analysis of the 5′ flanking region of the human β-glucuronidase gene

GENOMICS 10, 1009-1018 (19%)

Analysis of the 5’ Flanking Region of the Human @-Glucuronidase Gene’

J. MICHAEL SHIPLEY,~ RAYMOND D. MILLER,~ BENJAMIN M. Wu, JEFFREY H. GRUBB, SHANE G. CHRISTENSEN, JOHN W. KYLE, AND WILLIAM S. Sly“

Edward A. Doisy Department of Biochemistry and Molecular Biology, St. Louis University School of Medicine, St. Louis, Missouri 63104

Received December 5, 1990; revised April 23, 1991

We have sequenced 4.2 kb of the 5’ flanking region of the human &glucuronidase gene, compared this sequence to the 6’upstream sequence reported for the murine gene, determined the transcription start sites of the human gene, and studied expression of human minigene deletion constructs in COS cells. The 200 bp immediately 5’ to the translation initiation codon have a high G + C content (72%) and contain no TATA box, two properties commonly associated with “housekeeping genes.” The sequence 6’ to -200 bp contains seven Ah repetitive elements which account for more than 50% of this flanking sequence. From deletion analysis of minigene constructs, 200 bp of 5’ sequence appeared sufficient for maximal expression in transfected COS cells. Sl nuclease protection analysis showed that transcription initiates from a cluster of sites around -30 bp in all tissues examined. In some cases, a low but detectable level of transcription also initiates 126 bp upstream of the ATG. Inspection of the sequence surrounding both start sites revealed some similarity to the recently described “initiator” transcriptional control element (S. T. Smale and D. Baltimore (1989), Cell 57: 103-113). Com- parison of the 5’ flanking sequence with that available from the murine &glucuronidase gene reveals only one 26bp highly conserved region, which surrounds the -126 start site. 0 1SSl Academic Press, Inc.

INTRODUCTION

P-Glucuronidase is a lysosomal acid hydrolase com- posed of four identical subunits (M, = 82,000) that is

Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession No. M65002.

i This work was supported by National Institutes of Health Grants GM34182 and DK40163.

x J.M.S. is supported by March of Dimes predoctoral fellowship 18-88-28.

3 Current address: Department of Genetics, Washington Univer- sity School of Medicine, 4566 Scott Avenue, St. Louis, MO 63110.

’ To whom correspondence and reprint requests should be ad- dressed at Edward A. Doisy Department of Biochemistry and Mo- lecular Biology, St. Louis University School of Medicine, 1402 S. Grand Blvd., St. Louis, MO 63104.

involved in the stepwise degradation of glucuronic acid-containing glycosaminoglycans. Deficiency of @giucuronidase results in the accumulation in lysosomes of partially degraded glycosaminoglycans containing glucuronic acid at their nonreducing termini (Sly et aZ., 1973). In humans, this produces the clinical genetic disorder mucopolysaccharidosis type VII (MPS VII).’ Studies of human /3-glucuronidase and cells from MPS VII patients were important in defining the mannose 6-phosphate recognition marker that targets acid hydrolases to lysosomes (Kaplan et aZ., 1977; Natowicz et at., 1979). Recently, a mouse model for MPS VII was characterized (Birkenmeier et al., 1989; Vogler et al., 1990).

The human /%glucuronidase gene has been isolated in a cosmid clone and shown to express human /3-glucuronidase activity in transfected rat XC cells (Miller et al., 1990). The expressing cosmid clone contains 4.2 kb of 5’ upstream sequences. To define the 5’ region of the @glucuronidase gene and to map restriction sites that would be useful in construction of transgenes and deletion constructs, we sequenced the entire 4.2 kb. A 22-kb EcoRV fragment of the cosmid containing 1.6 kb of upstream sequence was subsequently intro- duced into mouse embryos and gave high-level expression of the human gene in several transgenic founder animals, one of which transmitted the expressing gene to progeny (Kyle et al, 1990). Expres- sion of this human transgene in the MPS VII mice was found to correct the clinical and biochemical ab- normalities of murine MPS VII.

In this report, we present the sequence of the 4.2-kb region upstream of the p-glucuronidase coding sequence and compare this sequence with 5’ upstream sequence of the mouse gene. We also present studies defining the transcription start sites of the human

6 Abbreviations used: MPS VII, mucopolysaccharidosis type VII; DMEM, Dulbecco’s modified Eagle medium; EDTA, ethylen- ediaminetetraacetic acid, SDS, sodium dodecyl sulfate; TdT, terminal deoxynucleotidyltransferase; AdML, adenovirus major late.

1009 08%7543/91 $3.00 Copyright 0 1991 by Academic Press, Inc.

All rights of reproduction in any form reserved.

1010 SHIPLEY ET AL.

gene and the expression levels of human minigene deletion constructs in transfected COS cells.

MATERIALS AND METHODS

Materials

Restriction enzymes, T4 DNA ligase, T4 DNApoly- merase, the Klenow fragment of Escherichia coli DNA polymerase I, and T4 polynucleotide kinase were purchased from Promega. M13mp18, M13mp19, DEAE- dextran, the mammalian expression vector pSVL, the E. coli p-galactosidase expression vector pCH110, and deoxynucleotides were from Pharmacia. Calf intes- tinal alkaline phosphatase, Sl nuclease, and a random primed labeling kit were obtained from Boehringer-Mannheim Biochemicals. Sequenase was from United States Biochemicals. Avian myeloblast- osis virus reverse transcriptase was purchased from Life Sciences, Inc. Nitrocellulose membranes were from Schleicher & Schuell. Chloroquine was from Sigma. RNAzol was from Cinna/Biotecx. The nucleic acid extraction kit was purchased from Applied Bio- systems. Low-melting-temperature agarose was from Seakem. All radioactive nucleotides were from Amer- sham and ICN.

