annals of warsaw university of life sciences – sggw

Annalsof WarsawUniversity

of LifeSciences– SGGWAnimal Science No 57 (4)

Warsaw 2018

Contents

BĄKOWSKI M., KLEBANIUK R., DANEK-MAJEWSKA A., ZASADNA Z., TOM-CZYK-WARUNEK A., KOSIŃSKI J., JA-RZYNA P., KUBACZYŃSKI A., KWIAT-KOWSKA K., BUDZYŃSKA A. Analysisof bone mineralization, osteometric and me-chanical properties in turkey hens at slaugh-ter demonstrates a infl uence of housing sys-tem but not stocking density 315

BRZOZOWSKI M., GOŚ J., DZIER-ŻANOWSKA-GÓRYŃ D. Estimation of the human factor in the form of litter size

regulation for the weaning results in mink 327

FOJUTOWSKA L., SKRZYPCZAK E., SZULC K., LUCIŃSKI P. Sows’ longevity – a case study of a native breed 333

KARPIESIUK K., KOZERA W., BUG-NACKA D., WOŹNIAKOWSKA A., JA-ROCKA B. The effect of partial replacement of soybean meal protein with guar (Cyamop-sis tetragonoloba) meal protein on the cost-effectiveness of pig fattening 341

Ann_Anim_Sci_57_4_2018.indd 311Ann_Anim_Sci_57_4_2018.indd 311 2018-12-10 10:37:152018-12-10 10:37:15

KICZOROWSKA B., KLEBANIUK R., KOWALCZUK-VASILEV E., BĄKOWSKI M., SAMOLIŃSKA W., JARZYNA P.,ZASADNA Z., OLCHA M., KWIECIEŃ M.,WINIARSKA-MIECZAN A., ZAJĄC M., AL-YASIRY A.R.M., DANEK-MAJEWS-KA A. The effi ciency of dairy cattle nutrition on chosen farms of central-eastern Poland 349

MAŚKO M., KRAJEWSKA A., OLECH W. The comparison of Polish HalfBred mares utility based on fi eld performance test result conducted in 2002–2015 357

MIGDAŁ Ł., RADOVIĆ Č., ŽIVKOVIĆ V., GOGIĆ M., MIGDAŁ A., MIGDAŁ W. Characterization of meat traits and fatty ac-ids profi le from Swallow-Belly_Mangalitsa, Moravka pigs and their crossbreeds 365

NOWICKI J., MAŁOPOLSKA M., PABIAŃCZYK M., GODYŃ D., SCHWARZ T., TUZ R. Environmental enrichment

for pigs – practical solutions according to the Commission Recommendation (EU) 2016/336 379

PAWLAK K., SWADŹBA-KARBOWY M. The impact of weather parameters on the mi-croclimate inside the building intended for antelopes 395

PIESZKA M., SZCZUREK P., PIETRAS M., PIESZKA M. SiO2 nanostructures as a feed additive to prevent bacterial infections in piglets 407

TAJCHMAN K., DROZD L. Management of hunting animals population as breeding work Part III: Hunting and breeding work on introduced fauna 419

ŻYCHLIŃSKA-BUCZEK J., BAUER E.,OCHREM A., GIL Z., SOWULSKA--SKRZYŃSKA E. Effect of heat stress ondairy farming at the period of global warming 429


SERIES EDITORIAL BOARD

Editor-in-ChiefAnimal Science series SecretaryAddress of Editorial Offi ce

prof. dr hab. Anna Rekieldr Danuta Dzierżanowska-GóryńWydział Nauk o Zwierzętach SGGWul. Ciszewskiego 8, 02-786 Warszawa, Poland

EDITORS prof. dr hab. Wanda Olech – statistics editorNatalia Filipczak – English language consultant Agata Cienkusz – Polish language consultant

THEME EDITORS dr hab. Elżbieta Michalska – genetics and animal breedingdr hab. Grzegorz Lesiński – biology and ecologydr hab. Iwona Kosieradzka – animal nutrition and feedstuffsdr hab. Tadeusz Kaleta – behaviour and welfare of animalprof. dr hab. Ewa Sawosz – biological engineering of animal dr hab. Ewa Skibniewska – welfare of animaldr hab. Justyna Więcek – animal husbandry and production technologydr hab. Robert Głogowski – animal husbandry and production technology

SERIES EDITOR Anna Rekiel

SERIES EDITORIAL ADVISORY COUNCILProf. DSc. Andrzej Chwalibóg (Denmark)Prof. DSc. Konrad Dąbrowski (USA)Prof. DSc. Ondrey Debréceni (Slovakia)Prof. Ewgienij Dobruk (Belarus)Prof. dr hab. Robert J. Eckert (Poland)Prof. Dr Sophie Ermidou-Pollet (Greece)Prof. dr hab. Grażyna Garbaczewska (Poland)Prof. DSc. Luis L. Gosálvez (Spain)Prof. DSc. Adrian Harrison (Denmark)

Prof. dr hab. Jarosław O. Horbańczuk (Poland)Prof. Dr Drago Kompan (Slovenia)Prof. Dr Sándor Kukovics (Hungary)Prof. Dr Stoycho Metodiev (Bulgarian)Prof. DSc. Francois K. Siebrits (RSA) Prof. dr hab. Jacek Skomiał (Poland)Dr hab. Arkadiusz Terman (Poland)Prof. dr hab. Romuald Zabielski (Poland)

The Editorial Board (Offi ce) of “Annals of Warsaw University of Life Sciences – SGGW. Animal Science” informs that the printed version of the journal is the original version.Redakcja „Annals of Warsaw University of Life Sciences – SGGW. Animal Science” informuje, że wersja drukowana czasopisma jest wersją pierwotną (referencyjną).

Covered in: AGRO, Index Copernicus (2014 – 83.35; 2015 – 78.24), CAB Direct, CEON, ARIANTA, ePNP, PBN, POL-INDEX, POLONBazy: AGRO, Index Copernicus (2014 – 83,35; 2015 – 78,24), CAB Direct, CEON – Biblioteka Nauki, ARIANTA, e-Publikacje Nauki Polskiej, PBN, POL-INDEX, POLON

WARSAW UNIVERSITYOF LIFE SCIENCES PRESS

ISSN 1898-8830

EDITORIAL STAFFAnna Dołomisiewicz PRINT: ZAPOL sp.j., al. Piastów 42,Elżbieta Wojnarowska 71-062 Szczecin


LIST OF REVIEWERS VOL. 57

Adamski Maciej, Babicz Marek, Batkowska Justyna, Batorska Martyna, Biel Wioletta, Bielański Paweł, Bodkowski Robert, Bogucki Mariusz, Boroojeni Farshad Goodarzi, Brzozowski Marian, Bugnacka Dorota, Butrimavičien Laura, Chabuz Witold, Chwalibóg Andre, Ciechanowski Mateusz, Cserkész Tamás, Czech Anna, Czyżowski Piotr, Daszkiewicz Tomasz, Dobrzański Zbigniew, Eckert Robert, Gołębiewski Marcin, Gospodarek Janina, Gryz Jakub, Gugołek Andrzej, Ignatow-icz Stanisław, Janiszewski Paweł, Jaworski Zbigniew, Jeżewska Grażyna, Kaleta Tadeusz, Kasprzyk Anna, Kempe Riitta, Kędzierski Witold, Kiczorowska Bożena, Klebaniuk Renata, Klotz Werner, Klopčič Marija, Kowalska Dorota, Król Jolanta, Kruszewicz Andrzej, Kupczyński Robert, Lipiński Krzysztof, Lisiak Dariusz, Maciorowski Grzegorz, Matusevicius Paulius, Mąkol Joanna, Michalczuk Monika, Mituniewicz Tomasz, Mucha Aurelia, Nawrotek Paweł, Nosal Paweł, Nowakowicz-Dębek Bożena, Nowicki Jacek, Ostaszewska Teresa, Panek Marek, Perzanowski Ka-jetan, Pieszka Magdalena, Pieszka Marek, Pilarczyk Andrzej, Pilarczyk, Bogumiła, Polak Grażyna, Popowska-Nowak Elżbieta, Rehman Habib, Rintelen Kristina von, Rząsa Anna, Sakowski Tomasz, Sawa Anna, Sentandreu Miguel A., Seremak Beata, Siemieniuch Marta, Skrzypczak Ewa, Słupczyńska Maja, Sobek Zbigniew, Sobotka Wiesław, Socha Magdalena, Sokołowicz Zofia, Sporek Kazimierz, Stanisz Marek, Szczerbińska Danuta, Szeleszczuk Olga, Szwaczkowski Tomasz, Szyndler-Nędza Magdalena, Terčič Dušan, Tryjanowski Piotr, Twardoń Jan, Wenk Caspar, Wójcik Anna, Yosef Reuven, Żak Grzegorz


Annals of Warsaw University of Life Sciences – SGGWAnimal Science No 57 (4), 2018: 315–325(Ann. Warsaw Univ. of Life Sci. – SGGW, Anim. Sci. 57 (4), 2018)DOI 10.22630/AAS.2018.57.4.30

Analysis of bone mineralization, osteometric and mechanical properties in turkey hens at slaughter demonstrates a influence of housing system but not stocking density

MACIEJ BĄKOWSKI1, RENATA KLEBANIUK1,ANNA DANEK-MAJEWSKA1, ZWENYSLAVA ZASADNA2,AGNIESZKA TOMCZYK-WARUNEK3, JAKUB KOSIŃSKI4,PIOTR JARZYNA1, ADRIAN KUBACZYŃSKI1,KATARZYNA KWIATKOWSKA1, ALICJA BUDZYŃSKA1

1 Faculty of Biology, Animal Sciences and Bioeconomy, University of Life Sciences in Lublin, 2 The State Scientific Research Control Institute of Veterinary Medicinal Products and Feed Additives in Lviv,

3 Faculty of Veterinary Medicine, University of Life Sciences in Lublin, 4 Chair and Department of Rehabilitation and Orthopaedics, Medical University in Lublin

Abstract: Analysis of bone mineralization, osteo-metric and mechanical properties in turkey hens at slaughter demonstrates a infl uence of housing system but not stocking density. Stocking density and housing system during rearing may nega-tively infl uence skeletal development in poultry. However, in turkeys, the studies about the infl u-ence of those welfare factors on bone develop-ment are extremely limited. It this study, female Big-6 turkeys birds were raised from 7th to 16th week of age indoors (traditional system) or in mixed system where birds were allowed during the day to use veranda at two sticking densities: 3 birds per m2 (33 kg of predicted fi nal body weight per m2 of fl oor space) or 4 birds per m2 (44 kg of predicted fi nal body weight per m2 of fl oor space). The high stocking density signifi cantly decreased only Young modulus of elasticity in tibia, while the positive effect of semi-open housing system was observed in tibia weight, bone mineralization and mechanical endurance, especially in indices describing bone fracture resistance (ultimate load, ultimate train and ultimate stress). Concluding,

results of this experiment suggest that in turkeys bone quality is infl uenced more by housing condi-tions than by stocking density and open and semi-open rearing systems may have benefi cial impact on bone development.

Key words: bone quality, turkey welfare, stocking density, housing system

INTRODUCTION

In modern fast-growing strains of meat poultry selection work and improvement of rearing conditions have resulted in a substantial shortening of the rearing period accompanied by upgrading of the carcass tissue composition. The rate of growth of the muscle tissue has increased more intensively than the rate of growth of other parts of the body. Due to the disproportionate growth of breast


316 M. Bąkowski et al.

muscles, the shift of the bird’s center of gravity towards the front disturbs the anatomically optimal distribution of body weight. Impairment of the functioning of the musculoskeletal system resulting from problems with maintaining balance, insufficient bone tissue growth rate and development induces problems in move-ment and may also lead to bone fracture during catching or transport, creating problems during processing (Rath et al. 2000).

High stocking density during rearing has been identified as one of the welfare factor that may negatively influence skel-etal development in poultry, as shown in meat broiler chickens, slow-growing chickens, and lying hens of different age (Hall 2001, Bradsahw et al. 2002, Buijs et al. 2012). High stocking den-sity affects the birds’ locomotion abil-ity through a higher severity of skeletal problems (Sorensen et al. 2000), includ-ing decreased braking strength of tibia (Škrbić et al. 2009). The high stocking density of growing birds can lead to heat accumulation in poultry house, increas-ing the risk of heat stress and hyperther-mia (Jankowski et al. 2015). High stock-ing density also increases litter moisture, which promotes the prevalence of foot pad dermatitis.

Another factor that could directly affect the birds welfare and skeletal develop-ment is the type of rearing system (Rath et al. 2000). In open or semi-open hous-ing systems birds have more opportuni-ties to perform their natural behaviours because of the access to a more natural environment than in indoor systems (Ekstrand et al. 1997). Another positive aspects of that type of open/semi-open rearing system is the additional space

available to the birds, which could lead to limit the litter moisture in the poul-try house (Bassler et al. 2013). On the other side, in open or semi-open hous-ing systems birds are exposed to adverse weather conditions (wind, sun radiation and rainfall), risk of infection or predator attack (Stadig et al. 2017).

However, in turkeys, the studies about the influence of housing system or stocking density on bone develop-ment are extremely limited. As the bone quality is directly related to the amount bone mineral material, bone spatial structure (geometry and cortical thick-ness) and mechanical strength of bones, the purpose of this study was to inves-tigate the effect of stocking density and housing system, and its interaction, on tibia osteometric properties, densitom-etry, and mechanical strength of tibia in female turkeys.

MATERIAL AND METHODS

Animal breeding and experimental designA total of 144 healthy Big-6 female turkeys were housed indoor during the initial period (up to 7th week of life) under standard turkey rearing condi-tions (litter maintenance system) and air temperature was set at the optimal level depending on the age. The tur-keys had constant access to fresh water and were fed ad libitum with standard feed concentrates (Agropol, Motycz, Poland) for particular rearing periods (Table 1).

After the 7th week of life, the birds were individually weighed, and random-ly allocated to four experimental groups


Analysis of bone mineralization, osteometric and mechanical properties... 317

TABLE 1. Composition and nutritive value of the basal diet

ItemAge of birds (weeks)

1–3 4–6 7–9 10–12 13–16Ingredient (%)

Corn 15.10 15.10 25.00 25.00 25.00Wheat 34.70 37.50 32.16 38.32 44.80Soybean meal1 42.00 39.20 32.70 26.80 20.30Soybean oil 1.50 1.50 3.80 4.00 4.50Phosphate 1-calcium 1.66 1.66 1.46 1.16 0.85Limestone 1.59 1.59 1.40 1.26 1.10Sodium bicarbonate 0.04 0.04 0.04 0.04 0.04Sodium chloride 0.31 0.31 0.31 0.31 0.31Premix vita-min 0.502 0.502 0.503 0.504 0.505

Concentrate protein-fat6 2.00 2.00 2.00 2.00 2.00DL-methionine 99% 0.34 0.34 0.32 0.26 0.25L-lysine-HCl 78% 0.26 0.26 0.26 0.25 0.25L-threonine 99% – – 0.05 0.10 0.10

The nutritional value of 1 kg diet:**Metabolic Energy (kcal·kg−1) 2784 2744 3016 3070 3161*Total protein (%) 27.2 24.81 21.98 20.57 18.50*Crude fiber (%) 2.80 3.24 3.11 3.26 3.26*Crude fat (%) 4.62 5.13 5.78 6.91 7.52*Lysine (%) 1.76 1.53 1.32 1.22 1.12*Methionine + Cysteine (%) 1.12 1.10 0.98 0.91 0.86*Total calcium (%) 1.31 1.15 1.03 0.95 0.83*Total phosphorus (%) 0.92 0.80 0.73 0.67 0.60**Available phosphorus (%) 0.61 0.53 0.47 0.41 0.34**Total calcium/available phosphorus 2.15 2.17 2.19 2.34 2.48

1 46% total protein in dry matter2 content of vitamins and minerals per 1 kg: Mn 60 mg, J 0.80 mg, Fe 50 mg, Cu 10 mg, Se 0.20 mg,

vitamin A 15 000 UI, vitamin D3 3 166 UI, vitamin E 60 UI, vitamin K3 3.5 mg, vitamin B1 2.3 mg, vitamin B2 6.5 mg, vitamin B6 4.2 mg, vitamin B12 10.01 mg, biotin 0.13 mg, folic acid 1.2 mg, nico-tinic acid 30 mg, pantothenic acid 17 mg, choline 40.30 mg;

3,4 content of vitamins and minerals per 1 kg: Mn 60 mg, J 0.80 mg, Fe 50 mg, Cu 10 mg, Se 0.20 mg, vitamin A 14 100 UI, vitamin D3 3 325 UI, vitamin E 40 UI, vitamin K3 2.75 mg, vitamin B1 1.9 mg, vitamin B2 5.5 mg, vitamin B6 3.6 mg, vitamin B12 15.01 μg, biotin 0.11 mg, folic acid 1.00 mg, nico-tinic acid 25 mg, pantothenic acid 14.5 mg, choline 20.00 mg;

5 content of vitamins and minerals per 1 kg: Mn 60 mg, J 0.80 mg, Fe 50 mg, Cu 10 mg, Se 0.20 mg, vitamin A 12 460 UI, vitamin D3 2 995 UI, vitamin E 32 UI, vitamin K3 2.45 mg, vitamin B1 1.74 mg, vitamin B2 5.1 mg, vitamin B6 3.36 mg, vitamin B12 15.00 μg, biotin 0.11 mg, folic acid 0.92 mg, nicotinic acid 23 mg, pantothenic acid 13.5 mg, choline 12.30 mg;

6 concentrate protein-fat: protein – 65%, fat – 15%* analysed values; ** calculated values



(n = 36 in each group) according to the experimental treatment: two indoor groups and two indoor + veranda groups. The birds in indoor groups were kept in indoor throughout the whole rearing period, and the stocking density was set to 3 birds per m2 (33 kg of predicted final body weight per m2 of floor space) in the “indoor 3” group and 4 birds per m2 (44 kg of predicted final body weight per m2 of floor space) in the “indoor 4” group. The birds in the indoor + veranda groups were allowed during the day to use veranda, however birds were confined to indoor pen at night. The stocking density was set to 3 birds per m2 in the “indoor + veranda 3” group and 4 birds per m2 in the “indoor + veranda 4” group. Feed and water also provided outdoors using trough feeders and water pans with res-ervoirs.

In the 16th week of life, 8 birds from each group (n = 32 in total) were random-ly selected, weighted and slaughtered by cutting the carotid arteries. Immediately after slaughter, the tibiae from individual birds were dissected, cleaned from the remnants of adherent tissues, wrapped in gauze soaked in isotonic saline and frozen prior to analysis at a temperature of –25°C.

Bone analysisThe mechanical properties of right tibiae were determined using the three-point bending test on a Zwick Z010 universal testing machine (Zwick-Roell GmbH & Co., Germany) after overnight thawing at room temperature. The bone, placed on the supports with length span equal to 40% of total bone length, was loaded in the anterior-posterior plane with a

displacement rate of 10 mm/min until fracture. Bone structural properties (stiff-ness, yield strength, ultimate strength, elastic energy and work to fracture) were determined on the basis of recorded force-displacement curves. Whole-bone material properties were calculated on the basis of determined structural proper-ties and geometry of the bone diaphysis using engineering beam-theory equations (Muszyński et al. 2017). The ascertained structural properties included: elastic stress, elastic strain, Young modulus, ultimate strain and ultimate stress.

The bone diaphysis cross-sectional geometry was determined on the basis of osteometric measurements performed on the corresponding left tibiae. The measurements included determination of bone weight, length, and both external and internal diameters of the diaphysis cross-section (both in medial-lateral and anterior-posterior plane). The calculated geometric properties were: cortical cross section area, cortical index, mean rela-tive wall thickness, diaphysis volume and the cross-sectional moment of inertia (Muszyński et al. 2017).

After evaluating the osteometric properties, the bones were subjected to the measurement of whole-bone mineral density (BMD) and bone mineral con-tent (BMC). The analysis was performed using the dual-energy X-ray absorpti-ometry (DXA) method on a Discovery W densitometer (Hologic Inc., USA) equipped with a software with a Small Animals Studies option for investigation of bones from various types of animals. Also, the bone weight to length ratio (WLR), as the indicator of whole bone density, was calculated.



Statistical AnalysisThe data were analysed using a 2 × 2 factorial design with the housing system and stocking density as the factors. The interaction between housing system and stocking density was added to the model. An individual animal was considered as the experimental unit. Whenever significant differences were found be-tween treatments (P < 0.05), values were compared by Tukey’s HSD test. Prob-ability values with 0.05 < P < 0.1 were described as trends.

RESULTS

The stocking density or housing system had no effect on birds final body weight (data not shown). The mean body weight in all groups was within the range of 11.0–11.5 kg.

However, there was an effect of housing system on bone length which decreased in birds reared in indoor + veranda system (Table 2). There was also an effect of housing system and stocking density interaction on bone length which decreased in birds reared in indoor at density of 4 birds/m2. The decrease of tibia mean relative wall thickness in birds reared in the indoor + veranda system at lower density can be described as a trend. There was also a strong trend for reduc-tion of diaphysis volume in tibiae of birds reared in greater stocking density. There was an effect of housing system on BMC and BMD, which were greater in tibiae of birds reared in the indoor + veranda system (Table 2). Bone mineral density was also dependent on stocking density (decreased in birds reared at den-sity of 4 birds/m2). No changes in other

osteometric and densitometric properties were observed (Table 2).

Irrespective of stocking density, the indoor + veranda housing system posi-tively influenced ultimate load (increase of approx. 6 10%, Table 4). Similarly, the ultimate strain and ultimate stress were significantly increased in birds from both groups reared in mixed hous-ing system (an increase of 12.8% and 10.1%, respectively). The stocking density influenced the Young modulus, which was increased in groups housed at lower stocking density. There was also a trend in increasing the yield load of bones from birds housed in indoor + veranda system (Table 3). No other changes or trends in tibia mechanical properties were observed.

DISCUSSION

Despite the fact that stocking density has been identified as one of the main factors affecting turkey welfare and growth (Marchewka et al. 2013), to the best of our knowledge, only one study on the effect of stocking density on bone quality have been conducted previously (Jankowski et al. 2015). Similarly, there is only one previous study, where the effect of housing system on the growth and mechanical strength of bones in turkeys was analyzed (Burs et al. 2008).

In our study, high stocking density negatively influenced bone length in birds reared in indoor system, not affect-ing the bone weight. Also in both hous-ing systems increased stocking density led to (a strong tendency for) reduction of bone diaphysis volume and had a negative effect on bone mineral den-


TAB

LE 2

. The

effe

ct o

f hou

sing

syst

em a

nd st

ocki

ng d

ensi

ty o

n tib

ia o

steo

met

ric a

nd d

ensi

tom

etric

pro

perti

es in

16-

wee

ks-o

ld fe

mal

e tu

rkey

s

Gro

up

Ost

eom

etric

pro

perti

esD

ensi

tom

etric

pro

perti

es

Bon

e w

eigh

t (g

)B

one

leng

th

(mm

)

Cro

ss se

ctio

n ar

ea (m

m2)

MRW

TC

ortic

al

inde

x (%

)

Dia

phys

is

volu

me

(cm

3 )

Mom

ent o

f in

ertia

(mm

4 )W

LR g

/mm

BM

C

(g)

BM

D

(g/c

m2 )

indo

or 3

78.5

±7.

320

2b ±5.

476

.7 ±

11.3

0.69

1 ±0

.135

27.3

±6.

96.

22 ±

1.68

1059

±20

90.

377

±0.0

357.

81 ±

1.07

0.27

3 ±0

.043

indo

or 4

78.6

±6.

519

7a ±3.

076

.7 ±

7.2

0.67

8 ±0

.095

29.6

±3.

15.

95 ±

0.81

1046

±28

00.

381

±0.0

487.

70 ±

0.70

0.25

4 ±0

.027

indo

or +

ve

rand

a 3

75.1

±10

.419

9b ±4.

477

.9 ±

9.2

0.59

4 ±0

.179

27.1

±5.

36.

46 ±

1.31

950

±145

0.38

3 ±0

.044

9.06

±0.

820.

299

±0.0

24

indo

or +

ve

rand

a 4

76.6

±6.

520

0b ±3

.675

.7 ±

9.3

0.69

3 ±0

.164

31.1

±6.

15.

85 ±

0.95

911

±110

0.34

0 ±0

.034

8.52

±1.

450.

279

±0.0

32

Sign

ifica

nce

P-va

lue

hous

ing

syst

em0.

033

0.52

80.

863

0.44

80.

733

0.13

80.

250

0.24

00.

010

0.04

6

stoc

king

de

nsity

0.93

40.

030

0.56

60.

426

0.12

30.

051

0.84

00.

194

0.38

60.

068

(hs)

× (s

d)0.

552

0.01

70.

462

0.07

30.

659

0.35

50.

704

0.11

60.

574

0.86

0

Dat

a gi

ven

are

mea

n ±s

tand

ard

devi

atio

n; a ,

b – m

ean

valu

es in

col

umns

with

diff

eren

t let

ters

diff

er si

gnifi

cant

ly a

t P <

0.0

5.

(hs)

× (s

d) –

inte

ract

ion

betw

een

hous

ing

syst

em (h

s) a

nd st

ocki

ng d

ensi

ty (s

d); M

RWT

– m

ean

rela

tive

wal

l thi

ckne

ss; W

LR –

wei

ght t

o le

ngth

ratio

; BM

C –

bon

e m

iner

al c

onte

nt; B

MD

– b

one

min

eral

den

sity

3 bi

rds/

m2 –

33.

0 kg

of p

redi

cted

fi na

l bod

y w

eigh

t per

m2 o

f fl o

or s

pace

; 4 b

irds/

m2 –

44.

0 kg

of p

redi

cted

fi na

l bod

y w

eigh

t per

m2 o

f fl o

or sp

ace


TAB

LE 3

. The

effe

ct o

f hou

sing

syst

em a

nd st

ocki

ng d

ensi

ty o

n tib

ia m

echa

nica

l pro

perti

es in

16-

wee

ks-o

ld fe

mal

e tu

rkey

s

Gro

up

Stru

ctur

al p

rope

rties

Mat

eria

l pro

perti

es

Yie

ld lo

ad

(N)

Ulti

mat

e lo

ad (N

)

Elas

tic

ener

gy (m

J)

Wor

k to

fr

actu

re

(J)

Stiff

ness

(N

.mm

)

Youn

g m

odul

us

(GPa

)

Yie

ld st

rain

(%

)

Ulti

mat

e st

rain

(%

)

Elas

tic st

ress

(M

Pa)

Ulti

mat

e st

ress

(MPa

)

indo

or 3

528

±56

708

±60

270

±36

1.36

±0.

3252

0 ±1

015.

31 ±

1.02

1.33

±0.

492.

97 ±

0.58

62.0

±11

.684

.5 ±

17.2

indo

or 4

505

±45

696

±115

288

±53

1.36

±0.

2655

8 ±3

84.

73 ±

0.69

1.11

±0.

162.

65 ±

0.29

61.4

±7.

384

.8 ±

14.9

indo

or +

ve

rand

a 3

558

±45

793

±78

283

±41

1.44

±0.

0752

6 ±6

55.

67 ±

0.68

1.21

±0.

183.

11 ±

0.34

66.7

±8.

198

.2 ±

8.1

indo

or +

ve

rand

a 4

534

±53

753

±48

270

±51

1.43

±0.

1652

7 ±8

44.

97 ±

1.03

1.25

±0.

373.

23 ±

0.38

67.3

±9.

988

.3 ±

9.2

Sign

ifica

nce

P-va

lue

hous

ing

syst

em0.

092

0.01

80.

333

0.32

80.

653

0.34

80.

937

0.01

50.

119

0.07

1

stoc

king

de

nsity

0.17

60.

360

0.51

40.

962

0.46

00.

049

0.44

00.

466

0.99

10.

306

(hs)

× (s

d)0.

982

0.62

10.

891

0.92

30.

488

0.86

60.

282

0.12

50.

856

0.27

6

Dat

a gi

ven

are

mea

n ±

stan

dard

dev

iatio

n; a ,

b – m

ean

valu

es in

col

umns

with

diff

eren

t let

ters

diff

er si

gnifi

cant

ly a

t P <

0.0

5.(h

s) ×

(sd)

– in

tera

ctio

n be

twee

n ho

usin

g sy

stem

(hs)

and

stoc

king

den

sity

(sd)

; MRW

T –

mea

n re

lativ

e w

all t

hick

ness

; WLR

– w

eigh

t to

leng

th ra

tio; B

MC

– b

one

min

eral

con

tent

; BM

D –

bon

e m

iner

al d

ensi

ty3

bird

s/m

2 – 3

3.0

kg o

f pre

dict

ed fi

nal b

ody

wei

ght p

er m

2 of fl

oor

spa

ce; 4

bird

s/m

2 – 4

4.0

kg o

f pre

dict

ed fi

nal b

ody

wei

ght p

er m

2 of fl

oor

spac

e



sity. This might be caused by the bone shape, as bone length was measured in a straight line. In meat type birds tibia deformations are common (Bradshaw et al. 2002) and high stocking density can additionally lead to increased tibia curva-ture (Buijs et al. 2012). This suggestion is supported by the lack of a influence of stocking density on tibia weight as well as other determined osteometric indi-ces of bone quality (mean relative wall thickness, cross section area, moment of inertia) and bone mineral content. This is also in agreement with other studies per-formed on poultry, showing that stocking density generally is not influencing bone mineral content or bone ash percentage in broiler chickens (Tablante et al. 2003, Baitshotlhi et al. 2014, Varga-Galicia et al. 2018).

Moreover, in our study, stocking density did not influence bone mechani-cal properties in turkeys, except Young modulus. However, Young modulus is strongly dependent (cube exponent) by the bone length (Muszyński et al. 2017, Tomaszewska et al. 2018). Our results are in partially agreement with the previous study examining the effect of stocking density on bone quality in tur-keys. The study performed on 18-weeks old male meat-type turkeys housed in indoor system showed that, like in pre-sented study, some indices character-izing bone diaphysis geometry (cortical index, mean relative wall thickness) or bone densitometry characteristic (bone volumetric density and bone ash percent-age) were not affected by the stocking density (Jankowski et al. 2015). On the other hand, increased stocking density negatively affected tibia, its length and weight, bone diaphysis cross-sectional

area, moment of inertia and bone break-ing strength (Jankowski et al. 2015). However, that study examined the effect of both stocking density and heat stress temperature and, as the effects of stock-ing density and temperature were con-founded, it is not possible to conclude how stocking density alone affected bone quality.

In chickens, birds welfare is influ-enced more by housing conditions than by stocking density (Dawkins et al. 2004). Likewise, in our study showed that in turkeys housing system exerts greater influence on bone properties than stocking density. Moreover, our results about the influence of housing system on bone quality are generally in correspondence with findings of similar study performed on turkey-toms raised from 7th to 22nd week of age indoors or in semi-open system under a shelter with access to open-air runs (Burs et al. 2008). Like in presented study, the semi-open system positively influenced tibia weight and the values of ultimate strain, while the yield strain and elastic energy were not affected by housing system (Burs et al. 2008). The main discrepancy between both studies is that in our female turkeys the effect of housing system on tibia yield and ulti-mate load was observed. This could be result of increased bone mineral content observed in tibias of turkeys reared in open housing system. However, this could be only speculated, as bone densi-tometry parameters were not examined in that previous study.

Bone mineral phase is the dominant factor determining the bone ultimate endurance while the bone elastic proper-ties are also depended on bone organic



phase, mostly collagen matrix. In our study, most of the mechanical indices characterizing the bone mechanical endurance (ultimate load, ultimate strain, ultimate stress) were influenced by the housing system while the yield load was the only parameter describing the bone elasticity which was housing system dependent.

The mechanisms by which the semi-open housing system may have improved bone mineral density and mineral content are not clear. One of the possible factor responsible for the change in bone min-eralization may be a different physical activities of turkeys in both housing sys-tems. Martrenchar et al. (1999) showed that stocking density had little effect on male turkey activity except more fre-quent disturbances of resting birds by other birds at the high density (4 birds per m2 of floor space, the same as in our study). Thus, it is possible that the physi-cal activity of our turkeys as the same in both stocking densities. However, despite the same floor space, our birds reared in semi-open system might have been forced to perform more physical activity (for example, due to the weather conditions), which increased their bones’ mineralization (Rath et al. 2000). Moreover, it has been shown that light intensity and light source affect activity levels and bone health in poultry (Bailie et al. 2013). The provision of sunlight UVA may lead to increase exploratory and foraging behaviours as these wave-lengths play an important role in avian colour vision (Maddocks et al. 2001), while UVB wavelengths are involved in the synthesis of vitamin D, which stimu-late the absorption of calcium from the gut (Stanford 2006). Nevertheless, it is

not certain whether the birds housed in semi-open system actually took more steps than the indoor birds as physical activity had not been monitored. This should be further investigated.

