Date: Approved: Dr. Jonathan Freedman, Advisor Dr. Norman L. Christensen, Dean

Master’s Project submitted in partial fulfillment of the requirements for the Master of Environmental Management

degree in the Nicholas School of the Environment

of Duke University December 19th

1997

An Examination of Thyroid Function

For the Assessment of the Applicability

Of Several Assays for use as Screens

For Thyroid Function Disruptors by

Dana Alyce Fitz-Simons

2

Introduction

On August 3, 1996 the Food Quality Protection Act (FQPA) was signed by President

Clinton. Under Title IV of this law are amendments to the Federal Food, Drug, and Cosmetic

Act, the purpose of which according to House Report number 104-669(II) are to “modernize the

regulation of pesticides” (Bliley, T, 1996 p29.). Within these amendments, under section 405,

“Tolerances and Exemptions for Pesticide Chemical Residues,” subsection (p), is a congressional

mandate for the United States Environmental Protection Agency (EPA) to “develop a screening

program, using appropriate validated test systems, and other scientifically relevant information to

determine whether certain substances may have an effect in humans similar to an effect produced

by a naturally occurring estrogen, or other such endocrine effects as the Administrator may

designate” by August 1998 (Food Quality Protection Act). The law states that this testing is to

be performed on all pesticide chemicals and “any other substance that may have an effect that is

cumulative to an effect of a pesticide chemical if the Administrator determines that a substantial

population may be exposed to such substance.” This subsection, requiring the screening

program, was first offered during Committee mark-up by Representative George E. Brown Jr. of

California (Bliley, T, 1996). Representative Brown indicates that the belief that endocrine

disrupters “interfere with fundamental biological functions in humans and other organisms” and

the suggested link between endocrine disrupters and breast cancer, motivated him in the

proposition of this amendment (Brown, G., 1996). This screening program is to be implemented

by August 1999 and a year later a progress report must be made to Congress (Food Quality

Protection Act).

Under the Federal Advisory Committee Act, the Endocrine Disruptor Screening and

Testing Advisory Committee (EDSTAC) was chartered in October 1996, to assist EPA in

3

establishing the mandated protocols (Office of Prevention Pesticides and Toxic Substances,

1997(a)). EDSTAC is composed of representatives from industry, academia, state and federal

government, public health, environmental and labor organizations, and small business (Office of

Prevention Pesticides and Toxic Substances. 1997(b)). EDSTAC is addressing a variety of

issues in the development of its recommendations to EPA. The endocrine systems on which

EDSTAC is focusing are the estrogenic, androgenic and thyroid systems. Other issues include

but are not limited to human health and ecological effects as well as the effects of both pure

compounds and common mixtures (Office of Prevention Pesticides and Toxic Substances,

1997(b)).

At the EDSTAC February Plenary Session committee members reasserted their

consideration of thyroid function as equal to, not secondary to the systems regulating sex steroids

(Office of Prevention, Pesticides and Toxic Substances, 1997(c)). Thyroid hormones and factors

within the system of thyroid function influence the functions of almost every organ in the body.

Thyroxine (T4) and 3,5,3’-triiodothyronine (T3) are the hormones produced by the thyroid gland

and they stimulate cellular oxygen consumption, and hence basal metabolism, in a variety of

tissues, like heart and skeletal muscle as well as tissue from the liver, kidney, pancreas and

pituitary gland. The mechanisms by which these functions are stimulated are uncertain. While

thyroid hormone binding sites have been found in mitochondrial plasma membrane in some cell

lines, their biological significance is unknown (Davis, P. J., 1991). T3, the more biologically

active of the two thyroid hormones, has been demonstrated, in many cases, to act via reaction

with nuclear hormone receptors (Jameson, J. L. and DeGroot, L. J., 1995). However a

combination of nuclear and extranuclear thyroid hormone activity cannot be ruled out (Davis, P.

J., 1991).

4

Thyroid hormones have been demonstrated to elicit pleiotropic effects in a variety of cell

types through both positive and negative transcription regulation (Jameson, J. L. and DeGroot, L.

J., 1995). Examining the effects of hyper- or hypothyroidism can illuminate the extent of

thyroidal influence over a variety of organ functions. Table 1. Gives a concise overview of these

effects in humans. The exact mechanisms in the elicitation of most of these effects have yet to

be fully elucidated.

In heart muscle tissue, thyroid hormone has been demonstrated to influence the

expression of myosin heavy chain isoforms (Balkman, C., et al., 1992; Izumo, S., et al., 1987;

Umeda, P. K., et al., 1987) as well as Na,K-ATPase isoforms (Orlowski, J. and Lingrel, J. B.,

1990). There are two isoforms, α and β, of myosin heavy chains(MHC). Their

Table 1.* The Effects of Hypothyroidism and Hyperthyroidism

Body system function Hypothyroid Hyperthyroid

Growth and development Impaired growth Accelerated growth

Activity and sleep Decreased activity and increased sleep Increased activity and

decreased sleep Temperature tolerance Intolerance to cold Intolerance to heat

Skin characteristics Coarse and dry Smooth Perspiration Absent Excessive

Pulse Slow Rapid

Gastrointestinal symptoms Constipation, decreased appetite, increased weight

Frequent bowel movements, increased appetite, decreased weight

Reflexes Slow Rapid Psychological aspects Depression and apathy Nervous and emotional

*adapted from Table 18.11 in S. I. Fox Human Physiology p584.

combination within the structure of myosin protein distinguishes the myosin isozymes, V1 (αα),

V2 (αβ), and V3 (ββ) (Balkman, C., et al., 1992; Izumo, S., et al., 1987; Umeda, P. K., et al.,

5

1987). Thyroid hormones have been shown to stimulate the transcription of α-MHC mRNA and

repress the transcription of β-MHC mRNA, this corresponds to an increase in cardiac tissue V1

content and a decrease in V3 (Balkman, C., et al., 1992; Izumo, S., et al., 1987; Umeda, P. K.,

et al., 1987). α-MHC’s contain a higher concentration of ATPase’s compared with β-MHC’s,

imparting greater contractility and shorter contraction periods to muscle tissue high in α-MHC.

Na,K-ATPase plays an essential role in the electrical activity muscle, modulating contractility

(Orlowski, J. and Lingrel, J. B., 1990). A study by Orlowski and Lingrel (1990) demonstrate

thyroid hormone dependent regulation of the expression of the different Na,K-ATPase α and β-

subunits. Thyroid hormone regulation of these two proteins probably contributes to the

modulation in pulse associated with hypo- or hyperthyroidism, as shown in Table 1. A list of

other genes regulated by thyroid hormones can be found in the appendix. Modulation of these

and other genes, contributes to the symptoms of thyroid hormone imbalance.

Proper thyroid hormonal balance is crucial for normal growth and development. In

amphibians thyroid hormone regulates metamorphosis with a close correlation between

metamorphic stages and cellular expression of thyroid hormone receptors (Yaoita, Y. and

Brown, D. D., 1990). In mammals severe mental retardation, deaf-mutism, improper skeletal

development and organ maturation can all be produced by instances of hypothyroidism at critical

stages of development in the affected systems (Schwartz, H., 1983; Thorpe-Beeston J. G. and

Nicolaides K. H., 1996). Thyroid hormones appear to play more of a role in cellular

differentiation and maturation, as opposed to cellular proliferation. However, thyroid hormone

does enhance some activities of growth hormone in many mammals and stimulates its

transcription in rat anterior pituitary cells (Schwartz, H., 1983; Yaffe, B. M. and Samuels, H. H.,

1984; Ye, Z., et al., 1988).

6

Both intrauterine and postnatal ossification is regulated by thyroid hormone.

Hyperthyroid conditions cause accelerated skeletal maturation, leading to stunted growth. A

delay in skeletal maturation is observed in hypothyroid rat fetuses and children with acquired

hypothyroidism (Schwartz, H., 1983). Normal patterns of ossification return with administration

of T4, but only in epiphyses developing subsequent to the administration. Epiphyses developing

under hypothyroid conditions remain dysgenic with T4 administration (Schwartz, H., 1983).

Thyroid hormone regulation of brain and CNS maturation is also limited by developmental

stages (Schwartz, H., 1983; Thorpe-Beeston J. G. and Nicolaides K. H., 1996).

Processes of neuronal development including synaptogenesis (Nicholson, J. L. and

Altman, J., 1972), myelination, and cellular differentiation and migration are under thyroid

hormone control (Schwartz, H., 1983). In humans the critical stage for these events is the period

between mid-gestation and two years, postnatal (Porterfield, S. P., 1994). Abnormal neural

morphology has been observed in neonates with congenital hypothyroidism (Schwartz, H.,

1983). The resulting mental retardation can be diminished with early T4 replacement therapy,

but some researchers have reported residual behavioral and cognitive problems increasing with

the length of delay before T4 treatment (Schwartz, H., 1983). Similar effects have been

observed in rats, but the studies have been indicative of a lesser role for fetal thyroid hormone in

rat fetal development (Morreale de Escobar, G., et al., 1993; Schwartz, H., 1983). At birth, the

developmental stage of the rat is considered to be equivalent to that of a human fetus entering

third trimester, this could contribute to the differences in the role of fetal thyroid function

observed between the two species (Schwartz, H., 1983).

Several environmental contaminants have been demonstrated to interrupt thyroid

function. A decrease in serum levels of thyroid hormone can increase serum levels of

7

thyrotropin, as explained later in this paper. The increased levels of thyrotropin can stimulate

hyperplasia within thyroid tissue. The enlargement of the thyroid gland, due to this hyperplasia

is referred to as a goiter. Many environmental contaminants are goitrogens, included among

these are resorcinol, amitrole and ethylenebis[dithiocarbimate] (EBDC), through the action of its

metabolite ethylenethiourea (ETU) (Hill et al., 1989). Resorcinol is usually associated with

plants, humic substances and coal. It has been identified in water supplies receiving effluent

from coal processing plants, from areas with endemic goiter (Cooksey, R.C., et al., 1985; Jolley,

R.L., et al., 1986; Lindsay, R.H., et al., 1986; Lindsay, R.H., et al., 1992,).

