Analysis of Barley microRNAs under Salinity Stress Using Small

RNA-Seq

Thi Hoang Yen Dang 1, Atul Kamboj

1, Mark Ziemann

2 and Mrinal Bhave

1+

1Faculty of Science, Engineering and Technology, Swinburne University of Technology, PO Box 218,

Hawthorn, Australia 2Baker IDI Heart and Diabetes Institute, Melbourne, Australia

Abstract. Salinity is a global issue, affecting >6% of total land, threatening plant growth and production.

Recent investigations on microRNAs (miRNA) have found these to be involved in many plant processes such

as plant development and abiotic and biotic stress response, by regulation of gene expression by silencing of

the target mRNA in various ways. Hence analysis of miRNAs and their gene regulation mechanisms may

enable development of stress-tolerant plants for food security. However, there are no reports of miRNA

studies in barley under abiotic stress conditions. In the present study, miRNA populations were investigated

using RNA-Seq of cDNA libraries of small RNAs isolated from salt-stressed and unstressed leaf of barley

(Hordeum vulgare cv. Arivat and Calmariout). Two hundred and thirty one miRNA species were identified

from the data using Mireap software and blast searches. Among these, 5 known, 11 with orthologs in other

species, and 25 novel miRNAs were identified, some which showed significant differential response to salt

stress. The results provide new deep sequence data on barley miRNAs in response to salt stress.

Keywords: miRNA, salinity, barley

1. Introduction

Soil salinity, drought, nutrient inadequacy, and toxicity of certain elements are amongst the most

common abiotic stresses that affect crop species around the world. Amongst these, salinity is a global issue

that affects over 100 countries and about 800 million hectares (>6%) of total land [1]. Soil salinity in some

areas is primary, i.e., from natural sources, while in other areas it is secondary in nature, irrigation of

shallow-rooted crops being a contributing factor. Soil salinity is known to influence the growth and

development of plants, resulting in reduction of productivity. High concentration of salt in soil prevents the

water uptake of roots and is detrimental to plant growth [1]. Salinity reduces plant growth by causing

osmotic stress and accumulation of ions in rhizosphere, restricting water extraction into the root. In addition,

salt stress also results in enzyme inactivation, nutrient starvation, ionic toxicity and oxidative stress by

causing ionic disequilibrium. Oxidative stress subsequently produces reactive oxygen species that damage

plant by increasing DNA damage, lipid peroxidation and inhibiting photosynthesis. The high concentration

of salt can lead to plant death [2].

MicroRNAs (miRNAs) are endogenous, typically 19-25 nucleotides long, single-stranded, non-coding

RNAs found in both animal and plant transcriptomes, and have roles in post-transcriptional regulation of

gene expression through the regulation of their specific target mRNAs. They have been reported to regulate

many plant processes such as development, flowering, auxin signaling, response to abiotic and biotic stress

or regulation of their own biogenesis [3]. In plants, miRNA genes are transcribed by RNA polymerase II into

primary-miRNAs (pri-miRNA), which then undergo 5’ capping and 3’ polyadenylation. The processing to

pre-miRNA(s) occurs in the nucleus by Dicer Like-1 (DCL1), which then makes a cut of pre-miRNA(s) to

liberate the miRNA together with its reverse complement, forming the miRNA-miRNA* (or miRNA5p-

Corresponding author. Tel.: +61 392145638.

E-mail address: thihuangyendang@swin.edu.au.

2014 3rd International Conference on Environment Energy and Biotechnology

IPCBEE vol.70 (2014) © (2014) IACSIT Press, Singapore

DOI: 10.7763/IPCBEE. 2014. V70. 14

74

miRNA3p) duplex . After export to cytoplasm, this duplex is unwound by a helicase to release the mature

miRNA [4]. The miRNA strand is then incorporated into the RNA-induced silencing complex (RISC). The

Argonaute (AGO) protein in RISC acts as an endonuclease on the target mRNA by two main mechanisms:

mRNA cleavage or miRNA-directed translational inhibition (repression) based on complementarity between

miRNAs and mRNA targets [4]. Over 5000 miRNAs have been identified and deposited in miRBase v19.0

(http://www.mirbase.org) so far, belonging mainly to Arabidopsis (291), rice (581), maize (172), sorghum

(171) and Brachypodium (142) [5].

