methanol since it was observed facultative methylotrophs such as Methylobacterium
also become more abundant. Zhang et al. (2010) indicated that soil CH4 emission correlated
with the water content, therefore improved soil physical properties followed biochar additions
may contribute to the mitigation of methane emission by improving the structure and aeration
in the amended soils.
119
Figure 4.4: Distance-based redundancy analysis (dbRDA) showing the relationship between
the significant soil chemical parameters and bacterial community in (a) black clay loam
(BCL), (b) red loam (RL) and (c) brown sandy loam (BSL) amended soils. The respective
treatment symbols are: ▼0% biochar, ■ 2.5% biochar, 5% biochar and 10% biochar.
Each symbol represents an individual soil sample. The best fitted and explained variables are
shown with vectors with the strength of the correlation indicated by the length of the line
(circle donates a correlation of 1.0). The direction of the vector relates the biochar loading
level.
(a) Black Clay Loam
-10 -5 0 5 10
dbRDA1 (36.4% of fitted, 27.5% of total variation)
-10
-5
0
5
10dbR
DA
2 (
22%
of fit
ted, 16.7
% o
f to
tal v
ariatio
n)
BP
OC
N
C:NK
C
CEC
pHNO3NH4
EC
(b) Red Loam
-10 -5 0 5 10
dbRDA1 (35.4% of fitted, 30.7% of total variation)
-10
-5
0
5
10
db
RD
A2
(2
3.4
% o
f fitt
ed
, 2
0.3
% o
f to
tal va
ria
tio
n)
N
B
P
OCCEC
NO3
K
pH
EC
C
C:N
NH4
(c) Brown Sandy Loam
-10 -5 0 5 10
dbRDA1 (28.5% of fitted, 19.3% of total variation)
-10
-5
0
5
10
db
RD
A2
(2
3.4
% o
f fitt
ed
, 1
5.8
% o
f to
tal va
ria
tio
n)
C
K
EC
CEC
NH4
OC
C:N P
NpHB
120
5. Conclusion
The results of this study indicated that the application of different rates of biochar
significantly enhances soil properties, and yet the impact was dependent on the soil type.
Furthermore, biochar addition has greater impact on the bacterial diversity in RL and BSL
than the heavier BCL soil. The abundance of nitrifying bacteria increased with increasing
biochar rate, especially AOB in BCL soil. However, the abundance of Nitrospira and NOB
was greater than AOB in all biochar amended soils. Although nitrogen fixing bacteria
responded differently to the biochar amendments in different soils, the abundance of selected
groups of nitrogen fixing bacteria were increased after biochar additions. Biochar
significantly increased the abundance of methanotrophs with increased application rates,
especially in BCL soil. This study demonstrates the short term impact of different biochar
application rates on bacterial groups that mediate N transformation. Long term studies and
measurements of chemical and gas fluxes are required to fully understand the implications of
different biochar rates and its interactions in different soil types, including those studied here.
121
Chapter 5
Eukaryal community changes and composition induced by
short term wood-based biochar amendments in three
different soils
Abstract
This study determined the loading impacts of wood-based biochar on the eukaryotic
community in three different soils (brown sandy loam – BSL, red loam – RL and a black clay
loam – BCL) using a pot trial conducted over 10 months. 18S rRNA gene sequencing
performed using the Illumina MiSeq platform was carried out to evaluate the changes in
eukaryotic community composition in relation to different added amounts of biochar. It was
found that biochar addition had a negligible effect on diversity parameters in the brown sandy
loam Kurosol (BSL) and red loam Dermosol (RL) soils. There were, however, significant
changes in eukaryotic community composition of these biochar amended soils. These
changes were most discernible in the lighter BSL soil for the fungal communities (F=3.0106,
p=0.0003) present and also when total eukaryotes were considered (F=2.3907, p=0.0002). In
this respect Glomeromycota seem to be slightly promoted in the lighter BSL soils, which
might be due to increased soil porosity and soil chemical fertility. Earlier we observed that
biochar had a significant impact on NH4 and NO3, total C and N, pH, EC and soil moisture
content. The limited impact of biochar loading rates on the soil microbiology could be due to
the short incubation period, the lack of added fertiliser nutrients, and also the inherent
stability of the soil eukaryotic community. Here we have shown the soil microeukaryotes
were affected by short term carbon amendment, though to a limited extent. The data
suggested this impact also included important plant symbiotic organisms. Hence the findings
122
have implications for soil productivity and thus food production in otherwise unfertilised
soils.
1. Introduction
Biochar benefits and impacts on biotic processes and microbial diversity have been
extensively examined recently, yet the interactions between biochar and the soil microbial
community are still unclear. More attention is needed to understand the impact of biochar
amendment on soil microbial dynamics and more specifically in relation to nutrient cycling
and modifications occurring in biochar amended soils (Tammeorg et al., 2016). Due to its
high surface area, biochar can significantly change soil physical properties, especially
porosity, and thus could provide habitats for soil microorganisms (Lehmann and Joseph, 2009;
Kookana et al., 2011). The use of biochar as a soil amendment may affect physical
characteristics and thus soil fertility, which might be different depending on pyrolysis
conditions used for creating the biochar. The variation in physical properties between biochar
and the soil matrix leads to an overall change in soil density and aggregation, hydraulic
conductivity and gas transportation, which in turn impacts chemical properties and
presumably the subsequent composition and activity of soil microorganisms (Lehmann et al.,
2011).
Biochar application could also improve water management and enhance fertiliser treatment
response in soil. A experiment conducted by Asai et al. (2009) to investigate the effect of
biochar amendment on soil physical properties and rice green yields within upland conditions
in ten sites at application rates from 0-16 t h-1, were combined with N and P fertilizer
application rates. The results showed an improvement in hydraulic conductivity and other
physical characteristics in soil, which provides suitable conditions for microorganisms. The
123
impact of biochar addition in soil could persist for extended periods of time due to high
resistance to microbial degradation. The various contributions and effects of biochar
application in different soils requires more clarification which could assist in the choice of
particular biochar for specific soils in order to gain the maximum benefits from biochar as a
soil amendment (Sohi et al., 2010).
The interactions between different biochars and soil types are complicated due to the
variations in biochar feedstocks and soil chemical properties as demonstrated by Unger et al.
(2011). Biochar has also been shown to increase soil pH, cation exchange capacity (CEC) and
thus nutrient holding capacity, influencing nutrient concentration in soils and their
availability for crop uptake (Fowles, 2007). Anion exchangeable capacity (AEC) can also be
enhanced, holding plant and microbe available nutrient anions such as phosphate and
sulphate (Chan and Xu, 2009; Atkinson et al., 2010; Lawrinenko and Laird, 2015).
The high surface area of biochar is likely to provide ideal colonisation sites for soil
microorganisms due to the high concentrations of adsorbed elements and organic substances,
including nutrients. Many reports indicate that biochar amendment enhances microbial
populations and activity in soil by inducing nutrient availability, metabolism and growth of
soil microorganisms (Kookana et al., 2011; Tong et al., 2014). The changes that biochar can
cause through increasing organic matter content, pH, total nitrogen and phosphorus,
exchangeable cations and CEC would be the most logical reason for the enhancement of
microbial populations and activity (Kelly et al., 2014). However, the specific changes,
behaviour and adaptation of soil microorganisms associated with particular kinds of biochar
in different soils still need to be considered (Chan et al., 2008; Lehmann et al., 2011).
Previous studies indicate that biochar creates a suitable environment for microorganisms,
enhancing population growth and microbial abundance in soil, but there is a variation in the
124
bacterial and fungal ratios because of the increase in C/N ratio and soil pH after biochar
addition (Kookana et al., 2011; Chen et al., 2013).
The purpose of this study was to determine the loading impact of wood-based biochar on the
eukaryotic community in Kurosol, Dermosol and Vertosol topsoils. The experiments were
performed in a minimally managed, non-fertilized pot trial to measure the effects of biochar
on the soil community after a period of 10 months. Biochar from green waste was mixed with
the topsoils at four loading levels from 0 to 10% w/w (Abujabhah et al., 2016b). Previous
results from the modelled system showed that biochar additions increase soil carbon and pH,
although the effects varied with soil types. Biochar loading rates also significantly affected
NH4 and NO3, N, EC and soil moisture content, yet the impact was different with each soil
type. Significant impact was observed on potential nitrification, carbon utilisation and
microbial activity at higher biochar loading rates in lighter soils. The increase of total C after
biochar application will increase labile carbon decomposition in soil which increases N
utilisation by microorganisms. To assess eukaryotes in the soils studied a next-generation
sequencing approach was used in which the 18S rRNA gene data were obtained and analysed
to compare eukaryotic community composition. These analyses were conducted in both the
original field soils and in biochar treated and incubated soils. The objectives were to
determine if biochar addition systematically affected the eukaryotic community structure in
the absence of other variables, such as fertilizer input, within a short time period. The second
goal was to determine whether soil type was influential in influencing the impact of the
biochar. Finally the effect of loading of biochar was evaluated to determine the sensitivity of
the eukaryotic community to the amount of carbon amendment.
125
2. Materials and methods
2.1. Soil Collection and Biochar Specifications
Three different topsoils were collected for use in this experiment. A black clay loam (BCL)
Vertosol was collected from a forested hillside located near the Horticultural Research Centre,
University of Tasmania, Hobart, Tasmania (42° 54. 25.92' S 147° 19.22.35 ’E). A loamy red
(RL) Dermosol was collected from a farm near Cambridge, Tasmania (42° 48.11.77’S 147°
26.22.03’E). Brown sandy loam (BSL) Kurosol was collected from an uncropped site in an
apple orchard at Mountain River, located in the Huon Valley region of south eastern
Tasmania (42°57’2.91”S, 147°5’52.13”E). Soil subsamples were kept frozen for biological
analysis; the remaining soils were mixed with biochar and used for the pot experiments after
all the plant residues and gravel material were removed. Biochar used in this experiment was
sourced from eucalypt green waste and produced in an updraft rotary hearth gasifier
operating with a peak temperature of 650 - 750 °C (feedstock dependant), with oxygen
limited atmosphere and residence times not longer than 3 minutes (most typically around 100
seconds).
2.2. Experiment layout
Biochar was mixed through the three different soils at four different rates (%, 2.5%, 5%, 10%
w/w). The prepared mixes were placed into 1.5 L pots and left exposed to the natural
elements for 10 months. The annual rainfall during the experiment was 613.3 mm which the
mean maximum and minimum temperatures were 19.9°C and 8.3°C respectively (Ellerslie
Road Weather Station, Lower Derwent, Tasmania). The pots were not planted or fertilised to
limit other factors that may obscure the impact of biochar addition on soil properties and
126
microbial community. However, natural volunteer weed vegetation grew during the
experiment most strongly on the RL and BSL soils. Each biochar-soil treatment was
replicated four times and arranged randomly in a grid of 48 pots.
2.3. Soil sampling and chemical analysis
Soil samples were taken from the pots after 10 months incubation for instant water content
measurements and chemical analysis. Selected soil chemical parameters were analysed by
CSBP Laboratories, Western Australia to estimate the potential changes in the three soils
after biochar amendments. These results are reported previously in Abujabhah et al. (2016b).
2.4. Scanning Electron microscopy analysis
Samples from the amended soils and the original biochar used in this experiment were
collected, coated with atomised gold and analysed using scanning electron microscopy
(Hitachi SU-70 field emission scanning electron microscope -FESEM) to observe the pore
morphology and surface properties of biochar after 10 months incubation time in soil. Also
uncoated samples from biochar amended soils were investigated via environmental scan
electron microscopy (FEI MLA650 environmental scanning electron microscope - ESEM)
analysis.
127
2.5. DNA extraction and soil biomass assessment
DNA was extracted from the soil samples using PowerSoil DNA Isolation Kit (MO BIO
Laboratories, Inc) by following the provided protocol. Soil biomass was estimated as
bacterial counts and DNA quantity. Extracted DNA (n=4 replicates for each treatment) was
checked for quality at 260/280 nm and quantified via Nanodrop spectrophotometer
(NanoDrop 8000 Spectrophotometer, Thermo Fisher Scientific Inc., Wilmington, DE 19810
U.S.A.) to estimate soil biomass (Marstorp et al., 2000; Bouzaiane et al., 2007). Bacterial
enumerations were estimated as colony forming units (CFUs) on 10% Tryptone soy solid
agar plates incubated at 25ºC for 21 days (Juhnke et al., 1987).
2.6. 18S rRNA sequencing and bioinformatics analysis
Sequence analysis was performed at the Ramaciotti Centre for Genomics (Kensington, NSW,
Australia) where the V9 region of 18S rRNA genes were amplified using 12 bp tagged
universal primers 1391F (TATCGCCGTT CG GTACACACCGCCCGTC) -EukBr
(AGTCAGTCAG CA TGATCCTTCTGCAGGTTCACCTAC) (Amaral-Zettler et al., 2009;
Caporaso et al., 2012; Hugerth et al., 2014), respectively. The primers have high coverage
read > 80% of eukaryote sequences (Hugerth et al., 2014) and the V9 region is shown the
best informative mechanism for biodiversity analysis. Sequencing was performed using the
Illumina MiSeq platform according to standard protocols generating 300 bp pair-ended reads.
