regulation studies of argo of e.coli by lysg mutants of corynebacterium glutamicum
Post on 14-Apr-2018
218 Views
Preview:
TRANSCRIPT
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
1/34
La
Centre fo
Regulatio
LysG mu
Sum
Indian
Indian NatiThe Nationa
1
boratory of Bacterial Genetics
DNA Fingerprinting and Diagnos
Guide: Dr. . Gowrishankar
studies ofargO of
tants ofCorynebact
glutamicum
er Research Fellowship 20
by
Aayudh Das
University of Calcutta
Academy of Sciences, Bangalore
onal Academy of Sciences, New DAcademy of Sciences India, Allah
tics
.coliby
rium
2
lhiabad
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
2/34
2
ACKNOWLEDGEMENT
I desire to show my sense of gratitude to the Indian Academy of Sciences, Indian National Academy of
Sciences and National Academy of Sciences for granting me the Summer Research Fellowship to work in
the Laboratory of Bacterial Genetics, CDFD Hyderabad.
My sincere thanks to Dr. J. Gowrishankar , Director, CDFD and Head, Laboratory of Bacterial Genetics as
well as my guide for permitting me to work in his laboratory as a summer trainee and allowing to attend
his lab meetings and seminars.
I thank Dr. K. Anupama, Scientist III, CDFD and my supervisor, for her patient guidance and support.
I acknowledge gratefully all LBGians, Amit, Nora, Aanisa, Amar, Raj, Shanthy, Mishraji, Suchitra, Shaffiqu,
Dr. Krishna Leela, Dr. Bindu, Dr. Vimala, for helping me out in different occasions. Dr. Harinarayanan and
Dr. Abhijit deserve special mention for useful discussions and criticism.
I wish to thank Vamsee, Giri and Debashish for providing me with media and other chemicals during my
work at LBG.
I thank NGTF for providing me with the DNA sequences on time.
To my friends and well-wishers of other laboratories and my co-summer trainees, my gratitude is
boundless- they made my stay in CDFD immensely enjoyable.
I have received complete support from my parents and sister all through and this has been a great source
of strength.
Aayudh Das
27.07.2012
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
3/34
3
~CONTENT~
ABSTRACT INTRODUCTION
OBJECTIVE
Materials
METHODS
RESULTS
DISCUSSION
REFERENCE
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
4/34
4
ABSTRACT
The pairs ArgP-argO of Escherichia coli and LysG-lysE of Corynebacterium glutamicum are orthologous,
with the first member of each pair being a LysR-type transcriptional regulator and the second its target
encoding a basic amino acid exporter. Whereas LysE is an exporter of arginine (Arg) and lysine (Lys)
whose expression is induced by Arg, Lys, or histidine (His), ArgO exports Arg alone and its expression is
activated by Arg but not Lys or His. Of several ArgP-dominant (ArgPd) variants that confer elevated Arg-
independent argO expression, ArgP (S94L), ArgP (P108S) and ArgP (P274S) activates lysEexpression in E.
coli. We constructed several LysG mutants at the corresponding residues of LysG namely T94L, P108S and
L274S to determine if they regulate argO. In the presence of arginine all those mutants activates the
transcription ofargO. So we can conclude that LysG mutants regulate argO in the presence of arginine.
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
5/34
INTRODUCTIO
A common mechanism for activatio
transcription factor of RNA polym
productive transcription.
LTTRs-
The family ofLysR-type transcripti
and Gram-negative bacteria, with
These proteins are involved in mod
cases is achieved by their binding t
between an individual protein, its
cross-talk has been identified bet
related function such as those for
reported between LTTR ortholo
transcriptional regulators share co
the mechanisms by which they bo
extensive structural homology espe
(A)
RBS
(B)
RBS
Fig 1: Schematic presentation (A)
transcription as RNAP is not rec
transcription as RNAP gets recruite
5
N
n of gene expression in all organisms is that
erase (RNAP) to a promoter so that the l
nal regulators (LTTRs) is widely distributed
multiple paralogs being represented even
ulating an extremely diverse set of metabol
co-effector ligands. Considerable specificit
co-effector(s) and cognate target(s); nevert
een LysR-type paralogs in a single bacteri
catabolism of aromatic compounds but no
s. Structural studies have indicated tha
mon protein folds, they differ in their oligo
th bind to DNA regulatory regions and co
cially at N-terminal DNA binding domain.
