university of groningen investigating possible bypass ...48 3 kim r. kampen 1, frank j.g. scherpen ,...
Post on 19-Mar-2021
1 Views
Preview:
TRANSCRIPT
University of Groningen
Investigating possible bypass mechanisms to sensitize AML blasts for combination therapyKampen, Kim Rosalie
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.
Document VersionPublisher's PDF, also known as Version of record
Publication date:2015
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):Kampen, K. R. (2015). Investigating possible bypass mechanisms to sensitize AML blasts for combinationtherapy: Targeting ligand induced receptor tyrosine kinase signaling. University of Groningen.
CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.
Download date: 17-08-2021
47
3 VEGFC targeted therapy reduces the CD34+ AML expansion by enhanced differentiation and apoptosis; A role for simultaneous glycolysis inhibition
48
3
Kim R. Kampen1, Frank J.G. Scherpen1, Hasan Mahmud1, Tobias Ackermann2, Arja ter
Elst1, André B. Mulder3, Victor Guryev2, Guy Eelen4, Peter Carmeliet4, Steven M.
Kornblau5, Eveline S. J. M. De Bont1
1. Division of Pediatric Oncology/Hematology, Department of Pediatrics, Beatrix Chil-
dren's Hospital, University Medical Center Groningen, University of Groningen, Groning-
en, The Netherlands. 2. European Research Institute for the Biology of Ageing, University
Medical Center Groningen, University of Groningen, Groningen, the Netherlands. 3. De-
partment of Laboratory Medicine, University Medical Center Groningen, Groningen, the
Netherlands. 4a. Laboratory of Angiogenesis and Neurovascular Link, Department of On-
cology, University of Leuven, Belgium. 4b.Laboratory of Angiogenesis and Neurovascular
Link, Vesalius Research Center, VIB, Leuven, Belgium. 5. Department of Leukemia The
University of Texas M.D. Anderson Cancer, Houston, TX, United States of America.
Under review at Cancer Cell
49
3
Abstract
High vascular endothelial growth factor C (VEGFC) expression predicts adverse
prognosis in acute myeloid leukemia (AML). Targeting VEGFC enforced myelocytic dif-
ferentiation of clonal CD34+ AML blasts. The 30-50% reduced expansion potential of
anti-VEGFC treated CD34+ AML blasts resulted from enhanced differentiation by
AMPK/FOXO3A suppression and inhibition of MAPK/Erk proliferative signals. Anti-
VEGFC therapy accelerated glycolysis for lactate production via increased PFKFB3/PFKL
axis in CD34+ AML blasts. Pharmacological PFKFB3 inhibition (3PO) to anti-VEGFC
treatment further decreased AML blast survival by mitochondrial shutdown and re-
duced in vivo tumor formation via synergistic repression of the LKB1/AMPK/PFKFB3
axis. Combined, we defined a regulatory function of VEGFC in CD34+ AML cell fate deci-
sions, and subsequent PFKFB3 inhibition revealed future therapeutic potential in AML.
50
3
Significance
The overall survival rates of patients with acute myeloid leukemia (AML) remain
poor, which demands the development of new therapeutic strategies beside chemother-
apy. The role of VEGFC in leukemic clonal blast maintenance was not previously eluci-
dated nor linked to leukemia cell metabolism. In this study, we identified a new differen-
tiation therapy strategy by targeting VEGFC in AML blasts. This therapeutic approach re-
sulted in the acceleration of glycolysis as a bypass mechanism for leukemia survival.
Combined VEGFC and glycolysis targeting through PFKFB3 inhibition proved to effi-
ciently reduce AML survival in vitro and reduced AML burden in xenograft models of
disease. Combined, we defined a regulatory function for VEGFC in AML blast cell fate de-
cisions, and subsequent PFKFB3 inhibition revealed future therapeutic potential in AML.
51
3
Introduction
Vascular Endothelial Growth Factor C (VEGFC) is one of the VEGF family mem-
bers. The contribution of VEGFC can be appreciated from its unique role in lymphangio-
genesis as well as in angiogenesis in normal homeostasis and cancer.1-4 VEGFC can bind
to kinase insert domain receptor (KDR, i.e. VEGFR-2) and fms-related tyrosine kinase-4
(FLT-4, i.e. VEGFR-3) expressed by vascular endothelial cells, lymphatic endothelial
cells, and by leukemic blasts.1-3;5;6 KDR was found to be expressed extracellular on the
acute myeloid leukemia (AML) cell membrane, intracellular in the cytoplasm and on the
nuclear membrane of AML cells, while FLT-4 mainly stained positive within the cyto-
plasm of AML blasts.5;7;8
Higher levels of VEGFC were identified as an independent prognostic factor in
pediatric and adult AML that associated with decreased complete remission rates, as
well as a shorter overall survival and event-free survival.9 Exogenous VEGFC protected
AML cells from chemotherapy induced apoptosis.5 We have previously shown that en-
dogenous VEGFC expression was associated with decreased drug responsiveness in
childhood AML, both in vitro as well as in vivo.10 We therefore hypothesized that VEGFC
is an important autocrine growth factor involved in CD34+ AML blast maintenance.
In this study, VEGFC targeted therapy in primary pediatric CD34+ AML cells was
shown to promote myelocytic maturation of primary CD34+ AML blasts to the detri-
ment of their expansion potential. Anti-VEGFC therapy mediated an induction of glycoly-
sis in AML for lactate production. Simultaneous inhibition of VEGFC and glycolysis
(PFKFB3 inhibitor 3PO) reduced the AML survival in vitro and in AML xenografts.
52
3
Materials & Methods
AML patient samples After getting written informed consent the mononuclear cell
fraction (MNC) of bone marrow from healthy controls and pediatric AML patients was
obtained and cryopreserved, approved by the Medical Ethical Committee of the Univer-
sity Medical Center Groningen METC 2010.036 and 2013.281. Samples were thawed
rapidly at 37°C and diluted in a 6 mL volume of newborn calf serum as was previously
shown.8 AML patient samples used for in vitro culture assays are characterized in Suppl.
Table 1 including the FAB, karyotype, blast (%), VEGFC levels (pg/mL), KDR (%), FLT-4
(%), CD34 (%), and FLT3 mutational status. A larger cohort of primary AML samples
was evaluated for VEGFC, KDR, and FLT-4 protein expression.
Cell lines THP-1 and MOLM13 AML cells were obtained from the American Type
Culture Collection (ATCC, Manassas, Virginia, USA), cultured in RPMI-1640 medium
(Lonza, Basel, Switserland) supplemented with 1% penicillin/ streptomycin (Life Tech-
nologies Europe BV, Bleiswijk, The Netherlands) and 10% fetal calf serum (FCS, Bod-
inco, Alkmaar, the Netherlands). MS5 was used as mouse derived bone marrow stromal
feeder layer (a kind gift from J.J. Schuringa from the Dept. Experimental Hematology,
University Medical Center Groningen).
Fluorescence-activated cell sorting (FACS) Cells were serum blocked and stained
with primary antibodies (Suppl. Table S2). Primary antibodies were visualized using a
secondary antibody staining incubation (Suppl. Table S2). Intracellular staining re-
quired fixation after cell surface staining followed by permeabilization according to
manufacturer’s protocol (Fix & Perm, Life Technologies Europe BV, Bleiswijk, The Neth-
erlands). Isotype control and secondary antibodies were used as negative controls.
Apoptosis analysis was performed using Annexin V-FITC(/PI) staining method following
manufacturer’s protocol (Annexin-V-FLUOS staining kit, Roche). Data was analyzed us-
ing LSRII (BD FACS DIVA software, BD bioscience) and processed using FlowJo software
(Tree Star Inc., Ashland, OR, USA).
VEGFC enzyme-Linked ImmunoSorbent Assay (ELISA) The VEGFC protein expres-
sion in patient samples was measured in duplicates using a VEGFC ELISA (R&D Systems,
Minneapolis, USA) following manufacturer’s protocol.
Compounds VGX-100 is a human monoclonal VEGFC antibody (a kind gift from
53
3
Vegenics Pty Ltd) that binds and precipitates all forms of VEGFC. 3PO is a PFKFB3 inhib-
itor (Calbiochem).