All reads were filtered based on quality scoring, trimmed of the tag regions, chimera checked
using QIIME. The 18S rRNA paired-end FASTQ reads were joined into one single read and
then converted into FASTA files using Galaxy (http://galaxycast.org) as described by
Blankenberg et al. (2010).The sequences were also uploaded in the MG-RAST server
128
(http://metagenomics.nmpdr.org) (project id: 12994) for annotation, classification and
metagenomics analysis (Meyer et al., 2008). The abundance data were extracted at the best
hit classification using the default MG-RAST setting where the data was compared to the
M5NR database (Wilke et al., 2012) with annotation utilizing maximum e-value of 1e-5, a
minimum identity of 60 %, and 15 as a minimum alignment length cut-off. The 18S rRNA
paired-end FASTQ reads were also filtered and joined using Mothur
(http://www.mothur.org/wiki/MiSeq_SOP) following the protocol described by Kozich et al.
(2013). The produced reads were then uploaded to SILVAngs (https://www.arb-silva.de/ngs/)
where all reads were processed by the NGS analysis pipeline of the SILVA rRNA gene
database project (SILVAngs 1.3) (Quast et al., 2013). Each read was aligned using the
SILVA Incremental Aligner (SINA SINA v1.2.10 for ARB SVN (revision 21008) (Pruesse et
al., 2012) against the SILVA SSU rRNA SEED and quality controlled (Quast et al., 2013).
Reads shorter than 50 aligned nucleotides and reads with more than 2% of ambiguities, or 2%
of homopolymers, respectively, were excluded. Putative contaminating sequences, artefacts
and reads with a low alignment quality (50 alignment identity, 40 alignment score reported
by SINA), were identified and excluded from downstream analysis. After these initial steps
of quality control, identical reads were de-replicated with unique reads clustered (OTUs), on
a per sample basis, and the centroid reference read of each OTU subsequently classified. De-
replication and clustering was done using cd-hit-est (version 3.1.2;
http://www.bioinformatics.org/cd-hit) (Li and Godzik, 2006) running in accurate mode,
ignoring overhangs, and applying identity criteria of 1.00 and 0.98, respectively. The
classification was performed by a local nucleotide BLAST search against the non-redundant
version of the SILVA SSU Ref dataset (release 123.1; http://www.arb-silva.de) using
BLASTn (version 2.2.30+; http://blast.ncbi.nlm.nih.gov/Blast.cgi) with standard settings
(Camacho et al., 2009). The classification of each OTU reference read was mapped onto all
129
reads that were assigned to the respective OTU. This yields quantitative information (number
of individual reads per taxonomic path), within the limitations of PCR and sequencing
technique biases, as well as, multiple rRNA operons. Reads without any BLAST hits or reads
with weak BLAST hits, where the function “(% sequence identity + % alignment coverage)/2”
did not exceed the value of 93, remain unclassified. These reads were assigned to the meta
group (No Relative) in the SILVAngs fingerprint and Krona charts (Ondov et al., 2011).
2.7. Statistical analysis
Soil chemical parameters were statistically tested using SPSS v22 to assess the effect of
biochar additions on soil properties compared to unamended control treatments. Permutation
multivariate analysis of variance (PERMANOVA) (Anderson et al., 2005), and canonical
analysis of principal coordinates (CAP) (Anderson and Willis, 2003) were conducted using
default settings with 9999 permutations, while CAP was conducted using default settings to
assess the microbial community compositions. For sequence read analysis, the data was
organised at the lowest taxonomic level possible and normalised as percentages, square root
transformed and a resemblance matrix created by calculation of Bray-Curtis coefficients. The
PERMANOVA derived significance values were considered significant when P < 0.01, while
0.01 < P < 0.05 were considered only marginally significant. PRIMER-6 was used to
calculate Shannon (H’, log base e), Pielou’s evenness (J’), and Fisher’s α-diversity. Good’s
coverage was calculated as 1 - (n/N) x 100, where n is the number of singleton OTUs and N
is the total number of sequences in the sample. The linear discriminant analysis effect size
(LEfSe) method was used to estimate the significant differences in the eukaryotic taxa
between the amended soils (Segata et al., 2011).
130
3. Results
3.1. Soil physicochemical properties
Previous soil analysis results reported by Abujabhah et al. (2016b) indicated that the addition
of different levels of biochar to different soils had a significant impact on NH4 and NO3, total
C and N, pH, EC and soil moisture content. No significant impact was observed on
extractable P or K (Colwell method), exchangeable cations or CEC in BCL soil with the
exception of exchangeable K. However in both BSL and RL soils, biochar addition had
significant effects on exchangeable Al, Ca, Mg and Na. The main impact among biochar
treatments across all three soils was that increasing loading increased the C/N ratio and soil
pH as described in more detail by Abujabhah et al. (2016b).
3.2. Electron-microscopic analysis of biochar
Scanning electron-microscopic analysis (SEM and ESEM) was used to visualise the pore
sizes and the interaction with soil particles in the biochar within the amended soils and the
original biochar used in this experiment. The images showed that the biochar had a wide
range of pore sizes, ranging two orders of magnitude (1 – 100 m). The micrographs show
that biochar pore sizes vary significantly with the dominant size-cluster of approximately 5 –
20 m and minor size-cluster at 40 – 60 m. These finer pores lie in the ‘plant available
water’ (PAW) range. The biochar also maintained much of this porous structure for over the
10 months period although with noticeable breakage and associated pore collapse and minor
in-fill with soil as compared to the fresh biochar (Fig. 5.1). The incubation time and
experiment preparation might have contributed to the heterogeneity of the surface structure
and pore size distribution.
131
Figure 5.1: Microscopic images from ESEM (a-d) of biochar amended soils and SEM of
biochar separately (e) and biochar mixed with soil (f) at different magnifications.
132
3.3. Eukaryotic alpha diversity
A total of 11,181,813 sequence 18S rRNA reads were obtained from all the soil samples with
an average of 186,364 reads per sample. As shown in Figure (5.2) the lighter topsoils (RL
and BSL) were more even (0.65 – 0.68 versus 0.53) and proportionally more diverse (2.86 –
2.94 versus 2.32, based on the Shannon index) than the heavier Vertosol BCL topsoil,
otherwise the average number of OTUs detected were similar, ranging from 15,000 – 23,000
(average 18,864). BSL had the greatest species richness (average 10.1) compared to BCL and
RL soils (9.12-9.21). The species richness in the RL topsoil was impacted by the preparation
of the pots as the initial samples had lower species richness (9.21) compared to the
homogenised and 10-month treated zero biochar soil (10.30).
The addition of biochar overall did not have any profound effect on eukaryotic soil diversity
after 10 months, and effects that did occur were soil dependent. The number of OTUs
increased in the BCL and BSL amended soils compared to the initial samples and the control
biochar soil by 8-25%, while the opposite occurred in the RL amended soils (reduced 6-20%)
(Fig. 2). Moderate loadings of biochar seem to achieve maximal OTU number increases (2.5%
for BSL and 5% for BCL), while for RL soil the lowest OTU number was recorded at 10%
loading , though there was no consistent trend associated with loading levels.
In terms of species richness, only biochar amendment in the BCL topsoil showed a
discernible effect, with richness increasing from 9.3 to 9.55 – 9.85 in the amended soil
(highest with 2.5% biochar). In terms of microbial species evenness biochar amendment had
no significant effect (Fig. 5.2). Biochar amendments in BCL soils resulted in an increase in
Shannon diversity (from 2.59 to 2.61 – 2.85) peaking with 10% biochar loading (2.85),
though biochar loading level itself was not significant in specifically affecting diversity.
133
Figure 5.2: (a) the number of OTUs, (b) Fisher α-diversity (c) Evenness and (d) Shannon
index in black clay loam (BCL), red loam (RL) and brown sandy loam (BSL) soils in the
initial samples and biochar treatment. Error bars present standard deviation and letters
indicate significant differences between treatments among amended soils.
134
The rarefaction curves as shown in Figure (5.3) indicated that none of the samples reached an
asymptote, with Good’ coverage estimations of 84%, 82% and 83% for BCL, RL and BSL
respectively. Based on the OTU versus sequence totals, biochar amendment in the BCL and
BSL soils resulted in greater OTU numbers as also indicated above; however the different
biochar rates all gave similar results in the case of the BCL soils, while in the BSL soil 2.5%
w/v amendment resulted in greatest OTU numbers. Overall, only the BCL soil showed
consistent responses to biochar loading and even then the level of loading did not have any
specific effect on diversity parameters.
135
Figure 5.3: Rarefaction curves for total eukaryote communitiy in black clay loam (BCL), red
loam (RL) and brown sandy loam (BSL) in the initial samples and biochar treatments.
136
3.4. Multivariate analysis of eukaryotic populations
Setting up the pot experiment and incubating for 10 months resulted in a significant change in
both fungal and overall eukaryotic communities. This difference would also incorporate the
homogenising effect caused by the physical biochar addition. PERMANOVA analysis
otherwise indicated that biochar additions had a marginal (p0.01) to moderate impact
(p0.001) on the fungal (F=1.3728, p=0.0317) and total eukaryote (F=1.5127, p=0.0034)
communities in the RL, (F=0.8673, p=0.6541) and (F=1.333, p=0.0599) in BCL soils,
respectively. The impact of biochar additions was more discernible on the fungal (F=3.0106,
p=0.0003) and total eukaryote (F=2.3907, p=0.0002) community in the lighter BSL soil (Fig.
5.4). Overall, biochar loading treatments had little separation in the BCL soil CAP plots
while sample groups were better classified in the case of RL and BSL soils.
137
Figure 5.4: Canonical analysis of principal coordinate (CAP) plots of fungi and total
eukaryote community structure determined from taxa classifications derived from 18S rRNA
gene sequence analysis data. Comparisons are shown between initial sample before
conducting the experiment, unamended control, 2.5% biochar, 5% biochar and 10% biochar -
amended soils. The respective treatment symbols are: ▲ Initial sample, ▼0% biochar, ■
2.5% biochar, 5% biochar and 10% biochar. Each symbol represents an individual soil
sample. The classification of replicate data treatment was assessed using PERMANOVA in
black clay loam, red loam and brown sandy loam soils.
138
3.5. Fungal community composition and the effect of biochar loading
The three soils were dominated by the phylum Ascomycota with class Eurotiomycetes (asci-
forming fungi, 17.5-46.3% of reads) contributing the greatest proportion of reads at the class
level, especially in BCL soil as shown by the LEfSe analysis (Fig. 5.7). Other major groups
of fungi that were well represented in soils included Agaricomycetes (“mushroom”-forming
fungi, 14.4 – 28.5 % of reads), Dothideomycetes (bitunicate asci-forming fungi, 3.0-15.4%),
Saccharomycetes (budding yeasts, 1.0 – 6.9%), Sodariomycetes (fungi that form asci in
perithecial fruiting bodies, 1.3 – 6.3%) and Tremellomycetes (“jelly” fungi, 1.6 – 3.5%). A
large proportion of reads (20.5 – 32.3%) could not be classified to class level (Fig. 5.5a).
In the initial BCL soil samples, class Eurotiomycetes were very abundant (46.3% of reads)
(Fig. 5.5a). The impact of biochar loading was minimal in the BCL soils as suggested by the
CAP/PERMANOVA analysis. The experimental set-up and the 10 month pot trial itself
generally had only a minor effect. The main differences were a greater abundance of
Neocallimastigomycetes (anaerobic plant fibre-degrading fungi) and Leotiomycetes (fungi
that mostly have asci in apothecia) and lower levels of Sodariomycetes when initial samples
were compared with the 0% biochar treatment soils. The relative abundance of
Eurotiomycetes ranged between 34-39% among biochar treatments in BCL soil, only slightly
lower than 0% control (41%). Similar level variations (<2 fold) in relative abundances occur
for most other fungal taxa. An increase in Sodariomycetes was observed with 1.1% of reads
in the control, increasing to 2.3-6.0% reads in the biochar amended samples (6.0% in the 10%
w/w loaded samples similar to the initial sample). A progressive reduction in Leotiomycetes
abundance occurred with loading from 3.4% of reads in the control to 0.8% in the 10%
loaded samples. Loading of biochar also seemed to reduce the relative abundance of lichen
139
fungi of class Lecanoromycetes (from 0.9% to 0.1-0.2%). Overall, the data suggests biochar
loading has minimal effects in BCL soils though it may promote Sodariomycetes.
In the initial RL soils Dothideomycetes and Wallemiomycetes (xerophilic moulds) were
relatively abundant compared to the other soil types. Setting up the experimental pot system
strongly promoted Neocallimastigomycetes and reduced the Dothideodomycetes relative
abundance. Weaker stimulation of Orbiliomycetes (saprobic sac and nematode trapping
fungi), Paraglomeromycetes (arbuscular mycorrhiza, (Oehl et al., 2011)) and
Saccharomycetes abundance also occurred. The effect of biochar loading, like the BCL soil
had minimal consistent effects on most class-level fungal taxa, variations likely mostly reflect
patchiness within the samples. The 10% biochar loaded sample, which would be expected to
have the greatest physio-chemical alterations stood out in that samples contained
Exobasidiomycetes (plant parasitic fungi, 4.2% of reads on average), Schizosaccharomycetes
(fission yeasts, 5.3%), Taphrinomycetes (plant parasitic fungi, 1.2%), and higher abundance
of Tremellomycetes (3.9% versus 0.9-1.4%). Overall, RL soils were not strongly affected by
biochar except at the highest loading level.
In the BSL soils setting up the pot trial resulted in effects analogous to what was observed
with the RL soils. Neocallimastigomycetes and Saccharomycetes were promoted in relative
abundance. Other taxa stimulated included the Archaeosporomycetes (a type of arbuscular
mycorrhiza, Oehl et al. 2011), Hyphochytriomycetes (stramenopiles formerly fungi) from the
LEfSE analysis (Fig. 5.8). The effect of biochar loading itself was much less evident.