Ethylenebis[dithiocarbimate] (EBDC) is a class of fungicides, which were applied to over one

third of the fruit and vegetable crops in the U. S. in 1990 (Doerge D. R., and Takazawa, R. S.,

1990). Amitrole is an herbicide. As will be discussed later, all of these compounds are known to

interrupt thyroid gland hormonogenesis in at a common point in the system of thyroid function

(Divi, R. L. and Doerge, D. R., 1994; Doerge, D. R. and Niemczura, W. P., 1989; Doerge D. R.,

and Takazawa, R. S., 1990). 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), mixtures of

polychlorinated biphenyls (PCB) and mixtures of polybrominated biphenyls (PBB) have also

been implicated in the modulation of thyroid function (Bahn, A. K., et al., 1980; Barter, .R. A.

and Klaassen, C. D., 1992; Barter, .R. A. and Klaassen, C. D., 1994; Goldey, E. S., et al., 1995;

Gray, L. E., et al., 1993; Juarez de Ku, L. M., et al., 1994; Koopman-Esseboom, C., et al.,

1994; Morse, D. C., et al., 1996; Ness, D. K., et al., 1993; Sewall, C. H., et al., 1995).

In the laboratory, rats treated with PCB’s, in particular aroclor 1254, show significant

reductions in serum T4 and this effect appears to be more pronounced in perinatally exposed

offspring compared with adults(Barter, .R. A. and Klaassen, C. D., 1992; Goldey, E. S., et al.,

1995; Gray, L. E., et al., 1993; Morse, D. C., et al., 1996). But the data from an

8

epidemiological study in a PCB contaminated area do not demonstrate such dramatic effects on

thyroid status (Koopman-Esseboom, C., et al., 1994). This study is part of a larger study termed

the Dutch PCB/Dioxin study examining the possible adverse effects of these pollutants on

human beings. The Koopman-Esseboom study (1994) examined T3, T4 and thyrotropin levels

in serum, and PCB congeners in breast milk, from 78 mother-infant pairs in a PCB contaminated

area near Rotterdam, the Netherlands. All but one mother-infant pair showed thyroid hormone

and thyrotropin serum levels within the normal range for their respective age group (Koopman-

Esseboom, C., et al., 1994). However, when mother-infant pairs were placed into groups

according to the toxic equivalency (TE) of the PCB congeners identified in the breast milk, there

was an inverse relationship between the TE of the PCB congeners and the levels of serum T4 in

the offspring (Koopman-Esseboom, C., et al., 1994).

A later study from this same Dutch PCB/Dioxin study examined the effect of perinatal

exposure to PCB’s on neonatal neurological development (Huisman, M., et al., 1995). Mother-

infant pairs from the same area of the Netherlands were divided into groups in which infants

were either breast-fed or bottle-fed. The premise of this separation being that the breast-fed

infants would receive a higher dose of PCB’s through the breast milk, compared with the bottle-

fed infants (Huisman, M., et al., 1995). Data from this study demonstrate a slight decrease in

muscle tone and neurological development in the breast-fed infants compared with the bottle-fed

infants. In this study the effect of PCB on neurological development is somewhat similar to the

decrease in neurological development seen in congenitally hypothyroid children (Frost G. J. and

Parkin, J. M., 1986). Another epidemiological study examined children from a region in Taiwan

where a large percentage of the population had been exposed to high levels of PCB’s from

consumption of PCB contaminated cooking oil in 1978 through 1979 (Chen, Y. J., et al., 1992).

9

The children were all born after the PCB poisoning incident and all displayed poorer cognitive

development compared with matched controls (Chen, Y. J., et al., 1992). The level of cognitive

development of these children is similar to that observed in hypothyroid children (Frost G. J. and

Parkin, J. M., 1986), but there are no corresponding measures of serum thyroid hormone for the

children in the Chen (1992) study. The connection between PCB, thyroid status and the effects

associated with PCB poisoning is not very clear from the available epidemiological studies, more

compelling evidence can be found from laboratory studies.

Two separate studies with rats demonstrate a correlation between a PCB dose-dependent

drop in serum T4 levels and a change in T4-dependent development. Development of the organ

of Corti in the middle ear has been shown to be dependent on thyroid hormone (Meyerhoff, W.

L., 1976) and as mentioned above, hearing loss and deaf-mutism are associated with congenital

hypothyroidism. A study by Goldey (1995 a) demonstrates that pre- and postnatal exposure to

araclor 1254 produces not only a PCB dose-dependent drop in serum T4 in developing rats, PCB

dose-dependent hearing loss was also demonstrated. The effect was similar to the results

obtained in a companion study by the same group in which hearing loss was observed in

developing rats made hypothyroid by 6-n-propyl-2-thiouracil (PTU) administration (Goldey, E.

S., et al., 1995 b). PTU is commonly used in laboratories to create hypothyroid conditions in test

animals. Juarez de Ku (1994) presents a stronger demonstration of PCB action through

interruption of thyroid function.

In the Juarez de Ku (1994) study, rats were exposed both pre and postnatally to PCB’s.

From postnatal days 4-14, some of the developing rats exposed to PCB’s received replacement

doses of either T3 or T4. The exposed rats, which did not receive replacement thyroid

hormones, the activity of choline acetyltransferase (ChAT) was greatly reduced in the

10

hippocampus and forebrain. The authors indicate that the development of these regions is

important in learning and memory (Juarez de Ku , L. M., et al., 1994). Replacement of T4 but

not T3 produced an increase in ChAT activity to 86% of the control group, indicating that the

PCB induced drop in ChAT could be due in part to the PCB dependent drop in serum T4 (Juarez

de Ku, L. M., et al., 1994).

The effect of many environmental compounds on thyroid function is clearly established

in the laboratory setting, and can be seen in the field as with cases of resorcinol induced goiter.

However, the elicitation of toxic effects by these compounds through interruption of thyroid

function has not yet been clearly established in epidemiological studies. More research may

uncover these types of mechanisms in the field. Laboratory studies indicate that there is an

interaction of environmental contaminants and thyroid function in the elicitation of several toxic

effects. The wording of the FQPA indicates that the screening and testing program should apply

to estrogenic compounds, but left the ultimate determination of the program focus to the Director

of the EPA. Thyroid function was chosen as a foci of the EDSTAC in the development of the

mandated screening and testing program because of its importance in growth and development

(Tyl, R., 1997), and because as indicated by the EDSTAC chair, Lynn Goldman, “…panel

members believed there is a sufficient research base upon which to build a program. And that

there is sufficient evidence of documented effects to warrant it.” (Goldman, L., 1997)

Though not expressly related to the activities of EDSTAC, a three day workshop “on

screening methods for endocrine disruptors in the thyroid” was convened at the Nicholas School

of the Environment in June of 1997 (McMaster, S., 1997). One of the organizers is an EDSTAC

member (McMaster, S., 1997; Office of Prevention, Pesticides and Toxic Substances, 1997(d))

and several of the attendant panelists are members of the Screening and Testing Workgroup

11

within EDSTAC (McMaster, S., 1997; Office of Prevention, Pesticides and Toxic Substances,

1997(e)). The purpose of the workshop was not the recommendation of a screening battery, but

rather discussion of methods currently available which may be adapted for use as tier 1 screens

for disruption of thyroid function (McMaster, S., 1997). The workshop panel discussed many

assays and currently used procedures, which showed promise for use as screens. To shed light

on a small fraction of the knowledge required to implement the program mandated by Congress,

this paper presents an overview of thyroid function, showing the different areas of thyroid

function that can be affected by endocrine disruptors. Within the context of thyroid function,

several of the assays and procedures discussed at the workshop will be examined for their

applicability as potential screens for disruptors of thyroid function.

Thyroid gland production and release of T4 and T3

Thyroxine (T4)

3’,3,5,-Triiodothyronone (T3) T4 and T3 are produced and released from the thyroid follicles. These follicles consist of

a lumen, which is filled with a protein rich fluid known as colloid, and lined with principal cells

(Fox, S.I., 1987). Iodide (I-) is actively transported from extracellular fluid to the lumen by these

principal cells (Taurog, A, 1991). Crossing into the lumen, the I- is oxidized by an apical

membrane bound protein, thyroid peroxidase (TPO), in the presence of hydrogen peroxide. TPO

12

then catalyzes the iodination of tyrosyl residues as well as the coupling of iodinated tyrosyl

residues within a colloid protein, thyroglobulin, in the synthesis of the thyroid hormones

(Magnusson, R.P., et al, 1984; Taurog, A, 1991.; Taurog, A, et al, 1996.)

Thyroglobulin, the matrix on which T4 and T3 are synthesized, is a dimeric, 660 kd

glycoprotein (Dunn, J.T., 1991). In initial synthesis, the monomers which make-up

thyroglobulin are identical, but after glycosylation and iodination, thyroglobulin is a heterodimer

(Dunn, J.T., 1991). Thyrotropin or thyroid stimulating hormone (TSH), an enzyme released

from the pituitary gland, can influence the structure of thyroglobulin. Iodination stabilizes

thyroglobulin dimerization (Dunn, J.T., 1991). Though human thyroglobulin has about 134

tyrosyl residues, not all are available for iodination and hormonogenesis. This trend appears

common for other species studied (Dunn, J.T., 1991). Only two to four molecules of thyroid

hormone are produced from each molecule of thyroglobulin (Taurog, A, 1991).

The first step in the proposed mechanism of hormonogenesis is a two electron oxidation

of TPO by peroxide to form compound I (Magnusson, R.P., et al, 1984; Nakamura M., et al.,

1984; Taurog, A, 1991; Taurog, A, et al, 1996.). There are two forms of compound I. Initially

one electron is removed from the iron (FeIII) within the TPO heme structure, forming an

oxoferryl group (FeIV). A porphyrin π-cation radical is formed when the second electron is

withdrawn from the porphyrin ring. In vitro this form can then spontaneously isomerize to a

protein radical, the most stable form of compound I, in which an electron is withdrawn from a

nearby amino acid residue to replace the one withdrawn from the porphyrin ring (Doerge, D.R.

and Divi, R.L., 1995; Taurog, A, et al, 1996.). The exact mechanism of hormonogenesis is

unknown, though it is recognized that TPO catalyzes both iodination and coupling. It has been

proposed that the porphyrin π-cation radical isomer is involved in iodination while the protein

13

radical form catalyzed coupling (Taurog, A, 1991), while other researchers have proposed that

the porphyrin π-cation radical isomer is involved in both processes (Taurog, A., et al. 1996).