CONCLUSIONS

In conclusion, findings of this experi-ment suggest that in turkeys bone quality is influenced more by housing condi-tions than by stocking density and open and semi-open rearing systems may have beneficial impact on bone development and its mechanical strength compared to conventional housing system. However, the mechanisms by which this occurs are unknown and further research is needed to understand the interactions among stocking density, rearing system and turkey behaviour in order to improve birds health and welfare.

REFERENCES

BAILIE C.L., BALL M.E., O’CONNELL N.E. 2013: Influence of the provision of natural light and straw bales on activity levels and leg health in commercial broiler chicken. Animal 7: 618–626.

BAITSHOTLHI J.C., MOREKI J.C., TSOPITO C.M., NSOSO S.J. 2014: Influence of stocking density on bone development in family chick-ens reared up to 18 weeks of age under inten-sive system. Int. J. Poult. Sci. 13: 652–656.

BASSLER A.W., ARNOULD C., BUTTER-WORTH A., COLIN L., DE JONG I.C., FER-RANTE V., FERRARI P., HASLAM S., WE-MELSFELDER F., BLOKHUIS H.J. 2013: Potential risk factors associated with contact dermatitis, lameness, negative emotional state, and fear of humans in broiler chicken flocks. Poult. Sci. 92: 2811–2826.

BRADSHAW R.H., KIRKDEN R.D., BROOM D.M. 2002: A review of the aetiology and pa-thology of leg weakness in broilers in relation to welfare. Avian Poult. Biol. Rev. 13: 45–103.



BUIJS S., VAN POUCKE E., VAN DONGEN S., LENS L., BAERT J., TUYTTENS F.A.M. 2012: The influence of stocking density on broiler chicken bone quality and fluctuating asymmetry. Poult. Sci. 91: 1759–1767.

BURS M., ZDYBEL A., FARUGA A., LAS-KOWSKI J. 2008: Wpływ sposobu utrzymania indorów na wytrzymałość mechaniczną kości udowej i piszczelowej [Effect of housing con-ditions on the mechanical strength of the femur and tibia in turkeys]. Med. Wet. 64: 202–206 [in Polish].

DAWKINS M.S., DONNELLY C.A., TRACEY A., JONES T.A. 2004: Chicken welfare is in-fluenced more by housing conditions than by stocking density. Nature 427: 342–344.

EKSTRAND C., ALGERS B., SVEDBERG J. 1997: Rearing conditions and foot-pad der-matitis in Swedish broiler chickens. Prev. Vet. Med. 31: 167–174.

HALL A.L. 2001: The effect of stocking density on the welfare and behaviour of broiler chick-ens reared commercially. Anim. Welf. 10: 23–40.

JANKOWSKI J., MIKULSKI D., TATARA M.R., KRUPSKI W. 2015: Effects of increased stocking density and heat stress on growth, per-formance, carcase characteristics and skeletal properties in turkeys. Vet. Rec. 176: 21–26.

MADDOCKS S.A., GOLDSMITH A.R., SHER-WIN C.M. 2001. Behavioural and physiologi-cal effects of absence of ultraviolet wave-lengths for domestic chicks. Anim. Behav. 62: 1013–1019.

MARCHEWKA J., WATANABE T.T.N., FER-RANTE V., ESTEVEZ I. 2013: Review of the social and environmental factors affecting the behavior and welfare of turkeys (Meleagris gallopavo). Poult. Sci. 92: 1467–1473.

MARTRENCHAR A., HUONNIC D., COTTE J.P., BOILLETOT E., MORISSE J.P. 1999: Influence of stocking density on behavioural, health and productivity traits of turkeys in large flocks. Br. Poult. Sci. 40: 323–331.

MUSZYŃSKI S., KWIECIEŃ M., TOMASZE-WSKA E., ŚWIETLICKA I., DOBROWOL-SKI P., KASPEREK K., JEŻEWSKA-WIT-KOWSKA G. 2017: Effect of caponization on performance and quality characteristics of long bones in Polbar chickens, Poult. Sci. 96: 491–500.

RATH N.C., HUFF G.R., HUFF W.E., BALOG J.M. 2000: Factors regulating bone maturity and strength in poultry. Poult. Sci. 79: 1024–1032.

ŠKRBIĆ Z., PAVLOVSKI Z., VITOROVIĆ D., LUKIĆ M., PETRIĆEVIĆ V. 2009: The effects of stocking density and light program on tibia quality of broilers of different genotype. Arch. Zoot. 12 (3): 56–63.

SORENSEN P., SU G., KESTIN, S.C. 2000: Ef-fects of age and stocking density on leg weak-ness in broiler chickens. Poult. Sci. 79: 864–870.

STADIG L.M., RODENBURG T.B., AMPE B., REUBENS B., TUYTTENS F.A.M. 2017: Effect of free-range access, shelter type and weather conditions on free-range use and wel-fare of slow-growing broiler chickens, Appl. Anim. Behav. Sci. 192: 15–23.

STANFORD M. 2006. Effects of UVB radiation on calcium metabolism in psittacine birds. Vet. Rec. 159: 236–241.

TABLANTE N.L., ESTEVEZ I., RUSSEK-CO-HEN E. 2003: Effect of perches and stocking density on tibial dyschondroplasia and bone mineralization as measured by bone ash in broiler chickens. J. Appl. Poult. Res. 12: 53–59.

TOMASZEWSKA E., KWIECIEŃ M., DOBRO-WOLSKI P., KLEBANIUK R., MUSZYŃSKI S., OLCHA M., BLICHARSKI T., GRELA E.R. 2018: Dose-dependent effects of probiotic supplementation on bone characteristics and mineralisation in meat-type female turkeys. Anim. Prod. Sci. 58 (3): 507–516.

VARGAS-GALICIA A.J., SOSA-MONTES E., RODRÍGUEZ-ORTEGA L.T., PRO-MARTI-NEZ A., RUIZ-FERIA C.A., GONZÁLEZ-CERÓN F., GALLEGOS-SÁNCHEZ J., ARREOLA-ENRÍQUEZ J., BAUTISTA-ORTEGA J. 2017: Effect of litter material and stocking density on bone and tendon strength, and productive performance in broilers. Can. J. Anim. Sci. 97: 673–682.

Streszczenie: Analiza mineralizacji kości, wła-ściwości osteometrycznych i mechanicznych u indyczek w zależności od obsady i systemu utrzy-mania. Gęstość obsady ptaków na m2 powierzch-ni oraz system utrzymania podczas chowu mogą wpływać na rozwój szkieletu ptaków. W przy-



padku indyków badania dotyczące wpływu tych czynników na rozwój kości są niezwykle ubogie. Celem przedstawionych badań była ocena wpły-wu systemu utrzymania i obsady indyków, na wskaźniki mineralizacji i wytrzymałości mecha-nicznej kości ptaków. Badaniami objęto indycz-ki Big-6 w okresie pomiędzy 7 a 16 tygodniem życia. Ptaki utrzymywano w pomieszczeniach zamkniętych (system tradycyjny) lub w systemie mieszanym, w którym ptaki mogły w ciągu dnia korzystać z wybiegu, w dwóch zagęszczeniach: obsada 3 ptaki na m2 (33 kg przewidywanej koń-cowej masy ciała na m2 powierzchni) lub 4 ptaki na m2 (44 kg przewidywanej końcowej masy ciała na m2 powierzchni). Zagęszczenie obsady znacz-nie zmniejszyło jedynie moduł Younga sprężysto-ści w kości piszczelowej, natomiast pozytywny wpływ półotwartego systemu utrzymania obser-wowano w masie kości piszczelowej, mineraliza-cji kości i wytrzymałości mechanicznej, zwłasz-cza w indeksach opisujących odporność kości na złamanie. Podsumowując, wyniki tego ekspery-

mentu sugerują, że u indyków jakość kości zależy bardziej od warunków utrzymania niż od obsady, a otwarte i półotwarte systemy hodowlane mogą mieć korzystny wpływ na rozwój kości.

Słowa kluczowe: jakość kości, dobrostan indy-ków, gęstość obsady, system utrzymania

MS received 27.07.2018MS accepted 10.10.2018

Authors’ address:Renata KlebaniukInstytut Żywienia Zwierząt i BromatologiiWydział Biologii, Nauk o Zwierzętach i Biogo-spodarkiUniwersytet Przyrodniczy w Lublinieul. Akademicka 13, 20-950 LublinPolande-mail: [email protected]



Estimation of the human factor in the form of litter size regulation for the weaning results in mink

MARIAN BRZOZOWSKI, JACEK GOŚ, DANUTA DZIERŻANOWSKA-GÓRYŃFaculty of Animal Sciences, Warsaw University of Life Sciences

Abstract: Estimation of the human factor in the form of litter size regulation for the weaning re-sults in mink. Results of studies on farm animals indicate that proper human behavior may bring about better parameters with respect to animal breeding. The aim of the study was to attempt to establish whether mink breeding effi ciency is in-fl uenced by undertaking measures with a view to regulating litter size. Each time the regulation of litters resulted from a direct decision of employee, hence it can be treated as the effect of a human fac-tor. Data derived from evaluation cards for stand-ard-colored one-year female mink (1,500 cards in total) were compared by two teams (team A: 748 cards, team B: 752 cards, respectively). During the initial inspection of each litter the number of young live born kits was counted and the employ-ees decided whether to introduce measures with respect to regulating litter size (either add or sub-tract kits) or whether to leave the litter as is, sans intervention. The evaluation of the number of weaned kits has allowed us to compare both teams with respect to the resulting breeding effi ciency, as well as evaluate the effi ciency of the regulatory measures (modeling) themselves with respect to litter size. The analysis of the received results did not show the existence of the infl uence of the hu-man factor, which is the modeling of litters on the rearing results. The obtained results indicate that in both teams employees approached in a similar manner the decision regarding the need to model litters. The possibility of making such conclu-sion is indicated by comparable weaning results received in both teams, both in the group of mod-eled and non-modeled animals. When compared

teams, team A obtained better results (P = 0.047), however, in none of the analyzed subgroups com-pared teams (A and B) were found statistically signifi cant differences in weaning results.

Key words: mink, litter size regulations, breeding effi ciency, human factor infl uence

INTRODUCTION

Multiple studies on breeding farm animals have confirmed that improper human behaviour may limit productivity. There also exists an opposite relationship: proper behaviour toward animals may result in better performance indicators. This has been confirmed in the studies of i.a. Barnett et al. (1992) and Cransberg et al. (2000) with respect to poultry; Hemsworth et al. (1986) and Gonyou et al. (1986) with respect to breeding swine; Breuer et al. (2000) with respect to cattle.

Such studies also pertained to mink. In their studies, Seremak et al. (2011) have demonstrated the influence of the human factor on the breeding efficiency of mink kits: it was different for groups of animals overseen by different teams.

The aim of the present study was to establish whether it is possible to speak


328 M. Brzozowski, J. Goś, D. Dzierżanowska-Góryń

of the influence of the human factor, which is the procedure of regulating the litter size, on the efficiency of mink weaning results.


The material of the study consisted of the breeding cards of breeding-stock standard-color female mink, collected on a farm located in central Poland. A total of 1500 evaluation cards were collected. They belonged to one-year female minks housed in ten enclosures. For each en-closure, about 150 evaluation cards were selected at random for the purpose of the calculations. The animals were taken care of by two teams, each of which oversaw five enclosures. This allowed us to estab-lish whether the human factor influences breeding efficiency. Table 1 presents the arrangement of the experiment.

The evaluation cards contained the following information:• The number of born kits in a litter

established during the first control.• The number of dead kits in a litter

established during the first control.• The number of live kits in a litter

established during the first control.• The number of kits added to the litter.• The number of kits subtracted from

the litter.• The number of reared (weaned) nest-

lings from a single litter.

The experiment paid significant atten-tion to the efficiency of adding kits to a litter or subtracting them from, or the so-called issue of “modeling” litters.

The litter-modeling measure consisted of subtracting a number of the kits when concerns arose that the mother may not be able to feed her offspring, as well as adding additional kits when determin-ing that the mother will be able to feed them. A positive result of the modeling process was announced when the female mink weaned a number of mink equal to or larger than the number of her live born offspring. A negative result of the modeling process was announced when following modeling, the female lost kits in the rearing stage.

Each female mink was assigned to one of the four following groups:1. Unmodeled litter, no losses in rearing2. Unmodeled litter, losses in rearing3. Modeled litter, positive result4. Modeled litter, negative result

Such a division allowed us to evaluate the efficiency of the modeling process both within teams, as well as between them. The analysis of results only took into account results which could have been influenced by the direct actions of the overseers themselves, hence it did not take into account the issue of still-born kits.

The statistical analysis of the results was performed using the Statistica 13.1

TABLE 1. The arrangement of the experiment

Team Number of enclosures Number of female minkA 5 748B 5 752

Total in the experiment 10 1,500


Estimation of the human factor in the form of litter size regulation... 329

program. The normality of the distribu-tion was checked by the Shapiro-Wilk test, and then the U Mann Whitney test for the χ 2 quality variables was used. The ones with P ≤ 0.05 were considered significant results.

RESULTS AND DISCUSSION

Table 2 presents the indicators of mink rearing with respect to the teams over-seeing the animals.

The average number of born, live kits in a litter obtained for both compared groups falls within the scope established by other authors (Bis-Wencel et al. 2006, Dziadosz et al. 2010, Brzozowski et al. 2012, Konopka et al. 2013).

The analyzed indicators (number of born kits, number of kits born live, number of weaned kits) are character-ize by similar variability in the case of

both teams (on a level of 30%), which points to the existence of a possibility to improve their values by holding system-atic breeding work.

The survivability rate for mink in the rearing stage has turned out to be larger in the case of enclosures overseen by team A. This group resulted in 158 more weaned kits, a significant improvement over the results of team B (Table 2).

In order to determine whether such differences pertain to modeled or unmodeled litters, the efficiency of the modeling measures was compared for both teams. The results are presented in Table 3.

Using modeling measures (adding or subtracting kits) is always an inter-ference with respect to the natural life rhythm of the female mink. For this reason, it is extremely crucial to account for the experience of the personnel and

TABLE 2. Indicators of mink breeding in the compared teams

Team Number of litters

Number of born kits in a litterx (v)

Number of living kits in a litter

x (v)

Number of weaned kits in a litter

x (v)A 748 6.87 (28.5) 6.57 (28.7) 5.70a (29.0)B 752 6.90 (31.4) 6.47 (32.4) 5.47a (33.6)

x – average value for the group, v – coeffi cient of variation, a, a – differences between rows in a column are statistically signifi cant on a level of P = 0.047.

TABLE 3. Indicators of mink breeding in the compared teams with respect to litter modeling meas-ures

Undertaken measures

Number of litters Average number of living kits in a litter x (v)

Average number of weaned kits in a litter x (v)

TeamA

TeamB

TeamA

TeamB

TeamA

TeamB

No litter modeling 556 562 6.85 (22.6) 6.72 (25.3) 5.78(29.1) 5.57 (31.9)

Litter modeling 192 190 5.76 (42.9) 5.69 (45.9) 5.49 (28.3) 5.18 (37.2)

x – average value for the group, v – coeffi cient of variation



their assessment of whether or not resort to modeling. It may as well turn out that needless disruption of the females and premature decisions to model the litter may be counterproductive to the goal at hand and may, in effect, lower breeding efficiency. On the other hand, it may turn out that failing to undertake modeling measures will lead to a reduction in the number of reared kits.

By way of comparing both teams, we did not identify statistically significant differences with respect to the values of rearing indicators in groups of litters which have undergone modeling, despite the fact that team A has achieved overall better breeding efficiency. After sum-ming up the number of young offspring obtained, it turns out that the team A modeled 192 litters and obtained 1054 young weaners, while the team B from 190 litters obtained 984 young weaners. Although, there were 70 young offspring less in this group, the difference was sta-tistically insignificant (P = 0.136).

Differences in breeding efficiency for unmodeled litters were also statistically insignificant (P = 0.711). Leaving litters sans intervention in this case turned out to be a decision which generated better

results. This observation seems to con-firm the thesis that modeling is done in situations when the female has too many or too few young. This is indicated by the observation that both the average number of live born and average rearing results were higher in non-modeled litters than in modeled ones, in groups of animals serviced by both teams. This may be the result of the fact that more numerous lit-ters are usually the ones being modeled, in which mink with less body mass may be observed, and which usually display less vitality. For this reason, kits from such litters may be less developed and more prone to all negative environmen-tal influences (Houbak and Malmkvist 2008, Hunter 2008).

In order to establish differences between breeding efficiency within modeled and unmodeled litters, we have performed an evaluation of the effi-ciency of modeling litters for both teams (Table 4).

Comparing breeding efficiency for both teams with respect to both mode-ling measures and their efficiency points to team A obtaining better results each single time, although, the results did not differ statistically significantly.

TABLE 4. The effi ciency of modeling litters in the compared teams

Undertaken measures

Effect of the measures

Number of litters

Average number of living kits in a litter x (v)

Average number of weaned kits in a litter x

(v)Team

ATeam

BTeam

ATeam

BTeam

ATeam

B

No litter modeling

No losses 227 225 6.50 (29.9) 6.33 (23.9) 6.50 (23.8) 6.33 (23.9)Losses 329 337 7.09 (21.2) 7.01 (25.3) 5.28 (30.2) 5.00 (33.6)

Litter modeling

Positive effect 142 128 4.96 (40.5) 4.67 (53.2) 5.56 (27.6) 5.33 (37.3)Negative effect 50 62 7.79 (33.85) 7.46 (28.7) 5.30 (30.3) 4.87 (45.29)

x – average value for the group, v – coeffi cient of variation


Estimation of the human factor in the form of litter size regulation... 331

Litter controls are performed at the earliest convenience following birth and it is then when people make decisions on further measures. In the analyzed mate-rial, members from both teams equally chose not to take modeling activity (sub-tracting kits from too numerous litters or adding kits to smaller litters).

CONCLUSION

To summarize it can be stated that the performed analysis of the obtained results did not show the existence of the influence of the human factor, which is the modeling of litters on weaning results. The obtained results indicate that in both teams employees approached in a similar manner the decision regarding the need to model litters. The results of the study also point to the fact that human influence on breeding efficiency may be the result of the conscious decision to refrain from taking modeling measures with a view to changing litter size. The possibility of making such conclusion is indicated by comparable weaning re-sults in both teams, both in the group of modeled and unmodeled animals. When compared teams, team A obtained better results (P = 0.047), however, in none of the analyzed subgroups (modeled and unmodeled) compared teams (A and B) were found statistically significant dif-ferences in weaning results.

REFERENCES

BARNETT J.L., HEMSWORTH P.H., NEWMAN E.A. 1992: Fear of humans and its relationships with productivity in laying hens at commercial farms. Br. Poult. Sci. 33: 699–710.

BIS-WENECEL H., ZOŃ A., SABA L., ON-DRASOVIC O. 2006: Wskaźniki rozrodu norek przy zastosowaniu różnych warunków żywienia [Mink Production Indices in Various Types Feeding Conditions]. Annales UMCS Lublin – Polonia, Sect. EE, 24, 52: 383–386 [in Polish].

BREUER K,. HEMSWORTH. P.H., BARNETT J.L., MATTHEWS L.R., COLEMAN G.J. 2000: Behavioural response to humans and the productivity of commercial dairy cows. Appl. Anim. Behav. Sci. 66: 273–288.

BRZOZOWSKI M., MAĆKOWIAK-KON-DRAK B., GŁOGOWSKI R., 2012: Repro-ductive efficiency of scanbrown and mahogany mink females, selected for litter size. Scientifur 36, (3/4): 267–269.

CRANSBERG P.H., HEMSWORTH P.H. COLE-MAN G.J., 2000: Human factors affecting the behaviour and productivity of commercial bro-iler chickens. Br. Poult. Sci. 41: 272–279.

DZIADOSZ M., SEREMAK B., LASOTA D., MASŁOWSKA A., MIELEŃCZUK G. 2010: Analiza wybranych cech reprodukcyjnych sa-mic norek (Neovison vison) różnych odmian barwnych na przestrzeni kolejnych lat badaw-czych. [Analysis in some reproduction traits of femele mink (Neovison vison) depending on the colour varieties and age]. Acta Sci. Pol., Zootech. 9(4): 71–80 [in Polish].

GONYOU H.W., HEMSWORTH P.H., BAR-NETT J.L. 1986: Effects of frequent interac-tions with humans on growing pigs. Appl. Anim. Behav. Sci. 16: 269–278.

HEMSWORTH P.H., BARNETT J.L., HANSEN C. 1986: The influence of handling by humans on the behaviour, reproduction and corticoste-roids of male and female pigs. App. Anim. Be-hav. Sci. 15: 303–314.

HOUBAK B., MALMKVIST J. 2008: Observa-tions of deliveries in mink: Potential for more kits. Scientifur 32(4): 4.

HUNTER D.B. 2008. Review of factors associa-ted with mink kit mortality. Scientifur 32(4): 28.

KONOPKA E., KOŁODZIEJCZYK D., SOCHA S., 2013: Estimation of mink farming efficien-cy in Poland on an example of production per-formance of a particular farm. Acta Sci. Pol., Zootech. 12(3): 25–36.



SEREMAK B., DZIADOSZ M., LASOTA B., FELSKA-BŁASZCZYK L., PŁAWSKI K., MASŁOWSKA A., MIELEŃCZUK G. 2011: Effect of the quality of handling and care on the reproduction parameters of mink. Acta Sci. Pol., Zootech. 10(3): 93–102.

Streszczenie: Ocena wpływu czynnika ludzkiego w postaci zabiegu regulacji liczebności miotu na wyniki odchowu u norek. Wyniki badań na zwie-rzętach gospodarskich wskazują, że właściwe postępowanie człowieka może przyczynić się do uzyskania lepszych wskaźników użytkowo-ści. Celem przeprowadzonych badań była pró-ba sprawdzenia, czy na wyniki odchowu norek mogą mieć wpływ dokonywane zabiegi regula-cji wielkości miotów. Każdorazowo regulacja miotów wynikała z bezpośredniej decyzji obsłu-gi, stąd można ją traktować jako efekt czynni-ka ludzkiego. Porównywano dane z kart oceny jednorocznych samic odmiany standard (1500 kart), którymi zajmowały się dwie brygady (bry-gada A: 748 kart, brygada B: 752 karty). Przy pierwszej kontroli każdego miotu liczono liczbę młodych żywo urodzonych i pracownicy podej-mowali decyzję, czy dokonać zabiegu regulacji wielkości miotu (dołożyć bądź zabrać szcze-nięta) czy też pozostawić miot bez ingerencji. Ocena liczby młodych odsadzonych pozwoliła porównać obydwie brygady pod względem uzy-skanych wyników odchowu, a także ocenić efek-tywność przeprowadzonego zabiegu regulacji (modelowania) wielkości miotu. Przeprowadzo-

na analiza uzyskanych wyników nie wykazała istnienia wpływu czynnika ludzkiego, jakim jest zabieg modelowania miotów na wyniki odcho-wu. Uzyskane wyniki wskazują, że w obydwu brygadach pracownicy w podobny sposób pod-chodzili do podjęcia decyzji, co do konieczności dokonania modelowania miotów. Na możliwość postawienia takiego wniosku wskazują porów-nywalne wyniki odchowu uzyskane w obydwu brygadach, zarówno w grupie zwierząt modelo-wanych jak i niemodelowanych. Przy porówny-waniu brygad lepsze wyniki odchowu uzyskała brygada A (P = 0,047), jednak w żadnej z ana-lizowanych podgrup (modelowanych i niemo-delowanych) porównywanych brygad A i B nie stwierdzono statystycznie istotnych różnic wy-ników odchowu.

Słowa kluczowe: norki, regulacja wielkości miotu, wyniki odchowu, wpływ czynnika ludzkiego


Authors’ addressMarian BrzozowskiKatedra Szczegółowej Hodowli ZwierzątWydział Nauk o Zwierzętach SGGWul. Ciszewskiego 8, 02-786 WarszawaPolande-mail: [email protected]



Sows’ longevity – a case study of a native breed

LIDIA FOJUTOWSKA, EWA SKRZYPCZAK, KAROLINA SZULC,PIOTR LUCIŃSKIFaculty of Veterinary Medicine and Animal Science, Poznań University of Life Sciences

Abstract: Sows’ longevity – a case study of a na-tive breed. The aim of the study was to assess the length of use of Złotnicka Spotted sows, which are covered by the National Programme for the Conservation of Genetic Resources. The research was conducted on 3,585 sows removed from herds between 2002 and 2017. On average, Złotnicka Spotted sows were removed from the herd when they were 1.112 days old and had farrowed 3.88 times. The research proved statistically signifi cant dependencies between sows’ functional traits and the parameters determining their longevity. The research fi ndings showed that the length of use of sows depended on the number of piglets in the fi rst and last litter as well as the number of pig-lets reared up to the 21st day per litter. The study also includes data on the percentage of Złotnicka Spotted sows removed (%) from herds during the period under study and the percentage share of primiparous sows introduced into herds. During the research period the values of both indicators fl uctuated considerably, which indicated the un-stable size of the population. These dependencies were closely related with the RDP 2007–2013 and 2014–2020 and the amount of subsidies allocated to native breeds. The length of use of sows is a very complex feature. It is of great economic im-portance and closely related with the profi tability of pig production. Therefore, although breeders received subsidies to native breed of sows, the downturn in the pig market caused instability of the pig population.

Key words: sows longevity, sow, Złotnicka Spot-ted, native breed

INTRODUCTION

Although pigs’ life expectancy is estimated at about 12–15 years, these animals are not maintained for such a long period of time due to the current volume of production. The length of the use of sows is directly proportional to the economy of pig breeding or raising. Sows are removed from herds when the results of production are falling and it is no longer profitable to keep these animals (Stalder et al. 2007). Sows are usually removed due to lower production results and health problems (Nikkilä et al. 2013). However, there may also be non-agricultural reasons such as bad situation on the pork market or unfavour-able relation between cereal and pork prices, which affect the profitability of pig breeding.

The maintenance system and envi-ronmental conditions also significantly affect sows’ welfare and the length of their stay in a herd (Anil et al. 2008). Longer maintenance of sows is finan-cially profitable because it reduces the herd exchange rate. Older animals, which have achieved maximum efficiency are maintained then (Hoge and Bates 2011). Apart from that, the number of reared


334 L. Fojutowska et al.

piglets increases, whereas the herd is healthier and more immune to diseases (Sobczyńska and Blicharski 2014). The selection aimed at improving meatiness and acceleration of the production cycle caused rapid removal of sows, on aver-age after 3–4 litters (Hoge and Bates 2011). It is estimated that as much as 15–20% of sows are removed after only one litter. Reproduction disorders are the main cause (30%) of the removal of sows. It is a serious problem, because profitability can be achieved only after 3 litters, whereas 5.5 litters is a satisfac-tory number (Sobczyńska and Blicharski 2014).

Recently the length of the use of sows has become increasingly important and the possibility of including longev-ity traits into breeding programmes for various breeds has been considered. For example, in Denmark this feature is already taken into account when animals are selected and it makes about 10% of the breeding target, depending on the population. However, there are prob-lems to assess the value of this feature, because it can be analysed only when the animal dies or is removed from the herd (Sobczyńska and Blicharski 2014).

The aim of the study was to assess the length of the use of Złotnicka Spotted sows, which are covered by the National Programme for the Conservation of Genetic Resources.


The research was conducted on a popu-lation of Złotnicka Spotted pigs, which are classified as rare breeds threatened by extinction. They are protected by law in Poland.

The research involved the analysis of data on Złotnicka Spotted pigs from the records provided by the Poznań Univer-sity of Life Sciences. Sows’ longevity was measured according to the age of their removal from herds and the number of litters. Reports with information on 3,585 sows removed from herds between 2002 and 2017 were generated from the electronic database OSHZ-Trzoda belonging to the Poznań University of Life Sciences. The data were analysed statistically by means of the SAS soft-ware suite.

Apart from the sow’s age on removal from the herd (days) and the number of litters (pcs), the following elements were included in the statistical analysis of the sow population: the inbreeding ratio, the sow’s age at the first farrow (days), the period between farrows (days), the number of nipples (pcs), the number of litters per sow (pcs), the number of live piglets per litter (pcs), the number of piglets reared up to the 21st day per litter (pcs), piglets lost by the 21st day of rearing (%), the number of live piglets in the last litter (pcs), the number of pig-lets reared up to the 21st day in the last litter (pcs) and piglets in the last litter lost by the 21st day of rearing (%). As the covariance method with the PROC GLM procedure was used for statistical calculations, the probit transformation described by Lynch and Welsh (1998) was used for the traits that were discrete random variables (the number of piglets born and reared and the number of lit-ters), because it enabled their conversion into continuous random variables. The data collected in the study enabled the following calculations: the removal of sows from the herd (the number of sows


Sows’ longevity – a case study of a native breed 335

removed from the herd in a year/the aver-age number of sows in the year × 100%) and the removal of sows from herds after consecutive litters (the number of sows removed from the herd after consecutive litters/the total number of sows removed × 100%).

The Pearson phenotypic correlation coefficient between the sows’ functional traits and the parameters determining their longevity was estimated with the CORR-SAS procedure v. 9.3. (2014).


Table 1 shows the statistics of the sows included in the study. On average, between 2002 and 2017 the Złotnicka Spotted sows were removed from herds when they were 1,112 days old and had had 3.88 litters of piglets. The inbreeding ratio was 0.0238. On average, the sows were 432 days old when they farrowed for the first time. The average period

between farrows was 212 days. On aver-age, in each litter 9.04 piglets were born alive and 8.01 piglets were reared up to the 21st day. On average, 13.71% of the piglets were lost by the 21st day of rearing. On average, in the last litter 8.61 piglets were born alive and 7.29 piglets were reared up to the 21st day. On aver-age, 14.57% of the piglets in the last litter were lost by the 21st day of rearing. On average, each sow had 13.53 nipples. The sows’ reproductive performance indica-tors differed from the results reported by Nowak et al. (2016), who studied cross-bred sows (Polish Large White, Polish Landrace, Pietrain, Hampshire, Duroc). On average, the sows had 11.3 piglets per litter. There were 9.78 weaned piglets, on average. The reproductive cycle lasted 163.1 days. Also, the research conducted on pure Polish Large White and Polish Landrace pigs by Schwarz et al. (2007) proved that native breeds of sows were characterised by worse reproductive

TABLE 1. The statistical characterisation of the traits determining the length of use of Złotnicka Spot-ted sows and their functional parameters between 2002 and 2017

Traits x– SESow’s age on removal from herd (days) 1 112 13.86Inbreeding ratio 0.0238 0.0009Sow’s age at first farrow (days) 432 5.33Period between farrows (days) 212 2.12Number of nipples (pcs) 13.53 0.54Number of litters per sow (pcs) 3.88 0.07Number of live piglets per litter (pcs) 9.04 0.05Number of piglets reared up to 21st day per litter (pcs) 8.01 0.05Piglets lost by 21st day of rearing (%) 13.71 0.46Number of live piglets in last litter (pcs) 8.61 0.07Number of piglets reared up to 21st day in last litter (pcs) 7.29 0.06Piglets in last litter lost by 21st day of rearing (%) 14.57 0.62



performance parameters. The Pearson phenotypic correlation analysis (Table 2) showed that both the age of sows’ removal from herds and the number of litters were positively correlated with the number of piglets born alive in each litter, the number of piglets born alive in the last litter and the number of piglets reared up to the 21st day in the last litter at a significance level of P ≤ 0.01. These parameters were negatively correlated with the number of piglets reared up to the 21st day per litter at a significance level of P ≤ 0.05. The results of our study were in agreement with the findings of the research conducted by Hoge and Bates (2011), who proved that the number of piglets born in sows’ first and last litters as well as the number of dead piglets in the first litter significantly affected sows’ longevity (P < 0.0001). Sevón-Aimonen and Uimari (2013) researched the genetic parameters of longevity and found high genetic correlations (> 0.9) between the length of use of herds, the total number of litters, the number of piglets born, the number of piglets born alive and the number of piglets weaned. They found low correlations between

the traits referring to piglet mortality. In our study on the population of Złotnicka Spotted sows the number of piglets lost by the 21st day of rearing did not depend on the traits referring to the length of use of the sows (Table 2).