Barley (Hordeum vulgare L.) is one of the most important cereal crops worldwide, ranking fourth

amongst cereal crops based on production. It is typically cultivated over 56 million hectares of arable land

and produces >157 million tonnes annually [6]. The barley grain has a highly nutritive composition of

carbohydrates (80%), protein (7-25%), lipids (3%), vitamins, minerals and phytochemicals. Although it is

used mainly for animal feed, malt and seed, it is still a major human food in parts of Asia and North Africa

[7]. Recently, a few studies on investigation of barley miRNA populations have been carried out, resulting in

up to 100 discovered miRNAs in leaf tissue through deep sequencing [8] and 126 conserved and 133 novel

miRNAs in different tissues, i.e., roots, stems, leaves and spikes [5]. A number of described and novel barley

miRNAs have also been investigated under various abiotic stresses such as drought [9] or boron stress [10].

However, only 67 miRNAs have been deposited in miRBase so far. Thus the study of barley (Hordeum

vulgare L.) miRNAs is in early stages compared to other species.

This study aimed to investigate the miRNA population in barley under acute salt stress with deep

sequencing. Barley (Hordeum vulgare cv. Arivat, Calmariout) cultivars were used in this study that have

been reported as salt sensitive and salt tolerant, respectively, based on physiological tests, i.e., length, weight,

relative water content and sodium ion content (unpublished data). Hence, the newly identified miRNAs may

be involved in regulating the salinity stress response and provide preliminary understanding on mechanism

of these miRNAs response to different salt responsive barley genotypes.

2. Materials and Methods

2.1. Plant materials, growth conditions and salinity stress

Barley (Hordeum vulgare cv. Arivat, Calmariout) seeds were obtained from The Australian Grains

Genebank and germinated on filter paper soaked in distilled water in Petri dishes at room temperature in dark.

After two days, seedlings were grown in pots on a mixture of vermiculite: perlite (2:1). Plants were watered

with Hoagland’s solution every two days and grown in plant growth cabinet (Thermoline, Australia) under

conditions of 20°C temperature, 70% humidity and 12 hour day/night cycles. At 2 week after transferring to

pots, plants had reached the two-leaf stage, and three biological replicas were watered with 150 mM NaCl

made in Hoagland’s solution while other three used as control plants, fed with Hoagland’s solution only.

After 12 hours of salt treatment, leaf and root tissues of both salt-stressed and control samples were

harvested separately and immediately frozen in liquid nitrogen and stored at -80oC.

2.2. RNA isolation and construction of small RNA libraries

Total RNA was extracted using TRIsure reagent (Bioline, Australia). In each variety, RNA from two

salt-stressed plants was pooled in equal quantities, and the RNA from two control plants was likewise pooled,

for the small RNA-Seq library preparations using the NEB Next Small RNA library preparation kit for

Illumina (New England Biolabs, USA). The libraries were purified and sequenced in Genome Analyzer IIx

(Illumina, USA).

2.3. Bioinformatics analysis of small RNA sequence data to identify miRNAs

Adapter sequences were removed using Fastx toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). Reads

were aligned to barley genome Bowman assembly version 5 using Burrows-Wheeler Aligner (BWA) with

default settings. Read alignments were then used to identify miRNA genes using the program Mireap

(http://sourceforge.net/projects/mireap/), on the basis of the following criteria: (1) miRNA-miRNA* duplex

located in opposite stem-arms with two-nucleotide 3’ overhangs, (2) mismatch of no more than 4 bases

between miRNA and the other arm including miRNA*, (3) asymmetric bulges, especially within miRNA-

75

miRNA* duplex, of minimal size and frequency (usually less than one) [11]. These candidate sequences

were then aligned to barley miRNA sequences deposited in miRbase (miRBase v 19.0,

http://www.mirbase.org/) for finding the previously reported (i.e., ‘known’) barley miRNAs, and comparing

to these. Additionally, for confirmation of the presence of these sequences in the barley genome, these

sequences were BLAST-searched against the sequenced genomes of Morex and Barke on International

Barley Sequencing Consortium (IBSC http://webblast.ipk-gatersleben.de/barley/). miRNA genes with fewer

than 10 reads per sample on average were eliminated from downstream analysis. Differential expression of

miRNAs was determined by comparing the library size adjusted read counts.