ABS -35 -10
Active
ABS -35 -10 +1
showing that LTTRs in absence of any c
ruited. (B) LTTRs in the presence any c
d.
involving recruitment by a
atter can then engage in
across both Gram-positive
within a single organism.
ic functions which in most
y exists in the interactions
heless, a limited extent of
ium that control genes of
cross regulation has been
although the LysR-type
merization properties and
tact RNAP. They have an
1
transcription
o-effectors cannot induce
-effectors is able induce
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
6/34
LysG-LysE ofC. glutamic
The proteins LysG and ArgP are
positive Corynebacterium glutam
regulator of LysE expression and liLysE and ArgO belongs to the famil
Fig 2: Schematic representation sh
LysE exports both lysine (Lys) and
transcription in presence of Arg, L
not Lys or His;
(A)
(i)
(ii)
(iii)
Fig 3: Schematic presentation (
transcription ofargOas RNAP is n
expression takes place. iii- In the
6
um and ArgP-argO of E.coli-
orthologous members of the LysR family
cum and Gram-negative Escherichia coli.
ikewise ArgP regulates expression of ArgO of amino acid exporters in bacteria.
wing LysG regulates LysE and ArgPregula
rginine (Arg), ArgO is an exporter only of A
s or histidine (His), while ArgP activates ar
(B)
(i)
(ii)
A) i- showing that ArgP without any c
t recruited. ii- In the presence of arginine R
presence of lysine ArgP actively shuts off
from, respectively, Gram-
LysG is a transcriptional
which is a LysE ortholog.
tes ArgO.
rg. The LysG activates lysE
gO in presence of Arg but
o-effector cannot induce
NAP is recruited and argO
argO transcription. (B) i-
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
7/34
showing that LysG without any co-
ii- In the presence of arginine or lys
Cross regulation betwee
Fig 4: Schematic presentation show
LysE regulate argOnor ArgP regula
Sequence Al ignment stud
Sequence alignment ClustalW wa
observed the corresponding residu
LysG were T94L, P108S, L274S.
Fig 5: Schematic representationglutamicum.
7
effector cannot induce transcription of LysE
ine RNAP gets recruited and LysE transcript
LTTRs-
1. It has been repo
regulate argO
2. ArgP doesnt regulat
But is has been reporte
mutants namely S94L a
lysE constitutively but
R217L are unable to acti
ing neither
te lysE.
ies ofArgP andLysG-
used to obtain ArgP of E.coli and LysG
es for E.coliArgP (T94L) , ArgP (L274S), Arg
howing the sequence alignment of ArgP
as RNAP is not recruited.
ion takes place.
rted that LysG doesnt
e lysE
d that some of the ArgPd
nd P274S, P108S activate
V144M, Q65V, R295L,
vate lysE.
of C. glutamicum. It was
(P108S) in C. glutamicum
of E.coli and LysG of C.
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
8/34
8
Table 1: LysG mutants-
LysG mutants Amino acid change
L274S Lysine to Serine (CTGTCT/AGA)
T94L Theronine to Lysine (ACCTTA/AAT)
P108S Proline to Serine (CCCTCT/AGA)
V144M Valine to Methionine (GTAATG/TAC)
Q65V Glutamine to Valine (CAAGTG/CAC)
R295C Arginine to Cysteine (CGGTCT/ACA)
R217L Arginine to Lysine (CGCTTA/AAT)
OBJECTIVE
The study aims at finding the effect of LysG mutants (T94L, L274S, P108S, V144M, Q65V, R295L, R217L) on
argO expression in E. coli.
MATERIALS
Bacterial strains: All the bacterial strains that were used in this study were derivatives of Escherichia coli
K-12 and their genotypes have been listed below.