Noppibool et al. (2016) and Rohrer et al. (2017) also confirmed high positive genetic correlations between traits refer-ring to the length of the use of sows and the number of piglets weaned per litter.

Aasmundstad et. al. (2014) indicated that there was no relationship between traits referring to sows’ body build and their longevity. Figure 1 shows the percentage of Złotnicka Spotted sows removed (%) from herds between 2002 and 2017. The lowest percentage of sows removed from herds was noted in 2016 (17.14%), whereas the highest percent-age was observed in 2014 (66.66%). It was so high because Poland started implementing the Rural Development Programme (RDP) 2014–2020. At the time some breeders abandoned the main-tenance of Złotnicka Spotted pigs within the Programme. In the following years fewer sows were removed. Figure 2 shows the percentage of Złotnicka Spot-

TABLE 2. The Pearson phenotypic correlation coeffi cient between the sows’ functional traits and the parameters determining their longevity

Item

Number of live piglets

per litter(pcs)

Number of piglets reared up

to 21st day per litter

(pcs)

Piglets lost by 21st day of rearing

(%)

Number of live piglets in last litter

(pcs)

Number of piglets reared up

to 21st day in last litter

(pcs)

Piglets in last litter

lost by 21st day

of rearing(%)

Sow’s age on removal from herd (days) 0.612** –0.322* –0.099 0.088 0.079 –0.108

Number of litters per sow (pcs) 0.889** –0.488* –0.075 0.709** 0.598** –0.157

** statistically signifi cant correlation (P ≤ 0.01), * statistically signifi cant correlation (P ≤ 0.05)



51.9454.97

35.1836.5838.86

31.1133.15

19.38

25.3929.66 31.4

18.27

66.66

25.05

17.1418.97

0

10

20

30

40

50

60

70%

Years

FIGURE 1. Złotnicka Spotted sows removed from herds between 2002 and 2017

51.9454.97

35.1836.5838.86

31.1133.15

19.38

25.3929.66 31.4

18.27

66.66

25.05

17.1418.97

0

10

20

30

40

50

60

70

%

Years

ted primiparous sows introduced into herds between 2002 and 2017.

The most primiparous sows were intro-duced into herds in 2007, i.e. 80.32%. At the time new herds were formed due to

the implementation of the Rural Devel-opment Programme (RDP) 2007–2013 and the allocation of subsidies to native breeds. As the time passed, there was a decreasing tendency due to the ageing

FIGURE 2. Złotnicka Spotted primiparous sows introduced into herds between 2002 and 2017



22.11

16.32

13.62 13.42

9.28

7.17 7.115.33

2.37 1.710.59 0.72 0.13 0.13

0

5

10

15

20

25

1 2 3 4 5 6 7 8 9 10 11 12 13 14

%

Litters

of the population of Złotnicka Spot-ted pigs. In consequence, the results of production worsened and breeders were less interested in this breed. However, in 2014 the interest in the breed began to increase again. There were new herds, so the number of primiparous sows began to rise. The rising trend was also strictly related with the RDP 2014–2020 and higher subsidies allocated to sows. It is believed that the values of both indica-tors (Figures 1 and 2) should be similar in a herd with a stable population. During the period under study the values of both indicators fluctuated considerably due to the unstable size of the population caused by poor cost-effectiveness of pig production.

Figure 3 shows the percentage of sows removed from herds after consecutive lit-ters. As can be seen, more than a half of the sows (52.05%) were removed after their third litter. This trend tended to decrease. The sows were usually removed due to reproductive problems. Many other authors also observed that after a

short period of time sows were removed from herds due to reproduction failures, decreasing fertility in consecutive cycles and mechanical injuries (Stalder 2006, Karpiesiuk et al. 2018). Tani el al. (2018) indicated that sows were removed from herds after a short period of time when they farrowed 3 or more dead piglets. According to Hoge and Bates (2011), sows were removed after 3–4 litters due to selection because farmers wanted to improve meatiness in the intensive pro-duction system. However, the results of recent studies show that the selection oriented at rapid growth had negative influence on longevity (Nikkilä 2013). The herd in our study was not influenced by attempts to increase the meat content in the carcass, because it was covered by the National Programme for the Con-servation of Genetic Resources, which is supposed to protect the gene pool of native breeds. The research results show that the length of use of native breeds of sows was chiefly influenced by the prof-itability of pig production.

FIGURE 3. The percentage of Złotnicka Spotted sows removed from herds after consecutive litters



CONCLUSIONS

The research showed that the sows were removed from herds due to the decreas-ing number of piglets in litters and fewer piglets reared up to the 21st day of life. More than a half of the sows were removed after the first 3 litters. The trend tended to decrease. The decreasing share of primiparous sows in herds indicated the ageing of the population. This phe-nomenon might negatively affect the re-sults of production. The research proved statistically significant dependencies between sows’ functional characteristics and the parameters determining their longevity. The research results showed that the length of use of sows depended on the size of their first and last litters as well as the number of piglets reared up to the 21st day per litter. Between 2002 and 2017 the percentage of primiparous sows and the share of sows removed from herds fluctuated considerably, which indicated the unstable size of the population, resulting from the economic factor of poor cost-effectiveness of pig production.

REFERENCESAASMUNDSTAD T., OLSEN D., SEHESTED

E., VANGEN O. 2014: The genetic relation-ships between conformation assessment of gilts and sow production and longevity. Livest. Sci. 167: 33–40.

ANIL S., ANIL L., AND DEEN J. 2008: Analy-sis of periparturient risk factors affecting sow longevity in breeding herds. Can. J. Anim. Sci. 88: 381–389.

HOGE M.D., BATES R.O. 2011: Developmental factors that influence sow longevity. J. Anim. Sci. 89: 1238–1245.

KARPIESIUK K., JARCZYK A., WINIARSKI Z., MILEWSKA W., BUGNACKA D., KOZ-ERA W., WOŹNIAKOWSKA A., KLEŚNIAK

P. 2018: Sow longevity as an indicator of resist-ance to environmental stressors. Pol. J. Natur. Sc. 33(1): 17–27.

LYNCH M., WELSH B. 1998: Genetics and anal-ysis of quantitative treids. Sinauer Associates Inc. Tabilisches Puschers Sunderland Massa-chuset (USA).

NIKKILÄ M. T., STALDER K. J., MOTE B. E., ROTHSCHILD M. F., GUNSETT F. C., JOHNSON A.K., KARRIKER L.A., BOG-GESS M.V., SERENIUS T.V. 2013: Genetic associations for gilt growth, compositional, and structural soundness traits with sow lon-gevity and lifetime reproductive performance. J. Anim. Sci. 91: 1570–1579.

NOPPIBOOL U., ELZO M. A., KOONAWOOT-RITTRIRON S., SUWANASOPEE T. 2016: Estimation of Genetic Parameters and Trends for Length of Productive Life and Lifetime Production Traits in a Commercial Landrace and Yorkshire Swine Population in Northern Thailand. Asian-Australas. J. Anim. Sci. 29(9): 1222–1228.

NOWAK B., KRUSZYŃSKI W., PAWLINA E. 2016: Wpływ wybranych czynników na płod-ność i plenność loch oraz długość laktacji i cy-klu reprodukcyjnego. [The influence of selec-ted factors on fertility of sows and the leught of location and reproductive cycle] Zesz. Nauk. UP Wroc., Biol. Hod. Zwierz. 81, 618: 9–18 [in Polish].

ROHRER G., CROSS A., LENTS C., MILES J. NONNEMAN D., REMPEL L. 2017: Genetic improvement of sow lifetime productivity. J. Anim. Sci. 95: 11–12.

SCHWARZ T., NOWICKI J., JELONEK M. 2007: Porównanie użytkowości rozpłodowej loch ras wbp i pbz w warunkach produkcji wielkotowarowej. [Comparison of reproducti-ve performance of Polish Large White and Po-lish Landrace sows under intensive production conditions]. Rocz. Nauk. Zoot., 34(2): 165–169 [in Polish].

SEVÓN-AIMONEN M. L. UIMARI P. 2013: Heritability of sow longevity and lifetime pro-lificacy in Finnish Yorkshire and Landrace pigs. Agricult. Food Sci. 22: 325–330.

SOBCZYŃSKA M., BLICHARSKI T. 2014: Al-ternatywne metody szacowania wartości ho-dowlanej długowieczności loch. Przegl. Hod. 2: 17–19.



STALDER K. 2006: Non-genetic factors influ-encing sow longevity. Anim. Sci. White Pa-pers, Technical Reports & Fact Sheets. 12.

STALDER K.J., KARRIKER L.V., JOHNSON A.K. 2007: The Impact of Gestation Housing Systems on Sow Longevity. Sow Housing Fo-rum Des Moines, Iowa.

TANI S., PIÑEIRO C. AND KOKETSU Y. 2018: Culling in served females and farrowed sows at consecutive parities in Spanish pig herds. Porc. Health Management. 4: 3.

Streszczenie: Długowieczność loch na przy-kładzie rasy rodzimej. Celem pracy była ocena długości użytkowania loch rasy złotnickiej pstrej objętej Krajowym Programem Ochrony Zaso-bów Genetycznych. Badaniami objęto 3585 loch wybrakowanych z hodowli w latach 2002–2017. Lochy rasy złotnickiej pstrej były wycofywane z hodowli w wieku średnio 1112 dni, dając 3,88 miotu. Wykazano, że istnieją statystycznie istot-ne zależności między cechami użytkowymi loch, a parametrami określającymi ich długowiecz-ność. Otrzymane w pracy wyniki wskazały, że długość użytkowania loch zależy od wielkość miotu podczas pierwszego i ostatniego opro-szenia, jak również od liczby prosiąt odchowa-nych do 21. dnia życia z miotu. Przedstawiono również brakowania loch rasy złotnickiej pstrej (%) ze stad w omawianych latach, jak również procentowy udział pierwiastek wprowadzonych

do stad. W badanym okresie odnotowano duże wahania wartości obu wskaźników świadczące o nieustabilizowanej wielkości populacji. Zależ-ności te były ściśle związane z PROW w latach 2007–2013 i 2014–2020 i wielkością subwencji do ras rodzimych. Długość użytkowania loch jest cechą bardzo złożoną o ogromnym znaczeniu ekonomicznym i ściśle powiązana z rentowno-ścią produkcji trzody chlewnej, dlatego pomimo dotacji, którą otrzymali hodowcy do loch rasy rodzimej, zła koniunktura na rynku wieprzowym wpłynęła na brak stabilizacji w liczebności po-pulacji.

Słowa kluczowe: długowieczność loch, locha, złotnicka pstra, rasa rodzima


Authors’ address:Ewa Skrzypczak Katedra Hodowli Zwierząt i Oceny SurowcówWydział Medycyny Weterynaryjnej i Nauk o Zwierzętach Uniwersytet Przyrodniczy w Poznaniuul. Słoneczna 1 62-002 Suchy Las – Złotniki, Polande-mail: [email protected]



The effect of partial replacement of soybean meal protein with guar (Cyamopsis tetragonoloba) meal proteinon the cost-effectiveness of pig fattening

KRZYSZTOF KARPIESIUK, WOJCIECH KOZERA, DOROTA BUGNACKA, ANNA WOŹNIAKOWSKA, BARBARA JAROCKAFaculty of Animal Bioengineering, University of Warmia and Mazury in Olsztyn

Abstract: The effect of partial replacement of soybean meal protein with guar (Cyamopsis tetragonoloba) meal protein on the cost-effective-ness of pig fattening Soaring demand for meat across the world has prompted an active search for alternatives to traditional protein sources. The aim of this study was to determine whether guar meal could be used as a source of protein in diets for fi nishing pigs. The experiment was per-formed on 64 crossbred pigs produced by simple commercial crossbreeding [♀ (Polish Landrace × ♂ Polish Large White) × ♂ (♀ Pietrain × ♂ Du-roc)]. The animals were fattened from average body weight (BW) of 30.1 kg to 112.2 kg. Control group (1) pigs were fed complete cereal-soybean meal (SBM) diets. In experimental groups 2, 3 and 4, SBM protein was partially replaced with guar meal protein in the amount of 25, 50 and 75%, respectively. All pigs were characterized by high fattening performance. Average daily gain (ADG) was highest in group 2, with no statistically signif-icant difference relative to the control group, and signifi cant differences relative to groups 3 and 4. The highest fattening performance was achieved in group 2 pigs fed diets containing 25% of guar meal protein, which were characterized by the highest growth rate and the lowest feed conver-sion ratio (FCR). An economic analysis revealed that feed cost per kg BW gain was lowest in group 2 in the 2nd stage of fattening (PLN 2.99).

Key words: fi nishing pigs, soybean meal, guar meal, protein, productivity, economics of pig fat-tening

INTRODUCTION

The availability of low-cost and high-quality and safe feed poses a challenge in animal production (Okorski et al. 2017). There is a high demand for feed additives capable of improving the palat-ability, nutritional value and quality of meat (Karpiesiuk et al. 2013, Lisiak et al. 2014, Lebret et al. 2015, Karpiesiuk et al. 2016). At present, the diets fed to monogastric animals, including pigs, are composed mainly of cereals and soybean meal (SBM) as the main source of protein. The significance of rational use of protein sources in pig nutrition has been recognized already in the 1970s by Grudniewska (1975). Recent years have witnessed a growing popularity of organic foods as a source of healthy and safe nutrition. This trend has contributed to an increase in the number of organic farms. Consumers around the globe have a growing interest in food products containing non-genetically modified ingredients. Pig fattening based on non-GM feeds may pose an alternative to intensive production systems that rely on GM feeds. There is a high demand for alternative low-cost sources of dietary


342 K. Karpiesiuk et al.

protein in animal nutrition. Polish re-searchers have been investigating local feed protein sources as an alternative to SBM (Hanczakowska and Księżak, 2012, Sońta et al. 2015, Kaczmarek et al. 2016, Sońta et al. 2016), and the use of indigenous protein crops in pig nutrition has been researched around the world (Písaříková and Zralý 2009, Crépon et al. 2010, Smith et al. 2013).

In addition to locally grown protein crops, another alternative feed protein source to SBM could be guar meal which is obtained from guar plants of the family Fabaceae, genus Cyanopsis, with the botanical name Cyamopsis tetragonoloba (L.) Taub (Kulthe et al. 2017). Guar is grown mainly in India, Pakistan and Africa (Saeed et al. 2017), therefore guar meal is not a popular feed ingredient in Poland. Guar is the source of guar gum, whereas guar meal is a by-product of seed processing. According to research studies conducted in the 1980s, pig diets can be supplemented with up to 6% of guar meal (Heo et al. 1987). Guar meal contains 48–52% protein and 10% dietary fiber. The widespread use of guar meal in pig and poultry diets is limited due to its relatively high fiber content and high levels of trypsin inhibitors. Howev-er, thermal processing inactivates more than 80% of trypsin inhibitors in guar meal. Guar meal is rich in arginine, but it is deficient in threonine, methionine, lysine, leucine and isoleucine (Verma and McNab 1984). Therefore, diets contain-ing guar meal as the main protein source should be supplemented with the above amino acids. According to Humphrey et al. (2018), improved new guar meal products, although regarded as unpalat-able and possibly toxic, can be a promis-

ing and inexpensive alternative protein source in animal nutrition because they contain large amounts of protein and carbohydrates. Since the introduction of the ban on the use of meat and bone meal in animal feeds, SBM has been the most popular, but also an expensive source of feed protein in Poland. In view of the above, the search for protein sources that could effectively replace SBM in animal nutrition should be continued.

The aim of this study was to deter-mine whether guar meal could be used as a high-protein substitute for SBM in diets for finishing pigs.

MATERIALS AND METHODS

The experiment was conducted at the Animal Research Laboratory in Bałcyny, administered by the Department of Pig Breeding, University of Warmia and Mazury in Olsztyn. The experimental material comprised 64 F2 crossbred pigs produced by simple commercial cross-breeding [♀(♀ Polish Landrace × ♂ Polish Large White) × ♂ (♀ Pietrain × ♂ Duroc)], with average initial body weight (BW) of 30.1 kg. The animals were divided into four groups by the analog method, based on BW, age and sex, and were placed in pens measuring 2.5 m × 2.5 m, with 4 pigs per pen. Before the experiment, all animals were weighed individually, marked and allocated to groups fed complete diets differing in protein source:1 – C (control, with SBM as the main

protein source);2 – (25% of SBM was replaced with

guar meal protein);3 – (50% of SBM was replaced with

guar meal protein);


The effect of partial replacement of soybean meal protein with guar... 343

4 – (75% of SBM was replaced with guar meal protein).

During the fattening period, all pigs were weighed at two-week intervals. The animals were slaughtered in a meat processing plant at average BW of 112.2 kg. The BW of pigs, feed intake and feed intake per kg BW gain (FCR) were recorded throughout the experiment.

During two-phase fattening (stage 1–30 to 70 kg BW, stage 2 – >70 kg BW), pigs were fed complete diets formu-lated in accordance with the Pig Nutrient Requirements, Polish edition (1993). The diets contained ground barley, ground wheat, soybean meal and guar meal in experimental groups. All diets were sup-plemented with commercial premix at 3 and 2.5% in the 1st and 2nd stage of fat-

tening, respectively (Table 1). The ani-mals had free access to water throughout the experiment.

Samples of experimental diets were analyzed for nutrient content, includ-ing crude protein, crude fat, crude fiber, dry matter and crude ash, by standard methods, at the Analytical Laboratory of the Department of Animal Nutrition and Feed Science, University of Warmia and Mazury in Olsztyn.

The cost of complete diets was calcu-lated based on their composition (feed ingredients) in the 1st and 2nd stage of fattening, and the prices of feed compo-nents in the 1st quarter of 2018. Since all pigs were kept under identical conditions during the experiment, feed efficiency was determined according to the sim-

TABLE 1. Feed ingredients

SpecificationGroup

1 2 3 41st stage of fatteningSoybean meal 21.50 16.20 10.90 5.50Guar meal – 4.90 9.90 14.60Wheat 30.00 30.00 30.00 30.00Barley 45.50 45.90 46.20 46.90Premix* 3.00 3.00 3.00 3.002nd stage of fatteningSoybean meal 15.00 11.25 7.50 3.75Guar meal – 3.40 6.80 10.30Wheat 25.00 25.00 25.00 25.00Barley 57.50 57.85 58.20 58.45Premix* 2.50 2.50 2.50 2.50

Premix: lysine – 8.4%, methionine – 2%, methionine and cystine - 2%, threonine – 2.5%, calcium – 17%, phosphorus – 2%, available phosphorus – 4%, total sodium – 4.4%, iron – 2000 mg, manga-nese – 1000 mg, zinc – 3500 mg, copper – 4000 mg, iodine – 26.6 mg, selenium – 6.6 mg, vitamins: A – 350 000 IU, D3 – 50 000 IU, E – 1 400 mg, K3 – 30 mg, B1 – 30 mg, B2 – 100 mg, B6 – 60 mg, B12

– 500 mcg, folic acid – 40 mg, pantothenic acid – 350 mg, niacin – 400 mg, choline chloride – 7 500 mg, amino acids: L-lysine, L-threonine, DL-methionine, phytase, antioxidants.



plified method proposed by Kim et al. (2017) where only feed cost was taken into account.

The results were processed statisti-cally by one-way analysis of variance (ANOVA), and the significance of dif-ferences between mean values in groups was estimated by Duncan’s test (Statis-tica 13.3).


The chemical composition of diets fed to pigs is presented in Table 2. The crude protein content of diets was consistent with the protein requirements of pigs (1993), and it ranged from 17.03 to 17.70% in the 1st stage of fattening, and from 14.69 to 15.57% in the 2nd stage of fattening. The fat content of diets was relatively low, from 0.84% in the control group in the 2nd stage of fattening to 1.75% in experimental group 3 in the 2nd stage of fattening. Along with the increase in the share of guar meal, the fat content in the feed increased. The crude fiber of diets varied, but it did not

exceed the maximum permissible level throughout the fattening period. All diets had similar dry matter content, ranging from 90.78 to 91.02%. The calculated concentration of metabolizable energy ranged from 12.93 MJ in the control diet in the 2nd stage of fattening to 13.48 MJ in experimental diet 3 in the 1st stage of fattening.

Mortality were not reported in any of the groups during the fattening period. In groups 3 and 4, diarrhea was noted in the initial phase of feeding diets with guar meal, but the symptoms subsided after several days of adaptation to the new feed. No treatment was required because feed intake did not decrease in groups 3 and 4, and weight loss was not observed. The fattening performance of pigs is pre-sented in Table 3. No significant differ-ences were found between groups during the fattening period which lasted from 97 days in group 1 to 101 days in groups 3 and 4. The average initial BW of pigs ranged from 30.1 kg in group 4 to 30.23 kg in the 1 group, and their average final BW at the end of fattening was as fol-

TABLE 2. Chemical composition (%) of pig diets

Specification

Group

1 2 3 4

1st period

(g)

2nd period

(G)

1st period

(g)

2nd period

(g)

1st period

(g)

2nd period

(g)

1st period

(g)

2nd period

(g)

Dry matter (%) 90.86 90.82 90.89 90.78 90.96 90.92 91.02 91.01

Crude protein (%) 17.09 15.35 17.40 14.69 17.70 15.57 17.03 15.39

Crude fat (%) 0.96 0.84 1.22 1.03 1.34 1.33 1.47 1.75

Crude fiber (%) 2.75 3.21 3.54 3.26 3.55 3.80 3.82 4.10

Crude ash (%) 4.28 3.62 4.37 3.59 4.19 3.65 4.42 3.19

Metabolizable energy (MJ EM) 13.00 12.93 13.16 13.04 13.33 13.15 13.48 13.27



TABLE 3. Fattening performance of pigs

SpecificationGroup

Total1 2 3 4

Number of animals N 16 16 16 16 64Duration of the fattening period (days)

1st stage of fatteningx– 49 49 54 59 23S 0 0 6.14 4.84 5.61

2nd stage of fatteningx– 48 49 47 43 46S 7.18 7.50 8.23 7.24 9.27

Total fattening periodx– 97 98 101 101 99S 7.18 7.5 7.5 7.50 7.56

Initial body weight (kg)x– 30.2 30.1 30.1 30.0 30.1S 4.36 3.76 4.76 3.33 3.99

Body weight at the beginning of the 2nd stage of fattening (kg)

x– 72.4 71.4 70.7 70.6 71.3S 7.21 8.15 5.41 5.21 6.49

Final body weight (kg)x– 115.3ab 117.0cd 109.8ac 106.8bd 112.2S 5.78 5.95 8.50 9.43 8.48

Average daily gain (g)

1st stage of fatteningx– 860 844 754 697 0.789S 108 111 98 90 121

2nd stage of fatteningx– 908 946 837 862 888S 112 101 139 237 158

Entire fattening periodx– 885ab 895cd 792ac 762bd 833S 88 86 111 120 116

Daily feed intake (kg)1st stage of fattening x– 2.26 2.36 2.13 2.00 2.192nd stage of fattening x– 2.60 2.64 2.47 2.48 2.55Entire fattening period x– 2.43 2.50 2.30 2.24 2.37Feed intake per kg body weight gain (kg)1st stage of fattening x– 2.67 2.80 2.87 2.91 2.832nd stage of fattening x– 2.90 2.73 3.03 3.10 2.96Entire fattening period x– 2.77 2.79 2.96 3.01 2.89

Means with the same letters differ signifi cantly between groups P ≤ 0.05

lows: 115.3, 117.0, 109.8 and 106.8 kg in groups 1, 2, 3 and 4, respectively. Sig-nificant differences (P ≤ 0.05) in average final BW were noted between groups 1 and 2, and between groups 3 and 4.

As shown in Table 3, partial replace-ment (50 and 75%) of SBM with guar meal had an adverse effect on average daily gain (ADG) during fattening period. Pigs from the C group and group 2 were



characterized by higher ADG (P ≤ 0.05) compared with groups 3 and 4. In a study by Heo et al. (1987), pigs fed diets con-taining 3, 6, 9 and 12% of guar meal were characterized by significant differences in ADG which reached 693 and 616 g in ani-mals receiving 9 and 12% of guar meal, respectively, compared with 757 g in the 1 group and 727 and 722 g in animals fed 3 and 6% of guar meal, respectively. Other studies investigating alternative protein sources to SBM in pig nutrition also produced satisfactory results (Thacker and Racz 2001, Roht-Maier et al. 2004). Castell and Cliplef (1993) demonstrated that growing-finishing pigs fed diets con-taining 12.4% of canola meal and 14.1% of pea screenings or 6.1% of canola meal and 28.3% of pea screenings achieved ADG of 850 and 880 g, respectively. Sim-ilar ADG (880 g) was reported by Müller and Bielfeldt (2013) in whose study, pigs were fed diets with rapeseed meal in the amount of 31.2 and 16.5% in the 1st and 2nd stage of fattening, respectively.

In the present study, feed intake per kg BW gain could be regarded as good. Table 3 data indicate that FCR values increased with increasing dietary inclu-sion levels of guar meal. However, the differences between mean values in groups were not significant.

The cost of feed per kg of BW gain was calculated based on total feed intake and the prices of feed components in the 1st quarter of 2018. The prices of complete

diets fed to pigs in the 1st and 2nd stage of fattening are presented in Table 4.

The inclusion of guar meal in diets reduced the cost of feed, from PLN 5.40 in 2 group in the 2nd stage of fattening to PLN 22 in experimental group 3 in the 1st stage of fattening, compared to the diets containing soy meal. The lowest feed cost per kg body weight gain was incurred in group 2 in the 2nd stage of fattening – PLN 2.29. Although group 4 pigs received the cheapest feed, the cost of 1 kg BW gain was highest in this group – PLN 2.61 in the 1st stage of fattening and PLN 2.55 in the 2nd stage of fatten-ing. Sońta et al. (2015) performed a sim-plified feed cost and production income analysis and found that the cost of 1 kg feed per 1 kg BW gain was lower in pigs fed diets containing 5% of blue lupine as a supplementary protein source.

CONLUSION

The results of this study indicate that partial (25%) replacement of SBM with guar meal in complete diets for finish-ing pigs had no negative effect on their productivity. The dietary supplementa-tion with guar meal at 25% was found to be economically justified. However, the above inclusion level of guar meal, used as a substitute for SBM in pig diets, should not be exceeded because greater amounts of guar meal could adversely affect the cost-effectiveness of pig fatten-

TABLE 4. Price of 1 ton of complete pig diets (PLN)

SpecificationGroup

1 2 3 41st stage of fattening 933.80 922.20 911.60 897.202nd stage of fattening 847.50 838.70 830.00 822.10



ing. Only a few studies have investigated the use of guar meal as an alternative protein source to SBM, therefore further research is needed to evaluate the effi-cacy of guar meal in pig nutrition.

REFERENCES

CASTELL A.G., CLIPLEF R. L. 1993: Evalu-ation of pea screenings and canola meal as a supplementary protein source in barley-based diets fed to growing finishing pigs. Can. J. Anim. Sci. 73: 129–139.

CRÉPON K., MARGET P., PEYRONNET C., CARROUÉE B., ARESE P., DUC G. 2010: Nutritional value of faba bean (Vicia faba L.) seeds for feed and food. Field Crops Res. 115: 329–339.

GRUDNIEWSKA B. 1975: Wzrost prosiąt przy zastosowaniu trzech mieszanek pełnoporcjo-wych o różnych poziomach białka. Zesz. Nauk. Akad. Roln.-Techn. w Olsztynie, Zootechnika 144(9): 3–50.

HANCZAKOWSKA E., KSIĘŻAK J. 2002: Kra-jowe źródła białkowych pasz roślinnych jako zamienniki śruty sojowej GMO w żywieniu świń. Roczn. Nauk. Zoot. 39(2): 171–187.

HEO P.S., LEE S.W., KIM D.H., LEE K.H., KIM Y.Y. 1987: Various levels of guar meal supple-mentation on growth performance and meat quality in growing-finishing pigs. J. Anim. Sci. 87, E-Suppl. 2/J. Dairy Sci. 92, E-Suppl. 1.

HUMPHREY R.M., YANG Z., HASAN M.S., CRENSHAW M.A., BRETT J., RUDE B.J., BUBBA BURCH H.B., LIAO S.F. 2018: 517 Amino Acid Profile of Guarpro F-71, a Poten-tial Protein Source for Swine and Other Agri-cultural Animals in the United States., J. Anim. Sci. 96, suppl. 2, 275–276. DOI: https://doi.org/10.1093/jas/sky073.514.

KACZMAREK P., KORNIEWICZ D., LIPIŃSKI K., MAZUR M., 2016: Chemical composition of rapeseed products and their use in pig nutri-tion. Pol. J. Natur. Sci. 31(4): 545–562.

KARPIESIUK K., FALKOWSKI J., RAUBO B., KOZERA W., BUGNACKA D. 2016: Wpływ systemu chowu i sposoby żywienia tuczników na ich wartość rzeźną i jakość mięsa. [Effect of rearing system and feeding method of fatte-ners on their slaughter value and meat quality].

Żywność. Nauka, Technologia, Jakość 5(108): 45–59 [in Polish].

KARPIESIUK K., KOZERA W., BUGNACKA D., FALKOWSKI J. 2013: Wpływ warun-ków chowu tuczników na jakość mięsa i profil kwasów tłuszczowych w mięśniu najdłuższym grzbietu. [Effect of rearing system conditions of fatteners on meat quality and profile of fat-ty acids in M. Longissimus dorsi]. Żywność. Nauka. Technologia. Jakość 3(88): 39–50 [in Polish].

KIM H.J., NAM S.O., JEONG J.H., FANG L.H., YOO H.B., YOO S.H., HONG J.S., SON W.W., HA S.H., KIM Y.Y. 2017: Various levels of co-pra meal supplementation with β-Mannanase on growth performance, blood profile, nutri-ent digestibility, pork quality and economical analysis in growing-finishing pigs. J. Ani. Sci. Technol. 59: 19. DOI: http://doi.org/10.1186/s40781-017-0144-6

KULTHE A.A., THORAT S.S., LANDE S.B. 2017: Preparation of β -Carotene En-riched Pearl Millet Based Cookies. Intern. J. Current Microbiol. Appl. Sci. 6(2): 1197-1203 DOI: http://dx.doi.org/10.20546/ijc-mas.2017.602.136

LEBRET B., ECOLAN P., BONHOMME N., MÉTEAU K., PRUNIER A. 2015: Influence of production system in local and conventional pig breeds on stress indicators at slaughter, muscle and meat traits and pork eating quality. Animal 9(8): 1404–1413.

LISIAK D., GRZEŚKOWIAK E., JANISZEW-SKI P., BORZUTA K., PEPLIŃSKI B., WAJSZCZUK K. 2014: Wpływ intensywności żywienia tuczników na jakość mięsa. [Effect of feeding intensity of fatteners on quality of meat]. Żywność. Nauka. Technologia. Jakość 6(97): 102–112 [in Polish].

MÜLLER K., BIELFELDT J. 2013: Kann Soja durch Raps auch im Mastfutter ersetzt werden. Baureblatt 8: 50–51.

Normy żywienia świń – Pig Nutrient Require-ments, Polish edition 1993: Omnitech Press Warszawa.

OKORSKI A. POLAK-SLIWINSKA M. KARPI-ESIUK K. PSZCZOLKOWSKA A. KOZERA W. 2017: Real time PCR: a good tool to es-timate mycotoxin contamination in pig di-ets. World Mycotoxin J. 10: 219–228. DOI: 10.3920/WMJ2016.2137.



PÍSAŘÍKOVÁ B, ZRALÝ Z. 2009: Nutritional value of lupine in the diets for pigs (a review). Acta Vet. Brno 78: 399–409.

ROTH-MAIER D.A,. BÖHMER B. M., ROTH F.X. 2004: Effects of feeding canola meal and sweet lupin (L. luteus, L. angustifolius) in ami-no acid balanced diets on growth performance and carcass characteristics of growing-finishing pigs. Anim. Res. 53(1): 21–34.

SAEED M., HASSAN F.U., SHAH Q.A., ARA-IN M.A., EL-HACK M.E.A., ALAGAWANY M., DHAMA K. 2017: Practical application of guar (cyamopsis tetragonoloba l. Taub) meal in poultry nutrition. Adv. Anim. Vet. Sci. 5(12): 491–499.