Cells

COS-7 cells were obtained from M. Green (Insti- tute for Molecular Virology, St. Louis University School of Medicine, St. Louis, MO). COS-7 cells and HeLa cells (ATCC CCL 2) were grown as monolayers in Dulbecco’s modified Eagle medium (DMEM) supplemented with 5% fetal bovine serum. Cells from cell line 293 (transformed primary human embryonal kidney, ATCC CRL 1573) were maintained as monolayers in minimal essential medium supplemented with 10% horse serum.

DNA Sequencing

Several BstXI, SphI, BamHI, and PstI restriction fragments encompassing the 5’ flanking region of @glucuronidase were excised from a cosmid isolate (Miller et al., 1990) and subcloned into bacteriophage M13mp18 and M13mp19 for sequencing (Messing, 1983). Sequence was also determined from the EcoRI-KpnI and HindIII-KpnI fragments. For B&XI fragments, T4 DNA polymerase was used to create blunt ends for subcloning into the SmuI site of Ml3. Subclones were sequenced using the dideoxynucleo- tide chain termination method (Sanger et al., 1977) with the Ml3 universal primer. Oligonucleotide primers were synthesized to complete the sequencing, where necessary (Strauss et al., 1986). In some cases,

it was necessary to use 7-deaza-dGTP in place of dGTP to sequence through G+C-rich regions.

Nucleic Acid Alignment

Nucleic acid alignments were done using the algorithm of Wilbur and Lipman (1983).

Construction of the Miniene Insert

pSC1, a cosmid isolate (Miller et al., 1990) from a human placental genomic DNA library (Lau and Kan, 1983, 1984), contains a 31-kb insert which in- cludes the entire &glucuronidase coding sequence as well as 4.2 kb 5’ to the ATG translation initiation codon. This cosmid was digested with Sal1 (two sites), diluted, and religated to obtain a 12.8-kb minicosmid construct, pMC, that contains all the sequence 5’ to the ATG to the Sal1 site in exon 3, as well as the vector elements necessary for propagation in E. coli. pMC contains two BamHI sites, one of which is located at -4.2 kb relative to the ATG and is thought to be the cloning site for the cosmid insert. This construct was partially digested with BamHI and the 12.8-kb linear BamHI fragment was isolated from low-melting-temperature agarose. XhoI linkers were ligated to the linearized pMC, cut with XhoI, and re- circularized to isolate a construct, pXhoMC, that contains a unique X/w1 site at -4.2 kb relative to the ATG. pHUGP13, a plasmid containing the human @-glucuronidase cDNA (Oshima et al., 1987), was partially digested with SalI to obtain the 2.2-kb cDNA which was then ligated into the XhoI site of the pSVL expression vector (Pharmacia) to give pSVL13. pSVL13 was digested with NotI, which cuts at a unique site in exon 1, and partially digested with Sal1 to obtain a 2.5-kb NotI-SaZI fragment harboring that portion of the cDNA 3’ to the Not1 site in exon 1 as well as an additional 518 bp of pSVL containing the SV40 sequences for polyadenylation. pXhoMC was digested with Sal1 and Not1 to isolate a 10.8-kb S&I- Not1 fragment containing all &glucuronidase sequence 5’to the Not1 site in exon 1, as well as 6.4-kb of vector DNA. This 10.8-kb fragment was ligated with the 2.5-kb NotI-Sal1 fragment of pSVL13 to generate the construct pXhoMC13, which now contained the human /3-glucuronidase cDNA flanked 5’ by 4.2 kb of genomic sequence and 3’by the SV40 polyadenylation singals. pXhoMC13 was digested with XhoI and partially with Sal1 to remove a 6.7-kb fragment containing the 4.2 kb 5’ to the ATG, the cDNA, and the polyadenylation sequences. This provided the minigene insert for the mammalian expression vector.

Minigene Deletion Constructs

The plasmid d1180 (provided by K. Calame) is a 2.4-kb pBR322-based plasmid containing 85 bp of the

HUMAN B-GLUCURONIDASE 5’ FLANKING REGION 1011

SV40 origin of replication sufficient for amplification in COS cells and lacking the viral transcriptional promoters (Learned et aZ., 1981). This plasmid was linearized with EcoRI, and XhoI linkers were attached to generate the construct dll80Xho. The 6.7-kb XhoI- Sal1 fragment of pXhoMCl3 described above was ligated into the XhoI site of dll8OXho. Progressive deletions of the 4.2 kb of 5’ flanking DNA were gener- ated using XhoI (at -4.2 kb) in conjunction with NsiI (-3.3 kb), StuI partial (-2.5 kb, -200 pb, -140 bp), EcoRV (-1.6 kb), and EcoRI partial (-378 bp). All distances are relative to the translation initiation site. When isolating the -200 bp and -140 bp StuI deletions, a spontaneous deletion at -115 bp was isolated where there was no StuI site. Using similar construc- tions, a cDNA insert containing the SV40 polyadenylation sequences was also subcloned into dl180. This construct begins at -26 bp relative to the ATG.

Transfection of COS-7 Cells

COS-7 cells (Gluzman, 1981) were split 12 h prior to transfection into 60-mm culture dishes so that the cells were about 60-70% confluent at the start of transfection. Transfection was carried out as described previously (Oshima et al., 1988). The cells were harvested 72 h after the start of transfection.