Iodination occurs in a sequential fashion (Dunn, J.T., 1991; Taurog, A, 1991; Turner,

C.D., et al., 1983; Xiao, S., et al., 1996.). The porphyrin π-cation radical oxidizes iodide ions.

An enzyme bound hypoiodite species is formed which iodinates thyroglobulin tyrosyl residues

(Taurog, A, 1991; Taurog, A., et al. 1996). The first sites of iodination are hormonogenic sites.

The sites of iodination and the sequence of iodination appear to be determined by the structure of

the thyroglobulin molecule itself, rather than interactions between thyroglobulin and TPO

(Turner, C.D., et al., 1983; Xiao, S., et al., 1996.). Experiments which have utilized both

chemical and TPO catalyzed iodination have shown that the same thyroglobulin tyrosyl residues

are iodinated with either catalyst (Turner, C.D., et al., 1983; Xiao, S., et al., 1996.). There is,

however, an increase in diiodotyrosine (DIT) production over monoiodotyrosine (MIT) with

TPO catalyzed iodination compared with the chemical catalyst (Xiao, S., et al., 1996.).

Coupling of iodinated tyrosyl residues does not occur until there is a sufficient

concentration of DIT within the thyroglobulin molecule. Hormonogenesis is an intramolecular

event, although it is not yet been determined whether coupling occurs between or within the two

polypeptide chains of thyroglobulin (Taurog, A, 1991). The proposed coupling mechanism

begins with the generation of DIT radicals within the thyroglobulin matrix, catalyzed by TPO, in

the presence of peroxide (Taurog, A, 1991). Two DIT radicals then couple to form a quinol

ether intermediate within the matrix. In the case of T3 formation, coupling would take place

between a DIT radical and a MIT radical, which would be contributing the outer phenol ring.

Non-enzymatically, the quinol ether intermediate splits, leaving a dehydroalanine residue at the

14

site of phenol contribution (Taurog, A, 1991). The newly formed iodothyronines are stored

within the thyroglobulin matrix.

As mentioned above, resorcinol, amitrole and ethylenethiourea are environmentally

relevant chemicals known to disrupt thyroid function in this area of hormonogenesis (Hill et al.,

1989). The herbicide, amitrole, and resorcinol are referred to as suicide inhibitors as both types

of these compounds have been shown to irreversibly inhibit the enzymatic activity of TPO (Divi,

R. L. and Doerge, D. R., 1994; Doerge, D. R. and Niemczura, W. P., 1989). Ethylenethiourea,

the fungicide metabolite, inhibits hormonogenesis by acting as an alternate substrate in the

catalytic action of TPO (Doerge D. R., and Takazawa, R. S., 1990).

The mechanism of resorcinol TPO inactivation proposed by Divi and Doerge involves the

oxidation of resorcinol by either isomer of TPO compound I to generate a resorcinol radical and

either an oxoferryl or protein radical compound II. The oxoferryl compound II has been shown

to isomerize to the protein radical form (Deme, D., et al., 1985). Inactivation becomes

irreversible when the resorcinol radical covalently binds to the protein radical compound II so

that the synthesis of more TPO is necessary for hormonogenesis. Enzymatic activity could not

be restored to recorcinol inactivated TPO or lactoperoxidase by dialysis or

chromatocentrifugation (Divi, R. L. and Doerge, D. R., 1994). The exact binding of the

resorcinol intermediate on the compound II isomer is unknown, however, changes in the visible

spectrum of the inactivated enzyme indicate a change in the prostetic heme structure. The

binding ratio appears to be 10 mol of resorcinol to 1 enzyme equivalent (Divi, R. L. and Doerge,

D. R., 1994).

Amitrole is a known goitrogen and has also been shown to covalently bind to peroxidase.

In this experiment lactoperoxidase (LPO) was used instead of TPO, but the two peroxidases are

15

similar in structure and activity (Doerge, D. R. and Niemczura, W. P., 1989). LPO is commonly

used in experiments examining model TPO systems. As in the incidence of recorcinol

inactivation, a radical amitrole intermediate is involved in covalent binding to the enzyme.

However, in the case of amitrole inactivation, there is no change in the visible spectrum of

inactivated LPO. This is an indication that the binding of amitrole and LPO does not involve the

prostetic heme active site of the enzyme. More evidence supporting amitrole binding to the

protein moitey of the enzyme is the observed binding of amitrole to cyano-inactivated LPO, in

which there should be no involvement of the heme group with amitrole binding (Doerge, D. R.

and Niemczura, W. P., 1989).

As mentioned above, ETU acts as a competitive substrate for an intermediate in the TPO

catalyzed iodination of thyroglobulin tyrosyl residues (Doerge D. R., and Takazawa, R. S.,

1990). The enzyme bound hypoiodite species (EOI), involved in iodination, will bind ETU

thereby inhibiting thyroid hormonogenesis at the level of thyroglobulin tyrosyl residue

iodination. Unlike the aforementioned chemically induced inhibitions, ETU inhibition is

reversible. In experiments with ETU and TPO, ETU appears to be consumed in a catalytic

process with EOI, in the presence of peroxide and iodide ion (Doerge D. R., and Takazawa, R.

S., 1990). In this same set of experiments, tyrosyl iodination resumed after total consumption of

ETU, supporting the assertion that ETU inhibition is reversible.

Barring inhibition from the aforementioned or similar compounds, thyroid

hormone is released from thyroglobulin upon thyroidal thyrotropin (TSH) stimulation. Hormone

release from the thyroglobulin matrix occurs in the follicular cells, but the mechanism of

thyroglobulin transfer, from the lumen, is as yet uncertain. Two mechanisms have been

observed, macropinocytosis and micropinocytosis (Dunn, A. D., 1996.). The occurrence of

16

either or both of these mechanisms appears to be species dependent, and can be affected by

various physiological changes (Bernier-Valentin, F., et al., 1991; Dunn, A. D., 1996).

TSH induced macropinocytosis in rat thyroid tissue was reported by Wetzel, Spicer and

Wollman in 1965 (Wetzel, B., 1965). TSH was administered to rats, which were killed at

different time intervals after TSH administration. The thyroid lobes were immediately removed

and fixed post mortem. Five minutes after TSH administration, there was the development of

apical follicular membrane pseudopod activity into the follicular lumen. Within the newly

forming pseudopodia there were rare appearances of small droplets of luminal colloid. At 10

minutes post-administration, these droplets were more numerous in the pseudopodia and there

were several droplets appearing in the apical cytoplasm. Pairs of adjacent pseudopodia were

observed to have joined, engulfing fairly large volumes of colloid (Wetzel, B., 1965). Once

formed, the colloid droplets appeared to exhibit basipetal migration. A transition, from relatively

large, less dense, homogenous colloid droplets to smaller, denser, heterogeneous granules

appeared to occur during this migration. Some of the large colloid droplets were observed to be

associated with dense granules. Acid phosphatase activity within the droplets was observed

within 15 minutes after TSH administration. The amount of a reaction product, indicating acid

phosphatase activity, was seen to increase in the droplets as they became more dense and basally

located (Wetzel, B., 1965).

Their observation of the bulk retrieval of colloid via pseudopodia engulfment and

subsequent proteolysis of thyroglobulin within the colloid droplets led this research group to

propose that this mechanism plays a major role in the release of thyroid hormones from the

thyroglobulin matrix (Wetzel, B., 1965). However, it has been asserted that observations of

thyroid pseudopodia and colloid droplets are rare except in rodents, and this process has been

17

documented only in thyroid glands stimulated by supraphysiological concentrations of TSH

(Bernier-Valentin, F., et al., 1991; Dunn, A., 1996). So the physiological importance of this

process in the release of thyroid hormones in other species is questionable. An alternative

mechanism for hormone release is the process of micropinocytosis (Bernier-Valentin, F., et al.,

1991; Dunn, A. D., 1996; Seljelid, R., et al., 1970).

Micropinocytosis, the formation of vesicles by invagination of the cell membrane, has

been observed in rodent thyroid tissue (Seljelid, R., et al., 1970), as well as porcine thyroid tissue

(Bernier-Valentin, F., et al., 1990; Bernier-Valentin, F., et al., 1991). In these studies, the

colloid containing endocytotic vesicles were observed in the presence or absence of TSH

stimulation, however, their formation was increased with TSH stimulation (Bernier-Valentin, F.,

et al., 1990; Bernier-Valentin, F., et al., 1991; Seljelid, R., et al., 1970). Of special significance

is the formation of these vesicles in TSH stimulated porcine thyroid tissue, in the absence of

pseudopod or colloid droplet formation, which further emphasizes the questionable physiological

significance of macropinocytosis in non-rodent species. (Bernier-Valentin, F., et al., 1990;

Bernier-Valentin, F., et al., 1991).

A study by Kostrouch (1991) reports observations of the transition of thyroglobulin

containing follicular coated vesicles from early endosomes, with strong staining for mannose-6-

phosphate receptors (MPR), to late endosomes which stained for both MPR and arylsulfatase-A

(ArS-A), a lysosomal enzyme. The early endosomes were found predominately in the apical

regions of the cells, while late endosomes were more basally localized. Thyroglobulin

concentrations within the endosomes, measured via gold complexed thyroglobulin, decreased

with the transition from early to late endosome phases. Follicular lysosomes, which stained

strongly for ArS-A, but had lost MPR staining, were also characterized in this study, but did not

18

show the presence of thyroglobulin (Kostrouch, Z. et. al, 1991). The morphology of the vesicles

and the progression of enzymatic activity observed in this study led the authors of this paper to

compare the endocytotic processing of thyroglobulin to endosomal transport and proteolysis

studied extensively in other tissues like baby hamster kidneys (Kostrouch, Z. et. al, 1991).