CD34+ short-term and long-term culture assays CD34+ cells were isolated using
a MoFlo-XDP sorter (Beckman Coulter, Woerden, the Netherlands). After CD34 sorting,
the CD34 percentages exceeded 95% in all samples. Human short-term Colony-Forming
Cell (CFC) assay A total of 1000 CD34+ sorted MNCs were cultured for 2 weeks in 1 mL
methylcellulose (MethoCult® H4435 Enriched, Stem cell technologies, Grenoble,
France) according to manufacturer’s protocol, experiment is performed in duplicate per
patient sample. Long-term culture-initiating cell (LTC-IC) assay CD34+ sorted blasts are
cultured on MS5 mouse bone marrow stromal cells, in Gartner’s media; αMEM contain-
ing 12.5% FCS, 12.5% horse serum, 1% penicillin/streptomycin, 57.2 µM β-
mercaptoethanol (Sigma-Aldrich, Zwijndrecht, the Netherlands), and 1 µM hydrocorti-
sone (Sigma-Aldrich, Zwijndrecht, the Netherlands), supplemented with 20 ng/mL
thrombopoietin (TPO) , IL-3, and granulocyte colony-stimulating factor (G-CSF), exper-
iment is performed in duplicate per patient sample. LTC-IC assay in limiting dilution LTC-
IC assay plated at a density range (1/5/10/50/100/250/40.000/120.000 cells/well)
were subjected to CFC methylcellulose on top of the stroma (MS5) at week 5 of co-
culturing, experiment is performed in 10-plo per density per patient sample.
Microscopy Cytospins were stained with May-Grunwald-Giemsa (MGG). Images
were taken with a Leica DM 3000 or Leica DM IL microscope with a Leica DFC420C
camera (Leica Geosystems B.V., Wateringen, the Netherlands), using a 40x0.9 numeric
dry or 63x0.9 numeric oil aperture objectives, evaluated by two separate investigators.
Western Blot (WB) 1*106 cells were lysed in Laemmli sample buffer (Bio-rad,
Veenendaal, the Netherlands). Proteins were separated by sodium dodecyl sulphate-
polyacrylamide gel electrophoresis (SDS-PAGE), transported to nitrocellulose mem-
branes, and incubated overnight with primary antibodies (Suppl. Table S2), washed, and
for 1 hour incubated with HRP conjugated secondary antibodies. Protein bands were
visualized by chemiluminescence on an x-ray film, and scanned.
FLT3-ITD fragment analysis This assay uses fluorescent labeling technology and
fragment length analysis to establish the ratio of the mutant (ITD) FLT3 allele to the
wild type (WT) FLT3 allele. Ratios up to 0.5 were indicative for a heterozygous FLT3-
ITD mutant allele present in 100% of the AML cells (1 ITD peak/ (1 ITD peak + 1 WT
peak) = 0.5). Newly diagnosed patients with AML harbor a heterozygous FLT3-ITD mu-
54
3
tation in >92% of the cases.26
Gene expression analysis Complementary DNA synthesis was accomplished from
1 µg RNA (RNeasy mini kit, Qiagen). The Quality control, RNA labeling, hybridization,
and data extraction was profiled on illumina expression beadchips, all performed at Ser-
viceXS B.V. (Leiden, the Netherlands). RNA quality and integrity was ensured using the
Agilent 2100 bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Biotinylated
cRNA was produced (Ambion, San Diego, CA, USA) and hybridized onto the Illumina
HumanHT-12 v4 (Illumina, San Diego, CA, USA). Scans (Illumina iScan), image analysis
and extraction of raw data (Illumina GenomeStudio v2011.1) were used, after which we
performed quantile normalization.
Reversed Phase Protein Array (RPPA) Proteomic profiling was performed using
newly diagnosed pediatric AML samples (n=31) and CD34+ NBM samples (n=10) using
RPPA. The method and validation of the technique are fully described previously.27
Briefly, patient samples were printed in five serial dilutions onto slides along with nor-
malization and expression controls. Slides were probed with a comprehensive set of val-
idated primary antibodies (Cell Signaling), thereafter a secondary antibody incubation
step to amplify the signal followed by a stable dye (40) precipitation. The stained slides
were analyzed using the Microvigene software (Vigene Tech) to produce quantified da-
ta.
Quantitative Real-Time polymerase chain reaction (qRT-PCR) p21, PFKFB3, PFKL,
PKM2, HK2, LKB1 mRNA expression together with HPRT as a reference gene, were ana-
lyzed in triplicates using SYBR Green qRT-PCR (Bio-rad laboratories, Veenendaal, The
Netherlands). Relative mRNA expression from triplicates was determined using the
ΔΔCt method (primer sequences Suppl. Table S2).
Metabolic assays THP-1 extracellular acidification rate (ECAR) for lactate produc-
tion and oxygen consumption rate (OCR) analysis for the mitochondrial respiration was
performed in two independent biological repeats of 6-plo and 4-plo (4h treatment), ac-
cording to manufacturer’s protocol using a XFe96 Analyzer (Seahorse Bioscience, Mas-
sachusetts, USA). OCR analysis for lactate production was performed in three independ-
ent biological repeats in 4-plo after 24h of anti-VEGFC treatment. In all OCR and ECAR
experiments 120.000 cells per well were seeded onto poly-L-lysine (Sigma-Aldrich,
Zwijndrecht, the Netherlands) coated plates. Glucose was used at a concentration of
10mM, oligomycin 2.5 uM, 2-deoxy-D-glucose (2-DG) at 100mM and trifluorocarbonyl-
55
3
cyanide phenylhydrazone (FCCP) at 0.25 uM.
THP-1 cells were incubated overnight with anti-VEGFC in 4 biological repeats in
3-plo/4-plo/6-plo/6-plo and incubated for 6h with 0.4 µCi/ml [5-3H]-D-glucose (Perkin
Elmer), as was previously described.28;29 Radioactivity was determined by scintillation
counting.
THP-1 xenografts in NOD-SCID/IL2γ-/- (NSG) mice NSG mice were purchased
from Charles River (UK). The ethical animal committee approved the experimental pro-
cedures (DEC6520). 10*106 THP-1 cells were injected subcutaneously. Mice were sacri-
ficed after 21 days receiving five anti-VEGFC treatment injections starting from day 4 af-
ter AML cell injection. Treatment was intra-peritoneal injected twice a week in therapy
groups of 6-7 animals receiving; scrambled THP-1, scrambled THP-1 anti-VEGFC
40mg/kg, shPFKFB3 THP-1, shPFKFB3 THP-1 anti-VEGFC 40 mg/kg, and in the second
pharmacologic model 25 mg/kg 3PO, 40 mg/kg anti-VEGFC, 12.5 mg/kg 3PO with 40
mg/kg anti-VEGFC or 25 mg/kg 3PO with anti-VEGFC. After sacrifice, half of the tumor
was prepared as single cell suspension using collagenase (Sigma-Aldrich, Zwijndrecht,
the Netherlands) dissociation for flow cytometric analysis of transduced cells.
Immunohistochemistry Frozen tumor sections were used for CD31 vessel staining
and phospho-Histone H3 proliferation marker. Frozen tumor sections were fixed in ace-
tone, and stained overnight with primary antibodies. After secondary HRP-linked anti-
body incubation (Dako cytomation, Heverlee, Belgium), we used a peroxidase reaction
mediated by DAB (3, 3’-diaminobenzidine, Abcam, Cambridge , UK) as a HRP substrate.
Statistics Statistical package for the social science (SPSS 17) software was used
for graphing box-plots. As indicated in the main text; Mann-Whitney U test was used to
determine differences between AML and NBM or two experimental groups of mice, two-
tailed paired Student’s t-tests for all analysis comparing untreated and treated AML cells
in various assays, Kruskal-Wallis test was used to define significant differences between
more than two groups.
56
3
Results
Anti-VEGFC treatment eliminates the expansion potential of CD34+ pediatric AML cells by inciting myelocytic
differentiation
All fractions of AML cells expressed significantly higher levels of VEGFC as com-
pared to NBM controls. Isolated CD34+ sorted AML cells were found to express the
highest levels of VEGFC, lower levels were detected in CD34- AML cells, and lowest lev-
els in NBM (Figure 1A, Kruskall-Wallis test, P = 0.013). KDR membrane protein expres-
sion was significantly higher in AML blasts as compared to NBM (Figure 1A, Mann-
Whitney U test, P = 0.001).8 In contrast, FLT-4 membrane protein expression was low in
both AML and NBM (Fig 1A, Mann-Whitney U test, P = 0.381). VEGFC is an important
prognostic factor in AML supporting AML blast growth and apoptosis evading signals
(Figure S1A/B/C). Therefore, we set out to investigate the AML treatment effects of anti-
VEGFC (30 µg/mL) using our experimental set-up for the rational design of combination
therapies (Figure 1B).