Determination of &Glucuronidase Specific Activity

Each 60-mm plate of transfected cells (about 5 x 10’ cells) was solubilized in 1 ml of 0.5% sodium deoxycholate 72 h after transfection. Determination of P-glucuronidase activity (Fisher et at., 1980a,b) and protein concentrations (Lowry et al., 1951) were made for each sample to calculate specific activities. fl-Gluc- uronidase enzyme activity units are nanomoles of substrate hydrolyzed per hour. E. coli @-glucuronidase activity was also determined using a 4-methylumbel- liferyl substrate.

Southern Blotting and Dot Blots

d1180 and the various @-glucuronidase deletion constructs were used to transfect COS-7 cells at a concentration of 0.05 pmol/ml. Plasmid DNA was isolated from each plate as previously described (Hirt, 1967), and l/60 of the recovered plasmid from each sample was cut with EcoRI, separated on a 1% agarose gel, and blotted to nitrocellulose using standard methods (Sambrook et al., 1989). This blot was probed using the parent vector dl180 which had been labeled by random priming (Boehringer Mannheim Biochemicals) to a specific activity of 5 X 10’ cpm/pg. The same amount of plasmid from each sample was used for dot blot analysis to estimate copy number

and compare replication efficiencies of the various plasmids.

Sl Nuclease Protection Assays

COS-7 cells were transfected with the various deletion constructs described above at a concentration of 0.05 pmol/ml. Total RNA was harvested 72 h after transfection using RNAzol (Cinna/Biotecx). The method of Han et al. (1987) was used to isolate RNA from human placenta and from tissues from MPS VII mice, some of which contained the human transgene (Kyle et al., 1990). Sl nuclease protection experiments were carried out using single-stranded DNA probes as described (Sambrook et al, 1989). Probe 58 is a 454-nucleotide p-glucuronidase-specific probe whose 5’ and 3’ termini are located respectively at nucleotides 124 and -330 relative to the translation start site. Hybridizations were at 50°C for 16 h using 80,000 cpm of probe 58 while Sl nuclease digestions were at room temperature for 1 h at a final concentration of 1000 units/ml. Two hundred micrograms of total cellular RNA was used in Sl experiments, with the exception of mouse kidney RNA and transfected COS cell RNA, where 50 and 5 pg were used, respectively. The products of the reaction were ethanol pre- cipitated with 20 pg of carrier tRNA and sized on a 6% polyacrylamide/7 M urea gel against a DNA sequencing ladder of known size.

RESULTS

Sequence of the /3-Glucuronidase 5’ Regulatory Region

Figure 1 presents a restriction map and the strategy employed in sequencing 4.2 kb of the 5’ sequence flanking the coding region of the human /3-glucuronidase gene. The 5’ flanking sequence, 100% of which was determined in both strands, is shown in Fig. 2. Two features of this sequence deserve comment. First, the distal portion contains seven copies of the moderately repetitive AZu element that account for over 50% of the entire 4.2 kb of 5’ flanking sequence. The positions and orientations of the AZu elements are indicated in Figs. 1 and 2. Second, the proximal portion has many properties described for promoters of “housekeeping genes” (Dynan, 1986a). The 200 bp immediately 5’ to the initiator methionine are 72% G + C and contain two potential binding sites for the transcription factor Spl (Dynan and Tjian, 1983). This same 200-bp region contains no TATA and CAAT box elements. When present, the TATA box is usually located 25-30 bp 5’ to the start of transcription initiation, while the CAAT box generally resides less than 100 bp 5’ to this site (Breathnach and Chambon, 1981). Promoters containing this combination of a high G + C content and no apparent TATA

1012 SHIPLEY ET AL.

Alu I- F- -I -+-I -+

FIG. 1. Sequencing strategy for the 5’ flanking region of the human @glucuronidase gene. B&XI (X), BamHI (B), SphI (S), HindI (H), PstI (P), EcoRI (E), and KpnI (K) restriction sites were used for the subcloning of fragments into Ml3 for sequencing. The position and orientation of individual sequencing runs are indicated by arrows. The coding region is shown by a solid box. Cosmid vector sequences are indicated by the hatched box. The position and transcriptional orientation of Ah repetitive elements are shown at the bottom by arrows.

box are found in genes referred to as “housekeeping genes,” which encode enzymes expressed in many tissues that perform essential metabolic functions.

The 400 bp of sequence immediately upstream of the /3-glucuronidase coding region was searched for other transcription factor binding sites (Jones et al., 1988). The only site identified is a potential binding site for the transcription factor AP2 at position -198. However, the sequence immediately downstream of the ATG contains three more potential Spl sites, two of which are located in the first exon and the other in the 5’ portion of the first intron.

5’ End Alignment of Human and Murine /I-Glucuronidase Genes

The 4.2 kb of 5’ sequence of the human &glucuronidase gene was compared by dot matrix analysis (data not shown) with the 2 kb available from the mouse gene (D’Amore et al., 1988). The two genes, which are similar through the coding and splice donor and ac- ceptor regions (Miller et aZ., 1990), share little similarity 5’ to the ATG except for a 28-bp region of high similarity beginning at -130 relative to the ATG of the human gene (Fig. 3). Unlike the human gene, murine P-glucuronidase contains a putative TATA box located 28 bp 5’ to the site of transcription initiation and contains no upstream Spl binding sites.