Most endocytotic processes begin with the binding of the ligand, which is transported by

the endosome, to a receptor on or within the plasma membrane (Blum, J. S., et al., 1993). It has

been observed that the highly iodinated thyroglobulin is concentrated in the follicle compared

with the more heterogeneous mixture of iodinated thyroglobulin in the lumen (Dunn A. D., 1996;

Seljelid, R., et al., 1970). A receptor for iodinated thyroglobulin was implicated in this

observation (Dunn, A. D., 1996; Kostrouch, Z. et. al, 1993; Lemansky, P. and Herzog, V.,

1992). The mannose-6-phosphate receptor, found in follicular endosomes and in the apical

membrane surface was shown to have no influence in thyroglobulin micropinocytosis, and no

thyroglobulin specific receptor has been found on the apical membrane (Dunn, A. D., 1996;

Kostrouch, Z. et. al, 1993; Lemansky, P. and Herzog, V., 1992).

A study of the thyroglobulin endocytotic pathway, demonstrates a lack of selectivity in

endosome formation (Kostrouch, Z. et al., 1993). Early endosomes in this study contained a

heterogeneous mixture of both the gold-complexed thyroglobulin (G-thyroglobulin) as well as

the gold-complexed bovine serum albumin (G-BSA), microinjected into the follicular lumen of

reconstructed thyroid follicles. This finding supports a mechanism like fluid-phase endocytosis

(Blum, J. S., et al., 1993; Kostrouch, Z. et. al, 1993). Late endosomes showed signs of protein

sorting, as many were homogenous for either G-BSA or G-thyroglobulin, and G-thyroglobulin

was also shown to be transported back to the lumen after endocytosis and sorting. Kostrouch, Z.

et. al propose that this sorting is a mechanism through which highly iodinated thyroglobulin is

19

concentrated in the follicular cells, while newly formed thyroglobulin can be returned to the

lumen for iodination.

The controversy over the mechanism of thyroglobulin uptake and release has yet to be

settled. Many researchers believe that micropinocytosis is probably the major mechanism of

thyroid hormone release for larger animals, like humans and pigs, under physiological conditions

(Bernier-Valentin, F., et al., 1990; Bernier-Valentin, F., et al., 1991; Dunn, A. D., 1996;

Kostrouch, Z. et. al, 1991; Seljelid, R., et al., 1970). Once thyroid hormones are released into

the follicular cells, after either method of thyroglobulin transport and proteolysis, they rapidly

enter the serum. The actual mechanism of hormone secretion is unknown (Dunn, A. D., 1996).

Hypothalamus-Pituitary-Thyroid axis

The major regulator of thyroid hormone production and release appears to be TSH.

Processes from thyroidal iodide transport, to the lysosomal enzyme activity, involved in

thyroglobulin processing, are regulated by TSH (Taurog, A., 1991; Dunn, A. D., 1984; Perrild,

H., et al., 1989). The absence of TSH, created in vivo via hypophysectomy, or in culture

medium, causes a marked decrease in the intracellular/extracellular [I-] ratio, which is restored

by TSH administration (Taurog, A., 1991). TSH stimulates transcription of the thyroglobulin

gene and thyroglobulin glycosylation appears to be affected by TSH (Dunn, J. T., 1991). As

mentioned above, TSH also stimulates follicular transport of iodinated thyroglobulin from the

lumen. TSH, in some way, affects almost every aspect of thyroid hormone production.

TSH is produced in thyrotropes located in the anterior pituitary gland or adenohypophysis. It is

composed of α and β subunits. The α subunit is a common subunit sharing structural similarities

with the α subunits of other hormones like luteinizing hormone or chorionic gonadotropin, while

20

biological specificity is imparted by the β subunit (Wondisford, F. E., et al., 1995). Thyrotropin-

releasing hormone (TRH) and T3 regulate TSH production and secretion.

TRH stimulates the production and release of TSH by several mechanisms reliant on

calcium and protein kinase C (PKC) (Geras, E. J., and Gershengorn M. C., 1982; Murakami, M.,

et al., 1991; Shupnik, M. A., et al., 1996). TRH stimulation of TSH secretion appears to be

biphasic, reflecting, perhaps, an initial release of stored TSH pools and the subsequent

production of TSH (Scanlon, M. F., 1991). Using mouse thyrotrophic tumor cells, Geras, et al.

(1982) demonstrated that TRH induces both calcium influx by these cells and calcium efflux

with the subsequent secretion of TSH. Calcium influx occurred with simultaneous addition of

calcium and TRH to cell cultures or with the addition of only TRH to cells which had reached a

steady-state level of calcium uptake prior to TRH addition. Calcium efflux, with subsequent

TSH secretion, was observed to occur regardless of extracellular calcium concentrations. The

signal transduction, initiated by the binding of TRH to its receptor in the thyrotroph plasma

membrane, involves the stimulation of phospholipase C. Phospholipase C, in turn, hydrolyzes

phosphatidylinositol bisphosphate into inositol triphosphate (IP3) and diacylglycerol (DAG)

(Scanlon, M. F., 1991). The IP3 stimulates the release of intracellular calcium pools, while DAG

activates PKC. This is a common route for signal transduction.

In addition to stimulation of TSH secretion, TRH has been demonstrated to stimulate an

increase in thyrotrophic mRNA coding for the α and β subunits of thyrotropin (Murakami, M., et

al., 1991; Shupnik, M. A., et al., 1996). Both the calcium and PKC signal transduction routes

appear to play a role in this effect (Scanlon, M. F., 1991). The influx of extracellular calcium

appears to be important as well, at least in the transcription of the β-subunit (Shupnik, M. A., et

al., 1996). DNA binding of a TRH-receptor complex is not apparent in the transcription of these

21

subunits, but the binding of a T3-receptor complex inhibits transcription of the β-subunit

(Steinfelder, H. J., et al., 1991).

There are several levels on which T3 is thought to inhibit the action of TRH. It has been

demonstrated, in TSH secreting systems, that T3 decreases TSH α and β- subunit mRNA, and

that T3 regulation is proportional to T3 nuclear receptor occupancy (Shupnik, M. A. and

Ridgeway, E. C., 1985; Shupnik, M. A., et al., 1986; Shupnik, M. A. and Ridgeway, E. C.,

1987). Steinfelder et al. (1991) demonstrated that deletion of the DNA sequences, which are

responsible for the T3 responsiveness of TSH β-subunit transcription, significantly reduces the

transcription of this subunit. The sequences corresponding to the T3 response element, appear to

be located near the common start site for both the α and β- subunits (Steinfelder, H. J., et al.,

1991). These experiments were run with human TSHB constructs in GH3 cells,

somatomammotrophs instead of thyrotropes, but these are also pituitary cells which have cell-

surface TRH receptors, and the production of hormones within these cells appears to be sensitive

to TRH stimulation (Scanlon, M. F., and Hall, R., 1995). Steinfelder et al. (1991) indicate that

Pit-1/GHF-1 is a transcription factor common to both cell types, somatomammotrophs and

thyrotropes. DNase I footprints from a human TSHB DNA fragment show that the Pit-1/GHF-1

binding site may be close to the binding site of the T3 receptor complex (Steinfelder, H. J., et al.,

1991). Pit-1/GHF-1 was shown to eliminate DNase I footprints yielded from an assay with the

extracts from the nuclei of a TSH secreting cell line, by Steinfelder et al. (1991). The common

sequences eliminated by Pit-1/GHF-1 are close to sequences attributed to the T3 response

element (Steinfelder, H. J., et al., 1991). Steinfelder et al. (1991) indicate that T3 may inhibit

TRH sensitive, TSH transcription by inhibition of Pit-1/GHF-1 binding when the TSHB T3-

response element is occupied.

22

T3 has also been proposed to inhibit the TRH stimulation of TSH secretion by decreasing

the number of TRH cell-surface receptors on TSH secreting cells (Scanlon, M. F., and Hall, R.,

1995). Some studies indicate that administration of T3 to anterior pituitary cell lines causes a

decrease in the level of TRH binding (De Lean, A., et al., 1977; Hinkle, P. M, Perrone, M. H.,

and Schonbrunn, A., 1981; Perrone, M. H., and Hinkle, P. M., 1978). Many of these studies

were performed with somatomammotrophs (GH3) and or pituitary tumor cells (GH4C1). The

authors indicate that the T3-dependent TRH receptor reduction displayed by GH3 and GH4C1 is

suggestive of a similar role for the T3-dependent reduction in serum TSH (De Lean, A., et al.,

1977; Hinkle, P. M, Perrone, M. H., and Schonbrunn, A., 1981; Perrone, M. H., and Hinkle, P.

M., 1978). Beyond this level of T3 control of TSH production and secretion, recent evidence

implicates T3 as a negative regulator of TRH transcription (Scanlon, M. F., and Hall, R., 1995).

An important factor in the T3 feedback mechanisms in the anterior pituitary is the role of

type I and II 5’-deiodinases within the tissues of this gland (Leonard, J. L. and Koehrle, 1996).

Though T3 is the active hormone in the aforementioned processes, the major source of T3 for

this gland is the local conversion of T4 via deiodination (Larsen, P. R., et al., 1981). So the

levels of serum TSH correlate more with serum concentrations of T4 as opposed to T3.

TRH production has been observed in a variety of tissues (Scanlon, M. F., and Hall, R.,

1995). However, the majority of blood flow entering the pituitary gland comes through the

hypophyseal portal from the hypothalamus (Riskind, P. N. and Martin, J. B., 1995), so the

majority of hypophysiotropic TRH probably originates in the hypothalamus. The parvocellular

region of the hypothalamic paraventricular nucleus is the most likely origin of hypophysiotropic

TRH within the hypothalamus (Riskind, P. N. and Martin, J. B., 1995). Several studies have

shown an inverse relationship between the concentration of circulating thyroid hormones and the

23

amount of TRH and TRH prohormone (proTRH) in the hypothalamic paraventricular nucleus

(Dahl, G. F., et al., 1994; Scanlon, M. F., and Hall, R., 1995; Segerson, T. P., et al., 1987).