In KDR+ AML cell line THP-1, we found that anti-VEGFC treatment significantly
induced myelocytic differentiation by morphology and differentiation marker analysis of
CD11b and CD14 (Figure 1C/D, student’s t-test, both P < 0.05). Subsequently, anti-
VEGFC treatment induced apoptosis in a dose-dependent matter (Figure 1E). Anti-
VEGFC treatment reduced KDR membrane expression, which implicates a complete
eradication of the VEGFC signaling loop (Figure 1F).
57
3
Figure 1. VEGFC targeted therapy in AML. (A) VEGFC ELISA of normal bone marrow (NBM, n=4) cells,
CD34- AML cells (n=3) and CD34+ AML cells (n=5) (mean ± SEM, * P < 0.05). KDR (VEGFR-2) mem-
brane protein expression levels on pediatric AML blasts (n=60) and NBM (n=5) controls (mean ± SEM, *
P < 0.05). FLT4 (VEGFR-3) membrane protein expression levels on pediatric AML blasts (n=18) and NBM
(n=5) controls. (B) VEGFC targeting study approach for the rational design of combination therapy. (C)
May-Grunwald-Giemsa (MGG) staining of THP-1 cells untreated and treated with VEGFC targeting human
antibody (30µg/ml). (D) CD11b and CD14 flowxcytometric analysis of THP-1 untreated and anti-VEGFC
treated cells (mean ± SEM, * P < 0.05). (E) Dose-dependent apoptosis analysis of anti-VEGFC treated
THP-1 cells using annexin V staining (mean ± SEM, * P < 0.05). (F) Flow cytometric KDR membrane pro-
tein expression analysis upon anti-VEGFC treatment in THP-1 cells (mean ± SEM, * P < 0.05).
58
3
Next, CD34+ sorted pediatric AML samples were examined for anti-VEGFC treat-
ment effects in various culture assays (Figure S1E/F). Anti-VEGFC treatment showed a
25% reduction in the colony formation (CFC assay) of CD34+ sorted leukemic cells of
four AML patient samples and one AML patient sample showed decreased colony for-
mation solely after serial re-plate (Figure 2A, combining all performed CD34+ AML pa-
tient CFC assays, Mann-Whitney U test, P = 0.0192). The overall reduced number of col-
onies per plate was underscored by 35% lower total CFC cell counts in all AML samples
(Figure 2A, Mann-Whitney U test, P = 0.0028). In long-term culture initiating cells as-
says (LTC-IC) anti-VEGFC treatment decreased the outgrowth of CD34+ AML cells in 6
out of the 7 AML patient samples presenting a significant decrease in the overall LTC-IC
outgrowth with an average reduction of 28% (Figure 2B, Mann-Whitney U test, P =
0.003). LTC-ICs were still able to re-plate and to reconstitute the culture in the presence
of anti-VEGFC treatment. The LTC-IC assays performed in limiting dilution revealed a
further decrease in expansion potential upon anti-VEGFC treatment with an overall re-
duced CD34+ initiating leukemic cell outgrowth potential of 49% (Figure 2C, Mann-
Whitney U test, P = 0.003). The reduction in expansion potential of individual CD34+
sorted AML samples in various assays can be appreciated (Figure 2D). Besides de-
creased outgrowth, morphological analysis revealed increased myelocytic differentia-
tion (Figure 2E/F). We found a significant 3.3-fold induction of differentiation along the
myelocytic lineage in LTC-IC assays (Figure 2G, Mann-Whitney U test, P = 0.001). Differ-
entiation marker analysis of the viable cell populations confirmed increasing percent-
ages of cells stained positive for CD38, CD11b and CD14 or CD15 cells in liquid cultures,
CFC assays and LTC-IC assays as compared to untreated controls together with de-
creased percentages of cells that stained positive for CD34 (Figure 2H/S1G/H). Apopto-
sis analysis revealed an increase in the percentages of apoptotic cells in anti-VEGFC
treated cultures (Figure 2I/S1G).
59
3
Figure 2. VEGFC targeting therapy effects on CD34+ AML stem and progenitor cells. (A) Colony forming cell
(CFC) assay analysis of CD34+ pediatric AML cells using a single dose of anti-VEGFC treatment represent-
ing the number CFC colonies on the left and the total CFC cell counts on the right (n=6, mean ± SEM, * P <
0.05). (B) CD34+ AML expansion potential in long-term colony forming cell assay (LTC-IC) after 7 weeks
60
3
of AML culturing on a mouse stromal feeder layer (n=7, mean ± SEM, * P < 0.05). (C) CD34+ AML expan-
sion potential of cobblestone forming cells residing underneath the stromal layer after 5 weeks of cultur-
ing, measured in limiting dilutions by their CFC output potential (n=5, mean ± SEM, * P < 0.05). (D) CFC,
LTC-IC and LTC-IC in limiting dilution represented per AML patient sample. (E) Representative MGG
stained cytospins of anti-VEGFC treated CD34+ AML samples in CFC and LTC-IC assays. (F) Microscopic
quantification of AML cell culture composition of hematopoietic myeloid cells in LTC-IC assays analysis
comparing untreated and anti-VEGFC treated cultures (n=7). (G) Box-plot presenting the mean percent-
age of myelomonocytic cells quantified from MGG stained cytospins comparing untreated and anti-VEGFC
treated cultures (mean ± SEM, * P < 0.05). (H) Flow cytometric confirmation of anti-VEGFC induced mye-
lomonocytic differentiation in CD34+ AML CFC and LTC-IC assays by CD38, CD34, CD11b and CD14 mem-
brane protein expression analysis. (I) Annexin V apoptosis analysis of untreated and anti-VEGFC treated
cultures.
Conformable to previous findings, neutralizing antibodies for KDR and FLT-4 did
not decrease AML outgrowth nor increased myelocytic differentiation of AML cells (Fig-
ure S1I).11 To assess whether the anti-VEGFC treatment affects the leukemic clone in-
stead of only remnant normal CD34+ cells, we determined FLT3-ITD allelic ratios in the
FLT3-ITD mutant AML samples. FLT3-ITD fragment analysis showed identical ratios of
heterozygous FLT3-ITD mutants in untreated and anti-VEGFC treated for AML4 CFC and
LTC-IC assays and for AML2 in LTC-IC assays (Table S3). As expected, the sorted in-
creased myelocytic and more primitive cell fractions of untreated and anti-VEGFC treat-
ed AML4 LTC-IC cultures all harbored identical ratios of the heterozygous FLT3-ITD al-
lele (Table S3). While all tested CD34+ AML samples showed a decreased outgrowth po-
tential in various CD34+ culture assays upon anti-VEGFC treatment, the cellular re-
sponses for FLT3-WT AML samples were superior to the FLT3-ITD AML samples (Figure
S2A, Mann-Whitney U test, P = 0.042). Control CD34+ NBM cultures showed approxi-
mately 3-4 weeks latency in myelocytic lineage skewing in NBM CD34+ cells as com-
pared to AML CD34+ cells (Figure S2B/C).
Identification of anti-VEGFC targeting mechanisms in pe-diatric AML
As a first approach to define VEGFC downstream targets, we combined flow cy-
tometric VEGFC and KDR protein expression analysis together with reverse phase pro-
tein array (RPPA) analysis of the same set of pediatric AML samples. The VEGFC/KDR
interactome showed strong significant associations with CCND3, LGALS3, FOXO3
(S318/321), PRKCD (S645), KIT, LSD1, NPM1, EIF2AK2, PTPN11, SSBP2, STAT5A/B (Fig-
ure 3A, Pearson correlations, all P < 0.05).
61
3
Figure 3. Identification of anti-VEGFC targeting mechanisms in pediatric AML and potential bypass mecha-
62
3
nism. (A) Flow cytometric VEGFC and KDR expression analysis combined with RPPA array analysis in pe-
diatric AML samples. The Venn diagram shows significantly overlapping protein expression. Bold proteins
show a positive correlation and non-bold proteins presenting a negative correlation. All shown proteins
were analyzed by RPPA analysis accept the ones that described to be analyzed by FACS (flow cytometry).