3. Results

Next generation sequencing is a powerful molecular technique that allows identifying and quantifying

the small RNA sequences and their differential expression. Small RNA sequences from leaf tissue generated

on Illumina GAIIx were used to identify miRNA genes. In present study, four libraries from two barley

varieties, Arivat and Calmariout, were constructed under control and salinity stress. After trimming adaptors

and removing RNA sequences shorter than 18 nucleotides, over 60 million reads with average of 28

nucleotides were obtained and up to 95% of these reads aligned to barley genome sequence (Hordeum

vulgare cv. Bowman). Use of the Mireap software, allowed the identification of 231 miRNA precursor genes

with 112 mature miRNAs located in the 5’ arm and 124 mature miRNAs located in 3’ arm of pre-miRNAs.

Intriguingly, five pre-miRNAs were found with two mature sequences that complemented and located in

both arms, considered as miRNA and miRNA* sequences. After eliminating any sequences with less than 10

reads, 41 miRNAs with 20-24 nucleotides in length were obtained. Mapping these miRNAs to known barley

miRNA sequences in miRbase allowed identifying 5 previously reported “known” barley miRNAs: hvu-

MIR171, hvu-MIR-5048a, hvu-MIR5048b, hvu-MIR159a and hvu-MIR159b. The remaining 36 miRNAs

were BLAST-searched against known precursor and mature plant miRNAs in miRBase for the identification

of any homologous miRNA in other plant species. Eleven out of 36 miRNA candidates were found to match

known plant miRNA sequences with no more than 3 mismatches, leaving 25 candidates as putative novel

barley miRNAs (Table 1). These putative novel miRNAs were then aligned to other barley miRNAs reported

in other papers. The result showed that the identified miRNAs were new and unique.

Table 1. Known miRNAs and examples of some novel and homologous miRNAs candidates with fold change >1.5

miRNA Location Start-End

position Sequence Number

of reads

used by

miReap

Fold

change in

Calmariout

(up/down)

Fold

change in

Arivat

(up/down)

Known miRNAs

hvu-MIR171 bowman_contig_863591 1761-1781 UGUUGGCUCGACUCACUCAGA NC -1.46 1.18

hvu-MIR159a bowman_contig_845099 2389-2409 UUUGGAUUGAAGGGAGCUCUG NC -1.78 -1.41

hvu-MIR159b bowman_contig_845099 2389-2409 UUUGGAUUGAAGGGAGCUCUG NC -1.20 1.04

hvu-MIR5048a bowman_contig_14776 1187-1208 UAUUUGCAGGUUUUAGGUCUAA NC -1.37 1.02

hvu-MIR5048b bowman_contig_14776 1187-1208 UAUUUGCAGGUUUUAGGUCUAA NC -1.37 1.02

Examples of novel and homologous miRNA candidates with fold change >1.5

SUT_hvu_mir_000174 bowman_contig_857828 1313-1335 TTGCATCTCTCGGGTCGTTCCAG 44 -1.82 -1.48

SUT_hvu_mir_000163 bowman_contig_851924 3777-3800 CATATATGTAGTGCTGTAAGAAGA 57 1.68 2.11

SUT_hvu_mir_000133 bowman_contig_73670 10386-10408 GAACGATTTGAGGCGATTTGAAC 59 1.91 1.41

SUT_hvu_mir_000043 bowman_contig_1663310 57-77 GGCGGATGTAGCCAAGTTGAG 541 1.77 -2.24

SUT_hvu_mir_000108 bowman_contig_42529 165-186 CACGAGGGCTCTGCTCGCTGAT 3 1.92 1.69

SUT_hvu_mir_000045 bowman_contig_196257 3202-3225 GCTTCTTGCTGATGGTGTTATTCC 166 1.55 2.2

‘NC’ means not count

In general, the read numbers of the five known miRNAs in Calmariout were higher than those in Arivat

in both control and salt-stressed libraries, excepting hvu-miR171 with showed opposite trend. Among the

five known miRNAs, hvu-miR159b had the highest expression, with over thousand reads in each library of 76

both cultivars, while hvu-miR171 displayed the lowest expression with around ten reads in each library. All

these known miRNAs showed a minor decrease in their expression under salt stress in Calmariout, excepting

hvu-miR171 with 1.78 fold-decreased in expression. Interestingly, their expressions were increased slightly

in Arivat, excluding hvu-miR159a that exhibited a reduction in both cultivars. After aligning to other barley

sequenced genomes, of the cultivars Morex and Barke, the five known miRNAs could identified in all three

barley genomes, indicating their conservation (data not shown).