Activity of Promoter Deletion Constructs

The 4.2 kb of 5’ flanking sequence provided promoter activity in rat XC cells transfected with the cosmid clone for human P-glucuronidase (Miller et al., 1990). A 22-kb fragment derived from this cosmid

containing 1.6 kb of 5’ flanking sequence gave high- level expression in several transgenic founder animals, one of which transmitted the expressing human gene to progeny (Kyle et al, 1990). To estimate the minimal amount of 5’ sequence required for promoter activity, a series of minigene deletion constructs was prepared and studied for express in COS cells. The vector used was dl180, an SV40-derived vector reported to lack the viral transcriptional promoters (Learned et aZ., 1981). It contains the minimal 85 bp of SV40 origin of replication sequence necessary for replication in COS cells.

The constructs studied are presented in Fig. 4. Data from experiments in which deletion constructs were used to transfect COS-7 cells are summarized in Ta- ble 1. To normalize the /3-glucuronidase levels for varying transfection efficiencies between plates, the deletion constructs were cotransfected with pCHll0 (Pharmacia), a plasmid that expresses E. coli &galactosidase. When assayed at pH 7.4, we could detect no @-galactosidase background activity from endogenous COS cell enzyme. The activity from each construct is expressed in Table 1 as a ratio of &glucuronidase/& galactosidase. Using this system, only 200 bp of 5’ sequence proved necessary to promote levels of activity comparable to those seen with 4.2 kb. Partial loss of promoter activity was seen in constructs containing only 140 and 115 bp of 5’ flanking sequence. The cDNA construct containing only 26 bp 5’ to the ATG gave no more activity than vector-only controls (dl180). To verify that differences seen were not due to varying levels of amplification of constructs in COS cells, a Southern blot was done on plasmid DNA isolated from Hirt lysates of transfected cells (data

-4253

-4103

-3953

-3803

-3653

-3503

-3353

-3203

-3053

-2903

-2753

-2603

-2453

-2303

-2153

-2003

-1853

-1703

-1553

-1403

-1253

-1103

-953

-803

-653

-503

-353

-203

-53

+97

FIG. 2. elements are shown by arrows above the DNA sequence. The translated peptide sequence is shown below the DNA sequence, and the position of the ATG encoding the initiator methionine is indicated as +l. Potential binding sites for the transcription factor Spl are underlined. Transcription initiation sites are indicated by asterisks. The annealing site in exon 1 for oligonucleotide 58 used in Sl nuclease and primer extension experiments is shown by an arrow below the sequence.

1014 SHIPLEY ET AL.

AP2 -182 AGACCTCGCCCTTATCGGCTGGGGCTGAGGGTGAGGGTCCGCCTGGGGTTCCAGCCA

SPl CGAAGCCCTACCGGGAGCGCCCGGCC~CTCCAGGCCT~~CTCGT------------------------

. . . . . . . . . . . . . . . . TCAnGCGACTT~CTCTTTCTG~A~AGTrCAGCCTTGGGGCGCG

SPl GCGGTTGCCTG~CGCTCGGGCCGTTGTTGTGGGGCTGCGCGCTGGGGCTG

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . AGTbCGTGT~GG;;TCGC;~~G~~C~A~C~~C~~~~~GCTGCGCGCTGGCT~~~~~~~~~~~~T~~~G

SPl . rr

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . AAGGAGAGCCCGTCGCGGGAGCTCAAGGCGCTGGCGGACCCGG

~1ntron 1 240 CGCCGGGGCTTCGAGGAGCAGTGGTACCGGCGGCCGCTGTGGGAGGTGC~TCTCGGGGCAGGGCCGGGACGGCC

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

!-+1ntron 1

FIG. 3. Alignment of the proximal 5’ flanking region and exon 1 of human and murine &glucuronidase. Human (top) and murine (bottom) fl-glucuronidases were aligned using the algorithm of Wilbur and Lipman (46). Identical residues are shown by dots. Gaps are indicated by dashes. Numbering of the human gene relative to the ATG is shown. Potential binding sites for the SPl and AP2 transcription factors are indicated above the human and below the murine sequence. The ATG’s for both genes are boxed, as well as the 23bp region of high identity upstream of the coding sequence. The position of the first intron for each gene is indicated by an arrow. Transcription initiation sites are shown by asterisks above the human and below the murine gene. The putative TATA element of murine fl-glucuronidase is indicated below the sequence as TATAA.

not shown). All constructs appeared to be replicated which is within one order of magnitude of what others to comparable levels. From dot blot experiments, have reported for amplication of plasmids containing which confirmed the conclusion from the Southern the SV40 origin of replication in COS cells (Mellon et blots, we estimated 170,000 copies of plasmid/cell, al., 1981).

kb -4 -3 -2 -1 0 1 2 I I I I I I I

5 AG 3

dl42kb dl-3.3kb

dl-2.5kb dl-1.6kh

dl-376bp- dl-200bp-

dl-140bp- dl -115bp-

dl-26bp-

FIG. 4. Construction of 8-glucuronidase minigene deletion constructs. Minigenes were constructed by fusing the 4.2 kb of upstream sequence to the fl-glucuronidase cDNA (hatched box) as described under Materials and Methods in the vector dl130. The SV40 sequences for polyadenylation are indicated. The XhoI, NsiI, StuI, EcoRV, and EcoRI restriction sites used for constructing these deletions are shown. The single asterisk denotes the site of a spontaneous deletion at -115. The double asterisk represents the 5’ end of a previously isolated cDNA which occurs 26 bp upstream of the ATG (shown by an arrow). The bold region in the vector denotes SV40 origin of replication sequences.