Table 2: List of Bacterial strains-
Strains Genotypes
MC4100 F-araD139(argF-lac) U169rpsL150rela1 F16B5301 fruA25 deeoC1 ptsF25 e14
DH5 fhuA2 (argF-lacZ) U169 phoA glnV44 80 (lacZ)M15 gyrA96 recA1 relAl endA1 thi-
1 hsdR17
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
9/34
9
Table 3: List of primers-
Name Sequence (5-3) Tm (C) DescriptionJGHlysGL274SF TGTATTGGCAACGATGGCGCTCTGAATCTAGATC
TCTAGCTAG
60 23bp, used for
L274S mutant
JGHlysGL274SR CTAGCTAGAGATCTAGATTCAGAGCGCCATCGTT
GCCAATACA
60 23bp, used for
L274S mutant
JGHlysGP108SF CGCTATCCACATGGTTTCCTTCTGTGTTCAACGA
GGTAGCTTC
61 23bp, used for
P108S mutant
JGHlysGP108SR GAAGCTACCTCGTTGAACACAGAAGGAAACCATG
TGGATAGCG
61 23bp, used for
P108S mutant
JGHlysGT94LF GCCTTGCTGAAATCCCGTTATTAATCGCCATCAA
CGCAGATTC
61 23bp, used for
T94L mutant
JGHlysGT94LR GAATCTGCGTTGATGGCGATTAATAACGGGATTT
CAGCAAGGC
61 23bp, used for
T94L mutant
JGHlysGP108SF CGCTATCCACATGGTTTCCTTCTGTGTTCAACGA
GGTAGCTTC
61 23bp, used for
P108S mutant
JGHlysGP108SR GAAGCTACCTCGTTGAACACAGAAGGAAACCATG
TGGATAGCG
61 23bp, used for
P108S mutant
JGHlysGV144MF GTGGAGATGTTTTAGGAGCGATGACCCGTGAAGC
TAATCCCGT
63 23bp, used for
V144M mutant
JGHlysGV144MR ACGGGATTAGCTTCACGGGTCATCGCTCCTAAAA
CATCTCCAC
63 23bp, used for
V144M mutant
JGHlysGR217LF ATGGTCCTGTGGGGCGCAGGTTAGTATCCATTGT
CCCGTCGGC
69 23bp, used for
R217L mutant
JGHlysGR217LR GCCGACGGGACAATGGATACTAACCTGCGCCCCA
CAGGACCAT
69 23bp, used for
R217L mutant
JGHlysGR295CF ATGCAGCAATCGAGGGATTGTGTCCTTAGTTACT
TCTGAAAAG
58 23bp, used for
R295C mutant
JGHlysGR295CR CTTTTCAGAAGTAACTAAGGACACAATCCCTCGA
TTGCTGCAT
58 23bp, used for
R295C mutant
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
10/34
Table 4: Plasmids-
Plasmid
pHYD2676 It is a
pHYD1723 I
pHYD2677 It is a pMU575 d
pHYD2606
pHYD929
pBAD18 pMB9 rep
pCL1920
Vector maps-
10
Description
pBAD18 construct of LysG cloned at EcoR
t is a pMU575 construct ofargO regulator
rivative carryin, a 334-bp PstI-BamHI fra
region.
It is a pCL1920 derivative of argP (p27
pCL1920 derivative of argP (P217L
licon for Ara-induced expression of target
SC101 replicon, streptomycin and spectin
and HindIII
region
ment oflysEregulatory
4S)
genes, ampicillin
omycin
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
11/34
11
Media and Buffers:
All the media and buffers were sterilized by autoclaving for 15 minutes at 121C under 15 psi pressure.
Media and buffers used in this study are as described below.
LB medium:
Tryptone : 10 g
Yeast extract : 5 g
NaCl : 10 g
Water to : 1000 ml
pH adjusted to 7.0-7.2 with 1N NaOH.
LB Agar:
LB medium : 1000 ml
Bacto-agar : 15 g
LB MES Agar (pH 5.8):
MES : 3.904g
Bacto tryptone: 2g
NaCl : 2g
Yeast extract : 1g
Bacto-agar : 30g
Made up the volume to 200 ml using autoclaved water
Minimal Agar (0.1 M; pH 5.8):
KHPO : 0.017M
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
12/34
12
KHPO : 0.183 M
(NH)SO : 0.2 %
Sodium Citrate: 0.1 %
Made up to 100ml using autoclaved water
TAE buffer:
40 mM Tris-acetate, 2 mM EDTA (pH 8.0)
It was used as standard electrophoresis buffer. It was prepared as 50X concentrated stock solutions and
used at 1X concentration.
