jinsong pang tel. 85099367 e-mail: pangjs542@nenu.edu.cn key laboratory of molecular biology...

Jinsong PangTel. 85099367

E-mail: pangjs542@nenu.edu.cn

Key laboratory of molecular biology epigenetics of MOE

From Genes to Genomes

Watson and Crick: DNA double helix (1953)

Eukaryotic chromosome SV40 minichromosome

•The bases are covalently attached to the 1’ position of a pentose sugar ring, to form a nucleoside

•Adenosine, guanosine, cytidine, thymidine, uridine

Glycosidic (glycoside, glycosylic) bond

•R•Ribose or •2’-deoxyribose

Nucleosides

•Bases in DNA

•purines

•pyrimidines

•adenine

•guanine

•cytosine

•thymine

•N9

•N1

BASES NUCLEOSIDES

NUCLEOTIDES

Adenine (A) Adenosine Adenosine 5’-triphosphate (ATP)

Deoxyadenosine Deoxyadenosine 5’-triphosphate (dATP)

Guanine (G) Guanosine Guanosine 5’-triphosphate (GTP)

Deoxyguanosine Deoxy-guanosine 5’-triphosphate (dGTP)

Cytosine (C) Cytidine Cytidine 5’-triphosphate (CTP)

Deoxycytidine Deoxy-cytidine 5’-triphosphate (dCTP)

Thymine (T) Thymidine/

Deoxythymidie

Thymidine/deoxythymidie

5’-triphosphate (dTTP)

Uracil (U) Uridine Uridine 5’-triphosphate (UTP)

GeneGene: A molecular unit of heredity of a living organism. A molecular unit of heredity of a living organism. The segment of DNA specifying production of a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).

Gene is a "particulate factor" that passes unchanged from parent to progeny. (Mendel 1865)

A brief history of genetics

The central dogma: Crick 1958A gene codes for an RNA, which may code for protein.

Exon is any segment of an interrupted gene that is represented in the mature RNA product.Intron is a segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it.RNA splicing is the process of excising the sequences in RNA that correspond to introns, so that the sequences corresponding to exons are connected into a continuous mRNA.Structural gene codes for any RNA or protein product other than a regulator.Transcript is the RNA product produced by copying one strand of DNA. It may require processing to generate mature RNAs.

Eukaryotic genes are often interrupted

Comparison of the cDNA and genomic DNA for mouse -globin shows that the gene has two introns that are not present in the cDNA. The exons can be aligned exactly between cDNA and gene.

2.5 Organization of interrupted genes may be conserved

Alternative splicing generates the a and b variants of troponin T.

Alternative splicing uses the same pre-mRNA to generate mRNAs that have different combinations of exons.

Most genes are uninterrupted in yeast, but most genes are interrupted in flies and mammals.

Yeast genes are small, but genes in flies and mammals have a dispersed distribution extending to very large sizes.

Exons coding for proteins are usually short. Introns range from very short to very long.

•Polymorphism (more fully genetic polymorphism): The simultaneous occurrence in the population of genomes showing variations at a given position.•Single nucleotide polymorphism (SNP): The polymorphism (variation in sequence between individuals) caused by a change in a single nucleotide.

An exon surrounded by flanking sequences that is translocated into an intron may be spliced into the RNA product.

Human chromosomesHuman chromosomes

Heterochromatin describes regions of the genome that are permanently in a highly condensed condition are not transcribed, and are late-replicating. May be constitutive or facultative.Euchromatin comprises all of the genome in the interphase nucleus except for the heterochromatin.

The contrast between interphase chromatin and mitotic chromosomes

•The importance of packing of DNA into chromosomes

Chromosome is a compact form of the DNA that readily fits inside the cell

To protect DNA from damage DNA in a chromosome can be transmitted efficiently to

both daughter cells during cell division Chromosome confers an overall organization to each

molecule of DNA, which facilitates gene expression as well as recombination

•Chromosome sequence & diversity

Chromosomes

Shape: circular or linear

Number in an organism is characteristic

Copy: haploid, diploid, polyploid

•Genomes•3/15/05

GenomeGenome

Genome: The complete set of sequences in the genetic material of an organism.

Transcriptome: The complete set of RNAs present in a cell, tissue, or organism.

Proteome: The complete set of proteins that is expressed by the entire genome.