Glomeromycetes became more abundant in biochar amended soil (0.8-3.1%).
Lecanoromycetes also become less abundant (1.4% dropping to <0.1%), as observed for BCL
soils. Overall, biochar showed little evidence of impacting BSL soil fungal communities.
140
Figure 5.5: Abundance of fungal groups at the class level in black clay loam (BCL), red loam (RL) and brown sandy loam (BSL) in the (a)
initial samples and (b) biochar treatment.
141
3.6. Composition of soil metazoa and other eukarya and the effect of biochar addition
The proportions of 18S rRNA sequences derived from metazoan inhabitants of the test soils
are shown in Figure 6. Initial soil profiles show differences that reflect the nature of the soil
types used in the experiment. Most metazoa in the BCL soils were nematodes (Chromadorea,
Enoplea) and annelid worms (Polychaeta) making up 87.8% of reads. In RL soils this
proportion was only 33.6%, instead this soil had a much higher content of Eutardigrada (24.6%
of reads), Trematoda (4.9%), Insecta (12.2%), and Nassophorea (9.0%) (ciliate protists).
BSL soils had 37.3% of reads derived from nematode and annelid taxa. The other major
community members include Insecta (26.0%), Gastropoda (7.1%) and Nassophorea (25.5%)
(Fig. 5.6).
Setting up the biochar experiment resulted in substantial changes to the BCL soil with
Chromadorea dramatically reduced (47.3% to 2.1-8.1% of reads) while increases occurred
with Insecta and Arachnida. The effect of biochar was minimal on the BCL topsoils though
this was not helped by a large proportion of unclassified taxa (20-35% of reads) and the quite
variable distributions between soil, reflecting patchy distributions of metazoa in the sample
replicates analysed. Biochar loading rate may have stimulated Gastropoda abundance (2.5-
15.0% versus 1.7% of reads).
In the case of the RL soil, the establishment of the experiment resulted in mainly loss of
Eutardigrada (24.6 to 2.0% of reads) and a large increase in Nassophorea relative abundance
(9.1 to 42.0%). The effect of biochar loading was substantially less obvious. Chromadorea
appeared to be slightly more abundant in biochar amended samples compared to the 0%
control (15.9-17.9% versus 10.8% of reads) while annelids were least abundant in the 10%
biochar amended soils (3.5% of reads versus 6.4-10.9% in the other samples and control).
142
BSL soil metazoan composition was also affected by experimental set-up. Chromadorea
(38.2% in the 0% control versus 6.3% of sequences in the initial samples), Eutardigrada (9.7%
versus 0.4%) became more abundant while Polychaeta was less abundant (1.9% versus 9.0%).
The effect of biochar was only evident for Polychaeta where more sequences of this group
were detected in the biochar containing samples (9.4-16.0% of reads compared to 1.9% in the
control). The 5% w/v biochar had a large proportion of Malacostraca (crustacean), mainly
isopods, not detected in the other samples.
Overall, the effect of biochar loading was relatively minimal as suggested by the spatial
distributions in the CAP/PERMANOVA plots (Fig. 5.4). The main changes that occurred
seem to affect taxa in the RL and BSL soils to a greater extent; however the taxa affected was
soil dependent
143
Figure 5.6: Abundance of metazoa and other eukarya groups at the class level in black clay loam (BCL), red loam (RL) and brown sandy loam
(BSL) in the initial samples and biochar treatments.
144
Figure 5.7: Phylogenetic distribution of the eukaryotic taxa (domain-genus level) with
distinct relative abundance differences (LDA values of >3.5) in black clay loam (BCL), red
loam (RL) and brown sandy loam (BSL) amended soils.
145
Figure 5.8: Linear discriminant analysis effect size (LEfSe) analysis showing the most
significantly different eukaryotic taxa in terms of relative abundance in black clay loam
(BCL), red loam (RL) and brown sandy loam (BSL) amended soils with LDA values of 3.5
146
4. Discussion
Biochar increases the pH and electric conductivity of soil (Kimetu et al., 2008; Chintala et al.,
2014). Abujabhah et al. (2016b) indicated that biochar addition in non-fertilized soils raised
pH values as loading rates increased in the RL and BSL soils that were investigated here.
Biochar application also increased the total carbon in proportion to the increasing application
of charcoal in all topsoils. The increases in soil pH and carbon after biochar addition provide
conditions that can promote soil microbial abundances (Lehmann et al., 2011). Previous work
on these soils (Abujabhah et al., 2016b) also indicated that different application rates of
biochar impacts on soil moisture content, EC, NH4/NO3 ratios, total N, in a 10 month
experiment, depending on the soil type. The degree of impact on microbial abundance by
biochar is thus affected by a range of factors in addition to simply extra carbon accumulation
(Gomez et al., 2014). The biochar carbon input also affects soil nutrient content and the
relative impact could depend on initial soil C; overall this would explain the variety of
biochar effects observed in different soils. Carbon content nevertheless is highly influential
on soil microbial activity and growth (Alden et al., 2001; Yoshitake et al., 2007). Therefore,
organic application not only affects soil chemical and physical properties, it also enhances
nutrient cycling, both indirectly and directly (Ros et al., 2006). Since biochar is a very stable
form of carbon, resistant to microbial degradation, available carbon utilised by soil
microorganisms most likely is derived from different existing soil C sources already present
or generated in the soil subsequent to biochar addition. The lighter topsoils were more
affected by the addition of biochar than the heavier clay loam topsoil which indicate that the
biochar impact is related to the changes in the physical properties like soil texture and
structure following biochar application (Uzoma et al., 2011; Abujabhah et al., 2016b). Here
we show that the 5 – 20 m pores, which lie in the plant available water holding range, are
147
dominant and this might aid the lighter-textured soils more than the heavier-textured soils. It
has been widely stated that biochar may increase the abundance of the microbial community
in soil, which agrees with the results observed in this study especially in the BSL amended
topsoil (O'Neill et al., 2009; Abujabhah et al., 2016a).
The multivariate results showed that biochar application significantly affects fungal and total
eukaryotic communities but overall the diversity and richness remain relatively stable,
possibly due to the short term nature of the modelling experiment, lack of nutrient input, and
inherently patchy nature of localised eukaryotic communities, especially metazoa (Bahram et
al., 2016). Eukaryote community structure alteration nevertheless could be due to
enlargement of soil in macroporosity after biochar application (Hardie et al., 2014;
Abujabhah et al., 2016a), for example greater abundance of Polychaeta and Gastropoda in
the BSL and BCL topsoils, respectively. The results showed an increase in the
Glomeromycota abundance especially in the lighter RL and BSL topsoils, possibly due to the
enhancement of fungal colonisation which increase hyphae growth giving plants greater
access to available P (Mickan et al., 2016). Different wild volunteer weedy vegetation grew
during the experiment, most likely from the original soil based seed banks, and this would
provide sites for the growth and survival of AM fungi. However, the differences in the AM
were observed as a result of increasing biochar additions as compared to the control,
occurring most especially in the RL and BSL soils. Hammer et al. (2014) stated that
arbuscular mycorrhiza (AM) hyphae are able to access biochar microsites that are too small
for most plant roots to enter (<10 μm), and therefore increase P uptake from biochar. The
dominant pore sizes in our biochar are within this size class (5 – 20 m) which retains water
in the plant available range. The ability of AM fungi and Ectomycorrhiza affiliated to
Ascomycota, Basidiomycota and Zygomycota to access biochar pores and hyphae colonisation
148
extension in or on the biochar surface potentially promotes plant growth and facilitates
nutrient uptake. Despite the higher abundance of soil fauna in the initial samples, biochar
additions seemed to increase the abundance of soil nematodes and protozoa in the lighter
topsoil (BSL), this might be due to the increased bacterial and fungal abundance, which are
considered a prey for soil fauna (Hallmann et al., 1999; Akhtar and Malik, 2000), in BSL
amended soils. The enhancement of soil porosity after biochar application can be expected to
stimulate the growth and colonisation of fungal hyphae and provide more suitable habitats for
soil micro-mesofauna which may in turn affect the microbial community structure, nutrient
transformations and overall soil health and fertility.
5. Conclusion
In summary, the eukaryotic community structure of the natural soils as assessed in the ‘initial’
soil samples showed they were noticeably different in structure to the soil placed in pots and
incubated outside for 10-months. Despite this a measurable impact of biochar loading on soil
communities, in particular the Glomeromycota (arbuscular mycorrhiza) in lighter-textured
topsoils was observed. The arbuscular mycorrhiza was most likely hosted on the wild weedy
vegetation which grew in the pots during the 10-month experiment. However, stronger soil
microbiological changes were observed due to soil mixing, potting and incubation of
unamended soils. The limited impact of biochar loading rates may also be in part due to the
short incubation-time and the lack of added nutrients, other than those present in the biochar
product. Patchiness is also a significant challenge for analytical purposes. To overcome the
disturbance and timing issues a longer-term field experiment would be required with a larger
number of replicates. Our work supports the need for further studies on the longer-term
149
impacts of biochar on eukaryotic community composition in conjunction with model
experiments to examine the specific physical, chemical and biological variables in different
soils.
150
Chapter 6
General discussion and conclusion
1. Overview
Since the transition from primitive bio-fuels (wood, charcoal, animal power) to fossil fuels
(coal, oil and gas) as primary energy resources, environmental concerns have progressively
increased on the impacts of increased anthropogenic CO2 production on the Earth’s
atmosphere and climate. Amongst a vast range of technologies and processes that seek to
reduce CO2 levels in the atmosphere ‘biochar’ (charcoal) as a soil amendment has been
proposed as a possible ‘win-win’ solution for sequestering more carbon in soils as well as
increasing agronomic productivity (Spokas et al., 2012). The Amazonian Terra Preta soils
provided the inspiration for the idea of adding charcoal to soil. Their long-term physical and
chemical fertility is considered as a model for sustainable soil management and long-term C
sequestration (Glaser and Birk, 2012). Terra Petra soils have a high fertility associated with
long term “slash and burn” agricultural practices which have cause the accumulation of large
amounts of burnt plant residues, including much charcoal (Mishra and Ramakrishnan, 1983;
German, 2003). This accumulated carbon is believed to enhance soil properties and
agronomic productivity. Despite the generally positive impacts of biochar amendment on soil
properties and microbial activity (Atkinson et al., 2010; Lehmann et al., 2011), the impacts
are quite varied and the exact reasons for this remain unclear. Based on the interaction
between biochars from different feedstocks and pyrolysis temperatures with different
application rates and soil types, considerable variation in response has been noted (Spokas
and Reicosky, 2009; Van Zwieten et al., 2010), thus it would seem that responses depend on
151
an interaction between biochar and soil properties and the downstream influence this has on
the soil microbial community.
2. Biochar characteristics and production
Wood and charcoal historically provided almost all fuel energies prior to the discovery of
fossil fuels. Nevertheless, wood and green wastes are increasingly being used as renewable
energy sources where biochar has emerged as a significant by-product (Spokas et al., 2012).
The potential environmental benefits of biochar being used as a soil C sequestration method
raised the focus on techniques that are used during production and methods and benefits of
soil amendment. Therefore, an understanding of the quality of biochar produced from
different feedstocks and under different conditions is required to enable selection of desirable
biochars for soil applications (Lehmann and Joseph, 2009; Novak et al., 2009b). The
feedstocks used and pyrolysis temperature produce biochar with different properties. Straw
biochars have a high ash content and available nutrients compared to the wood biochars
(Kloss et al. (2012). Most biochars are limited as a source of nutrients; however, biochar
produced at high temperature has significantly more surface area compared to low
temperature biochar which increases potential sorption capacity and nutrient retention in soils.
In particular biochar with higher surface area might be more beneficial in sandy soils
compared to heavier textured soils. High aromatic and stable biochars are crucial in C
sequestration in soils which is a featured strategy in climate change mitigation. Kloss et al.
(2012) stated that due to the variety of materials used to produce biochar, there is a potential
risk of toxicity in relation to the feedstocks and temperature used for biochar production.
Schimmelpfennig and Glaser (2012) suggested that different criteria can be used to choose a
152
suitable biochar for soil amendments. Their observations gave rise to analytical guideline
values with threshold variables of O/C ratio <0.4, H/C ratio <0.6, black carbon >15% C,
polyaromatic hydrocarbons lower than soil background values and a surface area >100 m2 g−1.
These variables could be used to assess the stability of biochar against degradation and to
identify a suitable biochar for soil amendment and environmental management
(Schimmelpfennig and Glaser, 2012). Furthermore, due to the different feedstock materials
and to avoid any negative impacts of biochar, simple tests are needed to identify any toxic
elements (Rogovska et al., 2012; Schimmelpfennig and Glaser, 2012).To ensure biochar can
be safely applied to soils, further studies are required to chemically characterise the
environmental effects and create a dataset for biochars due to the variety of feedstocks used
in pyrolysis processes (Busch et al., 2012).