Chemicals-
No. Chemical Final Concentration
1. Glucose 0.2 %
2. Arabinose 0.2 %
3. CaCl2 0.1M
4. Glycerol 0.8%
5. Thiamine ( B ) 0.0001 %
6. MgSO 0.001M
7. Lysine 10mM
8. Arginine 10mM
9. X-gal 80g/ml
10. IPTG 100M
11. ONPG 4mg/ml
12.SDS 0.1%
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
13/34
13
An tib io ti cs -
Antibiotics
Working Concentration (in g/ml)
Abbreviated in text as
LB MA
Spectinomycin 50 50 Spec
Trimethoprim 60 30 TP
Streptomycin 100 100 Strep
Ampicilin 40 40 Amp
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
14/34
METHODS
Isolation of plasmid DN
For high purity plasmid RBC HiYield
Restriction Digestion-
0.5-1g of DNA was used for restri
appropriate 10X buffers supplied b
reaction volume of 25l. The diges
fragments were visualized by ethidi
Commercially available DNA size
with the digestion samples to comp
Reaction mixture-
1) PCR product-20.5 l, EcoRI-
2) pBAD18 plasmid-20.5 l, Ec
Ligation-
100-200ng of DNA was used in ea
The reaction was done in 10l vol
0.5-1 units of T4 DNA ligase. The re
Reaction mixture-
14
MOLECULAR TECHNIQUES:
-
Plasmid Mini Kit were used where ever re
ction enzyme digestion. 5-20 units of the r
y the manufacturers at final concentration
tion was allowed to proceed for a minimu
um bromide staining following electrophore
arkers (GeneRuler) of 1kb and HindIII la
are with and estimate the sizes of the restri
l, HindIII-1l, Digestion buffer-2.5l. Total
RI-1l, HindIII-1l, Digestion buffer-2.5l. T
Fig 6:
showi
and d
h ligation reaction. The vector to insert ra
umes containing ligation buffer (provided b
ction was carried at 21C for 16h (overnigh
uired.
striction enzyme with the
of 1X were used in a total
of 6h at 37C. The DNA
sis on 0.8-1% agarose gels.
mba DNA were run along
tion fragments.
= 25l
otal = 25l
Schematic representation
ng digested PCR product
igested pBAD18 plasmid.
io was maintained at 1:3.
y the manufacturers) and
).
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
15/34
pBAD18 digested purified-2l, PC
ATP-0.5ul, Total reaction volume =
Polymerease Chain Reactio
The PCRs were performed using
Deep vent was mostly used as b
Thermostability: half-life of 23 ho
template in a 50 l reaction volume
Overlapping PCR-
The overlap extension polymera
specific mutations at specific poi
largerpolynucleotide.
It involves 2 PCRs with 2 template
as a template. PCR1-Using LysG rev
reverse primers primer. Now usi
pBAD18R and pBAD18F.
Fig 7: Di
principle
15
product digested purified-6.5l, T4 DNA
0l
n (PCR)-
ither Taq DNA polymerase or Deep Vent
cause it has got High-Fidelity: 5X greater
rs at 95C. Approximately, 10-20 ng of pl
containing 0.2 mM dNTPs and 1 picomole/
se chain reaction is a variant ofPCR.
ts in a sequence or to splice smaller
specific primers and 2 vectors specific prim
erse & pBAD18 forward primers, PCR 2-Usi
g PCR 1 product as a template and am
grammatic representation showing the gene
of overlapping PCR
ligase enzyme-1l, 10mM
proofreading polymerase.
than Taq, Extremely High
smid DNA was used as a
l of each primer.
It is used to insert
DNA fragments into a
rs using LysG (pHYD2676)
g LysG forward & pBAD18
lify using vector specific
ral
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
16/34
16
PCR amplification for LysG mutant construction-
PCR 1 PCR2 PCR 1+2
COMPONENTSVOLUME
(l)COMPONENTS
VOLUME
(l)COMPONENTS
VOLUME
(l)
10X Thrmo pol
buffer5
10X Thrmo pol
buffer5
10X Thrmo pol
buffer5
dNTPs 1 dNTPs 1 dNTPs 1
Deep Vent
enzyme0.5
Deep Vent
enzyme0.5
Deep Vent
enzyme0.5
LysGR 1 LysGF 1 pBAD18R 1
pBAD18F 1 pBAD18R 1 pBAD18F 1
Template DNA 10 Template DNA 10 PCR 1 product 21
MB grade water 31.5 MB grade water 31.5 PCR 2 product 20.5
Total reaction
volume50l
Total reaction
volume50l
Total reaction
volume50l
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
17/34
17
Reaction conditions-
PCR 1 and PCR 2 PCR 1+2
ConditionTemperatures
( C )Time
Temperatures
( C )Time
Initial Denaturation 95 5min 95 5min
Denaturation 95 1min 95 1min
Annealing 50 1min 50 1min
Extension 72 1min 72 1min 30sec
Final extension 72 5min 72 5min
Hoarding 4 5min 4 5min
Number of cycles 29 29
Colony PCR-
We can use this type of PCR to identify which are the colonies those have the insert of interest. First add
reverse and forward primers to MB grade water. Now pick up a little bit of colony with micropipettes and
resuspend in the water-primer mixture. Now lysis of the resuspended mixture has been done by heating
in 99C in PCR machine. After that add 10ul of Dream taq that is a mixture ofDreamTaq DNA Polymerase,
optimized Dream Taq buffer, MgCl2 and dNTPs. After that set up for PCR in a reaction condition
mentioned below then check insert release with the help of gel electrophoresis.