Genome size: the length of DNA associated with one haploid complement of chromosomes

Gene number: the number of genes included in a genome

Gene density: the average number of genes per Mb of genomic DNA

Genome & the complexity of the organism

•3/15/05

•Genome & genes

•Genome: all DNA sequences in a cell

•Genes: a stretch of continuous DNA sequence encoding a protein or RNA

•C-value is the quantity of DNA in the genome (per haploid set of chromosomes).

•C-value paradox refers to the lack of a correlation between genome size and genetic complexity (ie. Lungfish 139Gb vs. human 3Gb)

non-coding sequence• DNA sequence that does not code for protein or RNA, including

1. Introns (unique sequence) in genes

2. DNA consisting of multiple repeats, can be tandemly repeated sequences (e.g. satellite DNA) or interspersed repeats (e.g. Alu element) etc.

•Tandem gene clusters :

1. moderately repetitive DNA consists of a number of types of repeated sequence.

2. genes whose products are required in unusually large quantities, e.g. there are 10-10000 copies of rDNA encoding 45S precursor and X100 copies of histone genes.

Repetitive DNA

•The proportions of different sequence components vary in different genomes.

•The largest component of the human genome consists of transposons. Other repetitive sequences include large duplications and simple repeats.

•Satellite DNA (simple sequence) :

- Highly repetitive DNA (>106).

- very short (2 to 20-30bp, mini- or micro-), in tandem arrays

- concentrated near the centromeres and forms a large part of heterochromatin.

- as separate band in buoyant density gradient

- no function found, except a possible role in kinetochore binding

- Minisatellite repeats are the basis of the DNA fingerprinting techniques

•5’ – ATAAACTATAAACTATAAACT – 3’•3’ – TATTTGATATTTGATATTTGA – 5’

•Drosophila satellite DNA repeat•(several million copies)

•ACAAACT, 1.1x107 bp, 25% genome•ATAAACT, 3.6x106 bp, 8% genome•ACAAATT, 3.6x106 bp, 8% genome•AATATAG, cryptic•Satellites comprise more than 40% of the genome

•Human mitochondrial DNA has 22 tRNA genes, 2 rRNA genes, and 13 protein-coding regions. 14 of the 15 protein-coding or rRNA-coding regions are transcribed in the same direction. 14 of the tRNA genes are expressed in the clockwise direction and 8 are read counter clockwise.

CpG islands and the promoters of housekeeping genes

• Half of the molecular mass of eukaryotic chromosome is protein

In eukaryotic cells a given region of DNA with its associated proteins is called chromatin

The majority of the associated proteins are small, basic proteins called histones.

Other proteins associated with the chromosome are referred to as non-histone proteins, including numerous DNA binding proteins that regulate the transcription, replication, repair and recombination of DNA.

Nucleosomes: regular association of DNA with histones to form a structure effectively compacting DNA

•Proteins in chromosome

Centromeres, origin of replication and telomere are required for eukaryotic chromosome maintenance

Eukaryotic chromosome duplication & segregation occur in separate phases of the cell cycle

Cell cycle: a single round of cell divisionMitotic cell division: the chromosome number is

maintained during cell division

Required for the correct segregation of the chromosomes after replication

Direct the formation of kinetochore (an elaborate protein complex) essential for chromosome segregation

One chromosome, one centromere

The size varies (200 bp- >40 kb)

Composed of largely repetitive DNA sequences

•Centromeres

1.The region where two chromatids are joined

2.The sites of attachment to the mitotic spindle via kinetochore

3.Centromere DNA:

•The centromere

•AT-rich (88bp)•Yeast:

•Mitotic chromosome

•Mitotic

spindle

Mitotic chromosome - centromere

•Yeast centromere

Mammalian cells: much longer, flanked by satellite DNA

1. Specialized DNA sequences which form the ends of the linear DNA of the eukaryotic chromosome

2. Contains up to hundreds copies of a short repeated sequence (5’-TTAGGG-3’ in human)

3. Synthesized by the enzyme telomerase (a ribonucleoprotein) independent of normal DNA replication.

4. The telomeric DNA forms a special secondary structure to protect the chromosomal ends from degradation

•The Telomere

•Telomere & Telomerase

•Repeat sequence: Tetrahymena- TTGGGG; human- TTAGGG

•A loop structure forms at the end of chromosomal DNA

•Telomere: structure

The eukaryotic mitotic cell cycle

Nucleosomes are the building blocks of chromosomes

The nucleosome is composed of a core of eight histone proteins and the DNA (core DNA, 147 bp) wrapped around them. The DNA between each nucleosome is called a linker DNA. Each eukaryote has a characteristic average linker DNA length (20-60 bp)

The 10 nm fiber in partially unwound state can be seen to consist of a string of nucleosomes. Photograph kindly provided by Barbara Hamkalo.