(B) Phospho-protein array analysis presented as anti-VEFC targeting effects relative to untreated control
CD34+ AML samples (n=3) (mean ± SEM, * P < 0.05). (C) Immunoblot confirmation of anti-VEGFC
treatment effects on MAPK/Erk, STAT5, and FOXO3A protein expression and phosphorylation in pediatric
CD34+ AML samples, CD34+ NBM controls and THP-1 cells. (D) FOXO3A intracellular protein expression
as measured by FACS analysis of 24h treated primary AML samples and THP-1 cells. (E) Anti-VEGFC
treatment effects on gene expression in pediatric CD34+ AML samples (n=9, P < 0.05). (F) Gene expres-
sion array results of PFKL and HK3 in pediatric CD34+ AML samples (n=9) and NBM controls (n=2) up-
on anti-VEGFC treatment (mean ± SEM, * P < 0.05). (G) Immunoblot confirmation of total PFKL and
PFKFB3 protein reduction upon anti-VEGFC treatment in primary AML samples and THP-1 cells. (H) Rela-
tive glycolytic flux analysis comparing 24h untreated and anti-VEGFC treated THP-1 (mean ± SEM, * P <
0.05). (I) Extracellular acidification rate analysis after 24h anti-VEGFC treatment in THP-1 cells (mean ±
SEM, * P < 0.05).
VEGFC selective positive associations were found for HDAC6, RPS6 (S240/244),
and KDR specific positive correlations were found for MAPK1, MAP2K1, and Src, while
GATA1 showed a negative correlation (Figure 3A, Pearson correlations, all P < 0.05).
Subsequently, we analyzed phospho-proteome arrays of three independent untreated
and anti-VEGFC treated AML samples. Phosphorylation of MEK1/2 (S218/S222,
S222/S226), AMPKα2 (T172), HSP27 (S78/S82), Paxillin (Y118), STAT2 (Y689), and
STAT5b (Y699) were significantly reduced in anti-VEGFC treated AML samples (Figure
3B, paired samples t-test, mean ± SEM, * P < 0.05). Decreased phosphorylation of
ERK1/2 and STAT5a/b was confirmed by western blot analysis in anti-VEGFC treated
CD34+ AML samples, but not in CD34+ NBM (Figure 3C).
Decreased AMPK activity reduces FOXO3A, which in turn allows differentiation of
the AML blasts.12 In line with previous findings in adult AML, the basal levels of FOXO3A
expression and its phosphorylation were found to be significantly increased in pediatric
AML as compared to CD34+ NBM samples (Figure S2D).13 Total FOXO3A protein ex-
pression was decreased after 24h anti-VEGFC treatment in THP-1 cells (Figure 3C). Flow
cytometric analysis confirmed that FOXO3A total protein expression showed to be inhib-
ited by anti-VEGFC treatment in primary AML and THP-1 cells (Figure 3D).
Gene expression profiles allowed determination of differentially expressed genes
upon anti-VEGFC treatment in CD34+ AML samples to define possible escape mecha-
nism for the rational design of combination therapy in AML (Figure 3E, n=9, Table S4).
Many AML associated genes were found to be significantly downregulated e.g. CXCR4,
SerpinB2, CITED2, BST1, while EVI1, HOXB3 and GATA1 expression were upregulated.14-
16 VEGF associated genes and growth factors were simultaneously downregulated e.g.
HGF, FGFs, PIGF, COXs, JUN and MAPK1, while PTPNs were frequently upregulated. Simi-
63
3
lar as we observed in THP-1, KDR was significantly downregulated in anti-VEGFC treat-
ed AML samples. Interestingly, anti-VEGFC treatment induced metabolic reprogramming
by increasing the expression of metabolic genes e.g. HK3 that similarly to HK2 is in-
volved in catalyzing the first step in the glycolysis pathway and PFKL, which encodes an
enzyme that catalyzes the third step in the glycolysis pathway (Figure 3E/F). These
genes were not affected by anti-VEGFC treatment in CD34+ NBM samples (Figure 3F).
From these in depth analysis, we defined decreased AMPK phosphorylation by
anti-VEGFC treatment as a key regulating event necessary for controlling the expression
of FOXO3A for the preservation of primitive AML cells and guiding PFKFB3 for glycolysis
regulation in AML CD34+ blasts.17 Moreover, basal expression levels of glycolytic acti-
vating proteins PFKFB3 and PFKL were increased in pediatric AML in comparison to
CD34+ NBM control cells (Figure S2E). In addition, expression levels of PFKFB3 and
PFKL were found to be induced in anti-VEGFC treated AML samples and THP-1 cells
(Figure 3G). Anti-VEGFC treatment induced a 1.8-fold increase in the glycolytic flux
(Figure 3H/S3A, D-[5-3H]-glucose, paired samples t-test, P < 0.001). Anti-VEGFC treat-
ment induced glycolysis was confirmed in THP-1 by increased lactate production upon
glucose addition and a higher maximum glycolytic rate (Figure 3I, student’s t-test, P <
0.001). These findings defined metabolic reprogramming by enhancing the glycolysis as
a possible adaptive escape route for the survival of AML blasts upon anti-VEGFC treat-
ment.
Anti-VEGFC induced glycolysis as adaptation to targeted therapy; intervention opportunity for
combined VEGFC and PFKFB3 inhibition in AML
To gain insights into the effects of glycolysis inhibition in AML, we generated
PFKFB3 knockdown to target the controlled conversion of fructose-6-phosphate to and
from fructose-2,6-biphosphate, a key regulator of the glycolytic enzyme phosphofructo-
kinase-1 (PFK-1/PFKL). PFKFB3 knockdown in AML cell lines facilitated 40-50%
PFKFB3 transcriptional and translational downregulation (Figure 4A). The proliferation
was significantly reduced by PFKFB3 knockdown in AML (Figure 4B/S3B, paired sam-
ples t-test, THP-1 P = 0.012 and MOLM13 P = 0.042). Apoptosis was only induced in
MOLM13 AML cells but not in THP-1 (Figure 4C, students t-test, P = 0.002). PFKFB3
knockdown suppresses the cell cycle by increasing p21 mRNA expression (Figure 4C,
64
3
student’s t-test P < 0.05).
Although AML proliferation is delayed by shPFKFB3 the effects of anti-VEGFC in-
duced apoptosis and myelocytic differentiation were still present in THP-1 (Figure
S3C/D).
Pharmacological inhibition of PFKFB3 using 3PO showed a strong dose depend-
ent inhibition of AML blast survival in liquid CD34+ pediatric AML sorted cultures (Fig-
ure 4D). Supporting this finding, we observed a pronounced 3PO targeting effect on AML
blasts that was further enhanced by anti-VEGFC treatment, while lymphocytes were not
affected by the combination therapy (Figure 4E/S3E). Simultaneous inhibition of
PFKFB3 and VEGFC reduced the expansion potential of THP-1 AML cells in CFC assays as
compared to single therapies and controls (Figure 4F, Student’s t-test, P = 0.002). Com-
bination therapy provoked a superlative decrease in PFKFB3 and downstream PFKL
mRNA expression in conjunction with an increase in p21 mRNA expression upon com-
bination therapy equivalent to shPKFB3 results (Figure 4G, Student’s t-test, P < 0.05).
Confirming our previous findings, anti-VEGFC induced glycolysis resulted in enhanced
lactate production (Figure 4H, extracellular acidification rate (ECAR), Student’s t-test, P
= 0.002). Combined pharmacological inhibition of PFKFB3 and VEGFC reduced the max-
imum glycolytic capacity and resulted in a shutdown of the mitochondrial maximum
respiration capacity already after 4h of treatment (Figure 4H, ECAR P <0.01 and oxygen
consumption rate (OCR) P < 0.001).
65
3
Figure 4. Glycolysis inhibition subsequent to anti-VEGFC targeting strategies in AML. (A) Validation of
shRNA functionality targeting PFKFB3 in AML cells was confirmed by reduced mRNA expression and
66
3
PFKFB3 total protein expression in THP-1 and MOLM13 AML cell lines (mean ± SEM, * P < 0.05). (B) Pro-
liferation potential by serial growth analysis comparing scrambled controls and shPFKFB3 AML cell lines
(mean ± SEM, * P < 0.05). (C) Apoptosis annexin V staining analysis of scrambled controls and shPFKFB3
AML cell lines with subsequent cell cycle inhibitor p21 mRNA expression analysis (mean ± SEM, * P <
0.05). (D) Absolute viable cell counts (cell counts-annexin V+ %) measured at day 5 after DMSO or 3PO
treatment (2ug/ml ~9.5uM and 4ug/ml ~19uM) (mean ± SEM). (E) Flow cytometric analysis of apoptosis
and hematopoietic markers CD11b and CD14 to define different cellular subsets in an unsorted AML sam-
ple upon 72h 3PO treatment in the absence or presence of anti-VEGFC treatment, relatively to the DMSO
treated control. (F) Absolute viable CFC assays cell counts upon 3PO, anti-VEGFC or combined treatment
in THP-1 cells (mean ± SEM, * P < 0.05) and (G) relative PFKFB3, PFKL and p21 mRNA expression analy-
sis. (H) Oxygen consumption rate and extracellular acidification rate analysis after 4h 3PO, anti-VEGFC or
combined treatment in THP-1 cells (mean ± SEM, * P < 0.05).