SMITH L.A., HOUDIJK J.G.M., HOMER D., KYRIAZAKIS I., 2013: Effects of dietary inclu-sion of pea and faba bean as a replacement for soybean meal on grower and finisher pig perfor-mance and carcass quality. J. Anim. Sci. 91(8): 3733–3741.

SOŃTA M., REKIEL A., WIĘCEK J. 2015: Efek-tywność stosowania mieszanek z udziałem łubi-nu wąskolistnego w żywieniu świń rosnących. [Effectiveness of the use of mixtures containing narrow-leafed lupin in the diet of growing pigs] Rocz. Nauk. PTZ 11(1): 35–46 [in Polish].

SOŃTA M., REKIEL A., WIĘCEK J. 2016: Efek-tywność tuczu świń mieszankami z udziałem łubinu żółtego (Lupinus luteus). [The efficiency of fattening pigs with mixtures containing yel-low lupine (Lupinus luteus)]. Rocz. Nauk. PTZ 12(2): 9–18 [in Polish].

STATISTICA. StatSoft, Inc. 2017. www.statsoft.com.

THACKER P.A., RACZ V.J. 2001: Performance of Growing/Finishing Pigs Fed Hulled and Dehu-lled Peas With and Without Dietary Enzymes. Asian-Austr. J. Anim. Sci. 14(10): 1434–1439. DOI: https://doi.org/10.5713/ajas.2001.1434

VERMA S.V.S., McNAB M.J, 1984: Chemical, biochemical and microbiological examination of guar meal. Indian J. Poultry Sci. 19: 165–170.

Streszczenie: Wpływ częściowego zastąpienia białka poekstrakcyjnej śruty sojowej, białkiem pochodzącym ze śruty guar (Cyamopsis tetrago-

noloba) na efektywność tuczu świń. Ze względu na rosnące spożycie mięsa, problem poszukiwa-nia i wykorzystania zasobów białkowych jest cią-gle aktualnym tematem opracowań naukowych. Celem badań była ocena możliwości wykorzy-stania śruty guar jako źródło białka w żywieniu tuczników. Doświadczenie przeprowadzono na 64 tucznikach mieszańcach F2 pochodzących z krzyżowania towarowego prostego [♀(♀pol-ska biała zwisłoucha × ♂ wielka biała polska) × ♂ (♀ pietrain × ♂ duroc). Tucz prowadzono od średniej masy ciała 30,1 kg do 112,2 kg. Zwie-rzęta z grupy I (kontrolnej) żywione były zbożo-wo sojową mieszanką pełnoporcjową, natomiast w mieszankach przeznaczonych dla tuczników z grup doświadczalnych część białka poekstrak-cyjnej śruty sojowej zastąpiono białkiem śruty guar w ilościach odpowiednio: 25, 50 i 75% (2, 3, 4) Uzyskano dobre wyniki tuczne, przyrosty do-bowe masy ciała w grupie II były najwyższe, nie zanotowano istotnej różnicy w stosunku do grupy I, a istotnie wyższe w porównaniu do grupy III i IV. Najkorzystniejsze okazało się zastosowanie 25% udziału białka pochodzącego ze śruty guar w mieszance II, a tuczniki z tej grupy najlepiej przyrastały oraz wykorzystywały paszę. Wyko-nana analiza ekonomiczna wykazała na najniższy koszt przyrostu 1 kg masy ciała tuczników z gru-py II w II okresie tuczu – 2,99 zł.

Słowa kluczowe: tuczniki, poekstrakcyjna śruta sojowa, poekstrakcyjna śruta guar, białko, cechy produkcyjne, ekonomiczna efektywność tuczu


Author’s address:Krzysztof KarpiesiukKatedra Hodowli Trzody ChlewnejWydział Bioinżynierii ZwierzątUniwersytet Warmińsko-Mazurski w Olsztynieul. Oczapowskiego 5, 10-719 Olsztyn, Polande-mail: [email protected]



The efficiency of dairy cattle nutrition on chosen farmsof central-eastern Poland

BOŻENA KICZOROWSKA1, RENATA KLEBANIUK1,EDYTA KOWALCZUK-VASILEV1, MACIEJ BĄKOWSKI1,WIOLETTA SAMOLIŃSKA1, PIOTR JARZYNA1, ZWENYSLAVA ZASADNA2, MAGDALENA OLCHA1, MAŁGORZATA KWIECIEŃ1, ANNA WINIARSKA-MIECZAN1, MALWINA ZAJĄC1, ALI R.M. AL-YASIRY1,3, ANNA DANEK-MAJEWSKA1

1 Institute of Animal Nutrition and Bromatology, University of Life Science in Lublin,2 The State Scientific Research Control Institute of Veterinary Medicinal Products and Feed Additives in Lviv

3 Department of Animal Resources, University of Wasit, Al Kut, Wasit, Iraq

Abstract: The effi ciency of dairy cattle nutri-tion on chosen farms of central-eastern Poland. Practical nutrition of dairy cows should take into account the physiology of digestion in rumi-nants and the genetic potential of these animals. A fundamental role in their appropriate nutrition is played by detailed assessment of the nutritive value of applied diets. The aim of the study was to analyse the effectiveness of feeding dairy cows with feed doses balanced in accordance with the INRA system in different periods of lactation and to evaluate the nutritive value of the diets as well as the milk yield and composition. The research was carried out on eight farms rearing on average 55 black-and-white Holstein-Friesian dairy cows. The cows in the study farms were fed in accordan-ce with the PMR system. Mixed rations admini-stered twice a day from the mixer wagon were the basic diet for the milk cows. Cows yielding more than 20 litres of milk received complementary fe-edstuffs from a feeding station. The investigations demonstrated an adequate and characteristic che-mical composition and nutritive value of the feed-stuffs. The effi ciency of milk production and the composition of the milk produced by the farmed cows did not differ signifi cantly from the avera-ge values typical of the black-and-white variety

of the Polish Holstein-Friesian breed. The results confi rmed the advisability of balancing food ra-tions based on modern feed evaluation systems.

Key words: nutrition, dairy cows, effi ciency of milk production, milk chemical composition

INTRODUCTION

Practical nutrition of dairy cows should take into account the physiology of digestion in ruminants and the genetic potential of these animals. This facilitates adequate identification of nutritional requirements and, consequently, optimal balancing of feed rations (Vandehaar et al. 2016). Errors in cattle nutrition result not only in reduced productivity but also in health disorders. Solution of the nutritional, metabolic, or deficiency-related problems affecting the function of many organs can improve the general health status of the herd and reduce the incidence of animals’ disease on the farm


350 B. Kiczorowska et al.

(Van and Sniffen 2014, Klebaniuk et al. 2016, Klebaniuk et al. 2017).

A fundamental role in appropriate animal nutrition is played by thorough assessment of the nutritive value of applied diets. Underestimation of their value prevents optimal coverage of nutri-tional needs. This may result in a low level of production despite the high genetic potential, especially in dairy cows. The current methods for assessment of the feed value take into account the digest-ibility of protein and energy both inside and outside the rumen. Consideration of the protein and energy balance provides more detailed and accurate coverage of cows’ nutritional requirements (Daniel et al. 2017, Klebaniuk et al. 2018).

The aim of the study was to analyse the effectiveness of feeding dairy cows with diets balanced in accordance with the INRA recommendation (Strzetelski et al. 2014) in different periods of lacta-tion and to evaluate the nutritive value of the diets as well as the milk yield and composition.


The investigations were carried out between September 2017 and January 2018 on eight farms located in Lubelskie and Podlaskie Provinces. The black-and-white Polish Holstein-Friesian cows and young stock reared for rejuvenation of the herd were kept on the farms. The same system of nutrition and feed administra-tion and the cattle maintenance system (free-stall with division into production groups) were applied on the analysed farms. During the research period, the average number of animals per herd was 110, including 55 dairy cows. The

average area of the farms was 65 ha, with 20 ha of silage maize cultivation, 25 ha of grassland, and 20 ha covered by cereal cultivation.

Every two weeks during the study, the balance in the feed rations applied was evaluated and corrected with reference to the productivity of the cows, and sam-ples were collected for chemical analy-ses. The contents of basic nutrients, i.e. dry matter (d.m.), crude protein, crude fibre, ether extract, and crude ash in the roughage-concentrate mixtures were analysed according to the AOAC (2012) standards. The nutritive value of the feed ration components was calculated on the basis of their chemical composition using programme Winwar ver. 2.1.3.13.

The assessment of the milk yield and composition was carried out for over five months based on reports on monthly cow milking trials conducted by the Polish Federation of Cattle Breeders and Milk Producers. In each herd, four production groups of cows were distinguished with reference to the lactation days (early lac-tation – up to day 40 after calving, from lactation day 41 to 100, from lactation day 101 to 200, and after lactation day 200) in accordance with the milk yield report as well as a group of dry cows.

The results of the chemical composi-tion and nutritive value of feed as well as data on the milk yield and composition were subjected to basic statistical analy-sis, and means and standard deviations (SD) were calculated. One-way analysis of variance with Duncan’s test (α = 95; P < 0.05) was applied to the results of the nutritive value of the feedstuffs sampled on each farm. There were no statisti-cally significant differences between the values of the determined parameters


The effi ciency of dairy cattle nutrition on chosen farms... 351

between the farms; hence, the paper presents means from the entire experi-ment (from eight farms). The results were analysed statistically with the use of Statistica 10.0 software (StatSoft Inc. 2011).


The cows on the analysed farms were fed following the PMR (Partial Mixed Ration) system.

Mixed rations administered twice a day from the mixer wagon were the basic diet for the milk cows (Table 1). Additionally, cows yielding more than 20 litres of milk received complementa-ry feedstuffs from a feeding station. The ‘Bestermine Somi’ mineral feed blend, ‘Rumen Activ’ buffering agent concen-trate, baking soda, and chalk fodder were used as feed additives in accordance with the manufacturer’s recommendations and animals’ needs

Additionally, the cows had unlim-ited access to a salt lick composed of NaCl 97%, Cu 1200 mg/kg, and Co 100 mg/kg.

In the first lactation period, the cows also received a commercial “starter diet” from a feeding station (post-extraction soybean meal, wheat, protected fat, ‘Rumen Activ’ buffering agents). Addi-tionally, cows yielding over 20 litres per day throughout the lactation period were administered complementary feedstuffs (Table 2) as recommended (Strzetelski et al. 2014).

The protein concentrate and post-extraction soybean meal were the main sources of protein in the roughage, as they provided 315.9 and 252.4 PDIN as well as 215.7 and 147.0 PDIE, respec-tively, in 1 kg d.m. of the blend. The “starter” diet, complementary feedstuffs, and cereal meal administered as energet-ic fodder provided on average 1.05 UFL and met the recommended proportions of the energy-protein ratio optimally for the production groups of the dairy cows (Table 2). The highest values of filling parameters among the roughages were determined for wheat straw (1.6 LFU/1 kg d.m.), whereas the other roughages provided on average 1.06 LFU/1 kg d.m. (Table 3). The chemical composition and nutritive value of the feeds were characteristic for this type of feedstuffs and similar to these parameters reported in the literature (Strzetelski et al. 2014, Lamminen et al. 2017).

The data on the nutritional value per 1 kg d.w. of PMR (Table 3) indicate that the feed ration for the cows met their average requirement at production of 20 litres of milk. In comparison with lit-erature reports (Strzetelski et. al. 2014), the ration was shown to contain a slight excess of PDI protein. The mean feed dose per milk cow (body weight: 680 kg, milk yield: 20 litres, fat and protein con-

TABLE 1. Average composition of the basic diet

Type of feed Amount (%)Wheat straw 1.0Haylage 28.3Maize silage 40.5Beet pulp silage 20.3Cereal meal* 4.5Protein concentrate 40% 2.0Post-extraction rapeseed meal 3.0Feed additives 0.4

*average composition: wheat 50%, barley 35%, triticale 5%, maize 10%



TABLE 2. Average chemical composition of applied feedstuffs

ParametersFeedstuff

Post-extraction rapeseed meal

“Starter” mixture Cereal meal Complemen-

tary feedstuffs Protein

concentrate Dry matter (%) 87.97 88.22 85.87 87.74 87.89SD ±0.24 ±0.48 ±1.26 ±0.98 ±0.48

Per 1 kg dry matter (g)Crude ash 76.5 105.4 20.7 88.0 77.0SD ±0.15 ±0.21 ±0.34 ±0.54 ±0.96Crude protein 442.8 268.0 148.8 251.3 504.5SD ±1.24 ±0.48 ±1.26 ±0.94 ±0.31Crude fat 27.7 52.5 16.2 35.1 19.2SD ±0.57 ±0.74 ±0.32 ±0.94 ±0.31Crude fibre 134.1 86.2 37.3 92.7 104.9SD ±0.49 ±0.32 ±0.15 ±0.47 ±0.84NFE 318.9 487.9 777.0 532.9 294.3SD ±0.32 ±0.61 ±0.32 ±0.24 ±0.35

Nutritive value per 1 kg dry weightUFL 0.96 1.05 1.06 1.03 1.05PDIN (g) 252.4 159.7 86.3 150.8 315.9PDIE (g) 147.0 112.1 93.8 115.6 215.7LFU – – – – –

SD – standard deviation; NFE – nitrogen-free extract; UFL = Feed Unit for milk production; PDIN = protein truly digestible in the small intestine when N limits microbial protein synthesis; PDIE = protein truly digestible in the small intestine when energy limits microbial protein synthesis; LFU – fill units for cows

tent in the milk: 4.45 and 3.50%, respec-tively) exceeded the demand for PDIE in 4.5% and for PDIN in 6.3% at 0.5% energy excess.

Balancing the feed ration, especially in terms of energy and protein supply, is a prerequisite for the normal course of metabolic processes and the efficiency of milk production consistent with the cow’s milk yield potential accompa-nied by an appropriate composition of milk (Matras et al. 2000, Sobotka et al. 2014). In order to reduce the PDI pro-tein excess in the cows’ feed ration, it

is advisable to limit the proportion of feeds providing this type of protein, mainly post-extraction rapeseed meal. However, it can be assumed that, with such inconsiderable differences between the demand and supply meeting the feed requirements, the average daily feed intake in the ration as well as the energy and protein demand in cows with spe-cific milk production levels, estimated according to the standards (Strzetelski et al. 2014), in the respective nutrition periods revealed optimum balance of the feed rations.



Milk brought to collecting centres should contain on average 3.2% of pro-tein, 3.8% of fat. The milk from the ana-lysed farms was characterised by a good

chemical composition meeting the pur-chase requirements (Table 4).

The present investigations have con-firmed the possibility of maintenance of

TABLE 3. Average chemical composition of the roughages included in PMR and the whole PMR on the experimental farms

Parameters Wheat straw Beet pulp silage Haylage Maize silage PMRDry matter (%) 89.17 23.18 55.31 36.39 46.34SD ±0.24 ±0.37 ±1.08 ±0.98 ±0.64

Per 1 kg dry matter (g)Crude ash 42.0 77.8 68.0 106.0 87.6SD ±0.54 ±0.31 ±0.54 ±0.38 ±0.91Crude protein 34.6 104.3 180.9 89.8 147.6SD ±0.64 ±0.75 ±0.31 ±0.42 ±0.84Crude fat 15.9 4.9 38.4 38.7 24.3SD ±0.95 ±0.09 ±0.21 ±0.19 ±0.13Crude fibre 429.8 194.2 213.4 181.8 275.6SD ±0.97 ±0.23 ±0.64 ±0.84 ±0.32NFE 477.7 618.8 499.2 583.7 464.9SD ±0.26 ±0.38 ±0.51 ±0.84 ±0.62

Nutritive value per 1 kg dry weightUFL 0.40 0.98 0.92 0.81 0.80PDIN (g) 20.1 67.6 103.5 53.1 87.2PDIE (g) 41.9 84.6 88.6 70.0 85.5LFU 1.60 1.05 1.10 1.03 0.97

SD – standard deviation; PMR (Partial Mixed Ration); NFE – nitrogen-free extract; UFL = Feed Unit for milk production; PDIN = protein truly digestible in the small intestine when N limits microbial protein synthesis; PDIE = protein truly digestible in the small intestine when energy limits microbial protein synthesis; LFU – fill units for cows

TABLE 4. Milk yields and composition

Lactation, days CowsYield (kg) Fat (%) Protein (%)

mean SD mean SD mean SD1–40 7 32.1 ±0.21 4.32 ±0.09 3.31 ±0.0641–100 8 32.2 ±0.18 4.10 ±0.05 3.28 ±0.04101–200 14 26.6 ±0.15 4.59 ±0.07 3.56 ±0.12Over 200 16 24.2 ±0.09 4.57 ±0.06 3.86 ±0.08Mean 45 27.5 ±0.13 4.45 ±0.05 3.50 ±0.07

SD – standard deviation



high milk yields in dairy cows receiving optimal nutrition, which were higher (Table 4) than the average value (23–25 kg) reported in the literature (Sobotka et. al. 2011). The protein content in milk is largely dependent on genetic deter-minants, whereas the fat content can be modified with adequate nutrition. The amount of fat in milk depends on the ratio of roughage to concentrate mixtures in the feed ration. Additionally, the physi-cal structure of roughage as well as the concentration and composition of struc-tural carbohydrates (crude fibre, ADF, and NDF) contribute to an increase in the fat content in milk (Bąkowski et al. 2013, Stoffel et al. 2015). The average fat content in the milk produced on the ana-lysed farms was approximately 4.3%. The chemical composition of the milk col-lected from the experimental cows varied depending on the lactation period, and the best nutritive values were determined for the milk produced by cows lactating for over 200 days. Similar results were obtained by Van Knegsel et al. (2014), who investigated Holstein-Friesian dairy cows as well. To improve the chemical composition of milk from early lactation, they shortened or even omitted the drying period, which shifted the milk yield from the postpartum to the prepartum period and improved the energy balance in the early lactation period.

SUMMARY

The present study demonstrated an adequate and characteristic chemical composition and the nutritive value of the feedstuffs. The efficiency of milk production and the composition of the milk yielded by the cows on the analysed

farms did not differ substantially from the average values typical of the black-and-white variety of the Polish Holstein-Friesian breed. The results confirmed the advisability of balancing food rations based on the modern INRA feed evalua-tion system.

REFERENCES

AOAC 2012: Official methods of analysis of the AOAC International. 19th Edition. Horwitz W, Latimer Jr. GW (Eds.), Gaithersburg, Mary-land, USA.

BĄKOWSKI M., KICZOROWSKA B., MAR-CZUK J., KLEBANIUK R. 2013: Struktura dawki pokarmowej a zdrowotność krów mlecz-nych. Polskie Towarzystwo Nauk Weterynaryj-nych Oddział Łomżyńsko-Ostrołęcki, Łomża, in: Profilaktyka, rozpoznanie i leczenie chorób o etiologii żywieniowej u krów mlecznych. 145–160.

DANIEL J.B., FRIGGENS N.C., VAN LAAR H., FERRIS CP., SAUVANT D. 2017: A me-thod to estimate cow potential and subsequent responses to energy and protein supply accor-ding to stage of lactation. J. Dairy Sci. 100(5): 3641–3657.

KLEBANIUK R., KOCHMAN G., KOWAL-CZUK-VASILEV E., GRELA E.R., BĄKOW-SKI M., OLCHA M., DUNSTER F. 2016: Energy efficiency of diet for periparturient dairy cows supplemented with free fatty acids or glucogenic additives. Med. Wet. 72(12): 760–767

KLEBANIUK R., KOCHMAN G., KOWAL-CZUK-VASILEV E., GRELA E.R., KOWAL-CZYK-PECKA D., BĄKOWSKI M. 2018: Dietary supplementation with glucogenic pre-cusors and fatty acids improves performan-ce and health of periparturient dairy cows. Anim. Prod. Sci. DOI: https://doi.org/10.1071/AN16550. Submitted: 12 August 2016 Accep-ted: 14 September 2017. Published online: 14 December 2017

KLEBANIUK R., KOWALCZUK-VASILEV E., BĄKOWSKI M., ROCKI G., GRELA E.R., KICZOROWSKA B., MATRAS J., WIDZ J., KĘPKA K. 2017: Effectiveness of herbal



mixtures in beef cattle feeding, Med. Wet. 73(12): 751–755.

KNEGSEL van A.T.M., REMMELINK G.J., JORJONG S., FIEVEZ V., KEMP B. 2014: Effect of dry period length and dietary energy source on energy balance, milk yield, and milk composition of dairy cows. J. Dairy Sci. 9(3): 1499–1512.

LAMMINEN M., HALMEMIES-BEAUCHET-FILLEAU A., KOKKONEN T., SIMPURA I., JAAKKOLA S., VANHATALO A. 2017: Comparison of microalgae and rapeseed meal as supplementary protein in the grass silage based nutrition of dairy cows. Anim. Feed Sci. Technol. 234: 295–311.

MATRAS J., KLEBANIUK R., BUJANOWICZ B., WOJTASIK J. 2000: Zawartość białka i tłuszczu oraz jakość mleka krów w zależności od modelu żywienia w gospodarstwach specja-listycznych środkowo-wschodniej Polski [Pro-tein and fat concent and quality of milk of cows depending on the feeding model in Specialist farms of south-east Poland]. Rocz. Nauk Zoot. Supl. 6: 82–87 [in Polish].

SOBOTKA W., MICIŃSKI J., MATUSEVICIUS P., STANISKIENE BIRUTE., SOBIECH M., ZWIERZCHOWSKI G., FIEDOROWICZ E., PIETRZAK-FIECKO M. 2014: The effect of cattle breed and lactation stage on nutrient concentrations in milk and fatty acid profile of milk fat. Vet. Med. Zoot., 65(87): 85–90.

SOBOTKA W., MICIŃSKI J., WRÓBLEWSKI P., ZWIERZCHOWSKI G. 2011: Wpływ sys-temu żywienia tradycyjnego i TMR na pobra-nie paszy przez krowy, ich wydajność, skład mleka i jego jakość higieniczną. Rocz. Nauk PTZ 7(4): 87–96.

StatSoft 2011: Statistica (Data analysis software system), version 10. StatSoft® Inc., License No. AXAP307F818708FA-K

STOFFEL C.M., CRUMP P.M., ARMENTANO L.E. 2015: Effect of dietary fatty acid sup-plements, varying in fatty acid composition, on milk fat secretion in dairy cattle fed diets supplemented to less than 3% total fatty acids. J. Dairy Sci. 98(1): 431–442.

STRZETELSKI J.A., BRZÓSKA F., KOWAL-SKI Z. M., OSIĘGŁOWSKI S. 2014: IZ PIB – INRA Zalecenia Żywieniowe dla Przeżuwaczy i Tabele wartości pokarmowej pasz. Fundacja IZ PIB, Kraków.

VAN R.S., SNIFFEN C.J. 2014: Transition cow nutrition and feeding management for disease prevention. The Veterinary Clinics of North America. Food Anim. Pract. 30(3): 689–719.

VANDEHAAR M.J., ARMENTANO L.E., WE-IGEL K., SPURLOCK D.M., TEMPELMAN R.J., VEERKAMP R. 2016: Harnessing the genetics of the modern dairy cow to continue improvements in feed efficiency. J. Dairy Sci. 99(6): 4941–4954.

Streszczenie: Efektywność żywienia krów mlecz-nych w wybranych gospodarstwach środkowo-wschodniej Polski. Praktyczne żywienie krów mlecznych powinno uwzględniać fizjologię tra-wienia u przeżuwaczy oraz potencjał genetycz-ny zwierząt, a podstawową rolę w prawidłowym żywieniu tych zwierząt odgrywa szczegółowa ocena wartości pokarmowej skarmianych pasz. Za cel pracy przyjęto analizę efektywności żywie-nia krów mlecznych w różnych okresach laktacji, przy bilansowaniu dawek pokarmowych według systemu INRA, oceniając wartość pokarmową skarmianych pasz w dawkach oraz wydajność i skład mleka. Badania przeprowadzono w ośmiu gospodarstwach utrzymujących krowy rasy holsz-tyńsko-fryzyjskiej odmiany czarno-białej, średnio 55 krów mlecznych. Krowy w gospodarstwach objętych badaniami żywione były w systemie PMR. Podstawową dawkę pokarmową dla krów dojnych stanowiły wymieszane pasze zadawane dwa razy dziennie z wozu paszowego, a dodatko-wo krowy o wydajności powyżej 20 litrów mleka otrzymywały mieszankę treściwą uzupełniającą ze stacji paszowej. W przeprowadzonych badaniach stwierdzono, że skład chemiczny oraz wartość po-karmowa pasz były prawidłowe i charakterystycz-ne dla ich rodzaju. Wydajność krów i skład mleka krów w analizowanych gospodarstwach nie od-biegały zasadniczo od wartości średnich dla krów rasy polskiej holsztyńsko-fryzyjskiej, odmiany czarno-białej. Wyniki potwierdziły zasadność bi-lansowania dawek pokarmowych na podstawie współczesnych systemów wartościowania pasz.

Słowa kluczowe: żywienie, krowy mleczne, wy-dajność, skład mleka




Authors’ address:Renata KlebaniukInstytut Żywienia Zwierząt i BromatologiiWydział Biologii, Nauk o Zwierzętachi BiogospodarkiUniwersytet Przyrodniczy w Lublinieul. Akademicka 13, 20-950 LublinPolande-mail: [email protected]



The comparison of Polish Halfbred mares utility basedon the results of field performance tests conducted in 2002–2015

MAŁGORZATA MAŚKO, ANNA KRAJEWSKA, WANDA OLECHFaculty of Animal Science, Warsaw University of Life Sciences – SGGW

Abstract: The comparison of Polish Halfbred mares utility based on the results of fi eld perform-ance tests conducted in 2002–2015. The aim of the study was to analyze Polish Halfbred mares utility, basing on fi eld performance test results. 913 evaluated mares belonged to Malopolska (mlp), Wielkopolska (wlkp), Polish Halfbred (PKSP) and imported breeds (imp). Comparing results obtained in 2002–2015 of mlp, wlkp and PKSP mares, signifi cantly higher average fi nal re-sult and signifi cantly higher results for canter for mlp and sp mares than for wlkp mares were ob-served. Signifi cantly higher result for free jumps was observed for PKSP mares than for other breeds. Imported mares got signifi cantly higher results compared to national breeds. In conducted research PKSP mares are not signifi cantly more useful to saddle utility than mlp and wlkp horses. Existing gap in utility level between Polish and imported horses should be fi lled by a scrupulous realization of breeding programs and particular selection conducted in order to achieve popula-tion that may fulfi ll requirements of performance equestrian sport.

Key words: half-bred mares, fi eld performance tests, utility value

INTRODUCTION

The change in direction of usage of halfbred horses from versatile to saddle model caused, that majority of horses, referred to as noble, are used for horse

riding on more or less professional level. Horses selected for sport are subject of clearly defined expectations of their sports predispositions (Górecka et al. 2008). Cleverness, willingness to cooperate, obedience, trust and quick response to commands are appreciated in dressage. In show jumping, power with a proper perception of bascule is preferred. Horses selected to Three-Day Eventing are expected to have innate strength, utility performance, and versa-tile skills, obedience and trust to the rider (Próchniak 2017). Requirements for recreational riding horses are lower, in the context of adapting to the skills and physical traits of novice riders and also specific horse biomechanics ensuring comfort during riding (especially in walk and trot) (Janczarek and Wilk 2017).

The main goal of current breeding and maintenance of Malopolska (mlp) breed is obtaining horses for various sports disciplines, in particular, Three-Day Eventing (Malopolska Breeding Program 2005). Wielkopolska (wlkp) horse breeding is focused on competi-tive horse sports and also leisure horse riding (Wielkopolska Breeding Program 2005). However, the superior goal for Polish Halfbred (PKSP) horse breeding


358 M. Maśko, A. Krajewska, W. Olech

program is to get professional jump-ing or dressage horse (Polish Halfbred Breeding Program 2005).

According to Polish Halfbred Horse breeding program, the selection of Malo-polska (Malopolska Breeding Program 2005), Wielkopolska (Wielkopolska Breeding Program 2005) and PKSP horses (Polish Halfbred Breeding Pro-gram 2005) should be based not only on biometrics and type indicators but also on results of performance tests. It is stated that mares should be subjected to utility value assessment as carefully as stallions in the field of performance test or stationary test in training stations (Jończyk 2001, Byszewski 2009).

One day field performance test (PPW) is perceived as fast and easy to conduct for mare utility value evaluation. In PPW the following exercises are assessed from 0 to 10 points: walk, trot, canter and free jumping (without rider). Also, an independent rider is assessing apti-tude to saddle use (rideability). Energy, stride length and regularity are evalu-ated in walk and trot. In canter (pace 350 m/min), lightness of forelimbs and engagement of hindquarters are also evaluated. In free jumping, a jump style, facility, jumping potential, and courage are assessed. The last part of PPW, ride-ability, includes a willingness to work with rider and reaction on basic riding aids in walk, trot, and canter. Among PPW advantages should be mentioned: low costs, ease of conducting a test and possibility of early evaluation of mares’ predisposition, based on highly inher-ited traits, therefore a high accuracy of utility value evaluation (Chrzanowski et al. 2012). PPW is considered the most approachable performance test for

breeders due to self-contained mares’ preparation to test (conducted by owner) and fast, objective assessment, without significant costs. Those advantages, including the necessity of developing the most objective method of utility value evaluation are indicated by many authors (Szarska and Cywińska 2009, Kaproń 2001, 2006, Lewczuk 2004).

According to the breeding program of a Polish Halfbred Horse, national Polish breeds (Wielkopolska and Malopolska) are versatile breeds, with a limited pre-disposition to professional sports per-formance. Moreover, authors of cited programs regard that many individuals of mlp and wlkp breeds, or possibly most individuals, constantly represent versatile utility type (Polish Halfbred Breeding Program 2005). As mlp and wlkp breeds are considered a priceless value for Polish culture, that hypothesis requires detailed verification.

The aim of the study was to evalu-ate Polish Halfbred mares in the aspect of utility and comparison of results of field performance tests in Malopolska, Wielkopolska and Polish Halfbred mares against imported mares’ results. Obtained results allow evaluating usage predispositions of mares in accordance with particular Polish Halfbred Horses breeding programs.


Material for research were results of field performance test (PPW) of 913 mares, obtained in 2002–2015. Evaluated horses belong to following breeds: Malopolska (N = 60), Wielkopolska (N = 345), Polish Halfbred (N = 428) and other (imported: KWPN – the Koninklijk Warmbloed


The comparison of Polish Halfbred mares utility... 359

Paardenstamboek Nederland, Holsteiner, Hanoverian, BWB – Belgian Warm-blood, SF – Selle Français) (N = 80). Detailed results were received from the main database of Polish Horse Breeders Association (PZHK). Values of evaluated traits were imported to a Microsoft SQL Server database.

Using SAS procedure MEANS, aver-age values of tested traits were calcu-lated. Univariate marginal distributions were tested independently for each factor using a univariate Kolmogorov-Smirnov test (GraphPad Prism 6; GraphPad Soft-ware Inc., San Diego, CA, USA). PPW results of Malopolska mares in 2002–2015 demonstrated a significantly differ-ent distribution from a normal one (P < 0.05), whereas PPW results of PKSP and Wielkopolska mares in 2002–2015 dem-onstrated a normal distribution (P > 0.05). The comparison of data showing normal distribution was assessed by a one-way analysis of variance ANOVA followed by Tukey’s multiple comparisons test, if the differences between tested data series occurred, whereas the non-Gaussian data by the Kruskal-Wallis test, followed

by Dunn’s multiple comparisons test (GraphPad Prism 6; GraphPad Software Inc., San Diego, CA, USA). Differences at P < 0.05 were considered statistically significant and are marked on Figures with consecutive letters.