HUMAN @-GLUCURONIDASE 5’ FLANKING REGION 1015

TABLE 1

Relative Expression of &Glucuronidase Deletion Constructs

Construct GUS/GAL GUS/GAL minus Relative

(F k a) vector-only %

dl-4.2kb 0.847 iz 0.010 0.628 100 dl-3.3kb 0.833 +- 0.013 0.614 98 dl-2.5kb 0.719 & 0.004 0.500 80 dl-1.6kb 0.813 & 0.012 0.594 95 dl-378bp 1.030 * 0.012 0.811 129 dl-200bp 0.821 rt 0.018 0.602 96 dl-14Obp 0.750 * 0.010 0.531 85 dl-115bp 0.680 f 0.019 0.461 73 dl-26bp 0.211 + 0.017 0 0 dl180 (vector-only) 0.219 * 0.012 - -

Note. One-tenth picomole of each 5’ deletion construct was cotransfected with 0.02 of the Escherichia coli fl-galactosidase expression vector pCH110. P-Glucuronidase and /3-galactosidase activities were determined as described under Materials and Meth- ods and are expressed here as a glucuronidase/galactosidase (GUS/GAL) ratio. The means and standard deviations were determined from three plates for each sample. The relative &glucuronidase expression levels for each construct are calculated as a per- centage of the largest construct (dl-4.2 kb) after normalizing the transfection efficiency (to pCH110) and subtracting the endogenous background (d1180 vector-only control).

Identification of Transcription Initiation Sites

Sl nuclease protection assays were done to determine the transcriptional start site(s) of the human ,&glucuronidase gene (Fig. 5). An antisense probe whose 5’ terminus hybridizes to &glucuronidase sequences in exon 1 was used in these experiments. A cluster of initiation sites in the region of -27 to -43 is seen in human placenta, HeLa cells, 293 transformed human embryonal kidney cells, and transgenic mouse kidney and liver. The most prominent site is located at -30. Heterogeneity of transcription initiation sites has been reported for many housekeeping genes (Melton et al., 1986; Pate1 et al., 1986; Dynan et al., 1986b; Mitchell et al., 1986; Ishii et al., 1985a; Ishii et al., 1985b, Hoffman et al., 1987; Reynolds et al., 1984; Singer-Sam et al., 1984).

In RNA from 293 transformed human embryonal kidney cells, a second start site, representing only 1% of the @-glucuronidase RNA, was detected at position -126 (Fig. 5A). This transcript represents 15% of the total P-glucuronidase RNA in transfected COS cells (data not shown). However, it was not detected in HeLa, human placenta, or transgenic mouse tissues. Thus, its presence in nontransformed cells has not been established. The differences in the relative levels of this transcript between transfected COS cells and 293 cells may be an artifact related to amplification of the template in COS cells.

Sl nuclease and primer extension analysis were also done on RNA isolated from COS cells transfected with the deletion constructs described above (data not shown). Relative levels of &glucuronidase RNA between constructs correlated well with the expression data shown in Table 1. Specifically, the 15% loss of activity in the dl-140bp construct (Table 1) corre- lates with the loss of the -126 start site, which ac- counts for 15% of the j3-glucuronidase RNA in transfected COS cells. Transcription from this site is restored in the dl-200bp construct, indicating that the region between -140 and -200 (which contains one potential Spl site) is necessary for transcription initiation at -126. Transcription initiation in the cluster surrounding -30 is seen in the dl-115bp construct, indicating that 115 bp of 5’ sequence is all that is required for the majority of promoter activity in transfected COS cells.

DISCUSSION

We report here an analysis of the upstream sequence required for expression of the human @-glucuronidase gene. The 200 bp immediately upstream of the translation initiation site have a 72% G + C content, lack a conventional TATA and CAAT box, and contain potential binding sites for the transcription factors Spl and AP2. Several genes whose 5’ flanking sequences exhibit most of these characteristics have been described (Melton et al, 1986; Pate1 et al., 1986; Dynan et al., 1986b; Mitchell et al., 1986; Ishii et al., 1985a,b; Hoffman et al., 1987; Reynolds et aZ., 1984; Singer-Sam et al., 1984; Valerio et al., 1985; Dush et al., 1985; Chen et al., 1984; Broderick et al., 1987). The products of these “housekeeping” genes perform essential metabolic functions and show wide tissue distribution (Dynan, 1986a). As is true for many of these genes, transcription initiation occurs from multiple sites (in this case from a cluster around -30) rather than from one distinct site.

Several deletions of the 5’ flanking sequence were constructed to determine the minimal length of 5’ regulatory sequence necessary for expression of p-glucuronidase. Transfection experiments showed that no more than 200 bp of 5’ sequence is necessary for expression of human P-glucuronidase activity.

Transcriptional start sites were found in two regions, between -27 to -43 and at -126. The sequence directly surrounding both transcription start sites shows some similarity to the recently described “initiator” promoter element (Smale and Baltimore, 1989). This 17-bp element was described in the mouse terminal deoxynucleotidyltransferase (TdT) gene. It contained the site of transcription initiation and mediated basal level transcription of this gene in the ab- sence of upstream promoter elements. The same

1016 SHIPLEY ET AL.

C

12345

FIG. 6. Sl nuclease protection analysis on human P-glucuronidase RNA. Sl nuclease protection assays were done as described under Materials and Methods using probe 58. (A) Probe 58 is shown prior to Sl nuclease treatment (lane 1). Sl-treated samples include 200 fig tRNA (lane 2), 200 pg HeLa RNA (lane 3), and 200 pg RNA from 293 transformed human embryo& kidney cells (lane 4). (B) Sl-treated samples include 200 pg tRNA (lane l), 200 pg human placental RNA (lane 2), and 200 pg HeLa RNA (lane 3). (C) Sl-treated samples include 200 pg tRNA (lane l), murine MPS VII RNA from kidney (50 pg, lane 2) and liver (200 ng, lane 3), and human o-glucuronidase transgenic mouse kidney (50 pg, lane 4) and liver (200 fig, lane 6) RNA.