On the other hand, there is a debate about the expense of using biochar in agriculture and the
benefits regarding crop productivity and climate change management. Much of the literature
over the past decade has presented promising agricultural and environmental benefits of using
biochar to improve soil fertility and mitigate climate change (Guo et al., 2016). However,
there is a gap between the research and the actual application in relation to the cost and
benefits of biochar amendments. Also, most of the research studies are conducted in
developed countries with short term application for research interests, while fewer studies are
conducted in developing countries for a long term field application (Zhang et al., 2016b). As
a result, the lack of compiled information on a global scale limits our understanding of
biochar as a commercial product and the potential agricultural and environmental profits that
might be achieved to cover the cost of biochar amendment in soil. Life cycle assessments
conducted by Roberts et al. (2009) to estimate the energy, climate change impacts and the
economics of biochar systems that utilised corn stover residues, yard waste, and switchgrass
153
energy crops as feedstocks showed that the viability of biochar relied on the costs of
feedstock production, pyrolysis, and the value of C offsets. The results also indicated that the
net energy of switchgrass was the greatest in the system (4899 MJ t−1 dry feedstock) while
the net greenhouse gas (GHG) emissions for both corn stover and yard waste are reduced by
864 and 885 kg CO2 equivalent (CO2e) emissions per tonne dry feedstock, respectively. The
feedstock transportation cost seemed to be a barrier for the biochar-pyrolysis systems profit;
however, biochar might be financially applicable and beneficial as a climate change
mitigation strategy and waste biomass distribution system (Roberts et al., 2009). Galinato et
al. (2011) estimated the economic value of C sequestration and soil properties in biochar
amended soils, the study suggested that it might be profitable to use biochar as a soil
amendment under the conditions of existing C offset markets and low price biochar. Under
such conditions, biochar has the potential to increase C sequestration over a long time period,
and profit the environment (Galinato et al., 2011).
Wrobel-Tobiszewska et al. (2015) evaluated biochar production from eucalypt plantations
residue wood under Tasmanian conditions, the study concluded that biochar has a potential to
deliver financial benefits to the forestry industry. The production costs and financial gains
from savings in standard forestry procedures and biochar sale can be adjusted to fit local
conditions and the total benefit depends on the final product distribution and biochar price
(Wrobel-Tobiszewska et al., 2015).
3. Biochar and soil fertility
Soil fertility is related to many aspects, including biotic and abiotic reactions and their
interactions in an array of complex and dynamic processes. Biochar application may affect
154
soil parameters due to its specific properties and the changes that occur in soil after biochar
addition, which may involve a range of soil physical and chemical properties as well as
microbial activity (Atkinson et al., 2010; Lehmann et al., 2011). The changes in one or more
of these parameters in soil after biochar amendment may indirectly affect other aspects in
relation to soil fertility which denotes the complexity of the biotic and abiotic interactions and
activities in soil.
When added at sufficient levels biochar seems likely to change the soil, but the degree and
benefits/detractions from these changes appears to be partly based on the specifications of the
biochar applied. Biochar can provide high micro-porosity and surface area which can a
potential habitat for microorganisms in soil. Also their capacity to increase CEC enhances the
retention of nutrient cations and their availability in the soil for microbes and plant uptake
(Atkinson et al., 2010). The application of biochar could also improve irrigation management
and water infiltration and enhance fertiliser treatment response in soil. Asai et al. (2009)
investigate the effect of biochar on physical properties and rice green yields. Their
experiments, conducted within upland conditions in ten sites at application rates from 0-16 t/h
combined with different N and P fertilizer application rates, showed an improvement in the
hydraulic conductivity and increased rice yields in sites with low P content and also higher
responses in fertilised biochar treatments than fertiliser alone. Improving hydraulic
conductivity and other physical characteristics in soil provides suitable conditions for the
chemical interactions and microbial activity. Furthermore, because biochar has high
resistance to the microbial degradation; the impact of biochar addition in soil could persist for
a long time (Asai et al., 2009; Lehmann et al., 2009). The use of biochar as a soil amendment
could be more beneficial in soils that have poor physio-chemical characteristics, such as
sandy soils. An experiment conducted by Basso et al. (2013) suggested that biochar addition
155
increased water retention in soil by 23% compared to the control. The result also showed that
bulk density of the control soil increased during the incubation time of the experiment by
almost 3%, while bulk density of biochar-treated soils was 9% less than the control and
constantly stable during incubation time. Biochar contribution and impact on soil physical
properties such as soil stability and aggregation, water management, porosity and surface area
indicate that understanding biochar functions and effects in soil would assist the use of
particular biochars to suit specific agricultural soils to gain the maximum benefits from using
biochar as a soil amendment (Sohi et al., 2010).
The implications of biochar addition on soil chemical properties are complicated and
unpredictable because specific chemical properties of each biochar are affected by the
pyrolysis conditions and feedstock used to produce the biochar (Unger et al., 2011; Kloss et
al., 2012). Unger et al. (2011) conducted an incubation experiment to determine whether
biochar produced under different reactions from different feedstocks would differentiate the
influence of biochar on soil chemical properties. In this study, selected parameters were
measured included total nitrogen, total organic carbon, ammonium nitrogen (NH4-N) and
nitrate nitrogen (NO3-N), the results suggested that the reaction conditions and organic
materials used to produced biochar will affect specific chemical properties which therefore
influence soil parameters in the amended soils. It has been stated that biochar may increase
pH in soil which influence nutrients availability in soil (Fowles, 2007). However, the impact
of biochar on soil pH is dependent on the pH of the biochar itself and the liming capacity
which varies between different biochars (Kookana et al., 2011; Lehmann et al., 2011).
The impact of biochar on biotic processes and related microbes has been discussed recently
by many researchers; however there remains a limited understanding regarding the
interaction between biochar amended soils and the normal vs heightened or changes in micro
156
biological processes (Lehmann et al., 2011). Biochar contains highly stable forms of vitrified
carbon which potentially increases the C/N ratio and affects the microbial activity and
nutrient cycling in soil (Nguyen et al., 2008; Kookana et al., 2011). Improvement of soil
physical and chemical properties by biochar amendment may enhance microbial activity as it
is likely to be source of nutrients and a suitable habitat for soil microorganisms. Investigating
the effect of biochar addition on microbial biomass and activity, Kolb et al. (2009) added
biochar to four different soils (Mollisol, Alfisol, Entisol, and Spodosol) at five application
rates from 0 to 0.1 kg/kg-1 soil. Their results showed a significant increase in both microbial
biomass and activity with increasing application rates. The same patterns of biochar impact
were observed on microbial biomass, microbial activity and nutrient availability in all four
soils but the microbial response to biochar varied depending on the differences in nutrient
availability in each soil. Solaiman et al. (2010) found that phosphorus solubility increased in
the presence of biochar due to an increase in mycorrhizal colonisation, however, the results
showed a decrease in microbial respiration with increasing application rates in biochar
amended soil (Thies and Rillig, 2009; Solaiman et al., 2010). In contrast, other studies have
shown an increase in total respiration and respiratory rate, and a reduction in mycorrhizal
colonization after biochar application (Treseder, 2004; Steinbeiss et al., 2009). The
differences in biochars, application rates and type of soils are likely to have contributed to the
range of effects of biochar on microbial communities.
The effect of biochar on soil fertility can be positive or negative depending on the quality of
the biochar and application rates (Spokas et al., 2012), hence there are many aspects which
still need to be investigated. Furthermore, changes in soil nutrients often occur over a long
period of time and most of the studies reported in the literature were conducted over a
relatively short time period. Hence longer term experiments with observations of plant
157
response are required for a comprehensive determination of the impact of biochar on soil
fertility.
4. Research benefits and key findings
This thesis investigated the impact of biochar addition on physical and chemical properties
and interactions with the microbial community. Biochar was applied in an apple orchard field
site and compared to compost application under conventional agricultural practices for 3.5
years. In addition a controlled a pot-based experiment was conducted to evaluate the impact
of biochar loading rates and in three very different topsoil types. Several soil chemical and
biological tests were conducted to evaluate the changes in biochar amended soils and the
potential benefits of biochar application. The basic goal was to understand how green waste-
derived biochars affected soil properties – primarily chemistry, biology and the actual
community structure. The studies undertaken in the apple orchard site complement other
studies with an agronomic emphasis including assessment of tree growth and an assessment
of soil physical properties. The pot experiment on the other hand was a shorter term
evaluation to try to highlight biochar impacts in a lower input system in which soil
management inputs like irrigation and fertilisation were eliminated and instead the key
variables were distinct topsoil types.
4.1. Chemical and physical properties
The findings from Chapter 2 address a field trial based comparison between Acacia green
waste derived biochar and compost applied to a commercial apple orchard. The results
158
indicated that there was no significant impact on any of the measured nutrient anions and
cations in either biochar or compost treatments with an active nutirent management regime in
the orcahrd. It was concluded that this was most likely a result of the management practices
of this particular commercial orchard where high levels of fertilisers were regularly applied,
leading to swamping of the biochar impacts on soil fertility (Eyles et al., 2015). As
anticipated organic carbon was significantly increased (p=0.009) for biochar (23%) and even
more so for compost treatments (55%). Surprisingly soil pH decreased in both biochar and
compost treatments and this was attributed to the broadcasting of raw chicken manures and
other fertilisers across the whole site.
Chapter 3, which was based on a 10-month curing of various soil-biochar mixtures in pots
placed outside. This experiment showed that biochar also increases soil carbon levels but this
time it showed an increase in soil pH, though this varied with soil type. The increase of total
carbon was associated with an increase C/N ratio due to the very high C/N ratio of the
biochar. In general, adding carbon to a soil increases labile soil carbon decomposition and N
utilisation by microorganisms (Lehmann et al., 2011; Nelson et al., 2011). The pot
experiment described in Chapter 3 showed a reduction of the available N and organic carbon
in soil after biochar application for all three soil types. High biochar loading rates appear to
also influence nitrification and the function and activity of microbial community in lighter
soils. These changes occurred after biochar additions and might potentially affect microbial
activity, at least for long-term biochar amendment. The stability of C in biochar makes it an
ideal strategy for C sequestration. While there is some available C in low temperature
biochars for biodegradation, biochar C is more stable in soil than the C in other organic
materials (Ippolito et al., 2012). Therefore, adding high level of carbon in the form of biochar
seems to be a reliable way of keeping carbon in the soil for longer periods of time in order to
159
gain extended improvements of soil characteristics, C sequestration and climate change
mitigation.
The pot experiment showed that biochar additions had a significant impact on NH4 and NO3,
total C and N, pH, EC and soil moisture content in both a soil type and loading dependent
manner. In heavier and reactive soil, such as the clay loam - Black Vertosol, no significant
impact was observed on the available P and K levels, nor the total exchangeable base cations
(TEB) and CEC. However, in the other lighter soils, such as loam – Red Dermosol and sandy
loam – Brown Kurosol, biochar addition had a significant effect on the exchangeable Al, Ca,
Mg, Na levels and CEC. Thus, biochar addition to lighter sandy soil increases water holding
capacity which increases the available water content in soil as well as improving nutrient
availability and more generally soil physio-chemical properties in lighter soils (Sohi et al.,
2010; Basso et al., 2013).
Soil pH increased progressively after biochar application with increasing loading rates in the
pot experiment (Chapter 3), while pH decreased in the field study. This increase in soil pH
with increasing biochar application rates was expected due to the alkalinity of the biochar
(pH>9) used in this study (Kimetu et al., 2008; Chintala et al., 2014). However, a decrease in
soil pH after the addition of biochar and compost in the field site (Chapter 2) may be due to
the lower pH (6.4) and hence liming value of the biochar used in the field site. Furthermore,
increasing the organic matter following the addition of biochar or compost combined with the
impact of fertiliser additions may also decrease soil pH due to the microbial activity and
organic acids released during organic matter decomposition. As different biochars were used
in the field and pot experiments, the effect of biochar on soil pH is dependent on the pH of
biochar itself and the liming value resulting from different feedstocks and pyrolysis
conditions used for biochar production (Kookana et al., 2011; Lehmann et al., 2011). Biochar
160
with high pH and liming capacity might be used in acid soils to increase pH and thus improve
nutrient availability.
4.2. Microbial structure and activity
The results of this study illustrate a limited impact of biochar on microbial biomass,
composition and activity at least in the short term. Results from the field site experiment
(chapter 2) indicated that the application of biochar and compost can subtly influence soil
characteristics leading to changes in bacterial and fungal community structure more than
three years after the original application of the amendments. The changes in eukaryote
community structure could be associated with enhancement in macro-porosity and
bioturbation in the soil after biochar amendment (Hardie et al., 2014). The alteration in the
fungal community structure was the most evident while a lower impact was observed for the
overall bacterial community structure compared to untreated soils. The archaeal community,
mainly involved in nitrification were not affected by the amendments. In the pot study,
biochar addition had a limited effect on the microbial biomass; however, the interaction
between biochar and different soils significantly affected the potential nitrification especially
in RL and BSL soils. There were significant differences in C substrate utilisation among
biochar treatments in the three different soils. The opposite effects in substrate utilization
rates as biochar levels increased in the BCL and BSL soils compared with the RL soil
indicate that biochar may influence the function and activity of microbial communities.
Furthermore, biochar addition had a greater impact on the bacterial diversity in RL and BSL
than the BCL soil. The relative abundance of nitrifying bacteria increased with increasing
biochar rate, especially AOB in BCL soil. However, the relative abundance of Nitrospira and
161
NOB was greater than AOB in all biochar amended soils. It has been widely documented that
biochar reduces N2O emissions in agricultural soils (Zhang et al., 2010; Liu et al., 2012b;
Zhang et al., 2016a), this may be due to the adsorption of N by biochar reducing the available
N to denitrifying and/or nitrifying bacteria and archaea in soils (Singh et al., 2010b).