Twelve out of twenty-five miRNAs were located in the 3’ arm while the other thirteen were located in

the 5’ arm of the precursors. Most of them were found to be located in the genomes of the barley cultivars

Morex and Barke also (data not shown). These miRNAs had various abundances in term of the number of

reads, ranging from ten to thousands. The number was also variable between the two control samples. Out of

25 novel miRNAs, 11 miRNAs showed higher expression, 11 others displayed lower expressions while three

had equal number of reads, between the control sample of Calmariout and control sample of Arivat. The

most abundant miRNA was SUT_hvu_mir_000186, with over 1000 reads in each library of two varieties.

Especially, SUT_hvu_mir_000173 and SUT_hvu_mir_000158 were found to be present only in the control

sample of Calmariout with 83 and 41 reads, respectively. These novel miRNAs also had variable response to

salt stress between two cultivars. In general, most of novel miRNAs were found to be down-regulated in

Calmariout and up-regulated in Arivat under salt stress. These miRNAs did not show significant changes in

their expression, varying from 1 to 2.2 fold-changed. Out of the 25 miRNAs, seven showed up-regulation

and three displayed down-regulation in both the barley lines. Four and one novel miRNAs had unchanged

under salt stress in Arivat and Calmariout, respectively. The remaining miRNAs showed opposite expression,

increased expression in Calmariout and decreased expression in Arivat, and vice versa (Figure 1).

Fig. 1: Venn diagram illustrates common and unique differential miRNAs expression under salt stress. ↑ indicated up-

regulation, ↓ indicated down-regulation and * indicated an unchanged in miRNAs expression.

4. Discussion

In present study, 231 precursor miRNAs were identified. Of these, five had miRNA:miRNA* duplex

located in their sequences. Detection on the location of mature miRNAs and miRNA* on five precursor

miRNAs needs further analysis. Of the miRNAs, forty-one mature miRNAs were investigated as salt stress

responsive gene with more than 10 reads in all four libraries. The remaining mature miRNAs may play a role

in different abiotic or biotic stress.

After aligning to Morex and Barke genome, most of the 41 identified miRNAs were found to be located

in both genomes, excepting some miRNAs which were identified only in one of these, possibly due to the

differences in the gene coverage (Morex 82%, Bowman 71%, Barke 26%) [12]. The result suggested that the

investigated miRNAs are likely present in all barley cultivars.

Out of five known salt stress responsive miRNAs found, miR171 and miR159a/b have also been

reported as salt stress responsive in many previous studies such as in Arabidopsis under 300 mM NaCl

treatment from 0 to 24 hours [13] or in wheat after 24 hours of 200 mM NaCl treatment [14], showing up-

regulation in both plant species. In barley, these miRNAs were also found to be responsive to other abiotic

stresses such as drought stress [9] or boron stress [10]. The targets of miR171 and miR159 are mRNAs

encoding the GRAS and MYB families of transcription factors in barley [9]. GRAS transcription factors

10↓

4↑

1*

8↑

3↓

4*

7↑

3↓

Calmariout Arivat

77

regulate gene transcription and signal transduction during plant development [15], while MYB transcription

factors are reported to have diverse functions in plant developmental and metabolic processes, cell fate or

abiotic and biotic stress [16]. The expression of hvu-MIR159 and hvu-MIR171 were found to be inversely

correlated to their targets [9]. Up-regulation of these known miRNAs in Calmariout and down-regulation in

Arivat provided an understanding on the role of miRNAs on plant growth and development.

None of 25 detected novel miRNAs have been discovered in other reports [5], [10]. This number of

novel miRNAs is rather limited in comparison to other findings, possibly due to the use of only leaf RNA

extraction and selection of small RNAs having significant reads (>10) in all four libraries. The expression of

these miRNAs also varied among two barley lines. Ten novel miRNAs showing up-regulation in Calmariout

were down-regulated in Arivat and vice-versa, suggesting varied extents or types of roles of these miRNAs

on plant growth response to salt stress. The novel miRNAs showing unchanged expression suggests that they

may not play an important role in plant development under salt stress. Other ten of novel miRNAs showed

the same expression in both barley lines and need to be studied further for their target mRNAs. The variable

expression suggested that these miRNAs may have different mechanism of regulation on different genotypes.