Malopolska mares results were col-lected from 2003, 2005–2010, 2012 and 2014–2015. The observed differences in results probably partly depends on the number of evaluated horses, participating in PPW each year (Fig. 1), nevertheless it is not possible to determine causes of such variety in obtained results. Signifi-cantly higher PPW result (P = 0.0036) (Fig. 2) was found in 2003, 2008–2009 when compared to 2006–2007. There were no differences (P < 0.001) between PPW results of PKSP (Fig. 3) and wlkp (Fig. 4) in evaluated years. According to significant differences in a number of mares of each breed, participating in PPW each year, detailed analysis of differences was conducted for all mares from each breed participating in PPW in

15202530354045

obta

ined

in P

PW

Final results of Malopolska mares

aab

b ba a

a ab abab

05

1015

2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015

Poin

ts o

Years

FIGURE 1. A number of mlp, PKSP, wlkp mares, which participated in PPW in 2002–2015


15202530354045

obta

ined

in P

PW

Final results of PKSP mares

aa a a a a a a a a a a a a

05

1015

2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015

Poin

ts o

Years

FIGURE 2. PPW results (mean ±SD) of Malopolska mares in 2002–2015. Values which are not differ-ing signifi cantly are marked with the same letters. Signifi cant differences for P < 0.05

Final results of Wielkopolska mares

15202530354045

obta

ined

in P

PW aa a a a a

a a a a a a a a

05

1015

2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015

Poin

ts o

Years

FIGURE 3. PPW results (mean ±SD) of PKSP mares in 2002–2015. No statistically signifi cant differ-ences were observed. Signifi cant differences for P < 0.05

20

30

40

50

60

mar

espa

rtic

ipat

ed in

PP

W

mlp PKSP wlkp

0

10

20

2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015

Num

ber o

f

Years

FIGURE 4. PPW results (mean ±SD) of Wielkopolska mares in 2002–2015. No statistically signifi cant differences were observed. Signifi cant differences for P < 0.05



2002-2015. In the further consideration the influence of the year of data collec-tion has been disregarded in order to the most reliable validation of breed as the only factor.

Horse breeding in versatile type, with low feed requirements and usefulness at work in field and in a horse cart, has been performed in Poland after Second World War. Utility type of national mlp and wlkp horses was adapted to saddle horse, and assessed as useful for profes-sional sport and leisure riding (Kosiniak-Kamysz et al. 1997, Pikuła 2006). It can be assumed that the transformation process of mlp and wlkp utility type was active until 2001 (Nowicka-Posłuszna and Włodarczyk 2012). In presented research, no differences in PPW results were detected over time, which may indicate the end of the transformation process and utility traits stabilization. However, as long as mares of imported breeds obtain significantly higher results in each element of PPW, further appli-cation of breeding programs in order to improve the utility of polish breeds should be sustained. It can be stated, that all tested mares represent the same util-ity type – for saddle. Therefore, it cannot be agreed with PZHK statement, that in national breeds (mlp and wlkp), most individuals represent versatile utility type (Polish Halfbred Breeding Program 2005). PPW results indicated that the saddle utility type of mlp and wlkp breeds do not deviate when compared to results obtained by PKSP mares, which is sug-gested by detailed differences evaluation between tested breeds (Maśko 2015).

In a comparison of mlp, wlkp and PKSP results obtained in PPW, signifi-cantly higher final results (P = 0.0019)

for mlp and PKSP than wlkp mares were found (Fig. 5. A). Between evalu-ated breeds, there were no differences (P > 0.05) in results of a walk (Fig. 5. B), trot (Fig. 5. C) and rideability (evaluation of independent rider) (Fig. 5. F). At the same time, significantly higher results for a gallop (P = 0.0133) were detected for mlp and PKSP mares, in compari-son to wlkp mares (Fig. 5. D) and sig-nificantly higher result for free jumping (P < 0.001) for PKSP mares, comparing to mlp and wlkp mares (Fig. 5. E).

Evaluated mlp mares befit into a breeding plan, described in a breeding program for mlp breed and show predis-positions to all of the sports disciplines, especially the Tree-Day-Event (Malo-polska Breeding Program 2005). The level reached by evaluated mlp mares (except for free jumping), does not differ from PKSP mares achievements, which are bred to a professional sport (jumping and dressage) (Polish Halfbred Breeding Program 2005). Geringer de Oedenberg and Kiełbasiewicz (2003) and Jancza-rek and Próchniak (2010), attribute the highest utility value to PKSP mares, what indicates the necessity of paying attention to mlp breed utility advantages. Also, wlkp mares implement the goals of a breeding program, especially in leisure horse riding, showing very good walk and trot and also desired willingness to work with rider (Wielkopolska Breeding Program 2005). It is worth to notice that PPW results obtained by PKSP mares are convergent with aims of breeding programs, which states about the effec-tiveness of utility value evaluation and its cohesion with those aims.

Authors of PKSP breeding program assumed that national mlp and wlkp



FIGURE 5. The comparison of mlp, PKSP, wlkp, and imported mares, based on PPW results (mean ±SD) in 2002–2015, including elements: A. Final result. B. Walk, C. Trot, D. Canter, E. Free jumps, F. Independent rider evaluation. Signifi cant differences between years are marked with different letters. Signifi cant differences for P < 0.05

38

39

W

Final result

c

A

35

36

37

38

tain

ed in

PPW

a ab

32

33

34

35

Poin

ts o

b b

mlp PKSP wlkp impBreeds

7,6

W

Walk

b

B

7

7,2

7,4

btai

ned

in P

PW

a a a

6,4

6,6

6,8

Poin

ts o

b


7 6

7,8

W

Trot

b

C

7

7,2

7,4

7,6

tain

ed in

PPW

a a

b

6,4

6,6

6,8

7

Poin

ts o

bt a

,mlp PKSP wlkp imp

Breeds

7 6

7,8

W

Canter

c

D

7

7,2

7,4

7,6

tain

ed in

PPW

aab

6,2

6,4

6,6

6,8

Poin

ts o

bt


88,2

W

Free jumps

c

E

7,27,47,67,8

8

tain

ed in

PPW

a a

b

6,46,66,8

77,2

Poin

ts o

bt

,mlp PKSP wlkp imp

Breeds

7 8

8

W

Independent rider evaluation

b

F

7,2

7,4

7,6

7,8

tain

ed in

PPW

aa a

6,4

6,6

6,8

7

Poin

ts o

b a


breeds cannot compete with dominant breeds of world equestrian ranking in professional sport and the aim of PKSP breeding is to fill that need (Polish Halfbred Breeding Program 2005). To verify this hypothesis polish half-bred

mares results were compared to results of imported mares from the same PPW.

Significantly higher (P < 0.0001) final results for imported mares than for PKSP mares were observed (Fig. 5. A). This tendency was observed for every PPW



element: walk (Fig. 5. B), trot (Fig. 5. C), canter (Fig. 5. D), free jumps (Fig. 5. E) and independent rider evaluation (Fig. 5. F). Imported mares’ results are close to international level of field tests, described in the literature. Huzinga et al. (1990) obtained in KWPN mares lower average result for free jumps (7.29), higher for walk (7.27), canter (7.32), free jumps (7.12) and rideability (6.90). Albertsdot-tir et al. (2008) described higher average results for walk (7.61), trot (7.60) and canter (7.80) for Island horses.

National mlp, wlkp and PKSP horses present comparable utility value level. In conducted research, PKSP mares do not exhibit higher usefulness to the saddle than wlkp and mlp horses. The preva-lent gap in utility level can be filled by a realization of the breeding program and strict selection, leading to elimina-tion from breeding horses for minor usage: small sport, amateur sport and leisure riding (Polish Halfbred Breeding Program 2005).

CONCLUSIONS

PKSP mares represent saddle utility type with stable functional traits. Mares from evaluated breeds show different predispositions to usage according to breeding programs. Among national breeds involved into PPW test, mlp and PKSP mares show high suitability for sport utility. The wlkp mares tested in PPW show limited sports predis-positions, but compensate it by traits preferred in leisure riding. According to observed differences between imported and national mares, selection should be maintained at a high level, described in breeding programs.

REFERENCES

ALBERTSDOTTIR E., ERIKSSON S., NAS-HOLM A, STRANDBERG E., ARNASON T. 2008: Genetic correlations between com-petition traits and traits scored at breeding field-tests in Icelandic horses. Livest. Sci. 114: 181–187.

BREEDING PROGRAM FOR MAŁOPOLSKI HORSE BREED 2005: Warsaw, Polish Horse Breeders Association; (cited 15 May 2018). Available from: http://pzhk.pl/wp-content/up-loads/pr_hodow_mlp-2016.pdf

BREEDING PROGRAM FOR POLISH HALF-BRED HORSE 2005: Warsaw, Polish Horse Breeders Association; (cited 15 May 2018). Available from: http://pzhk.pl/wp-content/up-loads/pr_hodow_sp-2005_zaktualizowany.pdf

BREEDING PROGRAM FOR WIELKOPOL-SKI HORSE BREED 2005: Warsaw, Polish Horse Breeders Association; (cited 15 May 2018). Available from: http://pzhk.pl/wp-content/uploads/pr_hodow_wlkp-2005.pdf

BYSZEWSKI W. 2009: O próby dla wszystkich. Hodowca i Jeździec 1(20): 38–41.

CHRZANOWSKI S., MAŚKO M., OLEKSIAK S. 2012: The Evaluation of the results of field performance tests for mares. Ann. Warsaw Univ. Life Sci. – SGGW, Anim. Sci. 51:23–30.

GERINGER DE OEDENBERG H., KIEŁBA-SIEWICZ A. 2003: Udział koni różnych ras w konkursach krajowych w dyscyplinie ujeż-dżenia w latach 1995–2002 [The participation of the different horses’ breed in competition in dressage in 1995–2002]. Zesz. Nauk Przegl. Hod. 68(5): 101–108 [in Polish].

GÓRECKA A., CHRUSZCZEWSKI M.H., JA-WORSKI Z., GOLONKA M., PIESZKA M., DŁUGOSZ B., et al. 2008: Preferences of riders for selected dimensions of horses traits preliminary results, Proceedings of 4th Interna-tional Conference of International Society for Equitation Science, 2013: 92.

HUIZINGA H.A., BOUKAMP M., SMOLDERS G. 1990: Estimated parameters of field per-formance testing of mares from the Dutch Warmblood riding horse population. Livest. Prod. Sci. 26: 291–299.

JANCZAREK I., PRÓCHNIAK T. 2010: Malo-polski horse breeding development in the light



of its changes in the Lublin region. Annales UMCS, sec. EE, Zootechnica 28(4): 26–35.

JANCZAREK I., WILK I. 2017: Leisure riding horses: research topics versus the needs of stakeholders. Anim. Sci. J. 88: 953–958.

JOŃCZYK A. 2001: Próby dzielności dla klaczy. Biuletyn PZHK 3.

KAPROŃ M. 2001: Projekt modernizacji sys-temu wierzchowych prób dzielności ogierów półkrwi w Zakładach Treningowych. Rocz. Nauk. Zoot. Supl. 14: 81–94.

KAPROŃ M. 2006: Wykorzystanie parametrów genetycznych w modyfikacji systemów prób dzielności ogierów półkrwi. Prace i Mat. Zoot. 16: 69–78.

KOSINIAK-KAMYSZ K., PODSTAWSKI Z., TOBOROWICZ P. 1997: Charakterystyka koni półkrwi w rozwijającej się hodowli terenowej Polski południowej. Zesz. Nauk. AR w Szcze-cinie 177, Zootechnika 35: 121–128.

LEWCZUK D. 2004: Analiza różnic między ra-sami polski koń szlachetny półkrwi i wielko-polską na podstawie wyników prób dzielności ogierów [Analysis of differences between two warmblood breeds – Polish Half-bred horse and Wielkopolska on the basis of performance test results]. Zesz. Nauk. Przegl. Hod. 72(5): 71–76 [in Polish]..

MAŚKO M. 2015:. Analysis of the selected factors and their influence on the results of field and stationary performance tests for mares of half-breed races in Poland. Doctoral thesis. Warsaw University of Life Sciences – SGGW, Warsaw.

NOWICKA-POSŁUSZNA A., WŁODARCZYK M. 2012: Factors affecting performance test results in half-bred mares. Annales UMCS, sec. EE, Zootechnica 30(4):115–123.

PIKUŁA R., GÓRSKA K., TABISZEWSKA I. 2006: Charakterystyka koni biorących udział w czempionatach młodych koni w latach 1992–2002 ze szczególnym uwzględnieniem koni ras szlachetna półkrew. LXXI Zjazd PTZ w Bydgoszczy, Kom. Nauk. 3: 21.

PRÓCHNIAK T. 2017: Selection criteria in early evaluation of the breeding value of sport hors-es. Doctoral thesis. University of Life Sciences in Lublin, Lublin.

SZARSKA E., CYWIŃSKA A. 2009: Próba dzielności z monitorem. Hodowca i Jeździec 1: 37–39.

Streszczenie: Porównanie wartości użytko-wej klaczy polskich ras półkrwi na podstawie wyników polowych prób dzielności przepro-wadzonych w latach 2002–2015. Celem pracy była analiza wartości użytkowych klaczy ras półkrwi w Polsce na podstawie ich wyników uzyskanych podczas jednodniowych polo-wych prób dzielności. Analizie poddano wyniki913 klaczy należących do ras małopolskiej (mlp), wielkopolskiej (wlkp), polski koń szla-chetny półkrwi (PKSP) oraz ras importowanych (imp). Porównując wyniki klaczy ras mlp, wlkp i PKSP uzyskane w próbach polowych w latach 2002–2015, stwierdzono istotnie wyższy średni wynik końcowy oraz istotnie wyższe oceny za galop dla klaczy mlp i sp niż dla klaczy wlkp. Istotnie wyższe oceny za skoki luzem uzyska-ły klacze PKSP w porównaniu do pozostałych polskich ras. Klacze ras importowanych uzyska-ły istotnie wyższe wyniki w porównaniu do ras polskich. W przeprowadzonych badaniach kla-cze rasy PKSP nie górują wyraźnie przydatno-ścią do użytkowania wierzchowego nad końmi wielkopolskimi oraz małopolskimi. Istniejące luki w poziomie użytkowym koni polskich i im-portowanych, powinny być wypełniane poprzez sumienną realizację programów hodowlanych i szczególnie ostrą selekcją prowadzącą do uzy-skania pogłowia, mogącego sprostać wymogom stawianym aktualnie przez dyscypliny wyczyno-wego sportu jeździeckiego.

Słowa kluczowe: klacze ras półkrwi, polowa pró-ba dzielności, wartość użytkowa


Authors’ address:Małgorzata MaśkoZakład Hodowli Zwierząt Futerkowych, Towa-rzyszących i KoniKatedra Szczegółowej Hodowli ZwierzątWydział Nauk o ZwierzętachSzkoła Główna Gospodarstwa WiejskiegoCiszewskiego 8, 02-786 WarszawaPolande-mail: [email protected]



Characterization of meat traits and fatty acids profile fromSwallow-Belly Mangalitsa, Moravka pigs and their crossbreeds

ŁUKASZ MIGDAŁ1, ČEDOMIR RADOVIĆ2, VLADIMIR ŽIVKOVIĆ2,MARIJA GOGIĆ2, ANNA MIGDAŁ3, WŁADYSŁAW MIGDAŁ4

1 Faculty of Animal Science, University of Agriculture in Kraków 2 Institute for Animal Husbandry, Belgrade – Serbia3 Faculty of Animal Science, University of Agriculture in Kraków 4 Faculty of Food Technology, University of Agriculture in Kraków

Abstract: Characterization of meat traits and fatty acids profi le from Swallow-Belly Mangal-itsa, Moravka pigs and their crossbreeds. Auto-chthonous breeds are among the most valuable sources of high quality meat for local products. In a recent study, we have analysed meat and fatty acids profi le from Moravka, and Swallow-Belly Mangalitsa breeds, and from their crossbreed. Moreover, molecular analyses of MC4R and LEP gene were conducted for those breeds. We found previously identifi ed mutation within the MC4R gene – c.892A > G (Asp298Asn). Statistical anal-ysis did not show differences between genotypes for either Moravka or Swallow-Belly Mangalitsa meat chemical traits, shear force parameters or fatty acids profi le. We found statistical differences in intramuscular fat content (%) between Morav-ka and crossbreed animals (10.77 ±4.28, and 6.76 ±1.31, respectively). For fatty acids profi le, Swal-low-Belly Mangalitsa was characterized by sta-tistically the highest level of n-6 and n-3 PUFA (7.771 ±0.728, and 0.416 ±0.038, respectively). CLA level were the highest in Moravka, and the lowest in Swallow-Belly Mangalitsa (0.079 ±0.010, and 0.072 ±0,007, respectively). Our data showed that Moravka and Swallow-Belly Man-galitsa breeds can be valuable sources of meat, characterized by good quality.

Key words: Meat traits, Pig, Swallow-belly Man-galitsa, Moravka, fatty acids profi le, LEP, MC4R

INTRODUCTION

Recently, the interest in native breeds has increased, both in the context of gene preservation and also the produc-tion of meat products manufactured in a traditional way. One of most well known native pigs in Europe is Man-galitsa, which is a typical fat breed farmed mainly in Hungary, and also in Serbia and Croatia. Carcass of this pig is characterized by 65–70% of fat in car-cass sides, and approx. 30–35% of meat (Egerszegi et al. 2003). Results of recent studies (Egerszegi et al. 2003) show that this amount of meat is sufficient for the production of high quality ham. One of the reasons for high quality of ham is the traditional technology of rearing, as well as traditional nutrition (Petrović et al. 2010). Moravka is a breed of combined production, with more meat in carcass sides, and a breed of significantly less fat in Serbia (Petrović et al. 2010). This breed is reared in extensive conditions – both in terms of nutrition and housing. Moreover, the rearing and the lack of systematic selection of animals affect


366 Ł. Migdał et al.

the production traits, which are varied. On the other hand, this also results in these pigs’ excellent adaptability, good vitality, and high resistance to diseases (Petrović et al. 2007).

Recently, molecular tools are used in the identification of polymorphisms within candidate genes for fatness traits, and their possible implementa-tion into animal husbandry. One of the key factors controlling the energy balance is the Melanocortin 4 receptor (MC4R). As a part of leptin – signal-ing pathway, it decreases feed intake (Seeley et al. 2004). Known sequence variants of the MC4R gene reported in humans lead to obesity. Leptin gene, known also as the Ob or Obese is 146 amino acids expressed in adipose tissue (D’Andrea et al. 2007). Leptin, besides being a regulator of excessive fat depo-sition, seems to play an important role during the adaptation of animals to, as a GH secretion suppressor (Baratta et al. 2002), and attainment of puberty (Cun-ningham et al. 1999). In recent years, studies have been conducted in order to determine the association between reported polymorphism in the LEP, and carcass traits in animals (Jiang and Gibson 1999, Kennes et al. 2001, De Oliveira Peixoto et al. 2006).

The goals of the present study includ-ed the chemical analysis of the samples, fatty acids profile, texture, and shear force analysis from m. longissimus dorsi lumborum. Moreover, we sequenced the MC4R and the LEP gene, in order to analyse the potential polymorphisms and their association with the studied traits.


Animals

In the present study, we analysed m. long-issimus dorsi lumborum between 13th and 14th rib samples from 20 Moravka (MO) pigs (12 males and 8 females),18 Swallow-Belly Mangalitsa (SBM) pigs (10 males and 8 females) and crossbreed animals of Moravka x Swal-low-Belly Mangalitsa (3 males and 5 females). All animals were slaughtered at the age of 365 days. Animals of both breeds were born and reared on Ex-perimental pig farm of the Institute for Animal Husbandry, Belgrade-Zemun. The surface of the free range was 150 m2 (110 m2 open section and 40 m2 covered section of the range). Fed composition is presented in Table 1

Meat analysis

Instrumental measurement of shear forceCylinder-shaped samples (14 mm in diameter and 15 mm in height) were cut from the meat, and roasted in the oven at 180ºC until internal temperature of 78ºC. Shear force was measured using a TA-XT2 Texture Analyser (Stable Micro Systems), with a Warner-Bratzler attachment and a triangular notch in the blade. The blade speed during the test was 1.5 mm/s. Results were presented as force per area (kG/cm2).

Instrumental measurement of texture parametersCylinder-shaped samples (14 mm in diameter and 15 mm in height) were


Characterization of meat traits and fatty acids profi le... 367

cut from the meat roasted as described above. The texture was analysed using a TA-XT2 Texture Analyser (Stable Micro Systems), with an attachment in the form of a cylinder, 50 mm in diameter. The samples were subjected to a double pressing test using a force of 10 g to 70% of their height. The cylinder speed was2 mm/s, and the interval between the pressures was 3 s.

Collagen contentThe total collagen content was estimated according to Polish Standard PN-ISO 3496. The absorbance of samples was measured using the Novasina spectropho-tometer, at 558 nm. The hydroxyproline content was read from the calibration curve. The total collagen content was calculated from hydroxyproline amount, using the coefficient of 7.25, and taking into account the dilution factors. The soluble collagen was calculated as the difference between the total collagen, and the insoluble collagen. The amount of insoluble collagen was estimated ac-cording to the method proposed by Liu et al. (1994), with our modifications.

The hydroxyproline content was read from the spectrophotometric curve. Insoluble collagen content was calcu-lated using the coefficient of 7.25. The amount of soluble collagen was calculat-ed and expressed as percentage of total collagen.

Meat quality traitsThe meat samples were chemically ana-lyzed to determine water, protein, intra-muscular fat, and ash content according to Polish standards. Water content was

TABLE 1. Composition of pigs diet

Feedstuffs/the nutrient (%)

Fattening pigs25–60(kg)

60–100 (kg)

Corn (silage) 62.93 68.76Wheat bran 15.00 15.00Soybean oil meal 14.00 9.10Sunflower meal 5.00 4.00Limestone(calcium carbonate) 1.40 1.40

Monocalcium phospate 0.60 0.70

Salt 0.40 0.45Premix 0.50 0.50L-lysine 0.07 0.09Zeolite 0.10 –Total 100.00 100.00Crude protein 15 13ME, MJ/kg 12.95 13.05Ether extracts 3.48 3.62Fiber 4.21 3.87Ash 5.01 4.88Ca 0.70 0.70P 0.60 0.59Na, Sodium 0.23 0.24Lysine 0.763 0.648Met + cystin 0.557 0.506Tryptophane 0.187 0.158Threonine 0.581 0.503Isoleucine 0.665 0.566Valine 0.796 0.697Arginine 1.012 0.848Histidine 0.427 0.377Leucine 1.436 1.314Tyrosine + phenilalanine 1.404 1.240



determined by the drying method in 105°C were calculated (PN-ISO-1442), protein content (%) by the method of Kjeldahl where protein content (%) were calculated as 6.25 × total nitrogen level from sample (PN-A-04018:1975), intra-muscular fat content (%) by the method of Soxhlet petroleum- ether extraction using SOXTEK HTZ-2 (Tecator) (PN-ISO-1444), and total ash content (550°C for 12 hours) in accordance withPN-ISO-936.

Fatty acid profi le

Samples were extracted with chloroform-methanol (2 : 1, v/v), according to the method developed by Folch et al. (1957). Then, 1 g of meat samples was mixed with 15 mL of chloroform–methanol mixture, and homogenized for 10 min at 5000 rpm, and after a 5-minute pause – for another 5 min, at 1000 rpm, using homogeniser MPW-120. The mixture was then filtered through filter paper to a regular cylinder, and completed with extraction mixture up to 15 mL. Next, 3 mL of 0.74% KCl solution was added to 15 mL of the filtrate. The alcohol–water phase was removed, and the chloroform phase was washed three times using 2 mL solution of chloroform : methanol : 0.74% KCl (3 : 48 : 47, v/v/v). Subsequently, the chloroform phase was recovered, dehydrated with anhydrous sodium sul-phate (Na2SO4), and dried using nitrogen at 45ºC. Further, 0.5 ml 0.5 N KOH in methanol was added to the sample (about 10 mg), and heated at 85°C. Next, 1 ml 12% BF3 in methanol was added, and the sample was again heated at 85°C. After cooling in room temperature, 1 ml hexane and 5 ml saturated solution of NaCl were

added. Fatty acid methyl esters profile in one μl samples at the split ratio of 10 : 1 were separated by gas chromatography on a TRACE GC ULTRA gas chroma-tograph, equipped with 30 m capillary column SUPELCOWAX 10 of 0.25 mm inner diameter and coating thickness of 0.25 μm (30 m × 0.25 mm × 0.25 um). Operating conditions were as follows: helium was used as the carrier gas, flow of 1 ml/min, split flow of 10 ml/min, injector temperature of 220ºC, detector temperature of 250ºC, and initial column temperature of 160ºC.

The atherogenic index (AI) was calculated as (C12:0 + 4 × C14:0 + C16:0)/(MUFA + PUFA), whereas the thrombogenicity index (TI), as (C14:0 + C16:0 + C18:0)/(0.5 × MUFA+

0.5 × n-6PUFA + 3 × n-3PUFA + (n-3 PUFA/n-6 PUFA) (Ulbricht and South-gate 1991).

Molecular analysis

DNA fragments of the MC4R and the LEP genes were amplified from Swal-low-Belly Mangalitsa and Moravka ani-mals showing the highest, and the lowest intramuscular fat values. Genomic DNA was isolated from the meat by Genomic Wizard Purification Kit (Promega), according to the described protocol. Primers for amplification of the MC4R and the LEP exons were designed using Primer3 (Table 2). PCR was performed using MJ Mini Thermal Cycler (BioRad) in 25 μl reaction volume (5 μl Colorless GoTaq Flexi Buffer; 2 μl MgCl2, 25 mM; 1 μl dNTP (0,2 mM each); 1 μl of prim-ers (forward + reverse); 0,25 μl GoTaq® G2 Hot Start Polymerase (5u/μl); 1 μl template DNA and Nuclease-Free Water



to total volume of 25 μl). The PCR prod-ucts were purified using Exo_SAP, and then sequenced using BigDye Terminator Sequencing Kit (Applied Biosystems) on ABI 3130xl sequencing system (Applied Biosystems). All sequences were visually inspected, edited, and assembled using FinchTV and BLAST tools, after which the CodonCode Aligner (http://www.codoncode.com/aligner) was applied in order to align the sequences. The SNPs were identified by aligning the obtained sequences with the reference sequence of Sscrofa11.1 - NC_010443.5 for the MC4R and NC_010460.4 for the LEP. All animals were genotyped for MC4R G- > A substitution in 298 codon by means of the PCR-RFLP method, described by Kim et al. (2000).

Statistical analysis

Associations were investigated in the analysis of variance using STATISTICA software 13.1; specifically, the following models:

Yijk = μ + Bi + Sj + (B × S)ij + βMijk + + eijk

Yijk = μ + Gi + Sj + (G × S)ij + βMijk ++ eijk

where:Yijk – studied traits; μ – overall mean value of the

given trait; Bi – fixed effect of the i-th breed

(i = 1,2,3); Gi – fixed effect of the i-th geno-

type (i = 1,2,3); Sj – fixed effect of the j-th gender

(j = 1,2); (B × S)ij – the correlation between breed

and gender; (G × S)ij – the correlation between

genotype and gender; βMijk – linear regression of slaughter

weight; eijk – residual effect. The signifi-

cance of the differences was determined by applying the Tukey–Kramer test.

TABLE 2. Primers and PCR conditions

Fragment Primer sequences (5’–3’) Size (bp) Ta (ºC)Lep_1_for GTTTCCAGGCCCCAGAAG

200 58Lep_1_rev GTCTCCCAGGCCTTCCCTACLep_2_for CTGCACAGCAGTCTGTCTCC

379 59Lep_2_rev CCTTCAAGGCTTCAGCAGMC4R_1-2_for ATGAACTCAACCCATCACCA

189 58MC4R_1-2_rev CAGAGTCACAAACACCTCAGGAMC4R_3_for TCATCTGTAGCCTGGCTGTG

907 62MC4R_3_rev CAGAGACTGAGCAGAATCACGTaqI_RFLP_for* TACCCTGACCATCTTGATTG

226 56TaqI_RFLP_rev* ATAGCAACAGATGATCTCTTTG

* according to Kim et al. (2000)



RESULTS

In silico analysis of the obtained se-quences revealed one mutation within the MC4R gene – c.892A>G (As-p298Asn) substitution. The PCR-RFLP bands for both breeds – Swallow-Belly Mangalitsa and Moravka – are presented in Figure 1. In Table 3, allele frequency and genotypes are shown. For Swallow-Belly Mangalitsa, the frequency of the G allele was 97.7%, while for Moravka, it was 79.2%. The GG genotypes fre-quency ranged from 58.3% for Moravka to 95.4% for Mangalitsa. In Table 4, the chemical composition and shear force analysis results are presented. The high-

TABLE 3. Allele and genotypes frequencies from Moravka and Swallow-Belly Mangalitsa

Polymorphism Breed NAllele frequency (%) Genotypes frequency (%)

G A GG AG AA

c.892G>ASwallow-Belly

Mangalitsa (SBM) 22 97.7 2.3 21 1 0

Moravka (MO) 12 79.2 20.8 7 5 0

FIGURE 1. TaqI digestion of c.892G>A (D298N) polymorphism within MC4R

est intramuscular fat content (%) was found in Moravka meat (10.77 ±4.28), as compared to Swallow-Belly Mangalitsa (9.05 ±3.04), and Moravka × Swallow-Belly Mangalitsa (6.76 ±1.31). Total collagen content (%) was the highest in Moravka (0.44 ±0.15), as compared to Swallow-Belly Mangalitsa and Moravka × Swallow-Belly Mangalitsa (0.39 ±0.42 and 0.34 ±0.37, respective-ly). The highest shear force value was recorded for Moravka × Swallow-Belly Mangalitsa (83.81 ±11.95), as com-pared to Moravka and Swallow-Belly Mangalitsa (80.52 ±14.38, and 77.19 ±12.85, respectively). In Table 5, the association analysis between identified



TABLE 4. Chemical composition and shear force analysis of meat from Moravka, Swallow-Belly Man-galitsa and Moravka × Swallow-Belly Mangalitsa crossbred

Traits Moravka (MO) Swallow-Belly Mangalitsa (SBM)

Moravka × Swallow-Belly Mangalitsa

(MO × SBM)Slaughter weight (kg) 100.48a ±18.53 88.31b ±13.95 98.86 ±19.69Cooking loss (%) 26.69 ±4.85 27.98 ±4.41 27.69 ±2.9Water (%) 66.64 ±3.85 67.75 ±2.54 69.06 ±1.34Ash (%) 0.99 ±0.19 0.98 ±0.18 1.01 ±0.12Carbohydrate (%) 0.32 ±0.15 0.37 ±0.15 0.26 ±0.13Protein (%) 21.27 ±2.09 21.85 ±1.43 22.97 ±1.44Intramuscular fat (%) 10.77a ±4.28 9.05 ±3.04 6.76b ±1.31Total collagen (%) 0.44 ±0.15 0.39 ±0.42 0.34 ±0.37Soluble collagen (%) 0.08 ±0.13 0.04 ±0.03 0.08 ±0.09Unsoluble collagen (%) 0.36 ±0.15 0.35 ±0.41 0.26 ±0.34Shear Force (N) 80.52 ±14.38 77.19 ±12.85 83.81 ±11.95Hardness (N) 96.95 ±15.74 102.67 ±19.45 105.54 ±12.19Springiness 0.52 ±0.08 0.49a ±0.08 0.57b ±0.07Cohesiveness 0.47 ±0.08 0.45 ±0.06 0.46 ±0.05Gumminess 48.08 ±16.39 43.56 ±10.11 39.07 ±17.35Chewiness 25.11 ±10.48 21.6 ±6.16 22.1 ±9.89Resilience 0.19a ±0.04 0.16b ±0.02 0.17 ±0.02Cutting Strength (kg) 3.9 ±1.51 4.54 ±1.34 4.6 ±2.13

Means with different letters differ signifi cantly between groups in a observation, P ≤ 0.05

genotypes and meat traits is presented. Because in Swallow-Belly Mangalitsa we identified only one genotype (GA), it was excluded from the analysis. The latter had shown no statistical differ-ences between genotypes in Moravka breed. In Table 6, fatty acids profiles for the analysed breeds are presented. The levels of CLA (conjucted linolic acid) were the highest in Moravka breed (0.079 ±0.01), as compared to Swallow-Belly Mangalitsa (0.072 ±0.007), and to crossbred animals (0.078 ±0.005). Level of polyunsaturated fatty acids was the highest in meat from Swallow-Belly

Mangalitsa, as compared to Moravka and to crossbred animals. Saturated fatty acids (41.412 ±0.731) level was the highest in crossbred animals, as com-pared to Moravka (40.404 ±0.936), and to Swallow-Belly Mangalitsa (40.366 ±0.366), while unsaturated fatty acids level was the highest in Swallow-Belly Mangalitsa (59.604 ±0.361), as com-pared to Moravka (59.565 ±0.931), and to crossbred animals (58.559 ±0.730). In Table 7, association analysis for fatty acids profile between identified geno-types in Moravka breed was presented, showing lack of statistical differences.