The path of nucleosomes in the chromatin fiber

•Nucleosome core•146 bp, 1.8 superhelical turn

•Chromatosome•166 bp, 2 superhelical turn

DNAHistone octamer

Histone H1

The structure of nucleosome

Five abundant histones are H1 (linker histone, 20 kd), H2A, H2B, H3 and H4 (core histones, 11-15 kd).

The core histones share a common structural fold, called histone-fold domain

The core histones each have an N-terminal “tail”, the sites of extensive modifications

Histones are small, positively charged (basic) proteins

DNA packaged into nucleosomeDNA packaged into nucleosome

Six-fold DNA compaction

Many DNA sequence-independent contacts (?) mediate interaction between the core histones and DNA

The histone N-terminal tails stabilize DNA wrapping around the octamer

The histone tails emerge from the core of the nucleosome at specific positions, serving as the grooves of a screw to direct the DNA wrapping around the histone core in a left-handed manner.

Histone H1 binds to the linker DNA between nucleosome, inducing tighter DNA wrapping around the nucleosome

The role of H1

• 23 kDa, located outside of nucleosome core, binds to DNA more loosely

• Less conserved in its sequence

1. Stabilizes the point at which DNA enters and leaves the nucleosome core.

2. C- tail of H1: stabilizes the DNA between the nucleosome cores.

•The interaction of DNA with the histone octamer is dynamic

There are factors acting on the nucleosome to increase or decrease the dynamic natureThe dynamic nature of DNA-binding to the histone core is important for access of DNA by other proteins essential genome expression etc.

Histone variants and modification

• The major mechanisms for the condensing and decondensing of

chromatin operate directly through the histone proteins which carry out

the packaging.

• Short-term changes in chromosome packing modulated by chemical

modification of histone proteins

• Actively transcribed chromatin: via acetylation of lysine residues in the N-

terminal regions of the core histones.

• Condensation of chromosomes at mitosis: by the phosphorylation of

histone H1.

• Longer term differences in chromatin condensation: associated with

changes due to stages in development and different tissue types.

• Utilization of alternative histone variants, H5 replacing H1 in some very

inactive chromatin.

Modification of the histone N-terminal tails alters the function of chromatin

Interphase chromosomes: chromatin

Heterochromatin

1. Highly condensed

2. Transcriptionally inactive

3. Can be the repeated satellite DNA close to the centromeres, and sometimes a whole chromosome (e.g. one X chromosome in mammals)

Euchromatin: chromatin other than heterochromatin. 1. More diffused and not visible

2. The region where transcription takes place

3. Not homogenous, only a portion (~10%) euchromatin is transcriptionally active where the 30nm fiber has been dissociated to “beads on a string” structure and parts of these regions may be depleted of nucleosome.

DNase I hypersensitivityDNase I hypersensitivity

•Euchromatin

• CpG methylation : CpG island• Methylation of C-5 in the cytosine base of 5’-CG-3’• Occurs in mammalian cells• Signaling the appropriate level of chromosomal packing at

the sites of expressed genes • CpG methylation is associated with transcriptionally inactive

regions of chromatin• Islands of unmethylated CpG are coincident with regions of

DNase I hypersensitivity• “Islands”: surround the promoters of housekeeping genes.• Responsible for epigenetic and may also to RNA silencing

•Euchromatin

•DNase I hypersensitivity

Brief summary1. Prokaryotic chromosome: closed-circular DNA, domains/loops,

negatively supercoiled, HU & H-NS

2. Eukaryotic chromatin: Histones (octamer: H2A, H2B, H3, H4)+146bp DNA > Nucleosomes + H1 > chromatosome + Linker DNA > beads on string > 30nm fiber > fiber loop + nuclear matrix > highly ordered chromatin > > > chromosome

3. Eukaryotic chromosome structure: centromere, kinetochore, telomere, hetero- or euchromatin, CpG island and methylation

4. Genome complexity: noncoding DNA, unique sequence, repetitive DNA, satellite DNA