study identified a similar 17-bp element surrounding the start site in the adenovirus major late (AdML) promoter. The similarity of the initiator-like elements in J?-glucuronidase to those of TdT and AdML is shown in Fig. 6. The sequence surrounding -126 shares identity with 9 of 17 bp of the TdT and AdML initiators, including a 7-base stretch containing the initiation site with AdML. The sequence surrounding -30 shares 8 of 17 bp with the TdT initiator and 7 of 17 bp with the AdML initiator. As in the TdT gene,

Promoter 5' GCCCTCZCTGGAGAC

3' TdT AdML .T.....C...CCTCGG IS-Glucuronidase -126 .T.....AC.AA..TGG 8-Glucuronidase -30 CG..G..GA.G.TGGC.

FIG. 6. “Initiator-like” promoter elements in fl-glucuronidase. Sequence similarities between the @-glucuronidase -126 and -30 regions with the 17-bp initiator promoter elements of the terminal deoxynucleotidyltransferase (TdT) and adenovirus major late (AdML) promoters are shown. Bases identical to those of TdT are indicated by dots. The site of transcription initiation is shown by an asterisk.

the sequence immediately upstream of the D-glucuronidase start sites contains no TATA box.

These two genes have several differences as well. The sequence upstream of the P-glucuronidase coding region is G + C rich, whereas the corresponding sequence of the TdT gene is not. In addition, this region of the TdT gene contains no binding sites for the transcription factor Spl, while the fl-glucuronidase gene contains two potential Spl binding sites between -200 and +l. Smale and Baltimore (1989) reported that transcription from the TdT initiator could be activated by insertion of Spl binding sites upstream of the initiator. Activation was first observed when the Spl site was placed 24 bp upstream of the initiator, while maximal activation was observed when this Spl site was 40-50 bp upstream. Interest- ingly, the potential Spl sites in @-glucuronidase are located 39 and 29 bp upstream of the -30 and -126 initiator-like elements, respectively. Another differ- ence between the two genes is that 8-glucuronidase is expressed constitutively in most tissues, while TdT expression varies during differentiation and is active

HUMAN @GLUCURONIDASE 5’ FLANKING REGION 1017

only in pre-B and pre-T lymphocytes. The TdT and AdML initiators were shown to function in the ab- sence of known upstream regulatory elements. This is not the case for the sequence surrounding -126 in P-glucuronidase, as the construct containing 140 bp of 5’ sequence did not give rise to transcripts originating from the -126 start site (data not shown). Transcrip- tion from this site can be restored by including sequences between -140 and -200.

The data suggest that the human /3-glucuronidase gene may contain two types of promoters. The major one promotes transcription from a cluster of start sites around -30, has the characteristics of a housekeeping promoter, and is active in all tissues examined. Sl nuclease analysis on RNA prepared from nontransfected cells demonstrated a very low level of transcription from a second start site (-126) in 293 transformed human embryonal kidney cells. Tran- scription initiation from this site was also seen in transfected COS cells, another kidney-derived line. Thus, this transcript might be cell-specific. However, it was not seen in kidneys of mice expressing the human transgene. Nor was it seen in HeLa cells or human placenta. Thus, this start site has not been seen in any nontransformed cell line or tissue.

Transcription of the human and mouse genes is clearly regulated differently. The human gene contains a potential Spl binding site upstream of both the major and the minor transcription initiation sites and no TATA box, while the mouse gene contains a TATA box 28 bp upstream of the RNA cap site and no upstream Spl binding sites. Neither gene appears to contain a proximal CAAT box element. Both promoters share a high degree of identity over a 2%bp region surrounding the upstream minor human transcription initiation site (Fig. 3). The meaning of this region of similarity is not yet clear. Transcripts originating from this site in the murine @-glucuronidase gene have not been noted in the two cases where the murine transcription start site was determined (Fun- kenstein et al., 1963; D’Amore et al., 1988). In both cases the source of the RNA used in these experiments was mouse kidney.

Certain murine P-glucuronidase alleles have been shown to be androgen responsive in mouse kidney, though the putative androgen response element in these alleles has not been localized. The transgenic mouse expressing the human p-glucuronidase gene provides the opportunity to determine whether the human gene also contains an androgen response element. If it does, the deletion constructs described here might help to localize this element.

The high density of Ah sequences in the 5’ flanking region is striking. It has been estimated that the human haploid genome contains 500,000 copies of this 300-bp element (Schmid and Jelinek, 1982). If distrib-

uted randomly, these Ah elements would occur every 5 kb. The density of Ah elements in the P-glucuronidase 5’ flanking region is more than eightfold higher than the genomic average. Thus, the /%glucuronidase locus could represent a potential hotspot for recombi- nation between Alu elements. Another lysosomal enzyme gene, the HEX B gene of @-hexosaminidase, has recently been shown to be rich in Ah elements. Re- combination between Alus in the 5’ flanking region and fifth intron of this gene has been shown to give rise to a mutant allele of HEX B in Sandhoff disease (Neote et al., 1990). Mutant /3-glucuronidase alleles of this type have not yet been identified.

1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

REFERENCES

BIRKENMEIER, E. H., DAVISSON, M. T., BEAMER, W. G., GANSCHOW, R. E., VOGLER, C., GWYNN, B., LYFORD, K. A., MALTAIS, L. M., AND WAWFUYNIAK, C. J. (1989). Murine mucopolysaccharidosis type VII: Characterization of a mouse with fl-glucuronidase deficiency. J. Clin. Invest. 83: 125% 1266. BREATHNACH, R., AND CHAMBON, P. (1981). Organization and expression of eucaryotic split genes coding for proteins. Annu. Rev. B&hem. 50: 349-383.