TABLE 6. Fatty acids profi le (% of total fatty acids) of meat from Moravka. Swallow-Belly Mangalitsa and Moravka × Swallow-Belly Mangalitsa crossbred



(MO × SBM)10 : 0 0.132 ±0.009 0.137 ±0.012 0.129 ±0.00612 : 0 0.097 ±0.007 0.1a ±0.004 0.093b ±0.00414 : 0 1.543a ±0.069 1.506b ±0.034 1.501 ±0.04214 : 1 0.037a ±0.003 0.039b ±0.004 0.032c ±0.00215 : 0 0.044 ±0.015 0.043 ±0.006 0.047 ±0.01116 : 0 27.378 ±0.548 27.293 ±0.345 27.377 ±0.41116 : 1 n-9 0.319 ±0.026 0.311 ±0.025 0.298 ±0.02116 : 1 n-7 4.433a ±0.326 4.6a ±0.307 3.977b ±0.13317 : 0 0.184 ±0.078 0.165a ±0.028 0.219b ±0.06317 : 1 0.26 ±0.083 0.218a ±0.043 0.301b ±0.08318 : 0 11.02a ±0.455 10.983a ±0.316 11.88b ±0.52518 : 1 n-9 41.9a ±0.971 40.227b ±0.821 42.33a ±0.73818 : 1 n-7 5.074a ±0.278 5.266b ±0.297 4.631c ±0.19818 : 2 n-6 5.262a ±0.950 6.325b ±0.562 4.9a ±0.547

TABLE 5. Association between c.892G > A mutation and chemical composition and shear force analy-sis of Moravka breed

TraitsMoravka (MO)

GG GASlaughter weight (kg) 94.17 ±15.97 106.88 ±20.77Cooking loss (%) 24.11 ±3.59 25.54 ±1.85Water (%) 65.58 ±1.91 66.85 ±3.19Ash (%) 0.96 ±0.01 0.95 ±0.2Carbohydrate (%) 0.3 ±0.14 0.41 ±0.3Protein (%) 22.7 ±0.94 20.55 ±1.97Intramuscular fat (%) 10.45 ±1.86 11.24 ±3.39Total collagen (%) 0.45 ±0.29 0.48 ±0.13Soluble collagen (%) 0.23 ±0.29 0.07 ±0.1Unsoluble collagen (%) 0.22 ±0.2 0.4 ±0.1Shear Force (N) 72.46 ±7.56 70.63 ±12.82Hardness (N) 93.35 ±6.44 83.01 ±11.54Springiness 0.49 ±0.04 0.48 ±0.08Cohesiveness 0.44 ±0.09 0.48 ±0.11Gumminess 40.58 ±6.03 40.7 ±14.08Chewiness 20.06 ±4.5 19.77 ±8.98Resilience 0.18 ±0.01 0.2 ±0.06Cutting Strength (kg) 3.91 ±2.64 4.98 ±1.27




(MO × SBM)18 : 3 n-6 0.065 ±0.121 0.039 ±0.004 0.043 ±0.00518 : 3 n-3 0.176 ±0.068 0.203a ±0.012 0.166b ±0.034CLA 0.079a ±0.010 0.072b ±0.007 0.078 ±0.00520 : 0 0.135a ±0.014 0.140a ±0.010 0.165b ±0.01220 : 1 0.614a ±0.054 0.518b ±0.083 0.633a ±0.04120 : 2 0.168 ±0.033 0.166 ±0.012 0.158±0.01520 : 3 n-6 0.082a ±0.018 0.115b ±0.012 0.088a ±0.00620 : 4 n-6 0.735a ±0.132 1.175b ±0.228 0.683a ±0.11020 : 5 n-3 0.022a ±0.004 0.035b ±0.006 0.025a ±0.00722 : 4 n-6 0.095a ±0.017 0.117b ±0.02 0.098a ±0.01122 : 5 n-3 0.077a ±0.024 0.126b ±0.017 0.083a ±0.01222 : 6 n-3 0.037a ±0.01 0.052b ±0.012 0.031a ±0.008SFA 40.404a ±0.936 40.366a ±0.366 41.412b ±0.731UFA 59.565a ±0.931 59.604a ±0.361 58.559b ±0.730n6 6.197a ±1.009 7.771b ±0.728 5.813a ±0.548n3 0.311a ±0.087 0.416b ±0.038 0.305a ±0.044n6/n3 20.674a ±3.842 18.72b ±1.234 19.176 ±1.241UFA/SFA 1.475a ±0.058 1.477a ±0.022 0.129b ±0.006EFA 5.504a ±1.036 6.567b ±0.569 5.11a ±0.569OFA 28.921 ±0.546 28.799 ±0.34 28.878 ±0.34DFA 70.585 ±0.669 70.586 ±0.342 70.439 ±0.342MUFA 52.637a ±1.426 51.178b ±0.606 52.205a ±0.606PUFA 6.72a ±1.153 8.353b ±0.763 6.276a ±0.763AI 0.567a ±0.017 0.561a ±0.008 0.573b ±0.008A-SFA 29.018 ±0.547 28.899 ±0.34 28.971 ±0.34T-SFA 39.94a ±0.823 39.781a ±0.356 40.758b ±0.356TI 1.313a ±0.043 1.293a ±0.021 1.36b ±0.021Δ9-desaturase index 0.542a ±0.01 0.535b ±0.003 0.537 ±0.003

SFA – Saturated fatty acids; UFA – Unsaturated fatty acids; OFA – hypercholesterolemic acids (C14 : 0 + C16 : 0); DFA – neutral and hypocholesterolemic acids (C18:0 + UFA); AI index – (C12:0 + 4 × C14:0 + C16:0) / [(MUFA + ΣSPUFA (n-6) + (n-3)] (Ulbricht et al. 1991); A-SFA – the sum of C12:0.C14:0 and C16:0; T-SFA – the sum of C14:0. C16:0 and C18:0; TI – (C14:0 + C16:0 + C18:0) / (0.5 × MUFA + 0.5 × n-6-PUFA + 3 × n-3PUFA + (n-3PUFA/n-6PUFA)) (Ulbricht et al. 1991). Δ9-desaturase index = (C16:1 + c9C18:1 + c11C18:1) / (C16:1 + c9C18:1 + c11C18:1 + C14:0 + C16:0 + C18:0) (Smith et al. 2002)Means with different letters differ signifi cantly between groups in a observation, P ≤ 0.05

TABLE 6 – cont.



TABLE 7. Association between c.892G > A mutation and Fatty acids profi le (% of total fatty acids) of meat from Moravka breed

TraitsMoravka

GG GA10 : 0 0.138 ±0.009 0.130 ±0.00512 : 0 0.099 ±0.008 0.098 ±0.00714 : 0 1.554 ±0.063 1.572 ±0.04814 : 1 0.037 ±0.003 0.036 ±0.00315 : 0 0.04 ±0.011 0.038 ±0.00716 : 0 27.36 ±0.534 27.373 ±0.52116 : 1 n-9 0.323 ±0.029 0.31 ±0.0116 : 1 n-7 4.41 ±0.386 4.419 ±0.18517 : 0 0.155 ±0.068 0.171 ±0.05817 : 1 0.202 ±0.033 0.288 ±0.06518 : 0 10.861 ±0.565 10.942 ±0.3418 : 1 n-9 42.312 ±0.343 42.003 ±0.26818 : 1 n-7 5.332 ±0.106 5.041 ±0.2118 : 2 n-6 5.026 ±0.386 5.259 ±0.47618 : 3 n-6 0.036 ±0.012 0.042 ±0.00618 : 3 n-3 0.129 ±0.021 0.173 ±0.039CLA 0.079 ±0.004 0.083 ±0.00620 : 0 0.134 ±0.015 0.126 ±0.00320 : 1 0.628 ±0.08 0.605 ±0.02420 : 2 0.164 ±0.02 0.163 ±0.0220 : 3 n-6 0.067 ±0.012 0.082 ±0.01520 : 4 n-6 0.658 ±0.051 0.784 ±0.14220 : 5 n-3 0.024 ±0.003 0.02 ±0.00222 : 4 n-6 0.083 ±0.006 0.097 ±0.01522 : 5 n-3 0.068 ±0.012 0.08 ±0.0222 : 6 n-3 0.031 ±0.008 0.04 ±0.003SFA 40.009 ±0.702 40.449 ±0.432UFA 59.944 ±0.677 59.522 ±0.431n6 5.87 ±0.453 6.263 ±0.475n3 0.252 ±0.038 0.312 ±0.057n6/n3 23.614 ±4.072 20.482 ±3.365UFA/SFA 1.499 ±0.043 1.472 ±0.026EFA 5.192 ±0.394 5.473 ±0.47



DISCUSSION

Fatness is an important trait, influenc-ing meat quality and its technological values. Pork is an important source of meat for humans, accounting for more than half the world’s meat consump-tion. Moreover, consumers demand the highest quality meat, and high quality meat products, in the constantly chang-ing pork market (Moeller et al. 2010). Nowadays, consumers show preference for sustainable pork chains, whereas traditional products from local pig breeds have proven themselves as high quality products (Pugliese and Sirtori 2012, Pugliese et al. 2013). Reports by Petrović et al. 2010 showed that

TraitsMoravka

GG GAOFA 28.914 ±0.483 28.944 ±0.53DFA 70.805 ±0.195 70.465 ±0.51MUFA 53.245 ±0.636 52.701 ±0.09PUFA 6.287 ±0.446 6.738 ±0.52AI 0.566 ±0.015 0.568 ±0.01A-SFA 29.014 ±0.476 29.043 ±0.53T-SFA 39.776 ±0.920 39.887 ±0.46TI 1.311 ±0.053 1.309 ±0.03Δ9-desaturase index 0.547 ±0.008 0.543 ±0.01

SFA – Saturated fatty acids; UFA – Unsaturated fatty acids; OFA – hypercholesterolemic acids (C14:0 + C16:0). DFA – neutral and hypocholesterolemic acids (C18:0 + UFA); AI index – (C12:0 + 4 × C14:0 + C16:0) / [(MUFA + ΣSPUFA (n-6) + (n-3)] (Ulbricht et al.. 1991); A-SFA – the sum of C12:0. C14:0 and C16:0; T-SFA – the sum of C14:0. C16:0 and C18:0; TI – (C14:0 + C16:0 + C18:0) / (0.5 × MUFA + 0.5 × n-6- PUFA + 3 × n-3PUFA + (n-3PUFA//n-6PUFA)) (Ulbricht et al. 1991).Δ9-desaturase index = (C16:1 + c9C18:1 + c11C18:1)/(C16:1 + c9C18:1 + c11C18:1 + C14:0 + C16:0 + C18:0) (Smith et al. 2002).

TABLE 7 – cont.

intramuscular fat (IMF) content (%) in Moravka is lower compared to Mangal-itsa (6.74 and 13.24, respectively); also, cholesterol level (mg/100g) is lower in Moravka compared to Mangalitsa (42.14 and 61.82, respectively). Our results showed that intramuscular fat content was the highest in Moravka (10.77 ±4.28), as compared to Swallow-Belly Mangalitsa (9.05 ±3.04), and Moravka × Swallow-Belly Mangalitsa crossbreed (6.76 ±1.31). Intramuscular fat is generally associated with higher qual-ity of nutrition, therefore, it is of much significance to increasing intramuscular fat content of pork through feeding and genetic selection. Feeding has several disadvantages, because particular feed-



ing regimes need to be developed for various breeds. The most promising way is that of the genetic selection, however, the existence of numerous quantitative traits loci (QTL) may be problematic (Font-i-Furnols et al. 2012). Among the most analysed candidate genes for IMF value were: leptin (LEP) and Melano-cortin 4 Receptor (MC4R). Kim et al. 2000 analysed c.892G>A (D298N) polymorphism, and they found asso-ciation with back-fat and growth rate. Fontanesi et al. (2013) found association with average daily gain (ADG) and the feed:gain ratio (FGR) with c.892A. In our results, we did not find statistical significance between the genotypes, but we found that for slaughter weight, the GA genotypes were heavier compared to GG, similar to the IMF value (Table 3).

According to the current state of knowledge, n-6:n-3 PUFA (polyunsatu-rated fatty acids) ratio should be limited to 4–5 : 1 (Scollan et al. 2006). In our study, the ratio was higher than those values. Ulbricht and Southgate (1991) reported indicators of fat quality, includ-ing the atherogenicity index (AI), which likely reflects the risk of cardiovascular disease (CVD). It defines the propor-tion of SFA (myristic and palmitic acid) to UFA (PUFA + MUFA), indicating a negative role of C14:0, and an adverse effect of UFA in human nutrition. The lower the AI and TI index values, the healthier the food. In our study, statisti-cally significant differences were found between pure breeds and crossbred pigs, where crossbred pigs had highest values of AI and TI indexes (0.573 ±0.008 and 1.36 ±0.021, respectively). Ulbricht and Southgate (1991) suggested that the AI index should be lower than 0.5. The levels

of 20:3n-6; 20:4n-6; 20:5n-3; 22:4n-6; 22:5n-3; 22:6n-3 were statistically higher in meat from Mangalitsa compared to Moravka. Galián et al. (2008) pointed out that the PUFA levels should not be higher than 12–14% in meat destined to become processed products, and this was confirmed in our study. The polyunsatu-rated fatty acids and monounsaturated fatty acids play a role in decreasing the blood LDL-cholesterol concentration, by increasing the hepatic LDL receptor activity (Rudel et al. 1995). Cameron et al. (2000) showed that C18:2, C20:4 and C22:6 polyunsaturated fatty acids had a positive correlation with the flavor of meat.

Compared to Zlotnicka Spotted and Pulawska, the content of protein is similar (about 21–22%) (Florowski et al. 2006), however, intramuscular fat con-tent in Polish autochthonous pig breeds is between 2.5% (Pulawska) and 3.1% (Zlotnicka Spotted), while for Moravka, it is 10.77 ±4.28, and for Swallow-Belly Mangalitsa, it is 9.05 ±3.04. Differences can also be noticed in terms of shear force – its range is between 80.52 ±14.38 for Moravka, and between 83.81 ±11.95 for crossbreed pigs, while for Zlotnicka Spotted and for Pulawska, it is 18.3 ±4.4, and 31.7 ±10.6, respectively.

In summary, results from our study showed that Moravka and Swallow-Belly Mangalitsa have high quality meat, which can be used in the manufac-turing of traditional products. Meat from Moravka and Mangalitsa are used for production of cajna sausage and sremska sausage, petrovská sausage and Serbian pork ham. Those products have high acceptability in Balkan region, which show high quality of those products.



AcknowledgementsThe present research was financed by the Ministry of Science and Higher Education of the Republic of Poland (funds for statutory activity, DS 3203/KGiMDZ/2018) and BM4244.

REFERENCES

BARATTA M., SALERI, R., MAINARDI G.L., VALLE D. 2002: Leptin regulates GH gene ex-pression and secretion and nitric oxide produc-tion in pig pituitary cells. Endocrinology 143: 551–557.

CAMERON N.D., ENSER M., NUTE G.R., WHITTINGTON F.M., PENMAN J.C., FISKEN A.C., PERRY A.M., WOOD J.D. 2000: Genotype with nutrition interaction on fatty acid composition of intramuscular fat and the relationship with flavour of pig meat. Meat Sci. 55: 187–195.

CUNNINGHAM M.J., CLIFTON D.K., STEIN-ER R.A. 1999: Leptins actions on the repro-ductive axis: perspectives and mechanisms. Biol. Reprod. 60: 216–222.

EGERSZEGI I., RÁTKY J., SOLTI L., BRÜS-SOW K.-P. 2003: Mangalica - an indigenous swine breed from Hungary (Review). Arch. Anim. Breed. 46: 245–256.

FLOROWSKI T., PISULA A., ADAMCZAK L., BUCZYŃSKI J.T., ORZECHOWSKA B. 2006: Technological parametres of meat in pigs of two Polish local breeds – Zlotnicka Spotted and Pulawska. Anim Sci. J. 24(3): 217–224.

FONTANESI L., BUTTAZZONI L., GALIM-BERTI G., CALÒD D.G., SCOTTIA E., RUS-SO V. 2013: Association between melanocor-tin 4 receptor (MC4R) gene haplotypes and carcass and production traits in Italian Large White pigs evaluated with a selective genotyp-ing approach. Livest. Sci. 157(1): 48–56.

FONT-I-FURNOLS M., TOUS N., ESTEVE-GARCIA E., GISPERT M. 2012: Do all the consumers accept marbling in the same way? The relationship between eating and visual acceptability of pork with different intramuscular fat content. Meat Sci. 91(4): 448–453.

GALIÁN M., POTO Á., SANTAELLA M., PEI-NADO B. 2008: Effects of the rearing system on the quality traits of the carcass, meat and fat of the Chato Murciano pig. Anim. Sci. J. 79: 487–497.

JIANG Z.H., GIBSON J.P. 1999: Genetic poly-morphisms in the leptin gene and their asso-ciation with fatness in four pig breeds Mamm. Genome 10(2): 191–193.

KENNES Y.M., MURPHY B.D., POTHIER F., PALIN M.F. 2001: Characterization of swine leptin (LEP) polymorphism and their associa-tion with production traits. Anim. Genet. 32: 215–218.

KIM K.S., LARSEN N., SHORT T., PLASTOW G., ROTHSCHILD M.F. 2000: A missense variant of the porcine melanocortin-4 recep-tor (MC4R) gene is associated with fatness, growth, and feed intake traits. Mamm. Genome 11: 131–135.

DE OLIVEIRA PEIXOTO J., FACIONI GUI-MARÃES S.E., SÁVIO LOPES P., MENCK SOARES M.A., VIEIRA PIRES A., GUAL-BERTO BARBOSA M.V., DE ALMEIDA TORRES R., DE ALMEIDA E SILVA M. 2006: Associations of leptin gene polymor-phisms with production traits in pigs. J. Anim. Breed. Genet. 123(6): 378–383.

PETROVIĆ M., MIJATOVIĆ M., RADOJKOVIĆ D., RADOVIĆ Č., MARINKOV G., STOJANOVIĆ L.J. 2007: Genetic resources in pig breeding – Moravka. Biotechnol. Anim. Husb. 23(1–2): 1–11.

PETROVIĆ M., RADOVIĆ Č., PARUNOVIĆ N., MIJATOVIĆ M., RADOJKOVIĆ D., ALEKSIĆ S., STANIŠIĆ N., POPOVAC M. 2010: Quality traits of carcass sides and meat of Moravka and Mangalitsa pig breeds. Bio-technol. Anim. Husb. 26(1–2): 21–27.

PUGLIESE C., SIRTORI F. 2012: Quality of meat and meat products produced from southern Eu-ropean pig breeds. Meat Sci. 90(3): 511–518.

PUGLIESE C., SIRTORI F., ACCIAIOLI A., BOZZI R., CAMPODONI G., FRANCI O. 2013: Quality of fresh and seasoned fat of Cinta Senese pigs as affected by fattening with chestnut. Meat Sci. 93(1): 92–97.

SCOLLAN N.D., HOCQUETTE J.F., NUERN-BERG K., DANNENBERGER D., RICH-ARDSON I., MOLONEY A. 2006: Innova-tions in beef production systems that enhance



the nutritional and health value of beef lipids s and their relationship with meat quality. Meat Sci. 74: 17–33.

SEELEY R.J., DRAZEN D.L., CLEGG D.J. 2004: The Critical Role of the Melanocortin System in the Control of Energy Balance. Ann. Rev. Nutr. 24: 133–149.

SMITH S.B., HIVELY T.S., CORTESE G.M., HAN J.J., CHUNG K.Y., CASTENAD A P., GILBERT C.D., ADAMS V.L., MERSMANN H.J. 2002: Conjugated linoleic acid depresses the delta9 desaturase index and stearoyl coen-zyme A desaturase enzyme activity in porcine subcutaneous adipose tissue. J. Anim. Sci. 80: 2110–2115.

ULBRICHT T.L.V., SOUTHGATE D.A.T. 1991: Coronary heart disease: seven dietary factors. Lancet 338: 985–992.

ZHANG S., KNIGHT T.J., STALDER K.J., GOODWIN R.N., LONERGAN S.M., BE-ITZ D.C. 2007: Effect of breed, sex and ha-lothane genotype on fatty acid composition of pork longissimus muscle. J. Anim. Sci. 85: 583–591.

Streszczenie: Parametry jakości mięsa i profil kwasów tłuszczowych świń rasy mangalica ja-skółcza, morawka oraz ich mieszańców. Rasy autochtoniczne wiążą się z kulturą i tradycją danych regionów. Stanowią one bardzo ważny element krajobrazu jak i są źródłem produktów wysokiej jakości. Celem pracy była analiza pa-rametrów fizykochemicznych, składu chemicz-nego oraz profilu kwasów tłuszczowych mięśnia najdłuższego grzbietu świń rasy Moravka, Swal-low-Belly Mangalitsa i ich mieszańców. Ponad-to zsekwencjonowano fragmenty kodujące geny

leptyny (LEP) oraz receptora 4 melanokortyny (MC4R). W obrębie genu MC4R zidentyfiko-wano mutację c.892A>G (Asp298Asn). Analiza statystyczna nie wykazała różnic między geno-typami. Pomiędzy rasami statystyczne różnice wystąpiły dla zawartości tłuszczu (%) między rasą Moravka a mieszańcami (10,77 ±4,28 i 6,76 ±1,31). Rasa Swallow-Belly Mangalitsa cha-rakteryzowała się statystycznie największą za-wartością n-3 i n-6 PUFA (7,771 ±0,728 i 0,416 ±0,038). Poziom CLA była najwyższy u świń rasy Moravka a najniższy u świń rasy Swal-low-Belly Mangalitsa (0,079 ±0,010, and 0,072 ±0,007). Wyniki naszych badań potwierdzają, wysokie parametry jakościowe mięsa pochodzą-cego od świń rasy Moravka jak i Swallow-Belly Mangalitsa.

Słowa kluczowe: świnie, mangalica jaskółcza, morawka, cechy jakości mięsa, profi l kwasów tłuszczowych, LEP, MC4R


Authors’ addresses:Łukasz MigdałKatedra Genetyki i Metod Doskonalenia ZwierzątWydział Hodowli i Biologii Zwierząt Uniwersytet Rolniczy im. H. Kołłątaja w Krakowie30-059 KrakówPolande-mail: [email protected]



Environmental enrichment for pigs – practical solutions according to the Commission Recommendation (EU) 2016/336

JACEK NOWICKI1, MARTYNA MAŁOPOLSKA2, MARIOLA PABIAŃCZYK1, DOROTA GODYŃ2, TOMASZ SCHWARZ1, RYSZARD TUZ1

1 Faculty of Animal Breeding and Biology, University of Agriculture in Kraków, Poland2 National Research Institute of Animal Production in Balice n. Kraków

Abstract: Environmental enrichment for pigs – law regulations and practical solutions – a re-view. The public opinion is interested in purchas-ing high-quality and safe food products. This pri-marily concerns food of animal origin. Consumers pay more and more attention to the conditions in which animals are kept and question farm practic-es that are painful and cause suffering to animals. One of such procedures performed in piglets is cutting off tails. The pressure of public opinion has led to the changes in European legislation. Tail docking cannot be done routinely and instead, it is required that materials enriching environment for pigs should be provided. The features of such objects, as well as the materials from which they should be made, have been clearly defi ned in the regulations. The aim of the work is to answer the question how to enrich pig environment in slatted fl oor conditions, to be in compliance with the law and at the same time ensure the functionality of available solutions.

Key words: animal welfare, tail biting, environ-mental enrichment

EU LAW BACKGROUND

Period following after weaning is extremely critical stage of rearing pigs (Merlot et al. 2004). It determines the efficiency of production, but it is also important when the welfare of weaners

is taken into account. Usually during this time, unfamiliar weaners are placed in one pen and mixed together for economic reasons. Piglets separated from sows are in the new environment, which is related to the perception of fear they feel, and this often leads to aggression. The outbreak of aggression manifested in fights results from setting up a social hierarchy (Keel-ing and Gonyou 2001). Further pathologi-cal behaviours which appear during the fattening period are rarely dependent on the not stable hierarchy. Aggression may appear when the number of animals in the group exceeds their perception abilities. However, the main behavioural problem during fattening is tail-biting and other forms of cannibalism.

Directive 2008/120/EC specifying the minimum standards to ensure the welfare of pigs, states among other things, that pigs kept in groups must be protected from fights by the use of a large amount of litter or, if possible, by the introduc-tion of other materials suitable for explo-ration and occupation.

It is worth to notice that, the research on the environmental enrichment for pigs did not start, however, with the


380 J. Nowicki

entry into force of the current Directive regulations. The Directive regulations were not formulated narrowly, but they were based on the long-term research. Previous law regulations focused exclu-sively on the need to use litter, as was in the case of earlier legal acts in the EU, drawing attention to the importance of satisfying natural behavioural needs of pigs – Council Directive (91/630/EEC) dated 19 November 1991 about the mini-mum standards for pigs as well as in the Directive 2001/93/EC dated 9 November amending the Directive 91/630/EEC.

In the existing Directive 2008/120/EC, in point 4 of annex 1 it was stated that: “(...) pigs must have permanent access to a sufficient quantity of mate-rial to enable proper investigation and manipulation activities, such as straw, hay, wood, sawdust, mushroom compost, peat or a mixture of such, which does not compromise the health of the animals.”

In 2016, European Commission released Commission Recommenda-tion (EU) 2016/336 of 8 March 2016 on the application of Council Directive 2008/120/EC laying down minimum standards for the protection of pigs as regards measures to reduce the need for tail-docking.

THE ENVIRONMENTAL ENRICHMENT TRAITS ACCORDING TO THE RECOMMENDATION 2016/336

The Recommendation is much more strict than Directive in case of the traits which should characterize the environ-mental enrichment for pigs.

According to the paragraph 4 of men-tioned recommendation: “(...) enrichment

materials should enable pigs to fulfil their essential needs without compromising their health. For that purpose, enrich-ment materials should be safe and have the following characteristics: (a) Edible – so that pigs can eat or smell them, pref-erably with some nutritional benefits; (b) Chewable – so that pigs can bite them; (c) Investigable – so that pigs can investigate them; (d) Manipulable – so that pigs can change their location, appearance or structure....”

In the paragraph 5 we can read as fol-lows: ”(...) In addition to the characteristics listed in paragraph 4, enrichment materi-als should be provided in such a way that they are: (a) of sustainable interest, that is to say, they should encourage the explora-tory behaviour of pigs and be regularly replaced and replenished; (b) accessible for oral manipulation; (c) given in suf-ficient quantity; (d) clean and hygienic”. The very important issue is that “In order to fulfil pigs’ essential needs enrichments material should meet all the characteris-tics listed in paragraphs 4 and 5”.

Recommendation categorises enrich-ment materials as: a) optimal materials – materials pos-

sessing all the characteristics listed in paragraphs 4 and 5 and therefore such materials can be used alone;

b) suboptimal materials – materials pos-sessing most of the characteristics listed in paragraphs 4 and 5 and there-fore such materials should be used in combination with other materials;

c) materials of marginal interest – mate-rials providing distraction for pigs which should not be considered as fulfilling their essential needs and therefore optimal or suboptimal mate-rials should also be provided.


Environmental enrichment for pigs – practical solutions according 381

PRACTICAL SOLUTIONS

It is hard to imagine that other material but fresh straw which is replaced daily, can fulfil together all the requirements mentioned above. On the other hand, both mentioned above legal acts do not seem to take fully into account litter-free systems (slats) for pigs and the evacuation of droppings. They were not and still are not designed and adapted to evacuate such materials as straw, wood sawdust etc. The enrichment of the environment in the form of straw can indeed pose a problem, if the straw gets into the system of the evacu-ation of droppings. In connection with this, there are important questions what features should have the elements enrich-ing the slatted floor environment for pigs, and whether you can improve the comfort and the level of the welfare of piglets kept in the litter system by the application of additional solutions. One of the latest pro-posals suggests that when the enrichment of the environment of rearing cannot be provided in the form of straw or other type of bedding on the floor (for example in litter-free systems or grate systems), it is recommended that the enriching mate-rial should be offered in special trays. Some reports suggest that the straw with appropriate length (short stems) hinders the proper utilization of the evacuation system of droppings to a small extent (Westin et al. 2013). However, these data have not been verified yet on sufficient number of commercial farms. To meet the legal requirements, materials mentioned in the Directive should be placed in each pen for pigs. Very often they are provided with the minimal amount, replaced by things which are not compliant with the law requirements and chosen arbitrarily.

The indisputable issue is the fact that pigs have a natural tendency to explore the environment. These animals have evolved on partially wooded areas where they had to look for food in the soil. In spite of multi-generation selection, pigs still show internal motivation for explo-ration (Fraser et al. 1991). This need is particularly visible in the environment poor in stimuli (without enrichment), where manipulative behaviour is directed to a limited number of available elements (Rushen et al. 1993). In the environ-ment poor in stimuli, strongly motivated propensity to foraging and exploration is directed to the other pigs in the pen (Lyons et al. 1995, Kelly at al. 2000) and its equipment (Lyons et al. 1995). This can lead to aggression and cannibalism (Beattie et al. 1995). In such conditions, abnormal behaviours happen more often (van de Weerd et al. 2005, Scott et al. 2006). The reduction of the frequency of agonist behaviour in the enriched environment, reflects the lesser need to reciprocate persistent provocations from other pigs (Beattie et al. 1995). Features, which the elements of the enrichment of environment of rearing pigs should show, are still the subject of scientific debate (EUWelNet 2013).

In the middle of the first decade in the XXI century, it was stressed that a very important feature of the object is the possibility to bite and chew. The object itself should have a pleasant smell for pigs and the possibility of deforma-tion (van de Weerd et al. 2003). Pigs are especially interested in objects which are flexible, which when bitten, change their shape and can be destroyed after some time. This gives the pigs satisfaction and focuses their attention on a particular ele-


382 J. Nowicki

ment for a long time (van de Weerd et al. 2003, 2005, 2009, Scott et al. 2006). It has been proved that the elements provid-ing the animals with occupation, reduce the level of aggression significantly and make that they are not so prone to respond to “provocations” of other indi-viduals (Beattie et al. 1995). If the pigs cannot express their natural behaviour (especially exploratory behaviour), they become aggressive to such extent that they attack mainly the head, body side, abdomen and the neck of other individu-als. Thus they make extensive injuries from bruising to deep wounds. However, the degree of aggression can be almost eliminated by the application of at least one element enriching the environment of rearing (van de Weerd 2006).

Straw stimulates and allows animals to give vent to the needs of explora-tion, searching for food, burrowing and chewing (Studnitz et al. 2007). In spite of the fact that the application of straw has serious defects such as cost, labour outlay, less hygiene, at present no other form of the enrichment of environment provides the same level of occupation as straw (Scott et al. 2006). Clean and dry straw that is regularly replaced, provides all the features that are interesting and attractive for pigs, i.e. straw is suitable for chewing, rooting and can be easily destroyed as well as straw may be eaten. Straw stimulates exploratory behaviour. The more straw is available, the higher number of these behaviors is expressed by pigs (Studnitz et al. 2007). However, clean straw, provided in large quantities, may not be an appropriate solution for all pig producers. In such situations, other materials mentioned in the legislation may be more appropriate.

Approximately 90% of the produc-ers of pigs in the European Union keep animals on partially or completely slat-ted floor (Hendriks et al. 1998, Guy et al. 2013), therefore it is necessary to search for alternative forms of enrich-ing the environment, possible to use in these conditions (Scott et al. 2006). Usu-ally used on farms plastic tubes, chains, balls, bottles, tires do not meet all the features and requirements that would make them attractive for pigs. For exam-ple, a plastic tube or bottle is not edible, it is difficult to destroy and if you want to keep it clean when hanged over a pen, it quickly loses the value of novelty and pigs cease to be interested in it. Scott et al. (2006) compared the activity level of pigs housed in straw and on the slatted floor with plastic tubes as an enrichment and found that pigs spend more time interested in straw than plastic tubes. Increasing the number of toys with plas-tic tubes does not rise the occurrence of exploratory behaviour. Commercial Bite Rite – suspended cone with four attached tubes to bite, single tube suspended on the chain, two crossed tubes forming the so-called “helicopter”, suspended strips of material, balls of different size, chains, tires and many others, chosen when they are currently available are commonly used. Unfortunately, they do not meet all requirements mentioned in Commission Recommendation (EU) 2016/336. Moreover, none of these solutions offered the combination of the involvement of pigs in the exploration and manipulation with the snout, draw-ing the attention by stimulating the sense of smell, which is attractive for pigs. A predominant role in pigs is played by senses constituting the main adaptation



to the style of life of their ancestors, that is, smell and taste (Signoret et al. 1975). These senses play a vital role in wild boars in the search and selection of appropriate food and in social interac-tions. Pigs are omnivorous opportunists, which are able to eat almost every kind of food (e.g. Croney et al. 2003). With a strongly developed smell, these ani-mals are able to distinguish what is good for them and what is dangerous to eat. Probably some smells distinguished by these pigs can indicate a high level of protein, fat or carbohydrates in the food (Kyriazakis et al. 1990). Pigs learn smell and taste preferences from each other and younger individuals from their par-ents (Newberry and Wood-Gush 1985).