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
18/34
18
COMPONENTS VOLUME in l
pBAD18F 0.5
pBAD18R 0.5
Template DNA (colonies resuspended
in MB grade water)9
Dream Taq 10
Total reaction volume 20l
Reaction conditions-
PCR purification-
The PCR purification protocol of QIAGENTM
kit was employed.
Steps Temperatures ( C ) Time
Initial Denaturation 94 4 min
Denaturation 94 1min
Annealing 50 45sec
Extension 72 1min 30sec
Final extension 72 5 min
Hoarding 4 5 min
Number of cycles 25
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
19/34
Agarose gel electrophoresi
The DNA samples were mixed with
lblue, 0.25% xylene cyanol and 30
agarose gel in 1X TAE buffer at 5V/
for 30 min at room temperature a
size markers (GeneRuler) of 1kb a
Ladders-
Fig 8: Images of 1kb
Gel elution-
The gel elution protocol of QIAGEN
19
-
the appropriate volumes of the 6X loading b
% glycerol in water) and subjected to elec
cm for 2-4 hours. The gel was stained in 1
d bands were visualized under UV light. C
nd HindIII lamba DNA were run for visualizat
HindIII-DNA
ladder and HindIII lambda DNA.
M gel extraction kit was employed.
uffer (0.25% bromopheno
trophoresis through 0.8%
g/ml of ethidium bromide
mmercially available DNA
ion of DNA.
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
20/34
20
GENETIC TECHNIQUES-
Transformation (Calcium chloride method)
For routine plasmid transformation where very high efficiencies were not essential, the following methodwhich is a modification of the procedure described by Cohen et alwas used. An overnight culture of the
recipient strain was sub-cultured in fresh LB broth and grown at 37C till middle logarithmic phase. Cells
were washed with cold 0.1 M CaCl2 and resuspended in the same. The cells were incubated on ice for 30-
45 min. 0.1 ml of this cell suspension was mixed with 0.1-0.5 g of the DNA, incubated further for 30 min
and given a heat shock for 90 seconds at 42C. The cultures were rapidly chilled on ice for 1-2 min, mixed
with 1 ml of LB and incubated at 37C for 45-60 min. The cells were pelleted by centrifugation and
resuspended in 300 l of LB. 0.1 ml of this mixture was plated on selective media.
Transformation with Ultra competent cell-
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
21/34
21
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
22/34
22
Stored DH5-Ultracom cells are made by following protocol and 100l of freezing competent are taken.
Then thaw in ice for sometimes followed by the addition of 10l ligated plasmid, mix it properly and
incubate on ice for 45min. After that heat shock is given at 42C for 90sec. The cultures were rapidly
chilled on ice for 1-2 min, mixed with 1 ml of LB and incubated at 37C for 45min. Now after 45min
samples are spin it down at 6000 for 5min. The cells were pelleted by centrifugation and resuspended in
200l of LB. 0.1 ml of this mixture was plated on selective media and incubate overnight at 37C.
-gal assay-
From the purified plate we have to make primary
culture in minimal media with water, B1, MgSO4, 20%
glucose, Ampicilin, Trimethoprim. After that overnight
grown cultures are spin down at 7000 rpm for 3min.
Then the supernatant is discarded and washed with
minimal media.
Now the strains were sub-cultured in minimal media with water, B1, MgSO4, 20% arabinose, 80% glycerol,
Ampicilin, Trimethoprim. Then 3 sets are prepared one with arginine, one with lysine and one without any
amino acid. Now they are allowed to grow. Whenever the O.D of the subculture is 0.3-0.7 we must take
out the cultures and measure the O.D at 600nm. Then a reaction mixture is prepared with 700l of Z
buffer and 300l of cultures. Now to that mixture add few drops of 0.1% SDS and chloroform followed by
mixing with vortex. Now keep the samples in 28C for 10-15min. Then add 200l ONPG (ortho-
Nitrophenyl--galactoside) to mixture, mixed well and the time is noted. When pale yellow colour is
developed then check the O.D (must be ranging from 0.3-0.9). Now add 500l of Na2CO3 to stop the
reaction. Now measure the O.D at 429nm and calculate with the help of the given formula-
-gal unit=
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
23/34
X-gal assay-
X-gal (5-bromo-4-chloro-indoly
of galactose linked to a substit
hydrolyzed by the -galactosida
gal, when cleaved by -galacto
The latter then spontaneously d
an intensely blue product whi
colored product therefore may
This easy identification of an ac
to be used as a reporter gene in
23
--D-galactopyranoside) is an organic
ted indole. X-gal is an analog of lactose
se enzyme which cleaves the -glycosi
idase, yields galactose and 5-bromo-4-
imerizes and is oxidized into 5,5'-dibro
h is insoluble. X-gal itself is colorless
be used as a test for the presence of a
tive enzyme allows the gene for -galac
arious applications.