Although no N2O flux measurements were conducted in this study, the enhancement of NOB
abundance over AOB and the observed effect of biochar on potential nitrification in the
amended soils may possibly reduce N2O emissions due to reduction of available N to
nitrifying microbes (Cayuela et al., 2013) in combination with suppression of the
denitrification function (Li et al., 2016). Changes in nitrifier community composition has the
potential to change the nitrification patterns, yet the mechanisms of biochar impact on AOB
and NOB are still uncertain and require more attention (He et al., 2016a). Although nitrogen
fixing bacteria respond differently to biochar amendments in different soils, the relative
abundance of selected groups of nitrogen fixing bacteria (Bradyrhizobium, Azospirillum,
Frankia and Herbaspirillum) were increased after biochar additions. The impact of biochar
on biological nitrogen fixation might be as a result of nutrient enhancement in the amended
soils, especially K availability (Mia et al., 2014), which may lead to increases in nitrogenase
activity in the biochar amended soils (Quilliam, 2013). Therefore, further investigation is
required to explore the mechanisms of biochar impact on nitrogen fixation for long term
application. The significant increase in abundance of methanotrophs with increased biochar
application rates especially in BCL soil, suggest that the changes in methanotrophs
community composition and methanogens or methylotrophic activities induced by the
changes in physicochemical properties after biochar application will possibly affect methane
production in amended soils (Liu et al., 2011; Feng et al., 2012; Yu et al., 2013).
162
The results of the studies reported in this thesis also point to largely subtle changes in the
eukaryotic community composition when comparing biochar amended soils with unamended
controls. The impact of biochar additions on the fungal communities and total eukaryotes was
most discernible in the lighter BSL soil compared to the BCL and RL soils. In this respect
Glycomycota appears to be slightly promoted in BSL soils, possibly due to altered soil
porosity and chemistry. The eukaryotic community structure of the soils represented in the
initial samples in the pot study were noticeably different to the experimentally manipulated
samples, possibly due to the mixing of soil and biochar during preparation. The modest
impact of biochar loading on soil communities was possibly due to the short time incubation
and the lack of nutrient availability in the biochar amended soils. Longer-term trials with
grass cover of other natural carbon sources would seen to be a logical extension of this work.
5. Future research and conclusion
It is clear that biochar has potential for use as a soil amendment with benefits for greater
environmental management and crop productivity. However, there are some aspects that still
need to be considered to maximise agricultural, economic and environmental benefits of
biochar and to overcome the high cost of biochar production and application.
• Recent focus has been on short term experiments which investigate the impact of
biochar on selected soil chemical and physical properties, thus more field application
research is needed to evaluate the long term impact of biochar application and the
interactions between biochars derived from different feedstocks under different
pyrolysis conditions in different soils.
163
• In addition to the use of biochar as a soil amendment to improve fertility and crop
productivity, biochar needs to be recognised as an effective strategy to mitigate
climate change and C sequestration as well as other potential products of the
thermochemical pyrolysis of biomass materials. Therefore, more research is needed in
developing countries where the costs and profits of biochar production and application
are adjusted to be economically suitable for different needs and requirements. As a
result, sustainable land management through biochar utilization may promote poverty
reduction through increased soil fertility and productivity.
• Biochar use and application needs to be globalised to suit most environments and
economics, therefore, more research needs to be conducted in developing countries
where the costs and profits of biochar production and application are adjusted to be
economically suitable for different needs and requirements. As a result, sustainable
land management through biochar utilization promotes poverty reduction by
increasing soil fertility and productivity.
• As there are a variety of organic materials used in biochar production, ranging from
plant residues to waste products, toxicity tests and contamination studies are required
to avoid any negative effects of biochar application to soil. Also creating a dataset for
biochar classification would help in choosing suitable biochar for soil amendment
based on chemical characteristics. Such a classification tool has been described by
Camps-Arbestain et al. (2015), where biochar properties are classified based on a set
of physicochemical properties to meet soil-crop needs (International Biochar Initiative,
http://www.biochar-international.org/classification_tool). At present, properties that
are classified include carbon storage value, fertilizer value (P, K, S, and Mg only),
liming value and particle size distribution. The systematic use of this categorisation
164
with experiments and practices described above will aid in the realisation of effective
biochar application.
• Finally, more attention is needed to understand the impact of biochar amendment on
soil microbial dynamics, specifically in relation to nutrient cycling and biodegradation.
The effect of biochar on soil microorganisms is still not fully clarified, and the
interaction between different biochars and soils may affect microbial communities
differently depending on the original soil status and the changes that occur after
biochar application.
In conclusion, this thesis has explored several aspects of biochar application in soil. The
significance of this work was the evaluation of the impact of biochar amendment in a
conventional field site and pot studies with a short term and relatively longer term application
as well as the interaction between different loading rates of biochar and soil types. This work
has shown promising results regarding biochar application and has also allowed a better
understanding of the interaction between biochar and different soil systems and the impacts
on soil physicochemical properties and microbial community. The findings of this work
demonstrated the potential benefits of biochar amendment but have also shown that future
research is needed to explore more aspects of the impact of biochar on soil fertility and crop
productivity, as well as the potential benefits for sustainable agriculture and climate change
management in biochar amended soils.
165
Reference:
Abujabhah, I.S., Bound, S.A., Doyle, R., Bowman, J.P., 2016a. Effects of biochar and
compost amendments on soil physico-chemical properties and the total community
within a temperate agricultural soil. Applied Soil Ecology 98, 243-253.
Abujabhah, I.S., Doyle, R., Bound, S.A., Bowman, J.P., 2016b. The effect of biochar loading
rates on soil fertility, soil biomass, potential nitrification, and soil community metabolic
profiles in three different soils. Journal of Soils and Sediments 16, 2211–2222.
Abujabhah, I.S., Doyle, R.B., Bound, S.A., Bowman, J.P., 2017. Assessment of bacterial
community composition, methanotrophic and nitrogen-cycling bacteria in three soils
with different biochar application rates. Journal of Soils and Sediments, 1-11.
Aggelides, S., Londra, P., 2000. Effects of compost produced from town wastes and sewage
sludge on the physical properties of a loamy and a clay soil. Bioresource Technology 71,
253-259.
Aguilar-Chávez, Á., Díaz-Rojas, M., Cárdenas-Aquino, M.d.R., Dendooven, L., Luna-Guido,
M., 2012. Greenhouse gas emissions from a wastewater sludge-amended soil cultivated
with wheat (Triticum spp. L.) as affected by different application rates of charcoal. Soil
Biology and Biochemistry 52, 90-95.
Akhtar, M., Malik, A., 2000. Roles of organic soil amendments and soil organisms in the
biological control of plant-parasitic nematodes: a review. Bioresource Technology 74,
35-47.
Alden, L., Demoling, F., Bååth, E., 2001. Rapid method of determining factors limiting
bacterial growth in soil. Applied and Environmental Microbiology 67, 1830-1838.
166
Amaral-Zettler, L.A., McCliment, E.A., Ducklow, H.W., Huse, S.M., 2009. A method for
studying protistan diversity using massively parallel sequencing of V9 hypervariable
regions of small-subunit ribosomal RNA genes. PloS one 4, e6372.
Anderson, M.J., Connell, S.D., Gillanders, B.M., Diebel, C.E., Blom, W.M., Saunders, J.E.,
Landers, T.J., 2005. Relationships between taxonomic resolution and spatial scales of
multivariate variation. Journal of Animal Ecology 74, 636-646.
Anderson, M.J., Willis, T.J., 2003. Canonical analysis of principal coordinates: a useful
method of constrained ordination for ecology. Ecology 84, 511-525.
Arriagada, C., Almonacid, L., Cornejo, P., Garcia-Romera, I., Ocampo, J., 2014. Influence of
an organic amendment comprising saprophytic and mycorrhizal fungi on soil quality and
growth of Eucalyptus globulus in the presence of sewage sludge contaminated with
aluminium. Archives of Agronomy and Soil Science 60, 1229-1248.
Asai, H., Samson, B.K., Stephan, H.M., Songyikhangsuthor, K., Homma, K., Kiyono, Y.,
Inoue, Y., Shiraiwa, T., Horie, T., 2009. Biochar amendment techniques for upland rice
production in Northern Laos: 1. Soil physical properties, leaf SPAD and grain yield.
Field Crops Research 111, 81-84.
Atkinson, C.J., Fitzgerald, J.D., Hipps, N.A., 2010. Potential mechanisms for achieving
agricultural benefits from biochar application to temperate soils: a review. Plant and Soil
337, 1-18.
Awasthi, M.K., Wang, M., Chen, H., Wang, Q., Zhao, J., Ren, X., Li, D.-s., Awasthi, S.K.,
Shen, F., Li, R., 2017. Heterogeneity of biochar amendment to improve the carbon and
nitrogen sequestration through reduce the greenhouse gases emissions during sewage
sludge composting. Bioresource Technology 224, 428-438.
167
Bahram, M., Kohout, P., Anslan, S., Harend, H., Abarenkov, K., Tedersoo, L., 2016.
Stochastic distribution of small soil eukaryotes resulting from high dispersal and drift in
a local environment. ISME J 10(4), 885–896.
Bailey, V.L., Fansler, S.J., Smith, J.L., Bolton, H., 2011. Reconciling apparent variability in
effects of biochar amendment on soil enzyme activities by assay optimization. Soil
Biology and Biochemistry 43, 296-301.
Ball, P.N., MacKenzie, M.D., DeLuca, T.H., Montana, W.E.H., 2010. Wildfire and Charcoal
Enhance Nitrification and Ammonium-Oxidizing Bacterial Abundance in Dry Montane
Forest Soils. Journal of Environment Quality 39, 1243.
Bamminger, C., Zaiser, N., Zinsser, P., Lamers, M., Kammann, C., Marhan, S., 2014. Effects
of biochar, earthworms, and litter addition on soil microbial activity and abundance in a
temperate agricultural soil. Biology and Fertility of Soils 50, 1189-1200.
Banning, N.C., Maccarone, L.D., Fisk, L.M., Murphy, D.V., 2015. Ammonia-oxidising
bacteria not archaea dominate nitrification activity in semi-arid agricultural soil.
Scientific reports 5, 11146.
Basso, A.S., Miguez, F.E., Laird, D.A., Horton, R., Westgate, M., 2013. Assessing potential
of biochar for increasing water‐holding capacity of sandy soils. GCB Bioenergy 5, 132-
143.
Baudoin, E., Benizri, E., Guckert, A., 2003. Impact of artificial root exudates on the bacterial
community structure in bulk soil and maize rhizosphere. Soil Biology and Biochemistry
35, 1183-1192.
Beck, D., 1991a. Suitability of charcoal-amended mineral soil as carrier for Rhizobium
inoculants. Soil Biology and Biochemistry 23, 41-44.
Beck, D., 1991b. Suitability of charcoal-amended mineral soil as carrier for< i>
Rhizobium</i> inoculants. Soil Biology and Biochemistry 23, 41-44.
168
Beesley, L., Inneh, O.S., Norton, G.J., Moreno-Jimenez, E., Pardo, T., Clemente, R., Dawson,
J.J., 2014. Assessing the influence of compost and biochar amendments on the mobility
and toxicity of metals and arsenic in a naturally contaminated mine soil. Environmental
Pollution 186, 195-202.
Bengtsson, G., Bengtson, P., Månsson, K.F., 2003. Gross nitrogen mineralization-,
immobilization-, and nitrification rates as a function of soil C/N ratio and microbial
activity. Soil Biology and Biochemistry 35, 143-154.
Berglund, L.M., DeLuca, T.H., Zackrisson, O., 2004. Activated carbon amendments to soil
alters nitrification rates in Scots pine forests. Soil Biology and Biochemistry 36, 2067-
2073.
Blankenberg, D., Gordon, A., Von Kuster, G., Coraor, N., Taylor, J., Nekrutenko, A., 2010.
Manipulation of FASTQ data with Galaxy. Bioinformatics 26, 1783-1785.
Bouzaiane, O., Cherif, H., Ayari, F., Jedidi, N., Hassen, A., 2007. Municipal solid waste
compost dose effects on soil microbial biomass determined by chloroform fumigation-
extraction and DNA methods. Annals of microbiology 57, 681-686.
Bremner, J.M., 1997. Sources of nitrous oxide in soils. Nutrient cycling in Agroecosystems
49, 7-16.
Brussaard, L., De Ruiter, P.C., Brown, G.G., 2007. Soil biodiversity for agricultural
sustainability. Agriculture, Ecosystems & Environment 121, 233-244.
Bruun, E.W., Müller-Stöver, D., Ambus, P., Hauggaard-Nielsen, H., 2011. Application of
biochar to soil and N2O emissions: potential effects of blending fast-pyrolysis biochar
with anaerobically digested slurry. European Journal of Soil Science 62, 581-589.
Buchan, A., LeCleir, G.R., Gulvik, C.A., González, J.M., 2014. Master recyclers: features
and functions of bacteria associated with phytoplankton blooms. Nature Reviews
Microbiology 12(10), 686.
169
Busch, D., Kammann, C., Grünhage, L., Müller, C., 2012. Simple biotoxicity tests for
evaluation of carbonaceous soil additives: establishment and reproducibility of four test
procedures. Journal of environmental quality 41, 1023-1032.
Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., Madden,
T.L., 2009. BLAST+: architecture and applications. BMC Bioinformatics 10, 1.
Camps-Arbestain, M., Amonette, J.E., Singh, B., Wang, T., Schmidt, H.P., 2015. A biochar
classification system and associated test methods. Biochar for environmental
management: science, technology and implementation. Taylor and Francis, London, 165-
194.