Combined VEGFC and PFKFB3 inhibition acts
synergistically and reduces in vivo AML
progression
To investigate in vivo PFKFB3 inhibitory effects in combination with anti-VEGFC
treatment, we used an AML THP-1 xenograft model in NSG (NOD-SCID/IL2γ-/-) mice. By
using engineered THP-1 cells with genetic knockdown for PFKFB3 (shPFKFB3) and
scrambled controls (scram), we found a significant reduction in AML xenograft for-
mation (Figure 5A, Mann-Whitney U test, P = 0.020). The in vivo growth expansion po-
tential of shPFKFB3 cells as compared to scrambled controls was decreased as can be
appreciated by the significant reduction in the number of mCherry expressing shRNA
cells in shPFKFB3 tumors as compared to scrambled controls (Figure 5A/S4A, Kruskall
Wallis test, P < 0.001). This finding reveals that mainly the non-transduced THP-1 cells
were shown to give rise to tumor output in vivo, similar to the in vitro observation (Fig-
ure 5A/S4A). In line with this finding, the shPFKFB3 tumors showed a trend for reduced
percentage of proliferating transduced cells (mCherry+ ki67+) (Figure S4B). The num-
ber of hypoxia positive cells (pimonidazole) was not different between groups (Figure
S4B). In this xenograft model, we could not observe the effects of anti-VEGFC treatment
due to loss of PFKFB3 knockdown cells.
As a second approach, we investigated pharmacologic inhibition of PFKFB3 and
VEGFC by combination therapy in the AML THP-1 xenograft model in NSG mice. Tumor
volumes were significantly different between treatment groups (Figure 5B, Kruskal-
Wallis test, P = 0.046). Upon 3PO and anti-VEGFC combination therapy the tumor vol-
umes were significantly reduced in a dose-dependent manner (Figure 5B, Mann-
67
3
Whitney U test, P = 0.018). Tumor volumes of combination therapies were significantly
reduced as compared to monotherapies (Figure 5B, Mann-Whitney U test, P = 0.019).
The proliferation index was not significantly different between groups (Figure 5C/D,
Kruskal-Wallis test, P = 0.312).
Figure 5. Combined effects of glycolysis and VEGFC inhibition in AML xenografts. (A) AML xenograft tumor
volumes of either untreated or anti-VEGFC treated (40mg/kg) mice, comparing scrambled controls and
shPFKFB3 THP-1 xenografts, with subsequent mCherry tracing after sacrifice using flow cytometry (n=6
mice per treatment group, mean ± SEM). (B) THP-1 AML xenograft tumor volumes after serial treatment
68
3
with 3PO, anti-VEGFC or a combination of 3PO and anti-VEGFC (12.5mg/kg 3PO or 25mg/kg 3PO) (n=7
mice per treatment group, mean ± SEM). (C) Quantification of immunohistochemistry analysis presented
as (D) tumor proliferation index by phospho-Histone H3+ staining, vessel number by CD31+ staining of
the tumor vessels comparing 3PO treated mice with anti-VEGFC treated mice with combination therapy
groups of 12.5mg/kg 3PO and 25 mg/kg 3PO (n=7 per group, mean ± SEM,* P < 0.05). (E) Relative tumor
mRNA expression analysis of human HK2, PKM2 and LKB1 comparing different treatment groups e.g. 3PO,
anti-VEGFC or a combination of 3PO and anti-VEGFC (12.5mg/kg 3PO or 25mg/kg 3PO) (n=3 tumors per
treatment group, mean ± SEM,* P < 0.05).
The number of tumor vessels was not different between experimental groups (Fig-
ure 5C/D, Kruskal-Wallis test, P = 0.564). Next, we analyzed the gene expression dy-
namics of glycolysis initiating and glycolysis TCA cycle entrance genes (Figure 5E). In
line with our previous findings, glycolysis was significantly upregulated solely in anti-
VEGFC treated tumors, as shown by HK2 expression, which was efficiently reduced by
subsequent 3PO treatment (Mann-Whitney U test, P < 0.05 for anti-VEGFC versus all
other groups). Downstream in the glycolysis pathway, we found that anti-VEGFC treat-
ment slightly increased PKM2 expression and combination therapy decreased PKM2 ex-
pression in a synergistic dose-dependent manner, revealing a strong shutdown of gly-
colysis with similar dynamics as we observed upon combination therapy in vitro (Mann-
Whitney U test, all P < 0.05). As AMPK/FOXO3A has been shown to act as a metabolic
stress sensor that coordinates the expression of LKB1, we analyzed LKB1 expression
and found it to be efficiently decreased upon combination therapy (Figure 5E, compar-
ing monotherapy to combination therapies, Mann-Whitney U test, all P < 0.05).18 The
combination of glycolysis inhibition with subsequent anti-VEGFC treatment showed to
be very efficient and synergistic in combination therapy to reduce tumor formation via
the inhibition of the LKB1/AMPK/PFKFB3 axis in AML xenografts.
69
3
Discussion
VEGFC has been shown to be an independent prognostic factor and showed to inter-
fere with AML survival in vivo and ex vivo.5;9;10 In this study, we found that mono-
therapy targeting VEGFC had efficacy, but the upregulation of a glycolysis escape route
prevented this from efficiently targeting tumor progression in vivo. Recognition of the
anti-VEGFC induced metabolic reprogramming via the glycolysis escape route, suggested
that combination therapy simultaneously blocking VEGFC and glycolysis might be ad-
vantageous. It can be appreciated from this study that neither the inhibition of CD34+
AML blast proliferation, nor the skewing of CD34+ blast differentiation, were individual-
ly definitive for AML eradication, and that the metabolic balance was important for leu-
kemia maintenance. However, the combined inhibition of all three of these important
AML maintenance functions synergistically targeted CD34+ AML blasts in an efficient
synergistic manner in vitro as well as in vivo.
The net result of anti-VEGFC treatment effects on downstream proteins led to an
overall reduced CD34+ AML cell outgrowth of approximately 30-50% in all assays. Anti-
VEGFC treatment affected important signaling proteins including; MAPK/Erk pathway.
The downregulation of the MAPK signaling proteins may be able to suppress the prolif-
eration of leukemic cells partly. In our previous study, we showed that even when we
target the most sensitive cytogenetic subgroup of AMLs with MEK inhibition, there is an
escape mechanism facilitated by VEGFR-2 signaling activation.8 To this extend, in a
phase II clinical trial MEK inhibition only resulted in modest anti-leukemic responses.19
This supports the fact that only targeting the MAPK pathway is not sufficient to eradi-
cate AML blasts and the interconnection of the network easily results in the activation of
escape mechanisms. Terminal myelocytic differentiation through FOXO3A suppression
by anti-VEGFC treatment will also have contributed to the reduced expansion capacity of
CD34+ AML blasts. This study is one of the few that showed potent differentiation of the
CD34+ leukemic clone by pharmacologic VEGFC targeting antibody therapy. So far the
only differentiation therapy available as conventional therapy in the clinics is ATRA, ap-
plied to all acute promyelocytic leukemia (APL) patients that harbor the PML-RARA fu-
sion protein. This differentiation therapy significantly improved the outcome of APL.20;21
VEGFC targeting therapy therefore represents a promising new differentiation therapy
70
3
in AML. VEGFC targeting antibody therapy showed high therapeutic potency and is cur-
rently under investigation in a phase I clinical trial in combination with Bevacizumab
(VEGFA targeting antibody) for advanced solid tumors, which showed to be well tolerat-
ed (NCT01514123). Subsequently, we found that anti-VEGFC treatment blocked the
erythroid outgrowth in 2 out of 5 patients in long-term CD34+ AML cultures, which can
be caused by the inhibition of STAT5 phosphorylation that is known to guide erythro-
poiesis, even in the presence of enhanced GATA1 mRNA expression.22;23 Evidence of sim-
ilar effects should be watched for in the ongoing clinical trial of this compound.