Several isoforms of thyroid hormone receptors (TR’s) have been found within cells of the

paraventricular nucleus (Lechan, R. M., et al., 1994), and binding sites for these receptors have

been identified in murine and human TRH promoters (Hollenberg, A. N., et al., 1995; Satoh, T.,

1996). T3, in the absence of TR’s has no effect on TRH promoter activity. The binding of

unliganded TR’s has been shown to stimulate TRH promoter activity, while the presence of T3

and the TR’s, or deletion of some of these TR binding sites, has an inhibitory effect on promoter

activity (Hollenberg, A. N., et al., 1995; Satoh, T., 1996). T3 responses in the hypothalamus are

not as dependent on local T3 to T4 conversion as in the anterior pituitary (Leonard, J. L. and

Koehrle, 1996), so this feedback mechanism is more closely related to serum T3 levels.

Another level of T3 control over levels of TRH involves TRH degradation. Studies from

Bauer (1988) and Suen and Wilk (1989) have shown that T3 stimulates pyroglutamyl peptidase

II in the anterior pituitary. Pyroglutamyl peptidase II is a membrane bound peptidase that

appears to be specific for TRH (Bauer, 1988; Suen and Wilk, 1989). Interestingly, Bauer (1988)

found that the effect of T3 on this peptidase was decreased in female rats compared with male

rats. The Suen and Wilk (1989), study only used male rats. Ovariectomy of female rats

increased the T3 effect to the level of male rats, while estradiol benzoate administration to these

ovariectomized females antagonized the effects of T3 on the peptidase (Bauer, 1988).

Iodothyronine deiodination

T4 is the main secretory product of the thyroid. In humans it is secreted in amounts that

exceed T3 secretion by at least 20-fold (Jameson, J. L. and DeGroot, L. J., 1995). About 80% of

24

human T3 is derived from deiodination of T4 in peripheral tissues (Larsen P. R., et al., 1981).

The majority of circulating T3 results from T4 deiodination in the liver (Leonard, J. L. and

Koehrle, 1996). Three types of deiodinases have been characterized, type I 5’-deiodinase, type II

5’-deiodinase, and 5-deiodinase (Leonard, J. L. and Koehrle, 1996). Deiodination can lead to

generation of T3 from T4 or inactivation and degradation of the hormones. rT3, largely

generated from 5-deiodination of T4 and other lesser iodinated iodothyronines are rapidly

metabolized by many cell types releasing iodine back to bloodstream (Leonard, J. L. and

Koehrle, 1996).

5-deiodinase catalyzes both 5- and 5’deiodination, but its 5-deiodination activity is

around an order of magnitude greater than its 5’-deiodination activity, so this membrane bound

enzyme is mainly involved in processes of thyroid hormone inactivation and degradation

(Leonard, J. L. and Koehrle, 1996). 5-deiodination is observed in almost every tissue except

anterior pituitary. Some of the enzymes associated with this activity appear to have a

selenocysteine active site, like type I 5’-deiodinase, and can be inhibited by PTU similarly to

type I 5’-deiodinase. However, the dose of PTU required for inactivation of these enzymes are

an order of magnitude higher compared with type I 5’-deiodinase inhibition (Leonard, J. L. and

Koehrle, 1996).

Type I 5’-deiodinase is found in most tissues in rats and humans. This membrane bound

isozyme is important in local T3 generation as well as thyroid hormone clearance by catalyzing

both 5’-deiodination and 5-deiodination of iodothyronines (Leonard, J. L. and Koehrle, 1996).

Its substrate preference in decreasing order is: r-T3, T4, T3 (Leonard, J. L. and Koehrle, 1996).

4’-sulfation of type I 5’-deiodinase substrates inhibits 5’-deiodonation, yet increases the 5-

deiodination of T3 and 3,3’-diiodothyronine, catalyzed this isozyme (Leonard, J. L. and Koehrle,

25

1996). As mentioned above, the activity of this enzyme is blocked by PTU. Since the active site

of this isozyme contains selenium, selenium deficiency results in decreased deiodination

(Leonard, J. L. and Koehrle, 1996).

Type II 5’-deiodinase is not inhibited by PTU (Leonard, J. L. and Koehrle, 1996). This

isozyme has a more limited tissue distribution compared with type I 5’-deiodinase. In the rat, the

activity of this enzyme has been demonstrated in the CNS, anterior pituitary, brown adipose

tissue (BAT) and placenta (Leonard, J. L. and Koehrle, 1996). A high percentage of the nuclear

T3 in these tissues is generated locally via T4 5’-deiodination. Iodothyronine 5’-deiodination is

the most reported activity associated with type II 5’-deiodinase. Iodothyronine 5-deiodination is

not reported for this isozyme, so, unlike the type I isozyme, this isozyme does not participate in

thyroid hormone clearance via r-T3 formation. However the action of type II 5’-deiodinase is

crucial to the function of affected organs (Leonard, J. L. and Koehrle, 1996).

A study by Bianco and Silva (1987) demonstrated the effect of hypothyroxemia,

compared with hypothyroidism, on the initiation of “cold response” in rodent BAT. The activity

of malic enzyme, glucose–6-phosphate dehydrogenase (G-6-PD), acetyl coenzyme A (CoA)

carboxylase, and mitochondrial α-glycerolphosphate dehydrogenase (α-GPD) should increase in

these animals in response to exposure to cold (Bianco, A. C. and Silva, J. E., 1987). The activity

of these proteins was measured in the tissues of different of organs from euthyroid and

hypothyroid rodents exposed to cold. Under hypothyroid conditions, the response of these

proteins to cold was greatly diminished. Administration of high levels of T3 for 5-7 days,

inducing hyperthyroid conditions, were required to return the response of these proteins to

control levels in BAT. Replacement of T4 for 2 days was sufficient to restore normal responses

in this tissue (Bianco, A. C. and Silva, J. E., 1987). However, in the liver, which has a high

26

concentration of the type I isozyme and an extremely low type II concentration, less T3 and more

T4, were required to restore normality, compared with responses in BAT (Bianco, A. C. and

Silva, J. E., 1987).

The aforementioned serum T4 sensitivity has been observed in other tissues high in type

II 5’-deiodinases. T4 sensitivity in the brain and developing fetus have been the subject of

numerous studies (Larsen, P. R., et al., 1981; Morreale De Escobar, G., et al., 1990). Several

compounds have been demonstrated to inhibit the activity of type I- or type I- and type II-5’-

deiodinase (Leonard, J. L. and Koehrle, 1996), not much is known about compounds which

inhibit only the activity of type II-5’-deiodinase. However, given the observed iodothyronine

specificity of responses to serum iodothyronine concentrations in different tissues and the

differential response of the 5’-deiodinase isozymes to known chemical inhibitors, the effects of

compounds on the deiodinase system should be an important consideration in the development of

a screening battery for thyroid function disruptors.

Serum iodothyronines

Once in the serum the majority of thyroid hormones are bound to a variety of proteins. In

humans 70% of circulating thyroid hormones are bound to T4-binding globulin, 10% is carried

by transthyretin, and 15-20% is bound to serum albumin. A small fraction is carried by other

lipoproteins (Robbins, J., 1991). The three major carrier proteins are produced in the liver,

though transthyretin is also produced in the epithelium of the choroid plexus and the pancreatic

islet cells. Transthyretin is the major carrier of thyroid hormones to the brain and along the

central nervous system, in cerebrospinal fluid. Its production in the choroid plexus contributes to

its high concentration in this region (Robbins, J., 1991). Aside from serum storage of thyroid

27

hormones, no other role in thyroid function has been determined for these proteins. There is still

debate over the mechanism of thyroid hormone entry into the cell. Some authors have indicated

a role for plasma thyroid hormone-binding proteins in facilitating hormone entry into cells

(Robbins, J., 1991). Though cell surface receptors for free T4 and T3 have been reported, most

authors consider diffusion of free thyroid hormones across the plasma membrane as the main

physiological route of thyroid hormone cell entry (Jameson J. L. and DeGroot, L. J., 1995).

Assays Indicative of Thyroid Hormone Imbalance

One series of test discussed at the workshop measures serum levels of several hormones

involved in thyroid function: T4, T3, rT3 and TSH (McMaster, S., 1997). Measurement of

serum thyroid hormones is a common procedure in both the clinical and laboratory setting.

There are a variety of companies that sell radioimmunoassay (RIA) and enzyme-linked

immunoassay (ELISA) kits for the measurement of all of these hormones in serum. Used singly,

these tests may not provide a lot of information, but used together their results can show

interruption in many of the aforementioned areas involved in thyroid production and release.

As indicated above, T4 is the major secretory product of the thyroid gland. Though T4

serum levels can vary with nonthyroidal illness, serum levels of T4 will change more readily

from the effects of weakly goitrogenic compounds compared with T3 serum levels. In cases of

mild hypothyroidism and in areas of endemic goiter, usually from iodine deficiency, T3 serum

levels are observed to be within the normal range, while there is a drop in serum T4 accompanied

by an increase in serum TSH (Larsen, P. R., et al., 1981).

A similar effect is observed with polyhalogenated aryl hydrocarbon stimulation of

hepatic T4 glucuronidation (Schuur, A. G., et al., 1997; Sewall, C. H., et al., 1995). In humans,

28

about 10% of total T4 is cleared from the body via hepatic T4 glucuronidation, with subsequent

biliary excretion of the T4-glucuronide (Chopra, I. J., 1991). Chronic administration of TCDD

to Sprague-Dawley rats resulted in decreased serum levels of T4 with increased serum levels of

TSH (Sewall, C. H., et al., 1995). Acute exposure resulted in decreased serum T4, with no affect

on TSH (Schuur, A. G., et al., 1997). In both studies the decrease in serum T4 was determined

to result from TCDD stimulation of hepatic T4 glucuronidation (Schuur, A. G., et al., 1997;

Sewall, C. H., et al., 1995). In both studies, serum levels of T3 were not significantly affected by

TCDD treatment (Schuur, A. G., et al., 1997; Sewall, C. H., et al., 1995).