Caporaso, J.G., Lauber, C.L., Walters, W.A., Berg-Lyons, D., Huntley, J., Fierer, N., Owens,
S.M., Betley, J., Fraser, L., Bauer, M., 2012. Ultra-high-throughput microbial
community analysis on the Illumina HiSeq and MiSeq platforms. ISME J 6, 1621-1624.
Case, S.D.C., McNamara, N.P., Reay, D.S., Whitaker, J., 2012. The effect of biochar addition
on N2O and CO2 emissions from a sandy loam soil – The role of soil aeration. Soil
Biology and Biochemistry 51, 125-134.
Cayuela, M.L., Sánchez-Monedero, M.A., Roig, A., Hanley, K., Enders, A., Lehmann, J.,
2013. Biochar and denitrification in soils: when, how much and why does biochar reduce
N2O emissions? Scientific reports 3.
Chan, K., Van Zwieten, L., Meszaros, I., Downie, A., Joseph, S., 2008. Using poultry litter
biochars as soil amendments. Soil Research 46, 437-444.
Chan, K.Y., Xu, Z., 2009. Biochar: nutrient properties and their enhancement. Biochar for
environmental management: Science and technology, 67-84.
Che, J., Zhao, X.Q., Zhou, X., Jia, Z.J., Shen, R.F., 2015. High pH-enhanced soil nitrification
was associated with ammonia-oxidizing bacteria rather than archaea in acidic soils.
Applied Soil Ecology 85, 21-29.
170
Chen, J., Li, S., Liang, C., Xu, Q., Li, Y., Qin, H., Fuhrmann, J.J., 2017. Response of
microbial community structure and function to short-term biochar amendment in an
intensively managed bamboo (Phyllostachys praecox) plantation soil: Effect of particle
size and addition rate. Science of the Total Environment 574, 24-33.
Chen, J., Liu, X., Zheng, J., Zhang, B., Lu, H., Chi, Z., Pan, G., Li, L., Zheng, J., Zhang, X.,
2013. Biochar soil amendment increased bacterial but decreased fungal gene abundance
with shifts in community structure in a slightly acid rice paddy from Southwest China.
Applied Soil Ecology 71, 33-44.
Chen, Y., Shinogi, Y., Taira, M., 2010. Influence of biochar use on sugarcane growth, soil
parameters, and groundwater quality. Soil Research 48, 526-530.
Chintala, R., Mollinedo, J., Schumacher, T.E., Malo, D.D., Julson, J.L., 2014. Effect of
biochar on chemical properties of acidic soil. Archives of Agronomy and Soil Science 60,
393-404.
Clough, T.J., Condron, L.M., 2010. Biochar and the Nitrogen Cycle: Introduction. Journal of
Environment Quality 39, 1218.
Daims, H., Lebedeva, E.V., Pjevac, P., Han, P., Herbold, C., Albertsen, M., Jehmlich, N.,
Palatinszky, M., Vierheilig, J., Bulaev, A., 2015. Complete nitrification by Nitrospira
bacteria. Nature 528, 504-509.
Dempster, D., Gleeson, D., Solaiman, Z., Jones, D., Murphy, D., 2012a. Decreased soil
microbial biomass and nitrogen mineralisation with Eucalyptus biochar addition to a
coarse textured soil. Plant and Soil 354, 311-324.
Dempster, D.N., Jones, D.L., Murphy, D.V., 2012b. Clay and biochar amendments decreased
inorganic but not dissolved organic nitrogen leaching in soil. Soil Research 50, 216-221.
171
Deng, W., Van Zwieten, L., Lin, Z., Liu, X., Sarmah, A.K., Wang, H., 2016. Sugarcane
bagasse biochars impact respiration and greenhouse gas emissions from a latosol. Journal
of Soils and Sediments, 1-9.
Di, H., Cameron, K., Shen, J.P., Winefield, C., O’Callaghan, M., Bowatte, S., He, J., 2009.
Nitrification driven by bacteria and not archaea in nitrogen-rich grassland soils. Nature
Geoscience 2, 621-624.
Dowd, S., Callaway, T., Wolcott, R., Sun, Y., McKeehan, T., Hagevoort, R., Edrington, T.,
2008. Evaluation of the bacterial diversity in the feces of cattle using 16S rDNA bacterial
tag-encoded FLX amplicon pyrosequencing (bTEFAP). BMC microbiology 8, 125.
Ducey, T.F., Ippolito, J.A., Cantrell, K.B., Novak, J.M., Lentz, R.D., 2013. Addition of
activated switchgrass biochar to an aridic subsoil increases microbial nitrogen cycling
gene abundances. Applied Soil Ecology 65, 65-72.
Edgar, R.C., 2010. Search and clustering orders of magnitude faster than BLAST.
Bioinformatics 26, 2460-2461.
Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., Knight, R., 2011. UCHIME improves
sensitivity and speed of chimera detection. Bioinformatics 27, 2194-2200.
Eivazi, F., Tabatabai, M., 1988. Glucosidases and galactosidases in soils. Soil Biology and
Biochemistry 20, 601-606.
Ennis, C.J., Evans, A.G., Islam, M., Ralebitso-Senior, T.K., Senior, E., 2012. Biochar: carbon
sequestration, land remediation, and impacts on soil microbiology. Critical Reviews in
Environmental Science and Technology 42, 2311-2364.
Eyles, A., Bound, S.A., Oliver, G., Corkrey, R., Hardie, M., Green, S., Close, D.C., 2015.
Impact of biochar amendment on the growth, physiology and fruit of a young
commercial apple orchard. Trees 29, 1817–1826.
172
Farrell, M., Griffith, G.W., Hobbs, P.J., Perkins, W.T., Jones, D.L., 2010. Microbial diversity
and activity are increased by compost amendment of metal-contaminated soil. FEMS
Microbiology Ecology 71, 94-105.
Feng, Y., Xu, Y., Yu, Y., Xie, Z., Lin, X., 2012. Mechanisms of biochar decreasing methane
emission from Chinese paddy soils. Soil Biology and Biochemistry 46, 80-88.
Fidel, R.B., Laird, D.A., Parkin, T.B., 2017. Impact of Biochar Organic and Inorganic Carbon
on Soil CO and N O Emissions. Journal of environmental quality.
Firestone, M.K., Firestone, R.B., Tiedje, J.M., 1980. Nitrous oxide from soil denitrification:
factors controlling its biological production. Science (New York, NY) 208, 749.
Fowles, M., 2007. Black carbon sequestration as an alternative to bioenergy. Biomass and
Bioenergy 31, 426-432.
Frąc, M., Oszust, K., Lipiec, J., 2012. Community level physiological profiles (CLPP),
characterization and microbial activity of soil amended with dairy sewage sludge.
Sensors 12, 3253-3268.
Frankenberger, W.T., Tabatabai, M., 1980. Amidase activity in soils: I. Method of assay. Soil
Science Society of America Journal 44, 282-287.
Frey, S., 2014. The spatial distribution of soil biota. In Soil microbiology, ecology and
biochemistry, E. L. Paul (ed.). Elsevier - Academic Press, Waltham, Mass.
Galinato, S.P., Yoder, J.K., Granatstein, D., 2011. The economic value of biochar in crop
production and carbon sequestration. Energy Policy 39, 6344-6350.
Garland, J.L., 1997. Analysis and interpretation of community-level physiological profiles in
microbial ecology. FEMS Microbiology Ecology 24, 289-300.
Garland, J.L., Mills, A.L., 1991. Classification and characterization of heterotrophic
microbial communities on the basis of patterns of community-level sole-carbon-source
utilization. Applied and Environmental Microbiology 57, 2351-2359.
173
Gaur, A., Adholeya, A., 2000. Effects of the particle size of soil-less substrates upon AM
fungus inoculum production. Mycorrhiza 10, 43-48.
German, L.A., 2003. Historical contingencies in the coevolution of environment and
livelihood: contributions to the debate on Amazonian Black Earth. Geoderma 111, 307-
331.
Glaser, B., Birk, J.J., 2012. State of the scientific knowledge on properties and genesis of
Anthropogenic Dark Earths in Central Amazonia (terra preta de Índio). Geochimica et
Cosmochimica Acta 82, 39-51.
Glaser, B., Haumaier, L., Guggenberger, G., Zech, W., 2001. The'Terra Preta'phenomenon: a
model for sustainable agriculture in the humid tropics. Naturwissenschaften 88, 37-41.
Glaser, B., Lehmann, J., Zech, W., 2002. Ameliorating physical and chemical properties of
highly weathered soils in the tropics with charcoal-a review. Biology and Fertility of
Soils 35, 219-230.
Gomez, E., Garland, J., Conti, M., 2004. Reproducibility in the response of soil bacterial
community-level physiological profiles from a land use intensification gradient. Applied
Soil Ecology 26, 21-30.
Gomez, J., Denef, K., Stewart, C., Zheng, J., Cotrufo, M., 2014. Biochar addition rate
influences soil microbial abundance and activity in temperate soils. European Journal of
Soil Science 65, 28-39.
Green, V., Stott, D., Diack, M., 2006. Assay for fluorescein diacetate hydrolytic activity:
optimization for soil samples. Soil Biology and Biochemistry 38, 693-701.
Güereña, D.T., Lehmann, J., Thies, J.E., Enders, A., Karanja, N., Neufeldt, H., 2015.
Partitioning the contributions of biochar properties to enhanced biological nitrogen
fixation in common bean (Phaseolus vulgaris). Biology and Fertility of Soils 51, 479-491.
174
Gul, S., Whalen, J.K., 2016. Biochemical cycling of nitrogen and phosphorus in biochar-
amended soils. Soil Biology and Biochemistry 103, 1-15.
Gundale, M.J., DeLuca, T.H., 2007. Charcoal effects on soil solution chemistry and growth
of Koeleria macrantha in the ponderosa pine/Douglas-fir ecosystem. Biology and
Fertility of Soils 43, 303-311.
Guo, M., Uchimiya, S.M., He, Z., 2016. Agricultural and environmental applications of
biochar: Advances and barriers. Agricultural and Environmental Applications of Biochar:
Advances and Barriers, 495-504.
Hallmann, J., Rodrıguez-Kábana, R., Kloepper, J., 1999. Chitin-mediated changes in bacterial
communities of the soil, rhizosphere and within roots of cotton in relation to nematode
control. Soil Biology and Biochemistry 31, 551-560.
Hammer, E.C., Balogh-Brunstad, Z., Jakobsen, I., Olsson, P.A., Stipp, S.L., Rillig, M.C.,
2014. A mycorrhizal fungus grows on biochar and captures phosphorus from its surfaces.
Soil Biology and Biochemistry 77, 252-260.
Han, X., Sun, X., Wang, C., Wu, M., Dong, D., Zhong, T., Thies, J.E., Wu, W., 2016.
Mitigating methane emission from paddy soil with rice-straw biochar amendment under
projected climate change. Scientific reports 6.
Hanan, E.J., Schimel, J.P., Dowdy, K., D'Antonio, C.M., 2016. Effects of substrate supply,
pH, and char on net nitrogen mineralization and nitrification along a wildfire-structured
age gradient in chaparral. Soil Biology and Biochemistry 95, 87–99.
Hangs, R., Ahmed, H., Schoenau, J., 2016. Influence of willow biochar amendment on soil
nitrogen availability and greenhouse gas production in two fertilized temperate prairie
soils. BioEnergy Research 9, 157-171.
175
Hansen, J., Sato, M., Ruedy, R., Lacis, A., Oinas, V., 2000. Global warming in the twenty-
first century: An alternative scenario. Proceedings of the National Academy of Sciences
97, 9875-9880.
Hardie, M., Clothier, B., Bound, S., Oliver, G., Close, D., 2014. Does biochar influence soil
physical properties and soil water availability? Plant and Soil, 1-15.
He, L., Liu, Y., Zhao, J., Bi, Y., Zhao, X., Wang, S., Xing, G., 2016a. Comparison of straw-
biochar-mediated changes in nitrification and ammonia oxidizers in agricultural oxisols
and cambosols. Biology and Fertility of Soils 52, 137–149.
He, L., Zhao, X., Wang, S., Xing, G., 2016b. The effects of rice-straw biochar addition on
nitrification activity and nitrous oxide emissions in two Oxisols. Soil and Tillage
Research 164, 52-62.
He, Z., Piceno, Y., Deng, Y., Xu, M., Lu, Z., DeSantis, T., Andersen, G., Hobbie, S.E., Reich,
P.B., Zhou, J., 2012. The phylogenetic composition and structure of soil microbial
communities shifts in response to elevated carbon dioxide. ISME J 6, 259-272.
Huber, T., Faulkner, G., Hugenholtz, P., 2004. Bellerophon: a program to detect chimeric
sequences in multiple sequence alignments. Bioinformatics 20, 2317-2319.
Hugerth, L.W., Muller, E.E., Hu, Y.O., Lebrun, L.A., Roume, H., Lundin, D., Wilmes, P.,
Andersson, A.F., 2014. Systematic design of 18S rRNA gene primers for determining
eukaryotic diversity in microbial consortia. PloS one 9, e95567.
Ippolito, J.A., Laird, D.A., Busscher, W.J., 2012. Environmental benefits of biochar. Journal
of environmental quality 41, 967-972.
Isbell, R., 2002. The Australian soil classification. CSIRO publishing.
Jia, Z., Conrad, R., 2009. Bacteria rather than Archaea dominate microbial ammonia
oxidation in an agricultural soil. Environmental Microbiology 11, 1658-1671.
176
Jones, D.L., Murphy, D.V., Khalid, M., Ahmad, W., Edwards-Jones, G., DeLuca, T.H., 2011.