The current state of development with regards to glycolysis inhibitors is still lim-
ited. Most research has been performed using a PFKFB3 inhibitor. The high glycolytic
turnover of leukemic cells allows a therapeutic window for targeting glycolysis in AML.
Glycolysis inhibitory effects in cancer xenografts were shown at dosages of 70 mg/kg us-
ing an intensive treatment regimen, which to the extent of this study is not reaching
therapeutic translation towards the clinics for the use of glycolysis targeting agents, due
to high levels of drugs toxicity.24;25 Nevertheless, our results show that lower dosages of
3PO can be successfully used for in vivo modeling of glycolysis inhibitory effects. Most
presented 3PO studies made use of mouse-mouse models, without being able to meas-
ure intra-tumoral glycolysis inhibitory effects. In this study, the human xenograft mouse
model enabled to measure human specific glycolysis gene expression to show the accu-
rate glycolysis inhibitory intra-tumoral effects at low dosages 3PO in the combination
with anti-VEGFC. This study showed that the rational design of successful combination
therapies it is essential to 1) define cancer cell specificity of the drugs that restricts the
cytotoxic effects on other cell types and 2) to be aware of potential bypass opportunities
by activating pathways of cellular resistance. In our model, we showed that CD34+ NBM
cells are less dependent on both VEGFC and PFKFB3 targeting agents due to lower ex-
pression of the VEGFC/VEGFR-2, FOXO3A and PFKFB3/PFKL axis as compared to AML
blasts. This is important for defining the therapeutic translational capacity of combined
anti-VEGFC and PFKFB3 inhibitory agents into the clinics.
So far, our findings indicate an important regulatory function for VEGFC in CD34+
AML cell fate decisions. Anti-VEGFC therapy reduced the CD34+ AML blast expansion
via MAPK/Erk and enforced myelocytic differentiation by AMPK/FOXO3A suppression.
Dynamic adaptation was shown by anti-VEGFC induced metabolic reprogramming re-
sulting in glycolytic acceleration for lactate production via PFKFB3/PFKL. Inhibition of
71
3
VEGFC and glycolysis shows significant in vivo therapeutic potential, creating opportuni-
ties for additional differentiation therapy besides high dose chemotherapy in AML.
Acknowledgements
First of all, we would thank Megan E. Baldwin and Robert Klupacs from Vegenics for
their generous supply of anti-VEGFC treatment reagent (VGX-100). We would like to
thank Kirin Brewery for providing TPO used in LTC-IC assays. We would also like to
thank Imclone for providing KDR and FLT-4 neutralizing antibodies. In addition, we
thank Henk Moes, Roelof Jan van der Lei and Geert Mesander for assistance in cell sort-
ing. We appreciate the help of the pathologist W. A. den Dunnen at the UMCG for prepar-
ing the paraffin embedded tumor sections. We thank J. J. Schuringa from the department
of Experimental Hematology for his expert opinion, the discussions and for providing
the MS5 feeder layer and Bart-Jan Wierenga for the lentiviral plasmid. Götz Hartleben
from European Research Institute for the Biology of Ageing was of great help with per-
forming the seahorse experiments. Sandra Schoors and Guy Eelen from Carmeliet’s lab
helped with radioactive glycolysis assays. The authors would like to thank the patients
who donated leukemia specimens; physician assistants, nurse practitioners, and fellows
who acquired specimens.
Authorship contributions
K.R.K. designed research, performed research, collected data and wrote the paper.
F.J.G.S performed research. T.A. assisted performing the seahorse experiments. A.t.E. and
H.M. took part in the AML RPPA project. A.B.M. performed FLT3-ITD analysis. V.G. per-
formed gene expression normalization and supervised gene expression analysis and in-
terpretations. G.E and P.C. enabled glycolysis flux analysis and 3PO expertise. S.M.K. per-
formed RPPA analysis. E.S.J.M.d.B. designed research, supervised and wrote the paper.
Grant support
K.R.K. was supported by a PhD grant from the Foundation for Pediatric Oncology
Groningen, the Netherlands (SKOG, 12001), animal experiments were granted by Foun-
dation Beatrix Children’s Hospital (2014 to K.R. Kampen), a short-term fellowship was
received from the Dutch Cancer Society (KWF, 2014 to K.R. Kampen) to obtain
knowledge on metabolomics and a subsequent grant was received from the Jan Kornelis
de Cock Stichting (project code 2015-43 to K.R. Kampen). A.t.E and H.M. shared the KiKa
72
3
grant for the kinomics/proteomics AML project (2010-57 to E.S.J.M. de Bont and S.M.
Kornblau). P.C. is supported by a Federal Government Belgium grant (IUAP7/03), long-
term structural Methusalem funding by the Flemish Government, a Concerted Research
Activities Belgium grant (GOA2006/11), grants from the FWO (G.0532.10, G.0817.11,
G.0598.12, G.0834.13, 1.5.202.10N, G.0764.10N and 1.5.142.13N ‘Krediet aan navors-
ers’), Foundation against Cancer and ERC Advanced Research Grant (EU-ERC269073).
73
3
Reference List
1. Cao Y, Linden P, Farnebo J et al. Vascular endothelial growth factor C induces angiogenesis in vivo.
Proc.Natl.Acad.Sci.U.S.A 1998;95:14389-14394.
2. Chien MH, Ku CC, Johansson G et al. Vascular endothelial growth factor-C (VEGF-C) promotes angiogenesis
by induction of COX-2 in leukemic cells via the VEGF-R3/JNK/AP-1 pathway. Carcinogenesis 2009;30:2005-
2013.
3. Hamada K, Oike Y, Takakura N et al. VEGF-C signaling pathways through VEGFR-2 and VEGFR-3 in vasculo-
angiogenesis and hematopoiesis. Blood 2000;96:3793-3800.
4. Skobe M, Hawighorst T, Jackson DG et al. Induction of tumor lymphangiogenesis by VEGF-C promotes breast
cancer metastasis. Nat.Med. 2001;7:192-198.
5. Dias S, Choy M, Alitalo K, Rafii S. Vascular endothelial growth factor (VEGF)-C signaling through FLT-4
(VEGFR-3) mediates leukemic cell proliferation, survival, and resistance to chemotherapy. Blood
2002;99:2179-2184.
6. Fiedler W, Graeven U, Ergun S et al. Vascular endothelial growth factor, a possible paracrine growth factor in
human acute myeloid leukemia. Blood 1997;89:1870-1875.
7. Fielder W, Graeven U, Ergun S et al. Expression of FLT4 and its ligand VEGF-C in acute myeloid leukemia.
Leukemia 1997;11:1234-1237.
8. Kampen KR, Ter Elst A, Mahmud H et al. Insights in dynamic kinome reprogramming as a consequence of
MEK inhibition in MLL-rearranged AML. Leukemia 2014;28:589-599.
9. de Jonge HJ, Valk PJ, Veeger NJ et al. High VEGFC expression is associated with unique gene expression pro
files and predicts adverse prognosis in pediatric and adult acute myeloid leukemia. Blood 2010;116:1747-
1754.
10. de Jonge HJ, Weidenaar AC, Ter Elst A et al. Endogenous vascular endothelial growth factor-C expression is
associated with decreased drug responsiveness in childhood acute myeloid leukemia. Clin.Cancer Res.
2008;14:924-930.
11. Weidenaar AC, Ter Elst A, Kampen KR et al. Impaired Long-Term Expansion and Self-Renewal Potential of
Pediatric Acute Myeloid Leukemia-Initiating Cells By PTK787/ZK 222584. Mol.Cancer Res. 2013;11:339-348.
12. Sykes SM, Lane SW, Bullinger L et al. AKT/FOXO signaling enforces reversible differentiation blockade in
myeloid leukemias. Cell 2011;146:697-708.
13. Kornblau SM, Singh N, Qiu Y et al. Highly phosphorylated FOXO3A is an adverse prognostic factor in acute
myeloid leukemia. Clin.Cancer Res. 2010;16:1865-1874.
14. Ashton JM, Balys M, Neering SJ et al. Gene sets identified with oncogene cooperativity analysis regulate in
vivo growth and survival of leukemia stem cells. Cell Stem Cell 2012;11:359-372.
15. Korthuis PM, Berger G, Bakker B et al. CITED2-mediated human hematopoietic stem cell maintenance is
critical for acute myeloid leukemia. Leukemia 2015;29:625-635.
16. Chen Y, Jacamo R, Konopleva M et al. CXCR4 downregulation of let-7a drives chemoresistance in acute
myeloid leukemia. J.Clin.Invest 2013;123:2395-2407.