compound consisting
, and therefore may be
ic bond in D-lactose. X-
chloro-3-hydroxyindole.
mo-4,4'-dichloro-indigo,
, the presence of blue-
active -galactosidase.
tosidase (the lacZgene)
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
24/34
RESULTS
Cloning of lysG gene-
Specific mutation inserted in lysG
extracted PCR products as well a
pBAD18 have restriction enzyme si
and ligated plasmids are transfor
plates. Plasmid was isolated from
digesting with HindIII and EcoRI. All
the digestion was partial, as evide
insert (960bp). Plasmid from two o
PCR 1and PCR 2 results of ov
Fig 9:
(A) Sh
(B) Sh
(A)
24
gene by overlapping PCR and pBAD18 used
the vector plasmids are digested as in t
es for HindIII and EcoRI. Now after digesti
ed in DH5 ultra competent cell and wer
eight transformants to check for insert r
the clones selected showed insert release a
t from the presence of linearised plasmid (
the clones was transformed into MC4100
erlapping PCR-
Gel electrophoresis images of PCR products
owing L274S mutant.
owing T94L mutant.
(B)
as a vector. Now the gel
e LysG clone and vector
on ligation was performed
e selected on LB-amp-glu
elease of size 960 bp by
s shown in Fig.9., however
5.6Kb), vector (4.6Kb) and
rgP/argO-lac strain.
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
25/34
PCR 1+2 results of overlappi
(A)
Fig 10
(A) Sh
(B) Sh
(C) P1
L274S mutants
25
ng PCR-
(B)
(C)
: Gel electrophoresis images of PCR product
owing L274S mutant.
owing T94L mutant.
08S mutant.
T94L, V
muta
s
44M
ts
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
26/34
Gel showing digested PCR pr
Fig 11: Gel electrophore
Gel showing insert release a
26
oducts and vector plasmids-
is image of pBAD18 digested and dige
ter digestion of transformed clone
sted PCR products.
mutants-
Fig 12: Gel
electrophoresis image
showing that out of 6
transformed colonies
colony 1 and 3 got the
insert release.
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
27/34
Fig 13: Gel electrophoresis image s
insert release.
Gel showing insert release a
A Colon PCR of L274S m
(C)Colony PCR of P108S mutant
1 2 3
1 2 3 4 5 6
27
owing that out of 8 transformed colonies co
ter colony PCR of transformed clon
Fig 14: Gel electrophoresis iL274S mutant colony 1, 3,
of 8 transformed colonies. (
mutant colony 1, 3, 4, 6, 9,
of 10 transformed colonies.
mutant colony 2, 3, 4, 5, 6,
out of 10 transformed colon
tantsB Colon PCR of T9
s
4 5 6 1 2 3 4 5
7 8
lony 2 and 4 got the
ed mutants-
mage (A) Showing that inhave insert release out
) Showing that in T94L
10 have insert release out
(C) Showing that in P108S
7, 8 have insert release
ies.
4L mutants
6 7 8 9 10
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
28/34
28
Se quen cin g res ults of Clo nes -
L274S CLONE-
Fig 14: Sequencing results shownthat that lysine (CTG) has been changed
to serine (CTC).
T94L CLONE-
Fig 15: Sequencing results shown that
Threonine (ACC) has been changed to Leucine
(TTA).
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
29/34
29
P108S CLONE-
Fig 16: Sequencing results shown that Proline (CCC) has been changed to Serine (TCT).
X-gal assay results of Clones-
All positive regulators (L274S, P108S, T94L) are giving Blue coloration in the X-gal plate but not in same intensity
while negative regulators (V144M) giving white colouration and we used LysG as our control which is giving white
coloration in X-gal plate.