Short-term biochar-induced increase in soil CO2 release is both biotically and abiotically
mediated. Soil Biology and Biochemistry 43, 1723-1731.
Joseph, S., Camps-Arbestain, M., Lin, Y., Munroe, P., Chia, C., Hook, J., Van Zwieten, L.,
Kimber, S., Cowie, A., Singh, B., 2010. An investigation into the reactions of biochar in
soil. Soil Research 48, 501-515.
Juhnke, M.E., Mathre, D., Sands, D., 1987. Identification and characterization of rhizosphere-
competent bacteria of wheat. Applied and Environmental Microbiology 53, 2793-2799.
Kandeler, E., 1995. Potential nitrification. In: Methods in Soil Biology (Schinner, F., O¨
hlinger, R., Kandeler, E., and Margesin,. 146–149. Springer, Berlin, Heidelberg.
Kelly, C.N., Peltz, C.D., Stanton, M., Rutherford, D.W., Rostad, C.E., 2014. Biochar
application to hardrock mine tailings: Soil quality, microbial activity, and toxic element
sorption. Applied Geochemistry 43, 35-48.
Keppler, F., Boros, M., Frankenberg, C., Lelieveld, J., McLeod, A., Pirttilä, A.M., Röckmann,
T., Schnitzler, J.-P., 2009. Methane formation in aerobic environments. Environmental
Chemistry 6, 459-465.
Kimetu, J.M., Lehmann, J., Ngoze, S.O., Mugendi, D.N., Kinyangi, J.M., Riha, S., Verchot,
L., Recha, J.W., Pell, A.N., 2008. Reversibility of soil productivity decline with organic
matter of differing quality along a degradation gradient. Ecosystems 11, 726-739.
Kloss, S., Zehetner, F., Dellantonio, A., Hamid, R., Ottner, F., Liedtke, V., Schwanninger, M.,
Gerzabek, M.H., Soja, G., 2012. Characterization of slow pyrolysis biochars: effects of
feedstocks and pyrolysis temperature on biochar properties. Journal of environmental
quality 41, 990-1000.
Knoblauch, C., Marifaat, A.-A., Haefele, M., 2008. Biochar in rice-based system: Impact on
carbon mineralization and trace gas emissions. Bioresource Technology 95, 255-257.
177
Kolb, S.E., Fermanich, K.J., Dornbush, M.E., 2009. Effect of charcoal quantity on microbial
biomass and activity in temperate soils. Soil Science Society of America Journal 73,
1173-1181.
Kookana, R., Sarmah, A., Van Zwieten, L., Krull, E., Singh, B., 2011. Biochar Application to
Soil: Agronomic and Environmental Benefits and Unintended Consequences. Advances
in Agronomy 112, 103.
Kotroczó, Z., Veres, Z., Fekete, I., Krakomperger, Z., Tóth, J.A., Lajtha, K., Tóthmérész, B.,
2014. Soil enzyme activity in response to long-term organic matter manipulation. Soil
Biology and Biochemistry 70, 237-243.
Kozich, J.J., Westcott, S.L., Baxter, N.T., Highlander, S.K., Schloss, P.D., 2013.
Development of a dual-index sequencing strategy and curation pipeline for analyzing
amplicon sequence data on the MiSeq Illumina sequencing platform. Applied and
Environmental Microbiology 79, 5112-5120.
Kumar, M., Babel, A., 2011. Available micronutrient status and their relationship with soil
properties of Jhunjhunu tehsil, district Jhunjhunu, Rajasthan, India. Journal of
Agricultural Science 3, p97.
Lane, D., 1991. 16S/23S rRNA sequencing. p. 115–175 In Stackebrandt E., Goodfellow M.,
editors. (ed.), Nucleic acid techniques in bacterial systematics. John Wiley & Sons,
Chichester, United Kingdom.
Lane, D.J., Pace, B., Olsen, G.J., Stahl, D.A., Sogin, M.L., Pace, N.R., 1985. Rapid
determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proceedings
of the National Academy of Sciences 82, 6955-6959.
Lanzén, A., Jørgensen, S.L., Bengtsson, M.M., Jonassen, I., Øvreås, L., Urich, T., 2011.
Exploring the composition and diversity of microbial communities at the Jan Mayen
178
hydrothermal vent field using RNA and DNA. FEMS Microbiology Ecology 77, 577-
589.
Lawrinenko, M., Laird, D.A., 2015. Anion exchange capacity of biochar. Green Chemistry
17, 4628-4636.
Lee, K., Foster, R., 1991. Soil fauna and soil structure. Soil Research 29, 745-775.
Lehmann, J., Czimczik, C., Laird, D., Sohi, S., 2009. Stability of biochar in soil. Biochar for
environmental management: Science and technology, 183-205.
Lehmann, J., Gaunt, J., Rondon, M., 2006. Bio-char Sequestration in Terrestrial Ecosystems
– A Review. Mitigation and Adaptation Strategies for Global Change 11, 395-419.
Lehmann, J., Joseph, S., 2009. Biochar for environmental management: science and
technology. Earthscan.
Lehmann, J., Rillig, M.C., Thies, J., Masiello, C.A., Hockaday, W.C., Crowley, D., 2011.
Biochar effects on soil biota – A review. Soil Biology and Biochemistry 43, 1812-1836.
Li, S., Song, L., Jin, Y., Liu, S., Shen, Q., Zou, J., 2016. Linking N2O emission from
biochar-amended composting process to the abundance of denitrify (nirK and nosZ)
bacteria community. AMB Express 6, 1-9.
Li, W., Godzik, A., 2006. Cd-hit: a fast program for clustering and comparing large sets of
protein or nucleotide sequences. Bioinformatics 22, 1658-1659.
Liu, J., Schulz, H., Brandl, S., Miehtke, H., Huwe, B., Glaser, B., 2012a. Short‐term effect of
biochar and compost on soil fertility and water status of a Dystric Cambisol in NE
Germany under field conditions. Journal of Plant Nutrition and Soil Science 175, 698-
707.
Liu, X.-y., Qu, J.-j., Li, L.-q., Zhang, A.-f., Jufeng, Z., Zheng, J.-w., Pan, G.-x., 2012b. Can
biochar amendment be an ecological engineering technology to depress N 2 O emission
179
in rice paddies?—A cross site field experiment from South China. Ecological
Engineering 42, 168-173.
Liu, Y., Yang, M., Wu, Y., Wang, H., Chen, Y., Wu, W., 2011. Reducing CH4 and CO2
emissions from waterlogged paddy soil with biochar. Journal of Soils and Sediments 11,
930-939.
López-Cano, I., Roig, A., Cayuela, M.L., Alburquerque, J.A., Sánchez-Monedero, M.A.,
2016. Biochar improves N cycling during composting of olive mill wastes and sheep
manure. Waste Management 49, 553-559.
Marstorp, H., Guan, X., Gong, P., 2000. Relationship between dsDNA, chloroform labile C
and ergosterol in soils of different organic matter contents and pH. Soil Biology and
Biochemistry 32, 879-882.
McCormack, S.A., Ostle, N., Bardgett, R.D., Hopkins, D.W., Vanbergen, A.J., 2013. Biochar
in bioenergy cropping systems: impacts on soil faunal communities and linked
ecosystem processes. GCB Bioenergy 5, 81-95.
McDonald, D., Price, M.N., Goodrich, J., Nawrocki, E.P., DeSantis, T.Z., Probst, A.,
Andersen, G.L., Knight, R., Hugenholtz, P., 2011. An improved Greengenes taxonomy
with explicit ranks for ecological and evolutionary analyses of bacteria and archaea.
ISME J 6, 610-618.
McDonald, R.C., Isbell, R., Speight, J.G., Walker, J., Hopkins, M., 1998. Australian soil and
land survey: field handbook. CSIRO publishing.
Meyer, F., Paarmann, D., D'Souza, M., Olson, R., Glass, E.M., Kubal, M., Paczian, T.,
Rodriguez, A., Stevens, R., Wilke, A., 2008. The metagenomics RAST server–a public
resource for the automatic phylogenetic and functional analysis of metagenomes. BMC
Bioinformatics 9, 386.
180
Mia, S., Van Groenigen, J., Van de Voorde, T., Oram, N., Bezemer, T., Mommer, L., Jeffery,
S., 2014. Biochar application rate affects biological nitrogen fixation in red clover
conditional on potassium availability. Agriculture, Ecosystems & Environment 191, 83-
91.
Mickan, B.S., Abbott, L.K., Stefanova, K., Solaiman, Z.M., 2016. Interactions between
biochar and mycorrhizal fungi in a water-stressed agricultural soil. Mycorrhiza, 1-10.
Mishra, B., Ramakrishnan, P., 1983. Slash and burn agriculture at higher elevations in north-
eastern India. I. Sediment, water and nutrient losses. Agriculture, Ecosystems &
Environment 9, 69-82.
Moore, J.C., Berlow, E.L., Coleman, D.C., Ruiter, P.C., Dong, Q., Hastings, A., Johnson,
N.C., McCann, K.S., Melville, K., Morin, P.J., 2004. Detritus, trophic dynamics and
biodiversity. Ecology Letters 7, 584-600.
Nelson, N.O., Agudelo, S.C., Yuan, W., Gan, J., 2011. Nitrogen and phosphorus availability
in biochar-amended soils. Soil Science 176, 218-226.
Nguyen, B.T., Lehmann, J., Kinyangi, J., Smernik, R., Riha, S.J., Engelhard, M.H., 2008.
Long-term black carbon dynamics in cultivated soil. Biogeochemistry 89, 295-308.
Niu, B., Fu, L., Sun, S., Li, W., 2010. Artificial and natural duplicates in pyrosequencing
reads of metagenomic data. BMC Bioinformatics 11, 187.
Novak, J.M., Busscher, W.J., Laird, D.L., Ahmedna, M., Watts, D.W., Niandou, M.A., 2009a.
Impact of biochar amendment on fertility of a southeastern coastal plain soil. Soil
Science 174, 105-112.
Novak, J.M., Lima, I., Xing, B., Gaskin, J.W., Steiner, C., Das, K., Ahmedna, M., Rehrah, D.,
Watts, D.W., Busscher, W.J., 2009b. Characterization of Designer Biochar Produced at
Different Temperatures and Their Effects on a Loamy Sand. Annals of Environmental
Science 3.
181
Noyce, G.L., Basiliko, N., Fulthorpe, R., Sackett, T.E., Thomas, S.C., 2015. Soil microbial
responses over 2 years following biochar addition to a north temperate forest. Biology
and Fertility of Soils, 1-11.
Nunes-Alves, C., 2016. Microbial ecology: Do it yourself nitrification. Nature Reviews
Microbiology 14, 61-61.
O'Neill, B., Grossman, J., Tsai, M.T., Gomes, J.E., Lehmann, J., Peterson, J., Neves, E.,
Thies, J.E., 2009. Bacterial community composition in Brazilian Anthrosols and adjacent
soils characterized using culturing and molecular identification. Microbial Ecology 58,
23-35.
Oehl, F., Silva, G.A.d., Goto, B.T., Sieverding, E., 2011. Glomeromycota: three new genera
and glomoid species reorganized. Mycotaxon 116, 75-120.
Ondov, B.D., Bergman, N.H., Phillippy, A.M., 2011. Interactive metagenomic visualization
in a Web browser. BMC Bioinformatics 12, 1.
Partey, S.T., Saito, K., Preziosi, R.F., Robson, G.D., 2015. Biochar use in a legume-rice
rotation system: effects on soil fertility and crop performance. Archives of Agronomy
and Soil Science, 199-215.
Paz-Ferreiro, J., Gascó, G., Gutiérrez, B., Méndez, A., 2012. Soil biochemical activities and
the geometric mean of enzyme activities after application of sewage sludge and sewage
sludge biochar to soil. Biology and Fertility of Soils 48, 511-517.
Prommer, J., Wanek, W., Hofhansl, F., Trojan, D., Offre, P., Urich, T., Schleper, C.,
Sassmann, S., Kitzler, B., Soja, G., 2014. Biochar decelerates soil organic nitrogen
cycling but stimulates soil nitrification in a temperate arable field trial. PloS one 9,
e86388.
Pruesse, E., Peplies, J., Glöckner, F.O., 2012. SINA: accurate high-throughput multiple
sequence alignment of ribosomal RNA genes. Bioinformatics 28, 1823-1829.
182
Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., Peplies, J., Glöckner,
F.O., 2013. The SILVA ribosomal RNA gene database project: improved data processing
and web-based tools. Nucleic Acids Research 41, D590-D596.
Quilliam, R.S., 2013. Biochar application reduces nodulation but increases nitrogenase
activity in clover. Plant and Soil 366, 83–92.
Rawls, W., Pachepsky, Y.A., Ritchie, J., Sobecki, T., Bloodworth, H., 2003. Effect of soil
organic carbon on soil water retention. Geoderma 116, 61-76.
Roberts, K.G., Gloy, B.A., Joseph, S., Scott, N.R., Lehmann, J., 2009. Life cycle assessment
of biochar systems: estimating the energetic, economic, and climate change potential.
Environmental Science & Technology 44, 827-833.
Rogovska, N., Laird, D., Cruse, R., Fleming, P., Parkin, T., Meek, D., 2011. Impact of
Biochar on Manure Carbon Stabilization and Greenhouse Gas Emissions. Soil Science
Society of America Journal 75, 871.
Rogovska, N., Laird, D., Cruse, R., Trabue, S., Heaton, E., 2012. Germination tests for
assessing biochar quality. Journal of environmental quality 41, 1014-1022.