17. Faubert B, Boily G, Izreig S et al. AMPK is a negative regulator of the Warburg effect and suppresses tumor
growth in vivo. Cell Metab 2013;17:113-124.
18. Lutzner N, Kalbacher H, Krones-Herzig A, Rosl F. FOXO3 is a glucocorticoid receptor target and regulates
LKB1 and its own expression based on cellular AMP levels via a positive autoregulatory loop. PLoS.One.
2012;7:e42166.
19. Jain N, Curran E, Iyengar NM et al. Phase II study of the oral MEK inhibitor selumetinib in advanced acute
myelogenous leukemia: a University of Chicago phase II consortium trial. Clin.Cancer Res. 2014;20:490-498.
20. Tallman MS, Andersen JW, Schiffer CA et al. All-trans-retinoic acid in acute promyelocytic leukemia.
N.Engl.J.Med. 1997;337:1021-1028.
21. Fenaux P, Le Deley MC, Castaigne S et al. Effect of all transretinoic acid in newly diagnosed acute
promyelocytic leukemia. Results of a multicenter randomized trial. European APL 91 Group. Blood
1993;82:3241-3249.
22. Shimizu R, Engel JD, Yamamoto M. GATA1-related leukaemias. Nat.Rev.Cancer 2008;8:279-287.
74
3
23. Wierenga AT, Vellenga E, Schuringa JJ. Down-regulation of GATA1 uncouples STAT5-induced erythroid
differentiation from stem/progenitor cell proliferation. Blood 2010;115:4367-4376.
24. Clem B, Telang S, Clem A et al. Small-molecule inhibition of 6-phosphofructo-2-kinase activity suppresses
glycolytic flux and tumor growth. Mol.Cancer Ther. 2008;7:110-120.
25. Klarer AC, O'Neal J, Imbert-Fernandez Y et al. Inhibition of 6-phosphofructo-2-kinase (PFKFB3) induces
autophagy as a survival mechanism. Cancer Metab 2014;2:2.
26. Schnittger S, Bacher U, Kern W et al. Prognostic impact of FLT3-ITD load in NPM1 mutated acute myeloid
leukemia. Leukemia 2011;25:1297-1304.
27. Kornblau SM, Tibes R, Qiu YH et al. Functional proteomic profiling of AML predicts response and survival.
Blood 2009;113:154-164.
28. Aragones J, Schneider M, Van GK et al. Deficiency or inhibition of oxygen sensor Phd1 induces hypoxia
tolerance by reprogramming basal metabolism. Nat.Genet. 2008;40:170-180.
29. De Bock K, Georgiadou M, Schoors S et al. Role of PFKFB3-driven glycolysis in vessel sprouting. Cell
2013;154:651-663.
75
3
Supplementary data
76
3
Supplementary figure 1. VEGFC targeting potential in pediatric AML. (A) LTC-IC assays growth analysis of
CD34+ AML cells with the addition of VEGFC weekly added to the culture. (B) Relative anti-apoptotic Bcl-
XL mRNA expression analysis of VEGFC treated CD34+ AML blasts (mean ± SEM,* P < 0.05). (C) Cleavage
of WST-1 to formazan of VEGFC treated NBM cells and AML cells (mean ± SEM,* P < 0.05). (D) THP-1 flow
cytometric analysis of KDR and FLT4 membrane protein expression. (E) Sorting efficiency of CD34+ AML
populations. (F) Cartoon explaining differences between CFC, LTC-IC and LTC-IC in limiting dilution assay
analysis. (G) Flow cytometric analysis of membrane protein expression for CD38, CD14 and annexin V/PI
apoptosis analysis of CFC assay cells 2 weeks after plating 1000 CD34+ AML cells either untreated or
treated with a single dosage of anti-VEGFC. Flow cytometric analysis of membrane protein expression for
CD34, CD14, CD11b and annexin V/PI apoptosis analysis of unsorted liquid AML cultures at week 1 after
either untreated or treated with a single dosage of anti-VEGFC. (H) Flow cytometric analysis of membrane
protein expression for CD34, CD14 and CD11b of LTC-IC assay cells after 8 weeks of culturing in the pres-
ence or absence of anti-VEGFC. (I) THP-1 apoptosis analysis by annexin V/PI staining of untreated of anti-
KDR and anti-FLT4 targeting antibodies.
Supplementary figure 2. Specificity of anti-VEGFC targeting effects on pediatric CD34+ AML blasts. (A)
Overall therapeutic anti-VEGFC targeting effects on CD34+ AML blasts expansion potential comparing
FLT3-WT and FLT3-ITD AML patient samples in all performed CFC, LTC-IC and LTC-IC assays in limiting
dilutions (mean ± SEM,* P < 0.05). (B) MGG stained cytospins and their subsequent flow cytometric
membrane protein expression analysis for CD11b, CD14 and CD15 of CD34+ sorted NBM control samples
during the weeks of anti-VEGFC treatment showing a latency in VEGFC targeting effects (mean ± SEM).
(C) CFC assay of CD34+ sorted NBM cells upon anti-VEGFC treatment (mean ± SEM). (D) RPPA analysis
of total and phosphorylated FOXO3A protein expression in pediatric AML (n=31) and CD34+ NBM con-
trols (n=10) (mean ± SEM,* P < 0.05). (E) Immunoblot analysis of PFKL and PFKFB3 protein expression
in pediatric AML samples and CD34+ NBM controls.
77
3
Supplementary figure 3. Glycolysis targeting via PFKFB3 inhibition in AML. (A) Effects of anti-VEGFC on
glycolytic flux in THP-1 (mean ± SEM,* P < 0.05). (B) Absolute average growth reduction by shPFKFB3 in
independent experiments with different transduction efficiencies
78
3
(mean ± SEM,* P < 0.05). (C) Flow cytometric analysis of CD14 membrane protein expression after 48h
anti-VEGFC treatment comparing scrambled controls and shPFKFB3 THP-1 cells (mean ± SEM,* P < 0.05).
(D) Flow cytometric apoptosis analysis by annexin V staining comparing 48h and 72h of anti-VEGFC
treatment effects in scambled controls and shPFKFB3 THP-1 cells (mean ± SEM,* P < 0.05). (E) Flow cy-
tometric analysis presenting the sideward scatter (SSC) and the forwards scatter (FSC) of the unsorted
AML population with subsequent annexin V/PI apoptosis analysis and membrane protein expression
stainings for CD14 and CD11b of unsorted liquid AML cultures after 72h treatment with DMSO, 3PO
(2ug/ml, ~10uM) or 3PO combined with anti-VEGFC.
Supplementary figure 4. shPFKFB3 THP-1 xenograft flow
cytometric analysis. (A) In vitro analysis of injected THP-
1 cells at day 3 after implantation and at day 18 after im-
plantation, showing similar flow cytometric mCherry ex-
pression dynamics as compared to in vivo readout. (B)
Flow cytometric, hypoxia and ki67 expression analysis
between the different xenograft groups comparing
scrambled, scrambled plus anti-VEGFC, shPFKFB3 and
shPFKFB3 plus anti-VEGFC.
79
3
Supplementary Table S1. Pediatric AML patient sample characteristics.
FAB Karyotype Blasts (%)
VEGFC
(pg/mL) KDR (%) FLT-4 (%) CD34 (%) FLT3
AML1 M0 complex na 353 42 <5 92 WT
AML2 M4 t(6;9) 83 484 3,5 <5 40 ITD
AML3 M4 NK 73 269 83 <5 35 ITD
AML4 M4 9q- 82 na 41,9 <5 40 ITD
AML5 M4 INV16 83 444 32,6 <5 55,2 na
AML6 M5 complex 81 na 94,1 <5 0,19 na
AML7 M2 t(8;21) na 238 2,8 <5 77,9 WT
AML8 M5 complex 80 418 22 <5 66,5 WT
AML9 M5 trisomy 8 68 397 33,75 <5 1,84 ITD
FAB = French–American–British classification, KDR= kinase insert domain receptor, FLT-4= fsm-related
tyrosine kinase 4, FLT3= fms-like tyrosine kinase 3, WT = wildtype, ITD = internal tandem duplication.
Supplementary Table S2. Primer sequences and antibody characteristics used for in vitro analysis.