In the studies published by Nowicki et al. (2007a) attention was focused on the issue of the utilization of flavouring the element enriching the environment of pig rearing unprecedented then in the literature of subject so as to make it more attractive to draw the attention of these animals more. There is no doubt that the sense of smell plays a significant role in the process of the adaptation of pigs (Perry 1992, Kristensen et al. 2001, Jensen 2002, Nowicki and Klocek 2012). Pigs use smell not only to find food but also it serves them for social contacts (Mendl et al. 2002). On the other hand, there are many reports that pigs do not have a particularly well-developed sense of sight (Lomas et al. 1998, Tanaka et al. 1998, Hutson et al. 1993, 2000, Zonder-land et al. 2008), that is why the attempts were made to find whether the application of smell objects, can affect the change in behaviour and facilitate the adaptation of piglets after weaning and joining the ani-mals in a larger group by reducing time

and decreasing the frequency of agonistic behaviour. In spite of the Directive regu-lations, in the commercial pig farming systems the selection of objects, which enrich the environment for pigs, was often arbitrary and behavioural priori-ties of pigs were not taken into account. The consequence of such method of the enrichment of environment for pigs was a very fast lack of interest in this type of objects (Day et al. 2002)

A lot of reports show that the items placed on the floor of the pen can be very easily contaminated with droppings and eventually pigs - animals with a very sensitive sense of smell - quickly lose interest in them. It was the reason why in the literature the series of experiments using suspended objects which differed in case of the possibility of destruction, deformation, flavouring appeared in the last years (Nowicki et al. 2007a, 2007b, 2008, Nowicki and Klocek 2012). All the experiments were performed on straw bedding pens for weaners and fat-teners, so according to the mentioned EU regulation, the objects used may be called suboptimal materials, because most of them are destructible, chewable and investigable, however they are not edible. One of them (Nowicki et al. 2015) has very important feature, because it is equipped with the perforated container for changeable aromas, what ensures the novelty aspect. The interest in this object increases when the aroma is changed into the new one, and it makes it possible the decrease in dangerous and aggressive behaviours. This solution meets the hard-est requirement of the Commission Rec-ommendation (EU) 2016/336, because the container may be filled with edible aromatic material.


384 J. Nowicki

The number of enrichment objects placed in the pen is very important, as well. The Council Directive 2008/120/EC, annex 1, in point 4 laying down the general requirements on the prevention of tail-biting states that “...pigs must have permanent access to a sufficient quantity of material to enable proper investigation and manipulation activities, such as straw, hay, wood, sawdust, mushroom compost, peat or a mixture of such, which does not compromise the health of the animals”. The quality and quantity of materials are very important and each pig should have free access to those materials and ability to express exploration behaviour. The limited, insufficient amount of materi-als lead to competition between pigs and can cause aggression (van de Weerd et al. 2006). The localization of enrichment materials and objects inside pen is essen-tial, because it can stimulate pigs’ inter-est. The enrichments should therefore be placed close to the ground and should stay clean (without faecal fouling). As men-tioned above, the enrichment material that is soiled with faeces is not attractive to pigs which are characterized by perfect olfactory sense (Nowicki et al. 2008). It was found that when offered enrichment at different heights, pigs spend more time manipulating objects at ground level when compared to objects hanging 5 cm above floor level. Similarly, pigs manipu-late these low-hanging objects more than those offered at snout level (Courboulay 2011).

Moreover, point 4 (Directive 2008/120/EC, annex 1) showed emphasis on ani-mal’s health. Inadequately collected and stored straw could be a source of bacteria, fungi and mold. Consequently, enriching materials and objects are potentially dan-

gerous for pigs as a reservoir of pathogenic bacteria and viruses. Another risk factor is material from which the enrichment objects are made. One of the desirable features for environmental enrichment is possibility of deformation and destructi-bility. However, the way in which these objects are destroyed may cause danger, for example, splinters of soft pine wood, or wires in tires. The enrichment material cannot be toxic, as well.

During the examinations of welfare, pigs should be observed in case of activ-ity and interest of environmental enrich-ments. Following questions are useful to assess proper investigation: Does pigs have ability to express their natural behaviour connecting with searching and exploring environment elements? Are pigs able to eat, chew, root and destroy enrichment objects? Do pigs explore and try to manipulate other animals or other elements that are not enrichment of envi-ronment inside pen? Does each pig have permanent access to sufficient amount of enrichment objects inside a pen? Where the enrichment objects are located? Are the enrichment objects clean? Do pigs compete with each other for enrichment objects? Are the enrichment objects safe for pigs? Could they cause animal health risks?

ENVIRONMENTAL ENRICHMENT OR TAIL DOCKING PROCEDURE TO PREVENT TAIL BITING BEHAVIOUR?

In the barren environments, pigs are ex-posed to the lack of suitable enrichment substrate to explore and manipulate, which can cause pigs’ frustration and may also lead to abnormal behaviour. The



behavioural problems are easy to notice and can lead to destructing behaviour such as tail and ear biting, cannibalism, stereotypies (belly-nosing, snout rub-bing etc). Tail biting is a huge problem for both animal welfare and economics of pig production (Smulders et al. 2008). Tail biting is associated with a variety of pathological changes ranging from spinal abscesses to pyaemia in different parts of the body and may be related to the pigs’ motivation to explore novelty, to search for food and general occupation (EFSA 2007b).

The enrichment materials and objects which stimulate rooting, exploring and foraging behaviour are the best way to prevent tail baiting in pigs (Studnitz et al. 2007). The risk of occurring tail biting is lower while pigs have access to straw and artificial enrichment objects (Taylor et al. 2012). This underline the strong relationship between environmental enrichment, foraging and maintaining activity and the risk of occurrence tail biting. European Food Safety Author-ity (EFSA 2007b) reported that „there is little evidence that provision of toys such as chains, chewing sticks and balls can reduce the risk of tail biting”. While point 4, annex 1 Directive 2008/120/EC showed opposite relationship. In case of occurrence of tail baiting, point 8 of the same Directive is an essential guide of herd maintenance: „Neither tail-docking nor reduction of corner teeth must be car-ried out routinely but only where there is evidence that injuries to sows’ teats or to other pigs’ ears or tails have occurred. Before carrying out these procedures, other measures shall be taken to prevent tail-biting and other vices, taking into account environment and stocking den-

sities. For this reason inadequate envi-ronmental conditions or management systems must be changed”.

ASSESSING THE RISK OF TAIL BITING IN PIGS ACCORDING TO THE COMMISSION RECOMMENDATION (EU) 2016/336

While environmental enrichment objects are the most effective method to prevent and/or reduce abnormal behaviour such as tail-biting, other risk factors were identified in pig production. Tail-biting may be a pathological behaviour caused by stress (Sinisalo et al. 2012). This com-plex behavioural syndrome appears to provide the initial stimulus of tail biting, mostly in barren or uncomfortable envi-ronment which encourage pigs to focus on pen mates and the blood (Kritas and Morrison 2007). The occurrence of the risk of tail-biting in pigs involves lack of opportunities to fulfil their natural need for exploration and foraging behaviour (especially in barren environments). Arey (1991) concluded that „tail-biting is a sign that something is wrong with the system whether it is due to boredom, overcrowding, poor ventilation or diet. Its prevention should be of paramount importance”. EFSA (2007b) analysed the risk assessment of tail biting in pigs based on information obtained from scientific papers and made the ranking of hazards. The main risk factor for tail-biting is barren environment (fully slatted versus solid floor) and lack of manipulable materials (such as straw, hay, adequate enrichment). While, the lowest level of risk were noted in factors such as cold stress and poor air qual-ity. Interestingly, the high probability of


386 J. Nowicki

increase in the risk of ear and tail biting have been found in stocking density and high temperature inside piggery (EFSA 2007b). For this reason, inadequate en-vironmental conditions or management systems have to be changed. To make a decision about the management changes, the factors triggering tail-biting should be identified. The Recommendation 2016/336 provides some solutions how to assess the risk of tail-biting in pigs.

The Recommendation states that tail biting in pigs is an aberrant behaviour which has a multi-factorial origin. It is the reason why when applying the gen-eral requirements on the prevention of tail-biting and thereby a reduction of rou-tine tail-docking as laid down in annex 1 to Directive 2008/120/EC, Member States should take into account the best practices guidance based on scientific knowledge. According to the Recom-mendation, Member States should ensure that farmers carry out a risk assessment of the incidence of tail-biting based on animal and non-animal based indicators (‘the risk assessment’). In addition, they should establish compliance criteria with the requirements set out in the legislation and make them publicly available on the website.

The table below, printed originally in Commission Staff Working Docu-ment (SWD »2016« 49) presents the parameters to assess risk factors of tail biting included in the Recommenda-tion 2016/336. The possible assessment methods were presented, as well.

Based on the results of this risk assess-ment method, appropriate management changes in farms should be considered, such as supplying appropriate enrich-ment materials, in accordance with

presented above requirements, comfort-able environmental conditions, assuring a good health status and/or providing a balanced diet for pigs. The manage-ment changes should be done before the official inspection gives the permission for tail docking. Obviously, the effects of recommended management changes should be checked before the permission for tail docking.

The Commission Staff Working Docu-ment on best practices with a view to the prevention of routine tail docking and the provision of enrichment materials to pigs accompanying the document Commis-sion Recommendation 2016/336 states that: “It is therefore advisable to moni-tor the risk factors, by keeping detailed records of the husbandry conditions of the pigs as well as any findings that may trigger an episode of tail biting. This may help in identifying the underlying cause of the problem and measuring how effective, in the case of an outbreak, the measures put in place are”.

The identified hazards factors can be used for farmers to stop or prevent tail biting behaviour. Despite fact, that the wide range of factors increasing risk of tail biting is known, the exact triggering mechanism is still unclear. It should be emphasised that barren environment, in greatest degree increase risk of tail biting but in the same time, this behaviour have a multi-factorial origin. The risk factor that trigger the pathological behaviour is not necessarily a factor with greatest importance from assessment risk man-agement point of view. Previous research results suggested that provision of fresh straw each day in farrowing environment might contribute to reduced tail biting later in life (Moinard et al. 2003).



TABLE. Animal welfare indicators to assess risks of tail-biting

Criteria Non-animal based indicators Animal based indicators

Presence of biting

– increased occurrence of tail lesions and tail biting behaviour

– lowered tail posture– increased restlessness

Enrichment material

qualities of the material:– safe– edible – chewable – investigable – manipulablemanagement should ensure:– sustainable interest – accessible– in sufficient quantity– clean

– inappropriate exploratory behaviour (i.e. a low ratio of exploration directed to the enrichment material in comparison to that directed at pen fittings and/or other pigs)

Indicators showing inappropriate provision of enrichment material:– presence of bitten tails– presence of severe skin lesions

Cleanliness – material soiled with excreta– soiling of pen

– increased false nest building in sows – increased disease– increased dirtiness of animals

Thermal comfort and air quality

occurrence of:– extreme or variable air temperature– high airspeed (draughts)– intense light level– high level of harmful gases, e.g. carbon

dioxide, ammonia

increased:– panting, shivering – poor body condition, poor coat

condition– restlessness– red eyes– modified lying behaviour showing

thermal discomfort

Health status – poor biosecurity programme– inadequate vaccination programme

increased:– panting, shivering – lying behaviour (i.e. resting periods) – coughing, sneezing, red eyes– diarrhea– variation in growth within the group

Competition for food and space

– high number of animals per square meter of floor surface

– high number of animals per feeder– poor mixing management

increased : – skin lesions– aggression– restlessnesspoor body condition

Diet

– changes in diet composition– lack of sodium (salt) in the diet– lack of amino-acids in the diet– lack of energy in the diet

increased:– poor body condition, diarrhoea– poor coat condition– restlessness– foraging behaviour – gastric ulcers– variation in growth within the group


388 J. Nowicki

The multifactorial background of tail biting strongly relates to environmental risk factors, but very often even enrich-ment materials and rooting substrate could not to be sufficient to prevent this patho-logical behaviour. For example straw do not reduce aggression after the pigs are mixed on the farm (e.g. after weaning) (Arey and Franklin 1995). According to Council Directive 2008/120/EC: “(…) other measures shall be taken to pre-vent tail-biting and other vices, taking into account environment and stocking densities”. Achieving an improvement of early detection of tail biting is pos-sible by adequate, systematic evaluation and modification of management prac-tices with properly organize, specific veterinary advice. Despite of different housing and husbandry systems, the farmers should be supported by advisors or assessors with the knowledge about identification and minimisation possible risk factors and how to prevent abnormal behaviour in pigs (EFSA 2007b).

During one control inside farm, experts and producers are able to detect and prioritise the risk factors of tail biting, so farmers consequently could make a structural changes and those that require capital investment to change or man-agement changes (Taylor et al. 2012). Suggested tail damage scale classes is presented below:a – no damage – no evidence for tail-

baiting,b – minor damage – healed or mild

lesions, evidence of chewing but no evidence of swelling (red areas in the tail are not considered as wounds unless associated with fresh blood),

c – major damage – fresh blood is vis-ible on the tail, evidence of swelling

and signs of possible infection, par-tial loss of the tail (Welfare Qual-ity® Consortium 2009).

Tail biting usually appear during play, while pigs are lightly chewing and biting another pigs’ tail (without tail damage). While tail biting increase and results in wounds on the tail, bitten pigs may become more active or apathetic because of pain. Consequently, this lead to attract many pigs to bite or chew fresh blood, so pigs become aggressive and even canni-balism can occurred (Schrøder-Petersen and Simonsen 2001). Bitten animals suffer pain, feel fear which can caused escape behaviour, especially inside small pens (no place to hide) without envi-ronmental enrichment materials (EFSA 2007a).

Schrøder-Petersen and Simonsen (2001) reported that pigs’ tail is sensitive (peripheral nerves in the intact tip of the tail) so the pain from open tail wound could be acute (increased by infection) or pain from amputated tip may become a chronic pain. The bitten pig may become apathetic and may be charac-terized by a lack of appetite, reduction of body weight gain, weakness, loss of blood. Moreover, pigs with open tail wounds avoid open spaces such as eating from the feeder, to reduce further assault (Wallenbeck and Keeling 2013). Tail biting may lead to generalized infections and inflammatory states which result in deterioration quality of the carcass. The wounded tail may become infected, which causes abscesses in the adjacent tissue of the hindquarters and the pos-terior segment of the spinal column. Thus, even small tail wounds could be the place of infection and occurrence of pyaemia, which can lead to partial or full



condemnation of carcasses at slaughter (Grist 2007, Kritas and Morrison 2007).

The economic impact of tail biting was estimated for farms in Netherlands. If tail-biting occurred at the level 2.1%, the additional cost per one pig was esti-mated around 9.26 EUR. The fattening farm in herd to a 4,000 pigs, can lose up to 2 425 EUR. In Netherland the total costs caused by tail-biting was estimated to eight million EUR per year. (Zonder-land et al. 2011).

TAIL BITING AND TAIL DOCKING – INFLUENCE ON THE WELFARE OF PIGS

Both, tail biting and other welfare prob-lems decreased producer’s satisfaction of animal breeding and make it harder for the farmer (Kauppinen et al. 2010). Year by year, the level of education and awareness of animal welfare increase especially in European countries. The treaty on functioning of the European Union, Article 13 described: “The Union and the Member States shall, since animals are sentient beings, pay full regard to the welfare requirements of animals, while respecting the legisla-tive or administrative provisions and customs of the Member States (…)”. Therefore, tail docking is described as: „(..) likely to cause immediate pain and some prolonged pain to pigs.” (Directive 2008/120/EC). Tail docking, routinely used in many countries, is painful for piglets, because neuromas have been found in the tail stumps (Simonsen et al. 1991). The data about consequences of tail-docking such as chronic pain or dis-comfort are limited. However, research results suggested that tail docking can

cause chronic pain or sensitivity due to the development of traumatic neuromas in injured peripheral nerves (Sandercock et al. 2016). European Food Safety Authority (EFSA 2007b) estimated risk of chronic pain in case of tail docking in rage from 0 to 1 as 0.998. For that reason, tail-docking is considered as a practice which has a detrimental effect on the welfare of pigs (Directive 2008/120/EC). Nevertheless, tail docking is commonly practiced by pig producers, and it is very effective and controversial method to prevent or reduce tail biting (Sutherland et al. 2011), it only masks real problems or pathology on farm and as a constrains routine should be minimalized or even changed for alternative methods in ac-cordance to animal welfare.

The Directive clearly states that tail docking is detrimental to the welfare of pigs, so why is it still allowed (on large scale) as a method of preventing or combating the abnormal behaviour? It should be emphasised, that tail docking should be only conducted when other, non-invasive methods have failed. Some management factors are likely to reduce or prevent the probability to tail biting, but any of them are as effective as tail docking (Hunter et al. 2001). As a mul-tifactorial syndrome, tail biting can be caused by many reasons (internal factors and behavioural mechanisms) depend-ing of farm, so prevention methods which works on one farm are not always effective on the other farms (Schrøder-Petersen and Simonsen 2001). Hunter et al. (2001) noted tail biting level in the whole analysed population of docked pigs 2.4% and 8.5% in the whole popula-tion of long-tailed pigs. In some analysed cases, docking a tail reduced occurrence


390 J. Nowicki

of tail biting behaviour to 66% (Kritas and Morrison 2007). Nowadays, almost 90% of the pigs in Europe belong to the docked population, which is a consequence of high efficiency of this method in intensive housing systems (EFSA 2007b).

Problem of tail biting can occur even in tail docked population under unfa-vourable condition persist. This indicate, that tail docking is a reduction method, not (as was previously expected) method of removing tail biting syndrome (EFSA 2007b). Therefore, discussed Direc-tive informed that „pigs should ben-efit from environment corresponding to their needs for exercise and investiga-tory behaviour”, and the improvement of pig’s welfare and environment should be considered as a priority.

In some European countries such as: Sweden, the practice of tail docking is totally forbidden. Pigs with undocked tails can be at high risk of harmful social behaviour, thus environmental enrich-ments and straw bedding are required in this country because of the greatest impact on the prevention of abnormal behaviour (van de Weerd et al. 2005). According to EFSA (2007b), “the undocked pigs are kept in systems where hazard for tail biting are less prevalent (pigs have access to enrichment materi-als such as straw and additional space)”. The Swiss research results showed posi-tive effect of enrichment materials and daily access to outdoor in housing sys-tems on health and welfare of pigs (Cag-ienard 2005). Consequently, tail docking can be avoided when high-stimulus envi-ronment is provided and pigs can exhibit their natural behaviour (rooting, forag-ing behaviour).

Relationship between environmental enrichments and tail biting is very strong (next to the proper management of other risk factors) so the best indicator for good pig welfare (for weaned, growing and finishing pigs) is tail without any signs of damage (EFSA 2011). Additionally, “ it stands for high-quality management and respect for the integrity of the pig”.

It seems to be reasonable to think twice before making decision about tail docking. “Before carrying out these pro-cedures, other measures shall be taken to prevent tail-biting and other vices, taking into account environment and stocking densities. For this reason inadequate environmental conditions or manage-ment systems must be changed” (Coun-cil Directive 2008/120/EC, Annex 1, Chapter 1, point 8).

Once the animal welfare assessment has been carried out on the farm, it is useful to have a specific guide for anoth-er inspection process. All breeders and producers are obligated to maintain their herd with compliance of regulations. To improve control of pig welfare, in 2013, e-learning training on pig housing and management was carried out (EUWelNet 2013, Hothersall et al. 2016). When the tail biting occurred, appropriate changes in herd management must be made, with reference to risk factors in order to reduce and stop the cannibalistic behaviour. If the initial changes in management are not effective, then subsequent ones must be introduced. This process of introducing subsequent, appropriate changes should be continued until the tail biting and can-nibalistic behaviour is ceased completely. When tail-biting is stopped, the next batch of pigs should be reared without tail docking. Local veterinary inspectors



may allow to shorten tails by farmers, only as a short-term solution. However, producers are obligated to make appro-priate changes in the herd management to: firstly – reduce tail docking and sec-ondly – completely stop tail docking.

Summing up, it should be stated that the choice of enrichment for pigs in slatted floor systems is very difficult, but it should be remembered that law regulations are more and more strict and rigorous because of the pressure of public opinion on the politics. Each farm must have its own solutions to prevent abnormal behaviours in pigs, but all of them should meet law requirements. However, the perception of legal regula-tions cannot be uncritical. The guidelines set out in the Recommendation to the directive are clear and can also be met using materials other than straw bed-ding or straw available for pigs from special feeders. It seems, however, that the Commission Staff Working Docu-ment on best practices with a view to the prevention of routine tail docking and the provision of enrichment materials to pigs accompanying the document Com-mission Recommendation 2013/336 is excessively detailed, as it lists the types of enrichment of the environment that are assigned to the appropriate catego-ries of optimal, suboptimal and marginal interest. It seems that these exemplary materials (presented in this document) may affect the assessment of the farm made by the official institutions when the official inspectors focus only on the mentioned in this document materi-als. However, it is stated that this list is not exhaustive and the materials are not ranked as well as other materials may be used if they meet legal requirements.

In our opinion, it is important for the inspectors to consider each situation indi-vidually, focus not only on mentioned enrichment materials but also taking into account the features of each farm separately, especially in the farms where using straw or other bedding material may cause problems with flooding of manure.

REFERENCES

AREY DS. 1991: Tail-biting in pigs. Farm Build. Prog. 105: 20–23.

AREY D.S., FRANKLIN M.F. 1995: Effects of straw and unfamiliarity on fighting between newly mixed growing pigs. Appl. Anim. Be-hav. Sci. 45: 23–30.

BEATTIE V.E., WALKER N., SNEDDON I.A. 1995: Effects of environmental enrichment on behaviour and productivity of growing pigs. Anim. Welf. 4: 207–220.

CAGIENARD A., REGULA G., DANUSER J. 2005: The impact of different housing systems on health and welfare of grower and finisher pigs in Switzerland. Prev. Vet. Med. 68: 49–61.

COMMISSION RECOMMENDATION (EU) 2016/336 of 8 March 2016 on the applica-tion of Council Directive 2008/120/EC laying down minimum standards for the protection of pigs as regards measures to reduce the need for tail-docking; C/2016/1345.

COMMISSION STAFF WORKING DOCU-MENT on best practices with a view to the pre-vention of routine tail docking and the provision of enrichment materials to pigs; Accompany-ing the document Commission Recommenda-tion on the application of Council Directive 2008/120/EC laying down minimum standards for the protection of pigs as regards measures to reduce the need for tail-docking Brussels, 2016. Retrieved from: https://ec.europa.eu/food/sites/food/files/animals/docs/aw_prac-tice_farm_pigs_stfwrkdoc_en.pdf (accessed: 16.10.2018).

COURBOULAY V. 2011: Utiliation de différentes modalités de mise à disposition de chaînes pour des porcs en engraissement: impact sur le com-portement et les lésions des animaux. J. Rec. Por. 43: 183–184.


392 J. Nowicki

CRONEY C.C., ADAMS K.M., WASHINGTON C.G., STRICKLIN W.R. 2003: A note on vis-ual, olfactory and spatial cue use in foraging behaviour of pigs: Indirectly assessing cog-nitive abilities. Appl. Anim. Behav. Sci. 83: 303–308.

DAY J.E.L., SPOOLDER H.A.M., BURFOOT A., CHAMBERLAIN H.L., EDWARDS S.A., 2002: The separate and interactive effects of handling and environmental enrichment on the behaviour and welfare of growing pigs. Appl. Anim. Behav. Sci. 75: 177–192.

EFSA 2007a: Scientific report on the risks associ-ated with tail biting in pigs and possible means to reduce the need for tail docking considering the different housing and husbandry systems. The EFSA Journal 611: 1–13.

EFSA 2007b: Animal health and welfare in fatten-ing pigs in relation to housing and husbandry. The EFSA Journal 564: 1–14.

EFSA 2011: Technical Report, Prepared by Spoolder H., Bracke M., Mueller-Graf C., Edwards S. Retrieved from: http://www.efsa.europa.eu/en/supporting/doc/178e.pdf (ac-cessed:10.04.2018).

EU Directive 2008/120/EC 2008: Laying down minimum standards for the protection of pigs. Official Journal L 47.

EUWelNet 2013: EUWelnet Pip training: Un-derstanding environmental enrichment and tail docking requirements for finisher pigs in accordance with EU Directive 2008/120/EC. Available at www.euwelnet.eu (accessed: 10.04.2018).

FRASER D., PHILLIPS P.A., THOMPSON B.K., TENNESSEN T. 1991: Effects of straw on the behavior of growing pigs. Appl. Anim. Behav. Sci. 30: 307–318.

GRIST A. 2007: Porcine meat inspection: anat-omy, physiology and disease conditions. Not-tingham University Press, Nottingham, UK.

GUIDELINES CONCERNING COUNCIL DI-RECTIVE 2008/120/EC ON THE PROTEC-TION OF PIGS, DEVELOPED AT 2ND STAKEHOLDER MEETING, 2014. Retrieved from: http://ec.europa.eu/dgs/health_consum-er/information _sources/events/20140701_2nd-stakeholder-meeting_ en.htm (accessed: 10.04.2018).

GUY J.H., MEADS Z.A., SHIEL R.S., ED-WARDS S.A. 2013: The effect of combining

different environmental enrichment materi-als on enrichment use by growing pigs. Appl. Anim. Behav. Sci. 144: 102–107.

HENDRIKS H.J.M., PEDERSEN B.K., VER-MEER H.M., WITTMANN M. 1998: Pig hous-ing systems in Europe: Current distributions and trends. Pig News Inform. 19: 97N–104N.

HOTHERSALL B., WHISTANCE L., ZEDLACHER H., ALGERS B., ANDERS-SON E., BRACKE M., COURBOULAY V., FERRARI P., LEEB C., MULLAN S., NOWICKI J., MEUNIER-SALAÜN M-C. , SCHWARZ T., STADIG L., MAIN D. 2016: Standardising the assessment of environmental enrichment and tail docking legal requirements for finishing pigs. Anim. Welf. 25: 499–50

HUNTER E.J., JONES T.A., GUISE H.J., PEN-NY R.H.C., HOSTE S. 2001: The relationship between tail biting in pigs, docking procedure and other management practices. T. Vet. J. 161(1): 72–79.

HUTSON G.D., AMBROSE T.J., BARNETT J.L., TILBROOK A.J. 2000: Development of a behavioural test of sensory responsiveness in the growing pig. Appl. Anim. Behav. Sci. 66: 187–202.

HUTSON G.D., DICKENSON L.G., WILKIN-SON J.L., LUXFORD B.G. 1993: The response of sows to novel visual, olfactory and tactile stimuli. Appl. Anim. Behav. Sci. 35: 255–266.

JENSEN P. 2002: Ethology of domestic animals: an introductory text. CABI Publishing, Wall-ingford, UK, 1: 218.

KAUPPINEN T., VAINIO A., VALROS A., RITA H., VESALA K.M. 2010: Improving animal welfare: qualitative and quantitative method-ology in the study of farmers’ attitudes. Anim. Welf. 19(4): 523–536.

KEELING L.J., GONYOU H.W. 2001: Social behaviour in farm animals. CAB Intern. 147–157.

KELLY H.R.C., BRUCE J.M., ENGLISH P.R., FOWLER V.R., EDWARDS S.A. 2000: Be-haviour of 3-week weaned pigs in straw – flow, deep straw and flat deck housing systems. Appl. Anim. Behav. Sci. 68: 269–280.

KRISTENSEN H.H., JONES R.B., SCHOFIELD C.P., WHITE R.P., WATHES C.M. 2001: Theuse of olfactory and other cues for social recognition by juvenile pigs. Appl. Anim. Be-hav. Sci. 72: 321–333.



KRITAS S.K., MORRISON R.B. 2007: Relation-ships between tail biting in pigs and disease le-sions and condemnations at slaughter. T. Vet. Rec. 160: 149–152.

KYRIAZAKIS I., EMMANS G.C., WHIT-TEMORE C.T. 1990: Diet selection in pigs – choices made by growing pigs given foods of different concentrations. Anim. Prod. Sci. 51: 189–199.

LOMAS C.A., PIGGINS D., PHILLIPS C.J.C. 1998: Visual awareness. Appl. Anim. Behav. Sci. 57: 247–257.

LYONS C.A.P., BRUCE J.M., FOWLER V.R., ENGLISH P.R. 1995: A comparison of pro-ductivity and welfare of growing pigs in four intensive systems. Livest. Prod. Sci. 43: 265––274.

MENDL M., RANDLE K., POPE S. 2002: Young females can discriminate individual differences in odours from conspecific urine. Anim. Behav. 64: 97–101.

MERLOT E., MEUNIER-SALAÜN M.C., PRU-NIER A. 2004: Behavioral, endocrine and im-mune consequences of mixing in weaned pig-lets. Appl. Anim. Behav. Sci. 85: 247–257.

MOINARD C., MENDL M., NICOL C.J., GREEN L.E. 2003: A case control study of on farm risk factors for tail biting in pigs. Appl. Anim. Behav. Sci. 81(4): 333–355.

NEWBERRY R.C., WOOD-GUSH D.G.M. 1985: The suckling behaviour of domestic pigs in a semi-natural environment. Behav. 95: 11–25.

NOWICKI J., KOPYRA M., KLOCEK C. 2007a: The behavioural reaction of weaners to hang-ing toys: wooden ball and aromatized wooden ball – way to reduce aggression after mixing. J. Cent. Eur. Agric. 4(8): 447–452.

NOWICKI J., KOPYRA M., MOSKAŁA E. 2007b: The comparison of the behaviour of weaners housed after mixing in pen equipped with a hanging toys: object for biting and wood-en ball. J. Cent. Eur. Agric. 2(8): 153–158.

NOWICKI J., MOSKAŁA E., KOPYRA M. 2008: Behavioural response of mixed weaners to a hanging wooden ball and a free ball in the pen. Ann. Anim. Sci. 1(8): 63–69.

NOWICKI J., KLOCEK C. 2012: The effect of aromatized environmental enrichment in pen on social relations and behavioural profile of newly mixed weaners. Ann. Anim. Sci. 12(3): 403–412.

NOWICKI J., ŚWIERKOSZ S., TUZ R., SCHWARZ T., 2015: The influence of aroma-tized environmental enrichment objects with changeable aromas on the behaviour of weaned piglets. Vet. Arhiv. 85(4): 425–435.

PERRY G.C. 1992: Olfaction and taste. In: Farm animals and the environment, Phillips C.J.C., Piggins D. (Eds). CABI Publishing, Walling-ford, UK. 185–199.

RUSHEN J., LAWRENCE A.B., TERLOUW E.M. 1993: The motivational basis of stere-otypies. In: Lawrence A.B., Rushen J. (Eds.), Stereotypic Animal Behavior. Fund. Appl. Welf. CAB Inter. 41–65.

SANDERCOCK D.A., SMITH S.H., GIMINIANI P.D., EDWARDS S.A., 2016: Histopathologi-cal Characterization of Tail Injury and Trau-matic Neuroma Development after Tail Dock-ing in Piglets. J. Com. Path. 1(155): 40–49.

SCHRØDER-PETERSEN D.L., SIMONSEN H.B. 2001: Tail biting in pigs. T. Vet. J. 162(3): 196–210.

SCOTT K., TAYLOR L., GILL B.P., EDWARDS S.A. 2006: Influence of different types of envi-ronmental enrichment on the behaviour of fin-ishing pigs in two different housing systems. 1. Hanging toy versus rootable substrate. Appl. Anim. Behav. Sci. 99: 222–229

SIGNORET J.P., BALDWIN B.A., FRASER S. HAFEZ E.S.E. 1975: The beheviour of swine. In: E.S.E. Hafez (Ed). The Behaviour of Do-mestic Animals. Tindall and Cox. London. 295–329.