Rondon, M., Ramirez, J., Lehmann, J., 2005. Greenhouse gas emissions decrease with
charcoal additions to tropical soils, Proceedings of the 3rd USDA Symposium on
Greenhouse Gases and Carbon Sequestration, Baltimore, USA, p. 208.
Rondon, M.A., Lehmann, J., Ramírez, J., Hurtado, M., 2006. Biological nitrogen fixation by
common beans (Phaseolus vulgaris L.) increases with bio-char additions. Biology and
Fertility of Soils 43, 699-708.
Rondon, M.A., Lehmann, J., Ramírez, J., Hurtado, M., 2007. Biological nitrogen fixation by
common beans (Phaseolus vulgaris L.) increases with bio-char additions. Biology and
Fertility of Soils 43, 699-708.
183
Ros, M., Klammer, S., Knapp, B., Aichberger, K., Insam, H., 2006. Long‐term effects of
compost amendment of soil on functional and structural diversity and microbial activity.
Soil use and management 22, 209-218.
Saison, C., Degrange, V., Oliver, R., Millard, P., Commeaux, C., Montange, D., Le Roux, X.,
2006. Alteration and resilience of the soil microbial community following compost
amendment: effects of compost level and compost‐borne microbial community.
Environmental Microbiology 8, 247-257.
Schimmelpfennig, S., Glaser, B., 2012. One step forward toward characterization: some
important material properties to distinguish biochars. Journal of environmental quality 41,
1001-1013.
Segata, N., Izard, J., Waldron, L., Gevers, D., Miropolsky, L., Garrett, W.S., Huttenhower, C.,
2011. Metagenomic biomarker discovery and explanation. Genome biology 12, 1.
Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez, R., McWilliam,
H., Remmert, M., Söding, J., 2011. Fast, scalable generation of high‐quality protein
multiple sequence alignments using Clustal Omega. Molecular Systems Biology 7.
Singh, B., Singh, B.P., Cowie, A.L., 2010a. Characterisation and evaluation of biochars for
their application as a soil amendment. Soil Research 48, 516-525.
Singh, B.P., Hatton, B.J., Singh, B., Cowie, A.L., Kathuria, A., 2010b. Influence of Biochars
on Nitrous Oxide Emission and Nitrogen Leaching from Two Contrasting Soils. Journal
of Environment Quality 39, 1224.
Smithwick, E.A.H., Turner, M.G., Mack, M.C., Chapin, F.S., 2005. Postfire Soil N Cycling
in Northern Conifer Forests Affected by Severe, Stand-Replacing Wildfires. Ecosystems
8, 163-181.
Sohi, S., Krull, E., Lopez-Capel, E., Bol, R., 2010. A review of biochar and its use and
function in soil. Advances in Agronomy 105, 47-82.
184
Solaiman, Z.M., Blackwell, P., Abbott, L.K., Storer, P., 2010. Direct and residual effect of
biochar application on mycorrhizal root colonisation, growth and nutrition of wheat. Soil
Research 48, 546-554.
Song, Y., Zhang, X., Ma, B., Chang, S.X., Gong, J., 2014. Biochar addition affected the
dynamics of ammonia oxidizers and nitrification in microcosms of a coastal alkaline soil.
Biology and Fertility of Soils 50, 321-332.
Sorrenti, G., Buriani, G., Gaggìa, F., Baffoni, L., Spinelli, F., Di Gioia, D., Toselli, M., 2017.
Soil CO 2 emission partitioning, bacterial community profile and gene expression of
Nitrosomonas spp. and Nitrobacter spp. of a sandy soil amended with biochar and
compost. Applied Soil Ecology 112, 79-89.
Spokas, K.A., Cantrell, K.B., Novak, J.M., Archer, D.W., Ippolito, J.A., Collins, H.P.,
Boateng, A.A., Lima, I.M., Lamb, M.C., McAloon, A.J., 2012. Biochar: a synthesis of its
agronomic impact beyond carbon sequestration. Journal of environmental quality 41,
973-989.
Spokas, K.A., Koskinen, W.C., Baker, J.M., Reicosky, D.C., 2009. Impacts of woodchip
biochar additions on greenhouse gas production and sorption/degradation of two
herbicides in a Minnesota soil. Chemosphere 77, 574-581.
Spokas, K.A., Reicosky, D.C., 2009. Impacts of sixteen different biochars on soil greenhouse
gas production. Annals of Environmental Science 3, 4.
Steinbeiss, S., Gleixner, G., Antonietti, M., 2009. Effect of biochar amendment on soil
carbon balance and soil microbial activity. Soil Biology and Biochemistry 41, 1301-1310.
Steiner, C., Teixeira, W.G., Lehmann, J., Nehls, T., de Macêdo, J.L.V., Blum, W.E., Zech,
W., 2007. Long term effects of manure, charcoal and mineral fertilization on crop
production and fertility on a highly weathered Central Amazonian upland soil. Plant and
Soil 291, 275-290.
185
Tabatabai, M., Bremner, J., 1969. Use of p-nitrophenyl phosphate for assay of soil
phosphatase activity. Soil Biology and Biochemistry 1, 301-307.
Tabatabai, M., Bremner, J., 1970. Arylsulfatase activity of soils. Soil Science Society of
America Journal 34, 225-229.
Tabatabai, M., Bremner, J., 1972. Assay of urease activity in soils. Soil Biology and
Biochemistry 4, 479-487.
Tammeorg, P., Bastos, A.C., Jeffery, S., Rees, F., Kern, J., Graber, E.R., Ventura, M.,
Kibblewhite, M., Amaro, A., Budai, A., Cordovil, C.M.d.S., Domene, X., Gardi, C.,
Gascó, G., Horák, J., Kammann, C., Kondrlova, E., Laird, D., Loureiro, S., Martins,
M.A.S., Panzacchi, P., Prasad, M., Prodana, M., Puga, A.P., Ruysschaert, G., Sas-Paszt,
L., Silva, F.C., Teixeira, W.G., Tonon, G., Delle Vedove, G., Zavalloni, C., Glaser, B.,
Verheijen, F.G.A., 2016. Biochars in soils: towards the required level of scientific
understanding. Journal of Environmental Engineering and Landscape Management, 1-16.
Thies, J., Rillig, M.C., 2009. Characteristics of biochar: biological properties. Biochar for
environmental management: Science and technology, 85-105.
Tong, H., Hu, M., Li, F., Liu, C., Chen, M., 2014. Biochar enhances the microbial and
chemical transformation of pentachlorophenol in paddy soil. Soil Biology and
Biochemistry 70, 142-150.
Traunspurger, W., Bergtold, M., Goedkoop, W., 1997. The effects of nematodes on bacterial
activity and abundance in a freshwater sediment. Oecologia 112, 118-122.
Treseder, K.K., 2004. A meta‐analysis of mycorrhizal responses to nitrogen, phosphorus, and
atmospheric CO2 in field studies. New Phytologist 164, 347-355.
Ulyett, J., Sakrabani, R., Kibblewhite, M., Hann, M., 2014. Impact of biochar addition on
water retention, nitrification and carbon dioxide evolution from two sandy loam soils.
European Journal of Soil Science 65, 96-104.
186
Unger, R., Killorn, R., Brewer, C., 2011. Effects of Soil Application of Different Biochars on
Selected Soil Chemical Properties. Communications in Soil Science and Plant Analysis
42, 2310-2321.
Uzoma, K., Inoue, M., Andry, H., Fujimaki, H., Zahoor, A., Nishihara, E., 2011. Effect of
cow manure biochar on maize productivity under sandy soil condition. Soil use and
management 27, 205-212.
van Kessel, M.A., Speth, D.R., Albertsen, M., Nielsen, P.H., den Camp, H.J.O., Kartal, B.,
Jetten, M.S., Lücker, S., 2015. Complete nitrification by a single microorganism. Nature
528, 555-559.
Van Zwieten, L., Kimber, S., Morris, S., Chan, K., Downie, A., Rust, J., Joseph, S., Cowie,
A., 2010. Effects of biochar from slow pyrolysis of papermill waste on agronomic
performance and soil fertility. Plant and Soil 327, 235-246.
Von Mersi, W., Schinner, F., 1991. An improved and accurate method for determining the
dehydrogenase activity of soils with iodonitrotetrazolium chloride. Biology and Fertility
of Soils 11, 216-220.
Wang, J., Wang, L., Feng, X., Hu, H., Cai, Z., Müller, C., Zhang, J., 2016. Soil N
transformations and its controlling factors in temperate grasslands in China: A study
from 15N tracing experiment to literature synthesis. Journal of Geophysical Research:
Biogeosciences 121, 2949-2959.
Wang, J., Zhang, M., Xiong, Z., Liu, P., Pan, G., 2011. Effects of biochar addition on N2O
and CO2 emissions from two paddy soils. Biology and Fertility of Soils 47, 887-896.
Wang, Q., Garrity, G.M., Tiedje, J.M., Cole, J.R., 2007. Naive Bayesian classifier for rapid
assignment of rRNA sequences into the new bacterial taxonomy. Applied and
Environmental Microbiology 73, 5261-5267.
187
Warnock, D.D., Lehmann, J., Kuyper, T.W., Rillig, M.C., 2007. Mycorrhizal responses to
biochar in soil–concepts and mechanisms. Plant and Soil 300, 9-20.
Warnock, D.D., Mummey, D.L., McBride, B., Major, J., Lehmann, J., Rillig, M.C., 2010.
Influences of non-herbaceous biochar on arbuscular mycorrhizal fungal abundances in
roots and soils: results from growth-chamber and field experiments. Applied Soil
Ecology 46, 450-456.
Weber, K.P., Legge, R.L., 2009. One-dimensional metric for tracking bacterial community
divergence using sole carbon source utilization patterns. Journal of Microbiological
Methods 79, 55-61.
Wilke, A., Harrison, T., Wilkening, J., Field, D., Glass, E.M., Kyrpides, N., Mavrommatis, K.,
Meyer, F., 2012. The M5nr: a novel non-redundant database containing protein
sequences and annotations from multiple sources and associated tools. BMC
Bioinformatics 13, 141.
Woolf, D., Amonette, J.E., Street-Perrott, F.A., Lehmann, J., Joseph, S., 2010. Sustainable
biochar to mitigate global climate change. Nat Commun 1, 56.
Wrobel-Tobiszewska, A., Boersma, M., Sargison, J., Adams, P., Jarick, S., 2015. An
economic analysis of biochar production using residues from Eucalypt plantations.
Biomass and Bioenergy 81, 177-182.
Xu, N., Tan, G., Wang, H., Gai, X., 2016. Effect of biochar additions to soil on nitrogen
leaching, microbial biomass and bacterial community structure. European Journal of Soil
Biology 74, 1-8.
Yang, F., Lee, X., Theng, B.K., Wang, B., Cheng, J., Wang, Q., 2016. Effect of biochar
addition on short-term N2O and CO2 emissions during repeated drying and wetting of an
anthropogenic alluvial soil. Environmental Geochemistry and Health, 1-13.
188
Yao, Q., Liu, J., Yu, Z., Li, Y., Jin, J., Liu, X., Wang, G., 2017. Changes of bacterial
community compositions after three years of biochar application in a black soil of
northeast China. Applied Soil Ecology 113, 11-21.
Yao, Y., Gao, B., Zhang, M., Inyang, M., Zimmerman, A.R., 2012. Effect of biochar
amendment on sorption and leaching of nitrate, ammonium, and phosphate in a sandy
soil. Chemosphere 89, 1467-1471.
Yoshitake, S., Uchida, M., Koizumi, H., Nakatsubo, T., 2007. Carbon and nitrogen limitation
of soil microbial respiration in a High Arctic successional glacier foreland near Ny‐
Ålesund, Svalbard. Polar Research 26, 22-30.
Yu, L., Tang, J., Zhang, R., Wu, Q., Gong, M., 2013. Effects of biochar application on soil
methane emission at different soil moisture levels. Biology and Fertility of Soils 49, 119-
128.
Zhang, A., Cui, L., Pan, G., Li, L., Hussain, Q., Zhang, X., Zheng, J., Crowley, D., 2010.
Effect of biochar amendment on yield and methane and nitrous oxide emissions from a
rice paddy from Tai Lake plain, China. Agriculture, Ecosystems & Environment 139,
469-475.
Zhang, D., Pan, G., Wu, G., Kibue, G.W., Li, L., Zhang, X., Zheng, J., Zheng, J., Cheng, K.,
Joseph, S., 2016a. Biochar helps enhance maize productivity and reduce greenhouse gas
emissions under balanced fertilization in a rainfed low fertility inceptisol. Chemosphere
142, 106-113.
Zhang, D., Yan, M., Niu, Y., Liu, X., van Zwieten, L., Chen, D., Bian, R., Cheng, K., Li, L.,
Joseph, S., 2016b. Is current biochar research addressing global soil constraints for
sustainable agriculture? Agriculture, Ecosystems & Environment 226, 25-32.
189
Zhang, H., Voroney, R., Price, G., 2015. Effects of temperature and processing conditions on
biochar chemical properties and their influence on soil C and N transformations. Soil
Biology and Biochemistry 83, 19-28.
Zimmerman, A.R., 2010. Abiotic and microbial oxidation of laboratory-produced black
carbon (biochar). Environmental Science & Technology 44, 1295-1301.
Zimmerman, A.R., Gao, B., Ahn, M.-Y., 2011. Positive and negative carbon mineralization
priming effects among a variety of biochar-amended soils. Soil Biology and
Biochemistry 43, 1169-1179.
top related