Serum levels of T3 fall under conditions of clinical hypothyroidism. Decreased T4 and

rT3 as well as increased TSH accompany this fall in T3. Hyperthyroid conditions, however, are

usually marked with a disproportionate increase in serum T3 compared with T4, so serum T3 has

been found to be a better indicator of these conditions, though these conditions usually produce

increased serum T4 and rT3, with decreased TSH (Sarne, D. H. and Refetoff, S., 1995). Since,

as indicated above, the majority of serum T3 is generated by peripheral tissue deiodination,

changes in serum T3, concomitant with changes in the other hormones could also be indicative

of interference in deiodination processes. As discussed in section on deiodination, PTU inhibits

type I 5’-deiodinase. Administration of PTU to rats produces decreased serum T3 and increased

TSH, with no change in serum T4 (Larsen, P. R., et al., 1981). Changes in serum rT3, relative to

the levels of the other hormones, may also be indicative of interference with deiodination.

Interference in the function of the thyroid gland itself, the hypothalamic-pituitary-thyroid

axis, the deiodination processes and T4-glucuronide formation can all be assessed with the

proper use of the combination of these tests. An advantage to the use of tests like these is that

the possible effects of a compound’s metabolites or metabolic inactivation of a compound can be

29

observed with these in vivo tests. More specific tests were discussed at the workshop, such as an

assay measuring the ability of a compound to inhibit lactoperoxidase, and the TRH-challenge test

(McMaster, S., 1997), performed mostly in the clinical setting to measure the anterior pituitary

response to TRH (Sarne, D. H. and Refetoff, S., 1995). These test however, are only indicative

of single steps within the system of thyroid function and may be of better use as tier 2 tests.

Histopathological examination of the thyroid gland after compound exposure was also discussed

to pick up affects on the thyroid gland that may not be evident from serum hormone levels

(McMaster, S., 1997). These tests, however, will not be indicative of interference of thyroid

hormone action at target tissue.

T3 in the nucleus

As discussed above, T3 regulation in target tissue appears to involve the binding of T3 to

nuclear T3 receptors (TR) and the binding of these receptors to thyroid response elements

upstream of the promoter of T3 responsive genes. There are two families of TR isoforms, α and

β, and the number of isoforms within each family appears to be species specific as three isoforms

have been identified in humans, α1, α2 and β (Rentoumis, A., et al., 1990); at least four have

been identified in rats, α1, α2 and β1, β2 (Murray, M. B., et al., 1988; Hodin, R. A., et al.,

1989; Lazar, M. A., et al., 1988), and a large number have been identified in the isoform

families of amphibians (Jameson, J. L. and DeGroot, L. J., 1995). The structure of the TR

isoform places TR’s within the superfamily of receptors including the steroid hormone receptors,

retinoic acid receptors and receptors for vitamin D3 among others (Evans, R. M., 1988). Most of

the receptors in this superfamily require ligand association for chromatin binding; however, TR

chromatin binding has been demonstrated to independently of T3 association (Spindler, B. J., et

30

al., 1975), while TR mediated stimulation or repression of transcription is shown to be T3

dependent.

Since both α and β TR isoforms participate in positive and negative transcription

regulation, the nature of their regulation appears to be dependent on the thyroid hormone

response elements (TRE’s) to which they are bound (Brent, G. A., et al., 1992; Carr, F. E. and

Wong, N. C. W., 1994; Rentoumis, A., et al., 1990; Umesono, K., et al., 1991). The consensus

sequence within various TRE’s thus far studied is (A/G)GGT(C/A)A, though some degradation

appears to be tolerated. TRE’s, located upstream of the promoter region of a variety of T3-

positively regulated genes, contain this sequence in either palindromes, direct repeats, or a

combination of the two (Brent, G. A., et al., 1992; Rentoumis, A., et al., 1990; Umesono, K., et

al., 1991).

A study by Brent (1992) demonstrates that the arrangement of these hexameric binding-

motifs within the promoter regions examined is conducive to dimeric receptor binding and, T3

induction is proportional to TR dimer binding. As shown in Table 2., the arrangement of these

hexamers within the rat promoter region of the α MHC utilized by Brent (1992) contains two

direct repeats followed by an inverted copy, termed 3’ A, B and C’ 5’ in this study. Mutation of

one of the conserved G residues within either A, B or C resulted in a reduction of TR binding to

37%, 3% and 37% of wild type binding respectively. As shown by binding assays, mutation of

the conserved G residue in the A hexamer decreased dimer binding to the promoter region,

mutation of this residue in the B region prevented dimer binding, the C’ region mutation was

least effective in dimer inhibition (Brent, G. A., et al., 1992). The use of these mutated promoter

regions showed that the reduction in T3 induction was proportional to the decrease in dimer

binding for each mutation (Brent, G. A., et al., 1992). Other studies have shown the propensity

31

of dimeric TR binding and positive T3 regulation (Beebe, J. S., et al., 1991; Glass, C. K., et al.,

1989; Graupner, G., et al., 1989; Meier, C. A., et al., 1993; Rentoumis, A., et al., 1990;

Umesono, K., et al., 1991).

Table 2. Sequences of Selected Positive TRE’s

Gene TRE’s Sources

pTRE AGGTCATGACCT Umesono (1991)

rGH AAGGTAAGATCAGGGACGTGACCGC Brent (1992)

r α MHC GAGGTGACAGGAGGACAGCAGCCT Brent (1992)

rME AGGACGTTGGGGTTAGGGGAGGACAG

TG Brent (1992)

pTRE-palindromic TRE rGH-rat growth hormone r a MHC-rat a myosin heavy chain rME-rat

malic enzyme

Bold type denotes hexamers.

TR dimers can be homologous or heterogeneous, consisting of different TR isoforms

(Rentoumis, A., et al., 1990), TR retinoic acid receptor (RAR) combinations (Glass, C. K., et al.,

1989; Umesono, K., et al., 1991), TR retinoid X receptor (RXR) combinations (Meier, C. A., et

al., 1993), and some studies indicate dimerization between TR’s and uncharacterized protein

components within nuclear extracts (Beebe, J. S., et al., 1991). The proteins within nuclear

extracts termed TR auxiliary proteins (TRAP) appear to enhance TR binding (Beebe, J. S., et al.,

1991), and nuclear extracts have been used in many studies with TR/TRE binding assays. In

vitro RAR’s have been shown to bind the palindromic TRE’s (pTRE) (Graupner, G., et al.,

1989). Addition of retinoic acid (RA) to incubation medium with RAR’s has been shown to

32

activate RAR-RA mediated regulation of genes with these pTRE’s in the promoter region and

the combination of RAR’s and TR’s produces enhanced TR regulation through these pTRE’s

(Glass, C. K., et al., 1989; Graupner, G., et al., 1989; Umesono, K., et al., 1991). While

addition of RAR’s to systems containing the direct repeat/palindrome TRE motif, has been

shown to repress basal expression of these genes and RAR added to these systems with TR’s

decreases TR regulation (Glass, C. K., et al., 1989; Umesono, K., et al., 1991). hTR α2, which

can bind TRE’s but not T3, has this same inhibitory effect on the actions of hTR α1 and hTR β

(Rentoumis, A., et al., 1990).

Monomeric TR binding has been associated with T3 negative regulation (Carr, F. E. and

Wong, N. C. W., 1994; Rentoumis, A., et al., 1990). Negative TRE’s have not been well

characterized, but several studies have examined the TRE’s within the genes for the α and β

TSH subunits and one study has examined T3 negative regulation of human growth hormone

(hGH). An examination of the α and β TSH subunit promoters by Chatterjee (1989) showed that

unlike positive TRE’s, which are usually located upstream of the promoter, the TRE’s for these

subunits are proximal to the promoter, between the TATA box and the transcription start site.

The TRE within the rat TSHβ−subunit was examined by Carr and Wong (1994). Though the

sequence determined for the TRE contains a palindrome as well as a single hexamer, this study

demonstrated that T3 negative regulation only requires the single hexamer, allowing monomeric,

but not dimeric binding of the TR (Carr, F. E. and Wong, N. C. W., 1994). Interestingly, the

Carr (1994) study demonstrates that TR binding to this TRE, in absence of T3, enhances basal

transcription, this is contrasted by the observations of Rentoumis (1990) which indicated that the

binding of TR’s to positive TRE’s repressed basal transcription in absence of the ligand. The

addition of RXRβ to the system blunted or abolished T3 negative regulation of rTSHβ, while the

33

same study showed that RXRβ enhanced T3-TR stimulation of a construct containing the pTRE

(Carr, F. E. and Wong, N. C. W., 1994). Interference of competing receptors was not observed

by Rentoumis (1990) for the negative T3 regulation of TSHα, but the competing receptor used in

this study was TRα2. The addition of TRAP’s to the TSHβ system in the Beebe (1991) study

had no effect on T3 negative regulation. Another negative TRE, examined by Zhang (1992),

appears consists of several direct repeats, but is localized in a novel position with respect to other

positive or negative TRE’s.

The Zhang (1992) study characterized the negative TRE from hGH. Binding assays in

this study demonstrated the binding of TR’s, not within the promoter region, but within the 3’

untranslated/flanking region of the gene just upstream of the poly A region (Zhang, W., et al.,

1992). Placed in the same position on constructs with a chorionic sommatomammotropin

promoter, normally stimulated by TR/T3, the hGH TRE region confers T3 negative regulation to

this construct; however, placed upstream of the hGH promoter region, the same TRE confers T3

positive regulation to the construct (Zhang, W., et al., 1992). No other TRE’s have been found

in a similar location.

T3 positive and negative regulation via the two TR isoform families, provides a great

deal of information to consider when designing a screen for the interruption of this activity. The

workshop group discussed the use of solid state binding assays in which the TR’s would be

bound to either a multiwell plate or beads (McMaster, 1997). These types of assays can be used

to test large numbers of compounds, quickly and efficiently conferring the quality of high-

throughput to these assays. The choice of the TR isoform may be problematic and due to the

variable tissue specificity of the isoforms and the dependence of their expression on

developmental stages it may be prudent to utilize at one isoform from both the α and β families.