Fig 17: X-gal assay results of clones
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
30/34
30
- galac to si dase as say re sul t
Table 5: -gal assay of different strains-
Strain OD600 Time (t) OD420 OD420 avg. -gal unit
1. Control 1 (Z
buffer)
0.00
0.00
60min 0.001 0.001 00
2. Control 2 ( Zbuffer)
60min 0.001
3. ArgP (Glu-Arg) 0.720 60min 0.012 0.013 1.00
4. ArgP (Glu-Arg) 60min 0.014
5. ArgP (Glu-Lys) 0.810 60min 0.026 0.028 1.92
6. ArgP (Glu-Lys) 60min 0.030
7. ArgP (Ara-Arg) 0.303 60min 0.018 0.020 3.73
8. ArgP(Ara-Arg) 60min 0.023
9. ArgP (Ara-Lys) 0.473 60min 0.011 0.016 1.88
10. ArgP (Ara-Lys) 60min 0.02111. ArgP +(Glu-Arg) 0.293 90min 0.109 0.115 14.55
12. ArgP +(Glu-Arg) 90min 0.122
13. ArgP +(Glu-Lys) 0.274 90min 0.012 0.15 2.05
14. ArgP +(Glu-Lys) 90min 0.018
15. ArgP +(Ara-Arg) 0.298 90min 0.122 0.128 16.00
16. ArgP+(Ara-Arg) 90min 0.134
17. ArgP +(Ara-Lys) 0.252 90min 0.013 0.016 2.35
18. ArgP+ (Ara-Lys) 90min 0.019
19. pBAD18 (Glu-
Arg) 0.452
60min 0.022
0.021 2.59
20. pBAD18 (Glu-
Arg)
60min 0.020
21. pBAD18 (Glu-Lys) 0.632 60min 0.019 0.205 1.81
22. pBAD18 (Glu-Lys) 60min 0.022
23. pBAD18 (Ara-
Arg)
0.391 60min 0.017
0.015 2.14
24. pBAD18 (Ara-
Arg)
60min 0.014
25. pBAD18 (Ara-Lys) 0.356 60min 0.021 0.024 4.1226. pBAD18 (Ara-Lys) 60min 0.027
27. +pBAD18 (Glu-Arg) 0.483 90min 0.308 0.291 22.31
28. +pBAD18 (Glu-Arg) 90min 0.275
29. +pBAD18 (Glu-Lys) 0.489 90min 0.041 0.037 3.08
30. +pBAD18 (Glu-Lys) 90min 0.033
31. +pBAD18 (Ara-Arg) 0.457 90min 0.308 0.320 26.66
32. +pBAD18 (Ara-Arg) 90min 0.333
33. +pBAD18 (Ara-Lys) 0.409 90min 0.033 0.03 2.77
34. +pBAD18 (Ara-Lys) 90min 0.027
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
31/34
31
[Strains used in the -galactosidase assay-
1) ArgP = ArgP strain, 2) ArgP+= ArgP
+strain, 3) pBAD18= pBAD18 transformed in ArgP/argO-lac,
4) +pBAD18 = pBAD18 transformed in ArgP+/argO-lac, 5) LysG = LysG transformed in ArgP/argO-lac,
6) L274S = L274S mutant transformed in ArgP/argO-lac, 7) P108S = P108S mutant transformed in
ArgP/argO-lac 8) T94L = T94L mutant transformed in ArgP/argO-lac.]
35. LysG (Glu-Arg) 0.273 90min 0.012 0.03 4.28
36. LysG (Glu-Arg) 90min 0.018
37. LysG (Glu-Lys) 0.296 90min 0.023 0.024 3.03
38. LysG (Glu-Lys) 90min 0.026
39. LysG (Ara-Arg) 0.247 90min 0.030 0.029 4.1440. LysG (Ara-Arg) 90min 0.028
41. LysG (Ara-Lys) 0.209 90min 0.022 0.023 3.15
42. LysG (Ara-Lys) 90min 0.024
43. L274S (Glu-Arg) 0.491 60min 0.407 0.43 51.8
44. L274S (Glu-Arg) 60min 0.453
45. L274S (Glu-Lys) 0.450 60min 0.24 0.26 3.20
46. L274S (Glu-Lys) 60min 0.28
47. L274S (Ara-Arg) 0.462 60min 0.587 0.600 72.28
48. L274S (Ara-Arg) 60min 0.614
49. L274S (Ara-Lys) 0.419 60min 0.020 0.44 5.8650. L274S (Ara-Lys) 60min 0.068
51. P108S (Glu-Arg) 0.714 100min 0.447 0.45 21.42
52. P108S (Glu-Arg) 100min 0.443
53. P108S (Glu-Lys) 0.511 100min 0.029 0.027 1.761
54. P108S (Glu-Lys) 100min 0.025
55. P108S (Ara-Arg) 0.240 100min 0.432 0.459 65.5756. P108S (Ara-Arg) 100min 0.486
57. P108S (Ara-Lys) 0.896 100min 0.044 0.038 1.413
58. P108S (Ara-Lys) 100min 0.032
59. T94L (Glu-Arg) 0.568 80min 0.505 0.518 39.84
60. T94L (Glu-Arg) 80min 0.532
61. T94L (Glu-Lys) 0.664 80min 0.031 0.04 2.66
62. T94L (Glu-Lys) 80min 0.039
63. T94L (Ara-Arg) 0.652 80min 0.529 0.508 32.56
64. T94L (Ara-Arg) 80min 0.487
65. T94L (Ara-Lys) 0.591 80min 0.027 0.03 2.12
66. T94L (Ara-Lys) 80min 0.033
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
32/34
Graphical representation
Fig 18: Graphical representation o
that LysG mutants regulates the ar
Fig 19: Graphical representation sh
as a control.