It is also necessary to study the putative target genes of these novel miRNAs for further understanding the

regulation of these genes under salt stress and the genetic variants of it.

5. Conclusion

The present results have provided a number of miRNAs responsive to acute salt stress in barley. The

presence of these novel genes needs to be confirmed by cloning and sequencing methods, and their

differential expression by quantitative PCR. Further work on finding putative targets of these miRNAs will

provide a better understanding of the role of miRNAs in plant developmental and metabolic processes in salt

tolerant and salt sensitive barley lines and allow the tools for genetic selection or breeding.

6. References

[1] R. Munns, & M. Tester, Mechanisms of salinity tolerance. Annual Review of Plant Biology, 2008, 59: 651-681.

[2] S. Turan, K. Cornish, & S. Kumar, Salinity tolerance in plants: Breeding and genetic engineering. Australian

Journal of Crop Science, 2012, 6: 1337-1348.

[3] M. Kantar, S. J. Lucas, & H. Budak, miRNA expression patterns of Triticum dicoccoides in response to shock

drought stress. Planta, 2011, 233: 471-484.

[4] P. Guleria, M. Mahajan, J. Bhardwaj & S. K. Yadav, Plant Small RNAs: Biogenesis, Mole of Action and Their

Roles in Abiotic Stresses. Genomics Proteomics Bioinformatics, 2011, 9: 183-199.

[5] S. Lv, X. Nie, L. Wang, X. Du, S. S. Biradar, X. Jia, & S. Weining, Identification and characterization of

microRNAs from barley (Hordeum vulgare L.) by high-throughput sequencing. International Journal of

Molecular Sciences, 2012, 13: 2973-2984.

[6] Food and Agriculture Organisation of the United Nations [Online]. Available:

http://faostat.fao.org/site/339/default.aspx 2012].

[7] R. K. Newman, & C.W. Newman. Barley for Food and Health: Science, Technology and Products. Canada, Wiley-

Interscience, 2008.

[8] A. W. Schreiber, B.-J. Shi, C. Y. Huang, P. Langridge, & U. Baumann, Discovery of barley miRNAs through deep

sequencing of short reads. BMC Genomics, 2011, 12.

[9] M. Kantar, T. Unver, & H. Budak, Regulation of barley miRNAs upon dehydration stress correlated with target

gene expression. Functional & Integrative Genomics, 2010, 10: 493-507.

[10] E. Ozhuner, V. Eldem, A. Ipek, S. Okay, S. Sakcali, B. Zhang, H. Boke, & T. Unver, Boron stress responsive

microRNAs and their targets in barley. PloS ONE, 2013, 8.

[11] B. C. Meyers, M. J. Axtell, B. Bartel, D. P. Bartel, D. Baulcombe, J. L. Bowman, X. Cao, J. C. Carrington, X.

Chen, P. J. Green, S. Griffiths-Jones, S. E. J acobsen, A. C. Mallory, R. A. Martienssen, R. S. Poethig, Y. Qi, H.

Vaucheret, O. Voinnet, Y. Watanabe, D. Weigel, & J. K. Zhui, Criteria for annotation of plant microRNAs. Plant

Cell, 2008, 20: 3186-3190.

78

[12] S. A. Goff, J. C. Schnable, & K. A. Feldmann, 2014. The Evolution of Plant Gene and Genome Sequencing.

Genomes of Herbaceous Land Plants. UK: Elsevier.

[13] H. H. Liu, X. Tian, Y. J. Li, C. A. Wu, & C. C. Zheng, Microarray-based analysis of stress-regulated microRNAs

in Arabidopsis thaliana. RNA, 2008, 14: 836-843.

[14] W. Lu, J. Li, F. Liu, J. Gu, C. Guo, L. Xu, H. Zhang, & K. Xiao, Expression pattern of wheat miRNAs under

salinity stress and prediction of salt-inducible miRNAs targets. Frontiers of Agriculture in China, 2011, 5: 413-

422.

[15] C. Bolle, The role of GRAS proteins in plant signal transduction and development. Planta, 2004, 218: 683-692.

[16] C. Dubos, R. Stracke, E. Grotewold, B. Weisshaar, C. Martin, & L. Lepiniec, MYB transcription factors in

Arabidopsis. Trends in Plant Science, 2010, 15: 573-581.

79