34

In vitro transcription assays in mammalian cell lines were discussed as well (McMaster,

1997). These types of assays are commonly utilized in studies examining the mechanisms of

thyroid hormone regulation. The systems utilized can be well manipulated to include other

factors such as RAR’s and RXR’s, known to affect TR binding. Nuclear components such as

TRAP’s and other cellular components responsible for phosphorylation and activation of TR

binding are present in these cell lines so the effects of compounds that may hamper these

components of T3 nuclear regulation could be observed with this type of assay. Representatives

of both positive and negative regulation should be utilized due the specificity of these respective

mechanisms. As with the above assay, this assay can be used as a high-through-put screen. The

major drawback for both of these assay types is the lack of information concerning compound

metabolites.

Conclusion

Given the complexity of the biological system through which thyroid function is enacted,

no single screen will be sufficient to detect disruptors of this system. This paper provides a brief

overview of some of the mechanisms involved in thyroid function and demonstrates some of the

numerous levels at which thyroid function can be disrupted. From the information provided in

this paper, the use of a combination of assays measuring the serum levels of several of the

hormones involved in thyroid function, should provide a reasonably sound indication of any

major disruption of the processes responsible for thyroid hormone production and tissue

availability. The mechanisms underlying these disruptions will not be addressed by these assays,

but as they are to be used simply as tier 1 screens, the exact mechanisms of disruption are not at

issue. Tier 2 testing may address the mechanisms of disruption. The positive and negative

35

regulation exerted by T3, as well as the tissue and developmental stage specificity of the receptor

isoforms through which T3 exerts it effects, necessitate the use of several assays to screen for

disruption of T3 nuclear regulation. Both receptor isoform families should be represented in the

screens. Both types of T3 regulation should be represented.

The time limitation provided by Congress for the design and implementation of the

screening and testing program may limit the development of new techniques to be used as

screens. Existing assays can provide a reasonable assessment of a compound’s disruptive effects

on thyroid function in mammals. Hopefully, as knowledge increases concerning the exact

mechanisms through which thyroid function is enacted, and technological advances improve the

efficiency of assay techniques, the screens and test can be improved upon to provide an even

greater level of safety and assurrance.

36

Appendix A

Genes positively regulated by thyroid hormone* Rat growth hormone Myosin heavy chain α Malic enzyme Spot 14 lipogenic enzyme Oxytocin Phosphoenolpyruvate carboxykinase Moloney leukemia virus enhancer Lysozyme silencer Glucokinase Acetyl CoA carboxylase HMG-CoA reductase Apo A1 Pyruvate kinase M1 Fatty acid synthase 6-Phosphofructo-2-kinase 6-Phosphogluconate dehydrogenase Ca2+-ATPase

Mitochondrial β F1 ATPase Cytochrome C oxidase Na+,K+-ATPase B1 Adrenergic receptor Uncoupling protein Glucose transporter

Erythrocyte anion transporter (band 3) Atrial natriuretic protein Angiotensinogen Preprotachykinin-A Fibronectin Chorionic somatomammotropin Nerve growth factor Epidermal growth factor Brain RC3 glycoprotein Purkinje PCP2

Genes negatively regulated by thyroid hormone*

TSHα TSHβ EGF receptor Human growth hormone TRH Myosin heavy chain β G protein β Neural cell adhesion molecule Peptidylglycine a-amidating monooxygenase Thyroid hormone receptor β2

*These lists are presented as tables 37-3 and 37-4 respectively in Jameson and DeGroot, “Mechanisms of Thyroid Hormone Action” in Endocrinology (1995) on p.587.

37

References Bahn, A. K., Mills, J. L., Snyder, P. J., Gann P. H. Houten , L., Bialik, O., Hollman, L. and Utiger, R. D. (1980). Hypothyroidism in workers exposed to polybrominated biphenyls. The New England Journal of Medicine. 302(1), 31-33. Balkman, C., Ojamaa, K. and Klein, I. (1992). Time course of the in vivo effects of thyroid

hormone on cardiac gene expression. Endocrinology. 130(4), 2001-2006. Barolo, D. M. (1997) Pesticide Regulation (PR) Notice 97. http://www.epa.gov/opppmsd1/PR_Notices/pr97-1.html. Barter, R. A. and Klassen, C. D. (1992). UDP-glucuronosyltransferase inducers reduce thyroid hormone levels in rats by an extrathyroidal mechanism. Toxicology and Applied Pharmacology. 113, 36-42. Barter, R. A. and Klassen, C. D. (1994). Reduction of thyroid hormone levels and alteration of thyroid function by four representative UDP-glucuronosyltransferase inducers in rats. Toxicology and Applied Pharmacology. 113, 36-42. Beebe, J. S., Darling, D. S. and Chin W. W. (1991). 3,5,3'-Triiodothyronine receptor protein

(TRAP) enhances receptor binding by interactions with the thyroid hormone response element. Molecular Endocrinology. 5(1), 85-93.

Bernier-Valentin, F., Kostrouch, Z., Rabilloud, R., and Rousset, B. (1991) Analysis of the thyroglobulin internalization process using in vitro reconstituted thyroid follicles:

Evidence for a coated vesicle-dependent endocytotic pathway. Endocrinology. 129(4), 2194-2201.

Bianco, A. C. and Silva, J. E. 1987. Optimal response of key enzymes and uncoupling protein to cold in BAT depends on local T3 generation. The American Journal of Physiology. 253(3Pt.1), E255-E263. Bliley, T. (1996). House Report no. 104-669. http://thomas.loc.gov/cgi- bin/cpquery/2?cp104:./temp/~cp104nvUG:e1: Blum, J. S., Diaz, R., Mayorga, L. S. and Stahl, P. D. Reconstitution of endosomal transport and proteolysis. In Subcellular Biochemistry. (Bergeron, J. J. M. and Harris, J. R. editors) Volume 19. Endocytotic components: identification and characterization. pp69-93. Plenum Press. New York, New York. (1993) Brent, G. A., Williams, G. R., Harney, J. W., Forman, B. M., Samuels, H. H., Moore, D. D. and

Larsen, P. R. (1992). Capacity for cooperative binding of thyroid hormone (T3) receptor dimers define wild type T3 response elements. Molecular Endocrinology. 6(4), 502-514.

Brown, G. E., 1996. Additional Views of Honorable George E. Brown. House Report number 104-669. http://thomas.loc.gov/cgi-bin/cpquery/1?cp104:./temp/~cp104yoPe:e365395:

38

Carr, F. E. and Wong, N. C. W. (1994) Characteristics of a negative thyroid hormone response element. The Journal of Biological Chemistry. 269(6), 4175-4179. Chatterjee, V. K. K., Lee, J., Rentoumis, A. and Jameson, J. L. (1989). Negative regulation of the thyroid-stimulating hormone α gene by thyroid hormone: Receptor interaction adjacent to the TATA box. Proceedings of the National Academy of Sciences USA. 86, 9114-9118. Chen, Y. J., Guo, Y., Hsu, C. and Rogan, W. J. (1992). Cognitive development of Yu-Cheng (‘oil disease’) children prenatally exposed to heat-degraded PCB’s. Journal of the American Medical Association. 268(22), 3213-3218. Chopra, I. J. Nature, sources and relative biologic significance of circulating thyroid hormones. in Werner and Ingbar’s The Thyroid A Fundamental and Clinical Text. (Braverman, L. E. and Utiger R. D. editors.) 6th edition. Chapter 7, pp126-143. J. B. Lippincott Company. Philadelphia, Pennsylvania. (1991). Cooksey, R. C., Gaitan, E., Linsay, R. H., Hill, J. B., and Kelly, K. (1985) Humic substances, a possible source of environmental goitrogens. Organic Geochemistry. 8(1), 77-80. Dahl, G. E., Evans, N. P., Thurn, L. A., and Karsch, F. J. (1994). A central negative feedback action of thyroid hormones on thyrotropin-releasing hormone secretion. Endocrinology. 136(6), 2392-2397. Davis, P. J. Cellular actions of thyroid hormones. in Werner and Ingbar’s The Thyroid A Fundamental and Clinical Text. (Braverman, L. E. and Utiger R. D. editors.) 6th edition. Chapter 9, pp190-203. J. B. Lippincott Company. Philadelphia Pennsylvania. (1991). DeLean, A., Ferland, L., Drouin, J., Kelly, P. A., and Labrie, F. (1977). Modulation of Pituitary thyrotropin releasing hormone receptor levels by estrogens and thyroid hormones. Endocrinology. 100, 1496-1504. Deme, D., Pommier, J., and Nunez, J. (1976). Kinetics of thyroglobulin iodination and of hormone synthesis catalyzed by thyroid peroxidase. European Journal of Biochemistry. 70, 435-440 Deme, D., Virion, A., Michot, J. L., and Pommier, J. (1985). Thyroid hormone synthesis and thyroglobulin iodination related to the peroxidase localization of oxidizing equivalents: Studies with cytochrome c peroxidase and horseradish peroxidase. Archives of Biochemistry and Biophysics. 236(2), 559-566. Divi R. L., and Doerge, D. R. (1994). Mechanism-based inactivation of lactoperoxidase and thyroid peroxidase by resorcinol derivatives. Biochemistry. 33, 9668-9674. Divi R. L., and Doerge, D. R. (1996). Inhibition of thyroid peroxidase by dietary flavonoids. Chemical Research in Toxicology. 9, 16-23.