BRODERICK, T. P., SCHAFF, D. A., BERTINO, A. M., DUSH, M. K., TISCHFIELD, J. A., AND STAMBROOK, P. J. (1987). Com- parative anatomy of the human APRT gene and enzyme: Nu- cleotide sequence divergence and conservation of a nonran- dom CpG dinucleotide arrangement. Proc. Natl. Acad. Sci. USA 84,3349-3353.

CHEN, M.-Y., SHIMADA, T., MOULTON, A. D., CLINF,, A., HUMPHRIES, R. K., MAIZEL, J., AND NIEHUIS, A. W. (1984). The functional human dihydrofolate reductase gene. J. Bid. Chem. 269: 3933-3943.

D’AMORE, M. A., GALLAGHER, P. M., KORFHAGEN, T. R., AND GANSCHOW, R. E. (1988). The complete sequence and organization of the murine fl-glucuronidase gene. Biochemistry 27: 7131-7140. DUSH, M. K., SIKELA, J. M., KHAN, S. A., TISCHFIELD, J. A., AND STAMBROOK, P. J. (1985). Nucleotide sequence and organization of the mouse adenine phosphoribosyltransferase gene: Presence of a coding region common to animal and bac- terial phosphoribosyltransferases that has a variable intron/ exon arrangement. Proc. Natl. Acad. Ski. USA 82: 2731-2735. DYNAN, W. S., AND TJIAN, R. (1983). The promoter-specific transcription factor Spl binds to upstream sequences in the SV40 early promoter. Cell 36: 79-87. DYNAN, W. S. (1986a). Promoters for housekeeping genes. Trends Genet. 2: 196-197. DYNAN, W. S., SAZER, S., TJIAN, R., AND SCHIMKE, R. T. (1986b). Transcription factor Spl recognizes a DNA sequence in the mouse dihydrofolate reductase promoter. Na- ture 319: 246-248.

FISCHER, H. D., GONZALEZ-NORIEGA, A., AND SLY, W. S. (1980a). @-Glucuronidase binding to human fibroblast mem- brane receptors. J. Biol. Chem. 265: 5069-5074.

FISCHER, H. D., GONZALEZ-NOFUEGA, A., SLY, W. S., AND MORRE, D. J. (198Ob). Phosphomannosyl-enzyme receptors in rat liver: Subcellular distribution and role in intracellular transport of lysosomal enzymes. J. Bid. Cbem. 266: 9608- 9615. FUNKENSTEIN, B., LEARY, S. L., STEIN, J. C., AND CA~R-

1018 SHIPLEY ET AL.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

ALL, J. F. (1988). Genomic organization and sequence of the Gus-s” allele of the murine @-glucuronidase gene. Mol. Cell. Biol. 8: 1160-1168.

GLUZMAN, Y. (1981). SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23: 175-182.

HAN, J. H., STRATOWA, C., AND RUITER, W. J. (1987). Isola- tion of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning. Biochemistry 26: 1617-1625.

HIRT, B. (1967). Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26: 365-369.

HOFFMAN, E. K., TRUSKO, S. P., FREEMAN, N., AND GEORGE, D. L. (1987). Structural and functional characterization of the promoter region of the mouse c-Ki-ras gene. Mol. Cell. Biol. ‘7: 2592-2596.

ISHII, S., Xv, Y.-H., STRATTON, R. H., ROE, B. A., MERLINO, G. T., AND PASTAN, I. (1985a). Characterization and sequence of the promoter region of the human epidermal growth factor receptor gene. Proc. Natl. Acad. Sci. USA 82: 4920-4924.

ISHII, S., MERLINO, G. T., AND PASTAN, I. (1985b). Promoter region of the Harvey ras proto-oncogene: Similarity to the EGF receptor proto-oncogene promoter. Science 230: 1378- 1381.

JONES, N. C., RIGBY, P. W. J., AND ZIFF, E. B. (1988). Tran.s- acting protein factors and the regulation of eukaryotic transcription: Lessons from studies on DNA tumor viruses. Genes Dev. 2: 267-281.

KAPLAN, A., ACHORD, D. T., AND SLY, W. S. (1977). Phospho- mannosyl components of a lysosomal enzyme are recognized by pinocytosis receptors on human fibroblasts. Proc. Natl. Acad. Sci. USA 74: 2026-2030.

KYLE, J. W., BIRKENMEIER, E. H., GWYNN, B., VOGLER, C., HOPPE, P. C., HOFFMAN, J. W., AND SLY, W. S. (1990). Correc- tion of murine mucopolysaccharidosis VII by a human p-glucuronidase transgene. Proc. Natl. Acad. Sci. USA 87: 3914- 3918.

LAU, Y.-F., AND KAN, Y. W. (1983). Versatile cosmid vectors for the isolation, expression, and rescue of gene sequences: Studies with the human a-globin gene cluster. Proc. Natl. Acad. Sci. USA 80: 5225-5229.

LAU, Y.-F., AND KAN, Y. W. (1984). Direct isolation of the functional human thymidine kinase gene with a cosmid shut- tle vector. Proc. Natl. Acad. Sci. USA 81: 414-418.

LEARNED, R. M., MYERS, R. M., AND TJIAN, R. (1981). Repli- cation in monkey cells of plasmid DNA containing the minimal SV40 origin. In “ICN-UCLA Symposia on Molecular and Cellular Biology” (D. S. Ray and C. F. Fox, Eds.), Vol. 21, pp. 555-566, Academic Press, New York.