Primer sequences forward reverse
HPRT TTGCTGACCTGCTGGATTAC CCCTGTTGACTGGTCATTAC
PFKFB3 CCTCGTTGCCCAGATCCTGT GCTAAGGCACATTGCTTCCG
PFKL TGTGAGAGGCTGGGTGAGAC ACGAGATGGGCTTCCCGTTG
P21 GGCAGACCAGCATGACAGATT GCGGATTAGGGCTTCCTCT
HK2 AGCCACCACTCACCCTACTG GGAACTCTCCGTGTTCTGTC
PKM2 TCCTGCAGAGAAGGTCTTCC CTCTCCAGCATCTGAGTAGC
LKB1 GCTCTTACGGCAAGGTGAAG TTTTGTGCCGTAACCTCCTC
Antibodies Conjugate Alternative
name
Company
FACS KDR none VEGFR-2 Sigma-Aldrich
FLT-4 APC VEGFR-3 R&D systems
CD11b PE/FITC BD Biosciences
CD34 PE BD Biosciences
CD38 PerCP-Cy5.5 BD Biosciences
CD14 APC/PB/ PerCP-Cy5.5 BD Biosciences
CD15 FITC BD Biosciences
CD45 PerCP-Cy7 BD Biosciences
FOXO3A PE Cell Signaling
Ki67 Alexa-647 Santa Cruz
Anti-Pimonidazole PAb2627AP Hydroxyprobe
IgG1 PE BD Biosciences
IgG1 APC R&D systems
IgG1 PerCP-Cy5.5 BD Biosciences
IgG2a APC BD Biosciences
IgM FITC BD Biosciences
Secondary Rb anti-M PE Dako Cytomation
WB phospho-Erk Cell Signaling
80
3
total-Erk Cell Signaling
phospho-Akt Cell Signaling
phospho-STAT5 Cell Signaling
total-STAT5 Cell Signaling
total FOXO3A Cell Signaling
total PFKL Cell Signaling
total PFKFB3 Cell Signaling
actin Santa Cruz
Secondary Rb anti-M HRP Dako Cytomation
Secondary Sw anti-RB HRP Dako Cytomation
IHC Secondary G anti-Rb HRP Dako Cytomation
Anti-mouse CD31 BD Bioscience
Phospho-Histone H3 Cell Signaling
Secondary Rb anti-R HRP Dako Cytomation
FACS = Fluorescence-activated cell sorting, WB = western Blot, IHC = immunohistochemistry. APC = Al-
lophycocyanin, PE = Phycoerythrin, PerCP-Cy5.5 = tandem conjugate, Peridinin Chlorophyll Protein
Complex and Cyanine Dye 5.5, FITC = Fluorescein Isothiocyanate, PB = Pacific Blue, HRP = horseradish
peroxidase, secondary HRP linked antibodies are used for both WB and IHC. Rb = rabbit, R = rat, Sw =
swine, and M = mouse.
Supplementary Table S3. FLT3-ITD fragment analysis of untreated and anti-VEGFC treated AML cells in dif-
ferent assays and sorted fractions after wk2 of culturing.
wk2 liquid AML4 % of population
ratios
ITD/(ITD+WT)
% of ITD+
cells
untreated CD11b/CD14- 88,39 0,44 88
CD11b/CD14+ 11,61 0,43 86
anti-VEGFC CD11b/CD14- 76,29 0,42 84
CD11b/CD14+ 23,71 0,42 84
wk2 AML4 % CD14+ of population
ratios
ITD/(ITD+WT)
% of ITD+
cells
untreated CFC 33,1 0,42 84
LTC-IC 14 0,41 82
anti-VEGFC CFC 45,3 0,43 86
LTC-IC 21 0,42 84
wk2 AML4 % CD15+ of population
ratios
ITD/(ITD+WT)
% of ITD+
cells
untreated LTC-IC 79,47 0,38 76
anti-VEGFC LTC-IC 88,42 0,37 74
WT = wildtype and ITD = internal tandem duplication
Supplementary Table S4. Anti-VEGFC treatment effects on gene expression in primary CD34+ AML cultures
(n=9).
Downregulated genes Upregulated genes
gene P-value
gene P-value
TGFB1L1 0.0008
BMP1 0.0002
ATG3 0.0007
CAMK2N1 0.0007
PTPN2 0.0009
AMAC1L2 0.0009
81
3
HIST1H2BD 0.0009
RFX4 0.0010
CDCA7L 0.0009
HK3 0.001
CITED2 0.002
SLC38A11 0.002
EIF4E2 0.002
HDAC6 0.002
HIST1H4J 0.002
ULK3 0.002
HIS1H1C 0.002
CXCL9 0.004
HMGN2 0.002
EVL 0.004
HSF2 0.003
CHKB 0.004
CKS2 0.003
TCF4 0.004
HSF1 0.003
SLC36A2 0.004
CBX1 0.004
NXF1 0.005
PDE2A 0.004
PTPN7 0.006
FGF2 0.004
FCN2 0.006
FGF4 0.005
ACCN2 0.006
S100A4 0.005
SLC22A3 0.008
DUSP2 0.005
CSN3 0.008
PTPRN2 0.005
NFkBIL1 0.008
DUSP28 0.005
PML 0.008
SLC22A18 0.005
SLC8A3 0.009
ASB14 0.006
ADAMTS10 0.009
PIK3AP1 0.007
SLC29A2 0.009
PIGF 0.007
MAPK8IP3 0.009
SLC39A10 0.007
TOPBP1 0.009
RAD54B 0.007
SLC4A11 0.011
BET1 0.007
RAD9A 0.01
S100A7 0.008
ROCK2 0.01
SSR1 0.008
C1QTNF9 0.01
SLC5A2 0.008
PDE10A 0.01
RAP1A 0.008
SLC12A3 0.01
ARCN1 0.009
FASTK 0.01
PPP1R11 0.009
CD22 0.01
FGF8 0.01
SLC4A2 0.01
BST1 0.01
CCRK 0.011
IGF2BP3 0.01
MAPKAPK3 0.012
ALDH6A1 0.01
SLC17A6 0.014
CASP4 0.011
PPP2R3B 0.014
HGF 0.012
GATA1 0.015
BAG3 0.012
SLC16A4 0.016
PIP 0.012
PDE1B 0.017
RBM4 0.012
EVI1 0.018
ABCA13 0.013
MAP3K4 0.018
PTPN20A 0.013
ULK1 0.019
JUN 0.014
SLC17A9 0.019
MPP4 0.015
MYST3 0.022
FGF5 0.015
SLC25A18 0.023
82
3
SOX5 0.016
HIST1H2AA 0.024
HSPBP1 0.016
NOX1 0.025
NOTCH3 0.017
PDE4C 0.026
SLC25A35 0.017
HIST1H4F 0.028
UBL3 0.017
PTPN23 0.029
EIF3I 0.018
EphA3 0.03
FGFBP1 0.019
BMP8b 0.033
PPP1R2 0.019
EIF4G1 0.033
E2F1 0.019
IL18RAP 0.033
PARP9 0.021
PTPN6 0.034
CASP3 0.021
HOXB3 0.034
S100A11 0.021
IL2RA 0.035
CD63 0.021
CPT1B 0.036
EIF4EBP2 0.022
CSF2RA 0.036
SLC25A5 0.022
SLC9A8 0.036
PSPH 0.022
SLC25A11 0.037
PPP1CC 0.022
SLC2A5 0.037
ABCG1 0.023
S100A13 0.037
PHLDB2 0.025
ACAP1 0.037
ACE2 0.027
INSL3 0.039
FOXO6 0.027
IL5RA 0.042
MAPK1 0.027
SLC18A1 0.042
PVLR3 0.027
PPP2R5E 0.042
KDR 0.028
CDK5RAP3 0.042
HMGB2 0.028
PFKL 0.043
NTRK3 0.029
SLC1A4 0.043
S100A5 0.03
LAMP3 0.045
SLC38A8 0.03
SLC9A10 0.045
EIF4B 0.03
MAPKAPK5 0.046
TET2 0.031
HIST1H2BN 0.031
CD55 0.031
SLC39A11 0.032
S100A9 0.033
CXCR4 0.034
PHB2 0.035
INSR 0.035
SERPINB2 0.035
GSR 0.036
COX17 0.036
CDK5 0.037
CDKL3 0.037
MAPK6 0.038
CASP1 0.038
DUSP1 0.039
83
3
UBL5 0.04
SLC12A6 0.04
TOR1AIP1 0.041
COX11 0.041
PDE9A 0.042
TLR8 0.042
TLR7 0.043
COX7C 0.044
SLC16A8 0.045
84
top related