0
10
20
30
40
50
60
70
80
-gal
unit
32
f the -gal assay result-
LysG regulation level of argO from -gal a
gO in high level in the presence of arginine
owing the LysG regulation levels of LysG mu
Strains
say. It has been observed
o-factor.
tants using LysG wild type
b-gal unit
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
33/34
33
DISCUSSION
Specific mutations were inserted in lysG (pHYD2676) gene by overlapping PCR and pBAD18 used as a
vector. Now the gel extracted PCR products as well as the vector plasmids are digested as in the LysG
clone and vector pBAD18 have restriction enzyme sites for HindIII and EcoRI. Now after digestion
ligation was performed and ligated plasmids are transformed in DH5 ultra competent cell and were
selected on LB-amp-glu plates.
As several ArgP-dominant (ArgPd) variants that confer elevated Arg-independent argO expression, ArgP
(S94L), ArgP (P108S) and ArgP (P274S) activates lysEexpression in E. coli. So we constructed several LysG
mutants at the corresponding residues of LysG namely T94L, P108S and L274S to determine if they
regulate argO or not. After inserting the specific mutation the plasmids carrying the mutations are
transformed into ArgP-argO-lac and ArgP+-argO-lac strain and -galactosidase assay was performed.
From the assay result it has been concluded that in the presence of arginine all those mutants activates
the transcription of argO. So we can infer that LysG mutants regulate argO in the presence of arginine
with both arabinose and glucose.
-
7/29/2019 Regulation studies of argO of E.coli by LysG mutants of Corynebacterium glutamicum
34/34
REFERENCE
1. Rakesh S. Laishram and Jayaraman Gowrishankar. 2007 Environmental regulation operating
at the promoter clearance step of bacterial transcription. GENES & DEVELOPMENT, 21: 1258
1272.
2. Madhusudan R. Nandineni and J. Gowrishankar. 2004 Evidence for an Arginine Exporter
Encoded by yggA (argO) That Is Regulated by the LysR-Type Transcriptional Regulator ArgP in
Escherichia coli. JOURNAL OF BACTERIOLOGY 186.11.35393546.
3. Nandineni, M. R., R. S. Laishram, and J. Gowrishankar. 2004. Osmosensitivity associated with
insertions in argP (iciA) or glnE in glutamate synthase-deficient mutants ofEscherichia coli. J.
Bacteriol. 186:6391-6399.
4. Carmelita N. Marbaniang and J. Gowrishankar. 2011. Role of ArgP (IciA) in Lysine-Mediated
Repression in Escherichia coli. JOURNAL OF BACTERIOLOGY. 191: 59855996.
5. Bellmann, A., M. Vrljic, M. Patek, H. Sahm, R. Kramer, and L. Eggeling. 2001. Expression
control and specificity of the basic amino acid exporter LysE ofCorynebacterium glutamicum.
Microbiology 147:1765-1774.
6. Bouvier, J., P. Stragier, V. Morales, E. Remy, and C. Gutierrez. 2008. Lysine represses
transcription of the Escherichia coli dapB gene by preventing its activation by the ArgP
activator. J. Bacteriol. 190:5224-5229.
7. Celis, R. T. 1999. Repression and activation of arginine transport genes in Escherichia coliK 12
by the ArgP protein. J. Mol. Biol. 294:1087-1095.
8. Goss, T. J. 2008. The ArgP protein stimulates the Klebsiella pneumoniae gdhA promoter in a
lysine-sensitive manner. J. Bacteriol. 190:4351-4359.
9. Momany, C., and E. L. Neidle. 2012. Defying stereotypes: the elusive search for a universal
model of LysR-type regulation. Mol. Microbiol. 83:453-456.
10. Maddocks, S. E., and P. C. Oyston. 2008. Structure and function of the LysR-type
transcriptional regulator (LTTR) family proteins. Microbiology 154:3609-3623.
top related