LOWRY, 0. H., ROSEBROUGH, N. J., FARR, A. L., AND RAN- DALL, R. J. (1951). Protein measurement with the Folin phenol reagent. J. Biol. C&m. 193: 265-275.

MELLON, P., PARKER, V., GLUZMAN, Y., AND MANIATIS, T. (1981). Identification of DNA sequences required for transcription of the human al-globin gene in a new SV40 host- vector system. Cell 27: 279-288.

MELMN, D. W., MCEWAN, C., MCKIE, A. B., AND REID, A. R. (1986). Expression of the mouse HPRT gene: Deletional analysis of the promoter region of an X-chromosome linked housekeeping gene. Cell 44: 319-328.

MESSING, J. (1983). New Ml3 vectors for cloning. In “Meth- ods in Enzymology” (R. Wu, L. Grossman, and K. Moldave, Eds.), Vol. 101, pp. 20-78, Academic Press, New York.

MILLER, R. D., HOFFMAN, J. W., POWELL, P. P., KYLE, J. W., SHIPLEY, J. M., BACHINSKY, D. R., AND SLY, W. S. (1990). Cloning and characterization of the human P-glucuronidase gene. Getwmics ‘7: 280-283.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

MITCHELL, P. J., CAROTHERS, A. M., HAN, J. H., HA~NG, J. D., KAS, E., VENOLIA, L., AND CHASIN, L. A. (1986). Multi- ple transcription start sites, DNase I-hypersensitive sites, and an opposite-strand exon in the 5’ region of the CHO dhfr gene. Mol. Cell. Biol. 6: 425-440.

NATOWICZ, M. R., CHI, M. M.-Y., LOWRY, 0. H., AND SLY, W. S. (1979). Enzymatic identification of mannose-6-phosphate on the recognition marker for receptor-mediated pinocytosis of P-glucuronidase by human fibroblasts. Proc. Natl. Acad. Sci. USA 76,4322-4326.

NEOTE, K., MCINNES, B., MAHURAN, D. J., AND GRAVEL, R. A. (1990). Structure and distribution of an Alu-type deletion mutation in Sandhoff disease. J. Clin. Invest. 86: 1524-

1531.

OSHIMA, A., KYLE, J. W., MILLER, R. D., HOFFMAN, J. W., POWELL, P. P., GRUBB, J. H., SLY, W. S., TROPAK, M., GUISE, K. S., AND GRAVEL, R. A. (1987). Cloning, sequencing, and expression of cDNA for human @glucuronidase. Proc. Natl.

Acad. Sci. USA 84: 685-689.

OSHIMA, A., NOLAN, C. M., KYLE, J. W., GRUBB, J. H., AND SLY, W. S. (1988). The human cation-independent mannose- B-phosphate receptor. J. Biol. Chem. 263: 2553-2562.

PATEL, P. I., FRAMSON, P. E., CASKEY, C. T., AND CHINAULT, A. C. (1986). Fine structure of the human hypoxanthine phosphoribosyltransferase gene. Mol. Cell. Biol. 6: 393-403.

REYNOLDS, G. A., BASU, S. K., OSBORNE, T. F., CHIN, D. J., GIL, G., BROWN, M. S., GOLDSTEIN, J. L., AND LUSKEY, K. L. (1984). HMG CoA reductase: A negatively regulated gene with unusual promoter and 5’ untranslated regions. Cell 38: 275-285.

SAMBROOK, J., FRITSCH, E. F., AND MANIATIS, T. (1989). In “Molecular Cloning: A Laboratory Manual,” 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

SANGER, F., NICKLEN, S., AND COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467.

SCHMID, C. W., AND JELINEK, W. R. (1982). The Ah family of dispersed repetitive sequences. Science 216: 1065-1070.

SINGER-SAM, J., KEITH, D. H., TANI, K., SIMMER, R. L., SHIVELY, L., LINDSAY, S., YOSHIDA, A., AND RIGGS, A. D. (1984). Sequence of the promoter region of the gene for human X-linked 3-phosphoglycerate kinase. Gene 32: 409-417.

SMALE, S. T., AND BALTIMORE, D. (1989). The “initiator” as a transcriptional control element. Cell 57: 103-113.

SLY, W. S., QUINTON, B. A., MCALISTER, W. H., AND RIMOIN, D. L. (1973). j3-Glucuronidase deficiency: Report of clinical, radiologic, and biochemical features of a new mucopolysaccharidosis. J. Pediatr. 82: 249-257.

STRAUSS, E. C., KOBORI, J. A., Sru, G., AND Hook, L. E. (1986). Specific-primer-directed DNA sequencing. Anal. Bio- them. 164: 353-360.

VALERIO, D., DWVESTEYN, M. G. C., DEKKER, B. M. M., WEEDA, G., BERKVENS, TH. M., VAN DER VOORN, L., VAN O~ONDT, H., AND VAN DER EB, A. J. (1985). Adenosine de- aminase: Characterization and expression of a gene with a remarkable promoter. EMZ30 J. 4: 437-443.

VOGLER, C., BIRKENMEIER, E. H., SLY, W. S., LEW, B., PEG- ORS, C., KYLE, J. W., AND BEAMER, W. G. (1990). A murine model of mucopolysaccharidosis VII: Gross and microscopic findings in fl-glucuronidase deficient mice. Am. J. Path&. 138: 207-216.

WILBUR, W. J., AND LIPMAN, D. J. (1983). Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA 80: 726-730.

analysis of the 5′ flanking region of the human β-glucuronidase gene

Documents