39

Doerge D. R., and Niemcsura, W. P. (1989) Suicide inactivation of lactoperoxidase by 3 Amino-1,2,4-triazole. Chemical Research in Toxicology. 2, 100-103. Dunn, A. D. Thyroglobulin retrieval and the endocytotic pathway. in Werner and Ingbar’s The Thyroid A Fundamental and Clinical Text. (Braverman, L. E. and Utiger R. D. editors.) 7th edition. Chapter 4 part 2, pp81-84 J. B. Lippincott Company. Philadelphia, Pennsylvania. (1996). Dunn, A. D. (1984) Stimulation of thyroidal thiol endopeptidases by thyrotropin. Endocrinology. 114(2), 375-382. Dunn, J.T. Thyroglobulin: Chemistry and biosynthesis. in Werner and Ingbar’s The Thyroid A Fundamental and Clinical Text. (Braverman, L. E. and Utiger R. D. editors.) 6th edition. Chapter 5, pp98-110 J. B. Lippincott Company. Philadelphia Pennsylvania. (1991). Evans, R. M. (1988). The Steroid and Thyroid Hormone Receptor Superfamily. Science. 240, 889-895. Food Quaility Protection Act of 1996. www.pestlaw.com/law/HR1627.htm Forrest, D., Hallbook, F., Persson, H. and Vennstrom, B. (1991). Distinct functions for thyroid hormone receptors α and β in brain development indicated by differential expression of receptor genes. The EMBO Journal. 10(2), 269-275. Fox S.I. Human Physiology. 3rd edition. Wm. C. Brown Publishers. Dubuque, Iowa. 304-306 & 582-584 (1987). Frost, G. J. and Parkin, J. M. (1986). A comparison between the neurological and intellectual abnormalities in children and adults with congenital hypothyroidism. European Journal of Pediactrics. 145, 480-484. Glass, C. K., Lipkin, S. M., Devary, O. V. and Rosenfeld, M. G. (1989). Positive and negative regulation of gene transcription by a retinoic acid-thyroid hormone receptor heterodimer. Cell. 59, 697-708. Goldey, E. S., Kehn, L. S., Lau, C., Rehnberg, G. L. and Crofton, K. M. (1995 a). Developmental exposure to polychlorinated biphenyls (Aroclor 1254) reduces circulating thyroid hormone concentrations and causes hearing deficits in rats. Toxicology and Applied Toxicology. 133, 77-88. Goldey, E. S., Kehn, L. S., Lau, C., Rehnberg, G. L. and Crofton, K. M. (1995 a). Effects of developmental hypothyroidism on auditory and motor function in the rat. Toxicology and Applied Toxicology. 133, 67-76..

40

Goldman, L. (1997) EDSTAC chair, Assistant Administrator Office of Prevention, Pesticides, and Toxic Substances. USEPA. 401 M Street SW, MC 7101 Washington, DC 20460. Personal communication. Graupner, G., Wills, K. N., Tzukerman, M., Zhang, X. and Pfahl, M. (1989). Dual regulatory roles for thyroid-hormone receptors allows control of retinoic-acid receptor activity. Nature. 340, 653-656. Gray, L. E., Ostby, J., Marshall, R. and Andrews, J. (1993). Reproductive and thyroid effects of low-level polychlorinated biphenyl (Aroclor 1254) exposure. Fundamental and Applied Toxicology. 20, 288-294. Hill, R. N., Erdreich, L. S., Paynter, O. E., Roberts, P. A., Rosenthal, S. L., and Wilkinson, C. F. (1989). Thyroid follicular cell carcinogenesis. Fundamental and Applied Toxicology. 12, 629-697. Hinkle, P. M., Perrone, M. H., and Schonbrunn, A. (1981) Mechanism of thyroid hormone inhibition of thyrotropin-releasing hormone action. Endocrinology. 108(1), 199-205. Hodin, R. A., Lazar, M. A., Wintman, B. I., Darling, D. S., Koenig R. J., Larsen, P. R., Moore, D. D. and Chin, W. W. (1989) Identification of a thyroid hormone receptor that is pituitary-specific. Science. 244, 76-79. Huisman, M., Koopman-Esseboom, C., Fidler, V., Hadders-Algra, M., van der Paauw, C. G., Tuinstra, L. G. M., Weisglas-Kuperus, N., Sauer, P. J. J., Touwen, B. C. L. and Boersma, E. R. (1995). Perinatal exposure to polychloronated biphenyls and dioxins and its effect on neonatal neurological development. Early Human Development. 41, 111-127. Izumo, S., Lompre, A. M., Matsuoka, R., Koren, G., Schwartz, K., Nadel-Ginard, B. and Mahdavi, V. (1987). Myosin heavy chain messenger RNA and protein isoform transition during cardiac hypertrophy. Journal of Clinical Investigations. 79, 970-977. Jameson, J. L. and DeGroot, L. J. Mechanisms of thyroid hormone action in Endocrinology (DeGroot, L.J., Besser, M., Burger, H.G., Jameson, J.L., Loriaux, D.L., Marshall J.C., Odell W.D., Potts, J.T., Rubenstein, A.H. editors) Chapter 37, 583-601. 3rd edition. Vol 1. W.B. Saunders Company. Philadelphia, Pennsylvania. (1995).. Juarez de Ku de Ku, L. M., Sharma-Stokkermans, M. and Meserve, L. A. (1994). Thyroxine normalizes polychlorinated biphenyl (PCB) dose-related depression of choline acetyltransferase (ChAT) activity in hippocampus and basal forebrain of 15-day-old rats. Toxicology, 94, 19-30. Jolley, R. L., Gaitan, E., Douglas, E. C., and Felker, L. K. (1986). Identification of organic pollutants in drinking water from areas with endemic thyroid disorders and potential pollutants of drinking water sources associated with coal processing areas. American Chemical Society Division of Environmental Chemistry. 26, 59-62.

41

Koopman-Esseboom, C., Morse, D. C., Weisglas-Kuperus, N., Lutkeschipholt, I. J., van der Paauw, C. G., Tuinstra, L. G. M. T., Brouwer, A. and Sauer, P. J. J. (1994). Effects of dioxins and polychlorinated biphenyls on thyroid hormone status of pregnant women and their infants. Pediatric Research. 36(4), 468-473. Kostrouch, Z., Bernier-Valentin, F., Munari-Silem, Y., Rajas, F., Rabilloud, R. and Rousset, B. (1993) Thyroglobulin molecules internalized by thyrocytes are sorted in early endosome and partially recycled back to the follicular lumen. Endocrinology. 132(6), 2645-2653. Kostrouch, Z., Munari-Silem, Y., Rajas, F., Bernier-Valentin, F., and Rousset, B. (1991) Thyroglobulin internalized by thyrocytes passes through early and late endosomes. Endocrinology. 129(4), 2202-2211. Larsen, P. R., Silva, J. E., and Kaplan, M. M. (1989). Relationships between circulating and intracellular thyroid hormones: physiological and clinical implications. Endocrine Reviews. 2(1), 87-102. Lazar, M. A., Hodin, R. A., Darling, D. S. and Chin, W. W. (1988). Identification of a rat c-erb- Aα-related protein which binds deoxyribonucleic acid but does not bind thyroid hormone. Molecular Endocrinology. 2(10), 893-901. Lechan, R. M., Qi, Y., Jackson, M. D., and Mahdavi, V. (1994). Identification of thyroid hormone receptor isoforms in thyrotropin-releasing hormone neurons of the hypothalamic paraventricular nucleus. Endocrinology. 135(1), 92-100. Leonard, J. L. and Koehrle. Intracellular pathways of iodothyronine metabolism. in Werner and Ingbar’s The Thyroid A Fundamental and Clinical Text. (Braverman, L. E. and Utiger R. D. editors.) 7th edition. Chapter 8, pp125-161. J. B. Lippincott Company. Philadelphia,Pennsylvania. (1996). Linsay, R. H., Gaitan, E., Jolley, R. L., Cooksey, R. C., and Hill, J. B. (1986) Antithyroid activity of organic pollutants in wastewater effluents from coal conversion processes. American Chemical Society Division of Environmental Chemistry. 26, 64-67. Linsay, R. H., Hill, J. B., Gaitan, E., Cooksey, R. C., and Jolley, R. L. (1992) Antithyroid effects of coal-derived pollutants. Journal of Toxicology and Environmental Health. 37 467-481. Magnusson, R. P., Taurog, A., and Dorris, M. L. (1984). Mechanism of iodide-dependent catalytic activity of thyroid peroxidase and lactoperoxidase. The Journal of Biological Chemistry. 259 (1):197-205. McMaster, S. United States Environmental Protection Agency, National Health and Environmental Effects Research Laboratory. MD-51A Research Triangle Park, NC 27711. Personal Communication.

42

Meier, C. K., Parkinson, C., Chen, A., Ashizawa, K., Meier-Heusier, S. C., Muchmore, P., Cheng, S. and Weintraub, B. D. (1993). Interaction of human β1 thyroid hormone receptor and its mutants with DNA and Retinoid X Receptor β. The Journal of Clinical Investigation. 92, 1986-1993. Meyerhoff, W. L. (1976). The Thyroid and audition. The Laryngoscope. 89(4), 483-489. Morreale De Escobar, G., Calvo, R., Obregon, M. J. and Escobar Del Ray, F. (1990). Contribution of maternal thyroxine to fetal thyroxine pools in normal rats near term. Endocrinology. 126(5), 2765-2767. Morse, D. C., Wehler, E. K., Wesseling, W, Koeman, J. H. and Brouwer, A. (1996). Alterations n rat brain thyroid hormone status following pre- and postnatal exposure to polychlorinated biphenyls. Toxicology and Applied Pharmacology. 136, 269-279. Murray, M. B., Zilz, N. D., McCreary, N. L., MacDonald, M. J. and Towle, H. C. (1988). Isolation and characterization of rat cDNA clones for two distinct thyroid hormone receptors. The Journal of Biological Chemistry. 263(25), 12770-12777. Nakamura, M., Yamazaki, I., Hidehiko, N., Ohtaki, S., and Ui, N. (1984). Iodination and oxidation of thyroglobulin catalyzed by thyroid peroxidase. The Journal of Biological Chemistry. 259(1), 359-364. Nicholson, J. L. and Altman, J. (1972) Synaptogenesis in the rat cerebellum: effects of early hypo- and hyperthyroidism. Science. 176, 530-532. Office of Prevention, Pesticides and Toxic Substances, U. S. EPA. (1997)(a). Endocrine Disruptor Screening and Testing Advisory Committee: Description of the EDSTAC charge. http://www.epa.gov/opptintr/opptendo/005job.htm. Office of Prevention, Pesticides and Toxic Substances, U. S. EPA. (1997)(b). United States Environmental Protection Agency Federal Advisory Committee Charter Endocrine

Disruptor Screening and Testing Advisory Committee. http://www.epa.gov/opptintr/opptendo/endo4_1.htm

Office of Prevention, Pesticid