analyses of stormwater discharge from meadwestvaco paper mill susmitha marneni samayita ganguly...

14
Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Upload: rosamund-berry

Post on 23-Dec-2015

218 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Analyses of stormwater discharge from Meadwestvaco

Paper mill

SUSMITHA MARNENI

SAMAYITA GANGULY

MENTOR : DR. ASHWINI KUCKNOOR,

Page 2: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Meadwestvaco, Evadale Texas

Page 3: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Stormwater and stormwater outfalls

Common sources of Industrial Stormwater Pollution

Holding ponds that have overflow to the environment

Page 4: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

E.coli

The mill was exceeding the water quality maximum of 328 (MPN)/100 mL

E.coli lives in the gut and is an indicator organism for fecal matter.

There are pathogenic strains such as Escherichia coli O157:H7, which can cause illness.

The company contacted Lamar’s Biology department and Dr. Kucknoor to determine if the E.coli had a Human origin or Animal origin.

Page 5: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

To determine bacterial counts on stormwater drainage samples

To determine if the bacteria is E.coli

To determine the possible source of E.coli (human or non-human origin)

Objectives

Page 6: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Step 1: Colilert MPN test

Page 7: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Results from Colilert MPN test.

Samples #s I batch II batch III Batch

  24h 48h 24h 48h 24h 48h

# 7 4/5 4/5   1/5 1/5   1/5 1/5  

#10 5/5 5/5   2/5 5/5   3/5 3/5  

# 17 3/5 4/5   5/5 5/5   3/5 3/5  

#27 5/5 5/5 5/5 5/5 0/5 0/5

#29 3/5 4/5   2/5 5/5   4/5 4/5  

#35 0/5 5/5 3/5 4/5 4/5 4/5

# 37 - -   5/5 5/5   2/5 2/5  

Red colored numbers indicate that the tubes showed fluorescent cultures.

Page 8: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Step 2: Durham’s fermentation test

Presence of E.coli

The test looks for acid and gas production at 42◦C to conclude the presence of E. coli in samples.

The color change in samples #27, and #35 is positive for E.coli.

#10 shows growth but not from E.coli

Page 9: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Step 3: Streaking on EMB agar plate

EMB agar plate is selective for E.coli

Two samples that were positive: #27 & #35 were streaked

One sample that was negative: #35 was also streaked for comparison.

Page 10: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Problems of detecting the source of E.coli

Cannot determine origin of E.coli (i.e, whether it is of human origin or non-human origin)

Instead Use “Bacteroides” species that are associated with E.coli to determine the source.

Isolated total DNA from water samples and amplified the uidA gene specific to E.coli, and also primers specific to Cattle Bacteroides and Human Bacteroides (as done by others in literature)

Page 11: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Primers used to detect E.coli and Bacteroides from humans and cattle

Bac32F 5 5’AACGCTAGCTACAGGCTT 3’

Bac708R 5’CAATCGGAGTTCTTCGTG 3’

HF183F 5’ATCATGAGTTCACATGTCCG 3’

CF128F 5’CAAACYTTCCCGWTAACT 3’

uidA1318F 5’CCGATCACCTGTGTCAATGT 3’

uidA1698R 5’GTTACCGCCAACGCGCAATA 3’

  (Microbial source tracking : http://www.microbe.com/index.php/Overview/mst-mbts-overview.html)

Page 12: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Step 4: Gel electrophoresis of PCR products PCR products were

obtained from the 3 samples

gel electrophoresis shows the thick bands in lanes 2 and 4, corresponding to the primers amplifying uidA gene in E.coli

The bottom half of the gel shows bands corresponding to genes specific to cattle Bacteroides

Page 13: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Conclusive results

Based on the results, it can be concluded that sample #27 and #35 had E. coli contamination, which may have a probable cattle or non-human origin.

All PCRs from DNA samples showed NO presence of E. coli pathogenic strain O157:H7

Page 14: Analyses of stormwater discharge from Meadwestvaco Paper mill SUSMITHA MARNENI SAMAYITA GANGULY MENTOR : DR. ASHWINI KUCKNOOR,

Thank You for your time!

Questions?