SIMONSEN H.B., KLINKEN L., BINDSEIL E. 1991: Histopathology of intact and docked pig tails. T. Brit. Vet. J. 147(5): 407–412.

SINISALO A., NIEMI J.K., HEINONEN M., VALROS A. 2012: Tail biting and production performance in fattening pigs. Livest. Sci. 143(2–3): 220–225.

SMULDERS D., HAUTEKIET V., VERBEKE G., GEERST R. 2008: Tail and ear biting le-sions in pigs: an epidemiological study. Anim. Welf. 17: 61–69.

STUDNITZ M., JENSEN M.B., PEDERSEN L.J. 2007: Why do pigs root and in what will they root? A review on the exploratory behaviour of pigs in relation to environmental enrichment. Appl. Anim. Behav. Sci. 107(3–4): 183–197.

SUTHERLAND M.A., DAVIS B.L., MCGLONE J.J. 2011: The effect of local or general


394 J. Nowicki

anesthesia on the physiology and behavior of tail docked pigs. Anim. 5(8): 1237–1246.

TANAKA T., MURAYAMA Y., EGUCHI Y., YOSHIMOTO T. 1998: Studies on visual acu-ity of pigs using shape discrimination learning. Anim. Sci. Technol. 69: 260–266.

TAYLOR N.R., PARKER R.M.A., MENDL M., EDWARDS S.A., MAIN D.C.J. 2012: Preva-lence of risk factors for tail biting on commer-cial farms and intervention strategies. T. Vet. J. 194(1): 77–83.

WALLENBECK A., KEELING L., 2013: Using data from electronic feeders on visit frequency and feed consumption to indicate tail biting outbreaks in commercial pig production. J. An-im. Sci. 91(6): 2879–2884.

WEERD H.A VAN DE., DAY J.E.L. 2009: A re-view of environmental enrichment for pigs housed in intensive housing systems. Appl. Anim. Behav. Sci. 116: 1–20.

WEERD H.A. VAN DE, DOCKING C.M., DAY J.E.L, AVERY P.J., EDWARDS S.A. 2003: A systematic approach towards developing en-vironmental enrichment for pigs. Appl. Anim. Behav. Sci. 84(2): 101–118.

WEERD H.A. VAN DE, DOCKING C.M., DAY J.E.L, BREUER K., EDWARDS S.A. 2006: Effects of species relevant environmental en-richment on the behaviour and productivity of finishing pigs. Appl. Anim. Behav. Sci. 99(3–4): 230–247.

WEERD H.A. VAN DE, DOCKING C.M., DAY J.E.L., EDWARDS S.A. 2005: The develop-ment of harmful social behaviour in pigs with intact tails and different enrichment back-grounds in two housing systems. Anim. Sci. 80(3): 289–298.

WELFARE QUALITY® ASSESSMENT PRO-TOCOL FOR PIGS. 2009: Sows and piglets, growing and finishing pigs. Welfare Quality® Consortium, Lelystad, Netherlands.

WESTIN R., HOLMGREN N., MATTSSON B., ALGERS B. 2013: Throughput capacity of large quantities of chopped straw in partly slat-ted farrowing pens for loose housed sows. Acta Agricult. Scand., Sect. A – Anim. Sci. 63: 1–10.

ZONDERLAND J.J., CORNELISSEN L., WOLTHUIS-FILLERUP M., SPOOLDER H.A.M. 2008: Visual acuity of pigs at differ-ent light levels. Appl. Anim. Behav. Sci. 111: 28–37.

ZONDERLAND J.J., BOSMA B., HOSTE R. 2011: Report on the financial consequences of tail damage due to tail biting among pigs in conventional pig farms in the Netherlands. Livest. Res. Wageningen UR report 543: 1570––8616.

Streszczenie: Wzbogacanie środowiska dla świń – praktyczne rozwiązania zgodnie z zaleceniem Komisji (UE) 2016/336. Opinia publiczna jest za-interesowana nabywaniem wysokich jakościowo i bezpiecznych produktów żywnościowych. Do-tyczy to także, a może nawet przede wszystkim żywności pochodzenia zwierzęcego. Konsumenci zwracają coraz większą uwagę na warunki, w ja-kich utrzymywane są zwierzęta i kwestionują praktyki fermowe, które sprawiają zwierzętom cierpienie. Jednym z takich zabiegów wykony-wanych u prosiąt jest obcinanie ogonów. Naciski opinii publicznej doprowadziły do zmian euro-pejskiego prawodawstwa. Obcinanie ogonów nie może być wykonywane rutynowo, a zamiast tego wymaga się aby w kojcach dla świń zapewniać materiały wzbogacające środowisko ich chowu. Cechy takich obiektów, jak i materiały z których mają one być wykonane zostały jasno określone w przepisach. Celem pracy jest odpowiedź na pytanie, jak wzbogacać środowisko chowu świń w warunkach bezściołowych, aby pozostawać w zgodzie z prawem, a jednocześnie zapewnić funkcjonalność dostępnych rozwiązań.

Słowa kluczowe: dobrostan zwierząt, gryzienie ogonów, wzbogacenie środowiska chowu świń


Authors’ adddress:Jacek NowickiZakład Hodowli Trzody Chlewnej i Drobnego Inwentarza Wydział Hodowli i Biologii Zwierząt,Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowieal. Mickiewicza 24/28, 30-059 KrakówPolande-mail: [email protected]



The impact of weather parameters on the microclimate inside the building intended for antelopes

KRZYSZTOF PAWLAK, MAGDALENA SWADŹBA-KARBOWYFaculty of Animal Breeding and Biology, University of Agriculture in Kraków

Abstract: The impact of weather parameters on the microclimate inside the building intended for antelopes. Microclimate inside the buildings re-presents one of major factors that affect animal welfare. The purpose of this study was to examine the impact of selected weather parameters on the microclimate of the building intended for sitatun-gas. The measurements covered temperature, rela-tive humidity, air fl ow, concentration of particulate matter as well as the number of bacteria, fungi and actinomycetes. Experiments were conducted in the period from winter to summer inside and outside the building for antelopes. Measurement results show that analyzed weather parameters exert ef-fect on the microclimate of investigated rooms. Both the temperature (summer) and air humidity (spring, summer) inside the building intended for housing sitatungas demonstrated a strong correla-tion with the conditions existing outside the buil-ding. Another observation made during the study regarded a signifi cant statistical relationship be-tween the concentration of PM10 inside and out-side the building. No effect of the winds blowing outside on the air fl ow inside the studied building was detected. An increase in the concentration of bacterial and fungi aerosols in winter was most probably caused by poor ventilation of the buil-ding owing to low temperatures outside. Despite noticeable impact of the weather parameters on the microclimate of the studied building, acceptable standards recommended for the sitatunga were not exceeded, except for too low air humidity in winter caused by the intensive use of the heating system.

Key words: microclimate, bioaerosols, building, zoo, weather parameters, sitatunga

INTRODUCTION

Welfare is a state of complete physical and mental health that ensures main-taining perfect harmony between the animal and its surrounding (Hughes 1988). Animal welfare is assessed based on physiological, behavioral, health, productive and zoohygienic indicators (Kołacz and Bodak 1999). Factors shap-ing microclimate inside the buildings are classified into zoohygienic indicators. Due to the fact that animals in zoos are kept in artificial environment, suitable microclimate in the facilities designed for them has a significant impact on animal health and reproduction. Microclimate inside animal houses is affected by both internal and external factors. Internal factors include: the number of animals in one building, proper ventilation and the type of materials that were used to put up the facilities. External factors consist of location of the building, its surroundings (roads, railways, airports, housing estate) and weather conditions). The term weather is used to describe atmospheric conditions at a particular time over a particular area. Weather is made up the following parameters: air temperature, air humidity, air flow, solar irradiance (insolation), wind speed


396 K. Pawlak, M. Swadźba-Karbowy

and direction, cloud cover, atmospheric precipitation and deposits as well as atmospheric pressure (Mills 2017).

The sitatunga (Tragelaphus spekei gratus) is one of popular antelope species inhabiting zoos. This species belongs to the order Artiodactyla and the family Bovidae. The sitatunga comes from the central and western Africa. Its natural habitat covers swampy areas (moors and marshes) as well as tropical equatorial rainforests. Sitatungas live in uniformly hot and humid climate year-round. Owing to its lifestyle it is also called “water-kudu”. This sessile animal is active both during the day and at night (AZA 2009). When it comes to its conservation status, the sitatunga has been grouped as least concern (LC) in the IUCN Red List of Threatened Species (The IUCN red list: 2018).

The study was aimed at examining the impact of selected weather parameters (temperature, humidity, air flow) on the microclimate inside the building for the sitatunga.


Investigated facility

The experiments were carried out in the building for sitatungas located within the zoo premises. The facility is situated on the flat area at an altitude of 272 meters above sea level. The long axis runs north-south. The facility consists of two parts: the first with the dimensions 10.10 m × 6.20 m × 2.95 and the second 6.00 m × 7.60 m × 2.55 m. The building has four exits leading to the enclosures and one intended for animal caretakers. The building has been provided with 8 win-

dows (130 cm × 80 cm). The facility is used by 11 antelopes with the total mass amounting to 595 kg. The animals are kept in the free stall system. The building is equipped with electric heaters.

Experimental design

The experiments were carried out in three series (series I – winter, series II – spring, series III – summer). The measurements in each series were taken in the morning, afternoon and evening for three con-secutive days, except for microbiological tests that were conducted once per each experimental series (the second day of taking measurements – afternoon).

Test methods

Two measurement points were des-ignated within the building (each in different part) inside the stalls and one outside, 15 meters away from the facility. The measurements inside the building were taken at the height of an animal head, while those made outside 2 m above the surface of the ground. The measurements taken within the study included: air temperature, relative hu-midity, air flow (Airflow™ Instruments Velocity Meter TA440), concentration of the particulate matter (electronic particle counter PM10: DT-96, Accuracy 10 μg/m3, manufactured ACM). The micro-biological examination was carried out stationary using a volumetric method, with a 1-stage MAS-100 impactor. The air samples were collected once, each sample in duplicate. The apparatus was placed at a height of 1.0–1.5 m above the floor or ground (external measurements) in order to take samples from the animal’s


The impact of weather parameters on the microclimate inside the building... 397

respiratory zone. The flow rate of the air stream during sampling was 100 l/min. In the bacterial and fungal aerosol in-vestigations, 1.0-minute aspiration time was used, and the volume of air sample taken by the impactor was 0.10 m3. The following microbiological substrates were used for collection of bacterial aerosol samples: tryptic soy agar for the total bacterial count, Gauze’s medium for actinomycetes, EMB medium for Gram-negative bacteria, Chapman’s staphylococcal substrate and MEA malt agar for fungi. The incubation condi-tions of the air samples were as follows for the tested groups of microorganisms: bacteria: 1 day (37°C) + 3 days (22°C) + 3 days (4°C), fungi: 4 days (30°C) + 4 days (22°C). Prolonged incubation of the samples was aimed at allow to growth in the lower temperature range of slowly growing bacterial strains.

STATISTICAL ANALYSIS

The data obtained from this experiment were subjected to statistical analysis by calculating Pearson’s correlation coef-ficient (R) using sigma stat 2.03 (systat software gmbh, Germany). Testing was preceded by examination of the normal-ity of distribution using the Shapiro-Wilk test. It was found that the analyzed data have a normal distribution.


Microclimate created inside the build-ing is one of the factors that affect animal welfare (McArthur 1987). It is extremely important especially in the case of animals kept at zoos, where the animals are housed in buildings with ar-

tificial microclimate. Such man-shaped conditions should be as similar as pos-sible to the conditions existing in the wild, within the natural animal habitat. The factors that influence microclimate inside buildings for animals include, among others, air temperature outside the building.

Animals are characterized by different temperature requirements. Most species belonging to the subgenus antelopes display relatively high resistance to hot temperature. It has been assumed that the maximum temperature for these animals shall not exceed 38°C (Smith et al. 1997). According to the American Zoo and Aquarium Association (azaungulates.org) the minimum allowable tempera-ture inside the buildings intended for the sitatunga shall not be lower than 10°C, while the optimum temperature is 26°C.

During the experiment the tempera-tures recorded inside the building did not exceed acceptable temperature range for these animals. Temperature inside the facility for sitatungas was quite stable and ranged between 15.0°C and 17.2°C in experimental series I and between 14.9°C and 17.7°C in experimental series II. During taking measurements in winter the building was warmed using electric heaters. The highest tempera-tures inside the building were recorded in summer. The highest temperature was recorded on the second measurement day in the afternoon (24.8°C), while the lowest on the third day in the morning (16.7°C) – Figure 1.

Temperature outside the building in winter ranged between –12.0°C and –7.0°C, in the series II – spring between 6.0°C and 17.0°C, in summer between 17.9°C and 26.8°C (Fig. 1).


2530 5101520

temperature (oC) -15

-10-50

Air

mea

sure

men

t tim

e

seri

es I

-win

ter

seri

es II

-sp

ring

seri

es II

I -su

mm

er

mea

n te

mpe

ratu

res

insi

de th

e bu

ildin

g fo

r si

tatu

ngas

ai

r te

mpe

ratu

re o

utsi

de th

e bu

ildin

g

FIG

UR

E 1.

Air

tem

pera

ture

in th

e fo

llow

ing

mea

sure

men

t day

s



Based on the obtained results it can be concluded that during experimen-tal series I and II the construction and furnishing inside the building allowed to maintain stable thermal conditions despite highly unfavorable temperatures recorded outside.

In summer, during heatwaves, the temperature inside the building increased by 7.1°C as compared to the highest tem-peratures recorded during experimental series I and II. Despite the above, the temperature did not exceed limit values established for the sitatunga. The calcu-lated correlation coefficient of tempera-ture inside and outside the building was: winter –0.1 (heated building), spring 0.5, summer 0.9.

Air humidity is the second key factor which is always taken into consideration during evaluating microclimate inside buildings intended for animals. Too high concentration of water vapor in buildings for animals may lead to arthritis, upper respiratory tract infection, impaired immunity, poor feed usage and increased incidence of illnesses caused by mycotox-ins (Xiong at al. 2017). Whereas too low water vapor content in air leads to drying out mucous membrane in the respiratory system and its rupture. Ruptured mucous membrane provides gateway for patho-genic germs, especially those responsible for developing infections of the upper respiratory tract (Herbut and Angrecka 2012). Optimum relative humidity (RH) in livestock buildings should range between 60 and 80% (Marciniak 2014). However, available reference materials do not include information on the limits inside buildings for sitatungas. It must be remembered that the natural habitat of these antelopes covers swampy areas

where the air humidity ranges between 77 and 88% (www.blueplanetbiomes.org).

In the studied period relative air humid-ity inside the building was vary change-able. In winter this parameter reached values between 40.5% and 57.0%. Con-siderably higher values were recorded during II and III experimental series. In spring the highest RH value amounted to 86.0%, while the lowest to 64.0%. In summer RH values were similar 85.0% and 64.0%, respectively (Fig. 2). It can be stated that, except for the winter season, air humidity in the investigated building was suitable for sitatungas. Too low air humidity recorded in winter was most probably caused by intensive use of the heating system.

Relative air humidity measured out-side during experimental series I ranged between 57% and 80%, during series II between 50% and 75%, while during series III between 55% and 73% (Fig. 2). As shown by the data, relative air humid-ity inside the building, with the exception of the winter season (R = 0.4), is strongly depended on the water vapor content in the atmosphere (spring R = 0.8, summer R = 0.9). The correlation between water vapor content inside and outside the building arises due to the fact that even as much as 30% of water vapor inside the building comes from the air entering the building through ventilation system (Soldatosa et al. 2005).

Air movement in the buildings for animals is triggered by winds blowing outside as well as ventilation and heat-ing systems. In the period from autumn to spring the value of this parameter should not exceed 0,3 m/s, while during the spells of extremely hot temperatures


90100 4050607080

Relative humidity of air (%)

0102030

R

seri

es I

-win

ter

seri

es II

-sp

ring

seri

es II

I -su

mm

er

mea

sure

men

t tim

e

mea

n re

lativ

e ai

r hum

idity

insi

de th

e bu

ildin

g fo

r si

tatu

ngas

re

lativ

e ai

r hu

mid

ity o

utsi

de th

e bu

ildin

g

FIG

UR

E 2.

Rel

ativ

e hu

mid

ity o

f the

air

in th

e fo

llow

ing

mea

sure

men

t day

s



it should not go beyond 0,5 m/s. Too fast air flow distorts electric charges accu-mulated in the animal coat and leads to damaging air layer that adheres to the skin. The consequences of such situa-tion may cover a rapid decrease of skin temperature, immune deficiency and infections of the upper respiratory tract (Bustamante at al. 2015).

Air flow in the investigated building was stable. During I, II and III meas-urement series air flow ranged between 0.015 m/s and 0.122 m/s, between 0.001 m/s and 0.063m/s, from 0.008 m/s to 0.120 m/s, respectively (Fig. 3). Given the data presented above, air flow did not exceed limit values recommended for the sitatunga. The speed of air flow measured outside in the first series fluc-tuated between 1.54 m/s and 6.17 m/s, in the second series between 1.50 m/s and7.20 m/s, while for the third series from 1.00 m/s to 6.17 m/s (Fig. 3). Com-parison of the measurements inside and outside the building revealed that air movement outdoors did not produce any significant effect on the conditions prevailing inside facilities for sitatungas (R = –0.2).

Particle pollution represents another important factor that affects animal welfare but it is often neglected during evaluating microclimate conditions inside buildings for animals. Until recently this issue has been addressed only in view of pollution in the rooms for animals generated by dried plants, excrement, feed, hay, straw, animal hair, epithelium and pollen (Hartung and Saleh 2007). Fine dusts emitted as a result of fuel combustion or traf-fic are responsible for producing smog. The quantity of particulate matter that is

generated in these processes is often few times greater than permissible limits. It is obvious that the highest concentra-tion of particulate matter is recorded in atmospheric air but polluted air enters into the buildings for animals through the ventilation system.

The results demonstrate a strong cor-relation between the concentration of the particulate matter inside and outside the building (R = 0.9). The greatest concen-tration of PM10 in winter, both inside and outside, was recorded in the evening on the first measurement day (58,2 μg/m3

and 135.2 μg/m3, respectively), while the lowest in the morning on the second measurement day (30.1 μg/m3 and34.5 μg/m3). In spring the highest con-centration of particulate matter amount-ed to 39.4 μg/m3 (inside the building) and 54.6 (outside the building), while the lowest to 4.1 μg/m3 (inside the build-ing) and 5.8 (outside the building). In summer the largest PM10 concentra-tion was also recorded in the evening(44.0 μg/m3 and 60.3 μg/m3), while the lowest in the morning (5.2 μg/m3 and6.0 μg/m3) (Fig. 4). It should be pointed out that an increase in the concentration of the particulate matter in atmospheric air was associated with greater difference in particle pollution inside and outside the building.

Too high concentration of the particu-late matter can lead to many pathologi-cal conditions. Fine dust floating in air is capable of obstructing sebaceous (dry and exfoliating skin) and sudoriferous glands (problems with thermoregula-tion), can cause conjunctiva irritation and conjunctivitis, allergy (hay fever), irritation and congestion of nasal mucosa as well as bronchitis. It must be remem-


FIG

UR

E 3.

Air fl o

w ra

te in

the

follo

win

g m

easu

rem

ent d

ays (

loga

rithm

ic sc

ale)

10 0,11

ir velocity (m/s)

mea

sure

men

t tim

e

0,00

1

0,01

Ai

seri

es I

-win

ter

seri

es II

-spr

ing

seri

es II

I-su

mer

mea

n ai

r flo

w ra

te in

side

the

build

ing

for

sita

tung

as

air f

low

out

side

the

build

ing


120

140 406080100

120

PM10 dust concentration (μg/m3)

seri

es I

-win

ter

seri

es II

-sp

ring

02040

P

mea

sure

men

t tim

e

mea

n PM

10 c

once

ntra

tion

insi

de th

e bu

ildin

g fo

r si

tatu

ngas

PM

10 c

once

ntra

tion

outs

ide

the

build

ing

FIG

UR

E 4.

PM

10 d

ust c

once

ntra

tion

in th

e fo

llow

ing

mea

sure

men

t day

s



bered that particulate matter may carry fungal spores that can cause pulmonary mycosis. Moreover, some fine dusts contain heavy metals, dioxins or asbes-tos that are known for their carcinogenic effects (Bruce at al. 2015).

Available research data does not con-tain information about permissible limits of particulate matter inside the buildings at the zoo. Daily 24-hour limit value for PM10 for people amounts to 50 μg/m3. In the investigated facility this limit was slightly exceeded only twice.

The quantity and quality of microor-ganisms in air is one of the hygiene indi-cators for assessing the conditions inside buildings for animals (Tombarkiewicz et al. 2004). Microbial pollution includes bacteria, viruses as well as fungal and actinomycete spores that are suspended in air as bioaerosols. Unfortunately, allow-able limit values for microbes inside the buildings intended for animals have not been defined (Ropek and Frączek 2016).

There are only recommended values of the permissible concentrations of the most common categories of microorgan-isms in the internal environment, namely work rooms contaminated with organic dust (1.0 × 105 CFU·m–3 and 5.0 × 104 CFU·m–3, respectively for bacteria and fungi) (Augustinska and Pośniak 2016). Quantity of germs in air inside the build-ing for the sitatunga was presented in Table. In the analyzed building the great-est number of bacteria and fungi was recorded in winter. An increase in the quantity of fungal and bacterial aerosol was most probably caused by poor venti-lation owing to low temperatures outside. The number of actinomycetes in air inside the building for sitatungas did not show any correlation with any investigated microclimate factors (correlation coef-ficient: number of actinomycetes and air temperature 0.2; number of actinomycetes and air humidity –0.2; number of actino-mycetes and air movement –0.1, number

TABLE. Average values of the number of microbes in air in the following experimental series cfu·m–3

Experimental series

Measurementlocation

Totalnumber

of Bacteria

Totalnumber

of Actino-mycetes

Gram--negativebacteria

Staphylo-cocci

Totalnumberof Fungi

I winter

inside the building 8.5 × 103 0.2 × 103 3.2 × 103 1.8 × 103 5.1 × 103

outside the building 1.3 × 103 0.06 × 103 0.03 × 103 0.1 × 103 0.5 × 103

II spring



III summer





of actinomycetes and dust concentration 0.2). The concentration of bioaerosol (Bacteria 1.3 × 103/ 0.7 × 103, Fungi 0.5 × 103/ 0.3 × 103 »cfu·m–3« (Table) in air within zoo premises was significantly lower as compared with investigated facility. These observations regard both fungal and actinomycete aerosols.

CONCLUSIONS

Providing suitable microclimate conditions is one of major functions of the buildings intended for animals. Measurements taken in our study show that weather parameters affect microclimate in the investigated building. Both temperature (summer) and air humidity (spring, summer) in the build-ing for sitatungas strongly correlated with conditions observed outside. The experi-ment also showed significant correlation between PM10 concentration outside and inside the building. No relationship was found between the winds blowing outside and the rate of air flow inside investigated building. An increase in the concentration of bacterial and fungal aerosols detected in winter was most probably caused by poor ventilation that resulted from low outdoor temperatures. Despite producing detectable effects on the microclimate of the building, limit values for investigated weather parameters recommended for the sitatunga were not exceeded, except for too low air humidity in winter caused by intensive use of the heating system.

Acknowledgements

The paper has been drafted within the scope of a grant awarded by the Ministry of Science and Higher Education: DS-3263/ZWRiDZ

REFERENCES

AUGUSTYŃSKA D., POŚNIAK M. (Eds) 2016: Czynniki szkodliwe w środowisku pracy – war-tości dopuszczalne: CIOP – PIB, Warszawa

AZA – THE ASSOCIATION OF ZOOS AND AQUARIUMS. 2009: Antelope and Giraffe TAG Regional Collection Plan, 5th Edition.

BRUCE D., RANDI O.M., VIRGINIE M., VONNE L., CECILIE M. 2015: Air quality in alternative housing systems may have an im-pact on laying hen welfare. Part I. Dust. Ani-mals (Basel). 5(3): 495–511.

BUSTAMANTE E., GARCÍA-DIEGO F.J., CALVET S., TORRES A.G., HOSPITALER A. 2015: Measurement and numerical simula-tion of air velocity in a tunnel-ventilated broiler house. Sustainability. 7: 2066–2085.

HARTUNG J., SALEH M. 2007: Composition of dust and effects on animals. Landbau. Völken. Sp. Issue. 308: 111–116.

HERBUT P., ANGRECKA S., 2012: Forming of temperature-humidity index (THI) and milk production of cows in the free-stall barn dur-ing the period of summer heat. Anim. Sci. Pap. Rep. 30(4): 363–372.

HUGHES B.O. 1988: Welfare of intensively housed animals. Vet. Res. 123: 33–36.

KOŁACZ R., BODAK E. 1999: Dobrostan zwie-rząt i kryteria jego oceny [Welfare of animals and criteria of its evaluation]. Med. Wet. 55(3): 147–154 [in Polish].

MARCINIAK A.M. 2014: The use of tempera-ture-humidity index (thi) to evaluate tempera-ture-humidity conditions in freestall barns J. Cent. Eur. Agr. 15(2): 73–83.

MCARTHUR A.J. 1987: Thermal interaction be-tween animal and microclimate: a comprehen-sive model. J. Theor. Biol. 21(2): 203–38.

MILLS E. 2017: Weather Studies: Introduction to Atmospheric Science 6th Ed, 40.

ROPEK D., FRĄCZEK K. 2016: Microbiologi-cal air quality in livestock farm buildings Env. Med. 19(3): 16–22.

SMITH R., RUHTER D., FLANAGAN J., OLSEN T., IADEROSA J., FULK R., COR-RELL T. 1997: AZA minimum husbandry guidelines for keeping antelopes and gazelles in captivity.In minimum husbandry guidelines for mammals; American Zoo and Aquarium Association: Silver Spring, Md, USA.



SOLDATOSA A.G., ARVANITISB K.G., DASKALOVC P.I., PASGIANOSA G.D., SI-GRIMISB N.A. 2005: Nonlinear robust tem-perature–humidity control in livestock build-ings. Comput. Electron. Agr. 49(3): 357–376.

THE IUCN RED LIST OF THREATENED SPE-CIES. Available at http://www.iucnredlist.org/ (accessed: ....08.2018).

TOMBARKIEWICZ B., GRZYB J., PODGÓR-NI Z. 2004: The attempt to evaluate of range of microbiological contamination of environment of cow farm. Lviv State of Vet. Med. 6(2): 121–126.

XIONG Y., MENG Q., GAO J, TANG X., ZHANG H. 2017: Effects of relative humidity on animal health and welfare. J. Integr. 16(8): 1653–1658.

http://www.azaungulates.org/ (accessed: ....08.2018).

www.blueplanetbiomes.org/rainforest.htm.ej (ac-cessed: ....08.2018).

Streszczenie: Wpływ składników pogody na mi-kroklimat budynku dla antylop. Jednym z czyn-ników wpływających na dobrostan zwierząt jest mikroklimat pomieszczeń, w których przebywa-ją. Celem niniejszej pracy było zbadanie wpływu wybranych wskaźników pogody na mikroklimat budynku dla sitatung. W trakcie pomiarów oce-niano temperaturę, wilgotność względną, ruch powietrza, stężenie pyłów, oraz ilość bakterii, grzybów i promieniowców. Badania zostały wy-konane w okresie zima–lato wewnątrz i na ze-wnątrz budynku dla antylop. Przeprowadzone pomiary wykazały, że badane wskaźniki pogo-dowe miały wpływ na mikroklimat ocenianego pomieszczenia. Zarówno temperatura (lato), jak

i wilgotność powietrza (wiosna, lato) w obiek-cie przeznaczonym dla sitatung kształtowały się w ścisłej korelacji z warunkami panującymi na zewnątrz. W trakcie badań zauważono również ścisłą korelację między stężeniem pyłu P10 na zewnątrz i wewnątrz budynku. Nie stwierdzono wpływu wiejących na zewnątrz wiatrów na pręd-kość ruchu powietrza wewnątrz badanego po-mieszczenia. Obserwowany w okresie zimowym wzrost poziomu aerozolu bakteryjnego i grzy-bowego był najprawdopodobniej spowodowany słabym przewietrzaniem budynku, wynikającym z niskich temperatur panujących na zewnątrz. Po-mimo zauważalnego wpływu wskaźników pogo-dowych na mikroklimat badanego budynku, nie stwierdzono przekroczenia dopuszczalnych norm zalecanych dla sitatung. Wyjątek stanowiła zbyt niska w okresie zimowym wilgotność powietrza, spowodowana intensywną pracą systemu grzew-czego.

Słowa kluczowe: mikroklimat, bioaerozol, budy-nek, ogród zoologiczny, składniki pogody, sita-tungi


Authors’ address: Krzysztof Pawlak Wydział Hodowli i Biologii ZwierzątUniwersytet Rolniczy im. Hugona Kołłątaja w Krakowieal. Mickiewicza 24/28, 30-059 Kraków. [email protected]



SiO2 nanostructures as a feed additive to prevent bacterial infections in piglets

MAREK PIESZKA1, PAULINA SZCZUREK1, MARIUSZ PIETRAS1, MAGDALENA PIESZKA2

1 National Research Institute of Animal Production2 Faculty of Animal Breeding and Biology, University of Agriculture in Kraków

Abstract: SiO2 nanostructures as a feed additive to prevent bacterial infections in piglets. The aim of the study was to determine the effect of a feed additive containing SiO2 nanostructures (nSiO2) mixed with organic acids encapsulated in a lipid matrix, fructooligosaccharide and Yucca Schidige-ra extract, on the prevalence of bacterial gastrointe-stinal infections in piglets, production parameters, nitrogen emission, and the condition of the sows during pregnancy. The experiment was carried out on 18 sows (Polish Landrace × Polish Large White) and 194 piglets from their litters, randomly divided into 3 groups (6 sows with litters each): experimen-tal groups A and B fed standard diets supplemented with the additive differentiated by the concentra-tion of nSiO2 and control group fed standard diets without any additive. The additive was given to sows from the 100th day of pregnancy to the end of lactation, while to piglets from 7 to 70 days of age. The feed additive used signifi cantly improved production parameters of weaned piglets, including body weight gain and feed intake (P ≤ 0.05). The analysis of gut microbiota showed a signifi cant in-crease in the number of lactic acid bacteria and a decrease in the number of bacterial pathogens (P ≤ 0.05), followed by reduced prevalence of diarrhea and ammonia emission (P ≤ 0.05) in groups A and B compared to control. The improved performan-ce and prevention of bacterial diarrhea indicate the reasonable use of the feed additive in both tested doses in rearing of pigs.

Key words: SiO2 nanostructures, gut microbiota, piglets, feed additives

INTRODUCTION

The rearing of piglets is one of the most difficult stages in the pig production cycle, often associated with gastroin-testinal (GI) diseases and piglets losses. To reduce the occurrence of bacterial infections in piglets, it is necessary to develop innovative feed additives with multidirectional effects that will mimic the action of antibiotic growth promoters (AGP). The most popular feed additives with antibacterial properties include acidifiers that inhibit the growth of pH-sensitive pathogens by lowering their internal pH (Ahmed et al. 2014). In turn, prebiotics such as fructooligosaccharides (FOS), promote the growth of commensal bacteria (lactic acid bacteria, Bifidobacte-rium) ensuring the proper composition of the GI ecosystem (Mikkelsen and Jensen 2004). Plant extracts, e.g. Yucca Schidi-gera with high amount of saponins, may further facilitate the bacteria penetration


408 M. Pieszka et al.

by active compounds by reducing the surface tension of cells (Cheeke 2000). Other, less popular compounds, such as SiO2 nanostructures (nSiO2), due to their specific physicochemical properties, may also show strong bactericidal and toxin binding abilities (Pietroiusti et al. 2016).

It was assumed that the use of a feed additive containing a mixture of bio-logically active compounds through their synergistic bactericidal action will be effective in regulating intestinal microenvironment and improving piglets performance. Therefore, the aim of the study was to determine the effect of the feed additive containing organic acids encapsulated in a lipid matrix which allows for their gradual release in the entire GI tract, FOS, Yucca Schidigera extract and nSiO2 on piglets survival and growth performance during rearing

period, gut microbiota composition and a prevalence of bacterial diarrhea, as well as nitrogen emission and sows condition during pregnancy.


The experiment was conducted on 18 multiparous sows (Polish Landrace × Polish Large White) and 194 piglets from their litters, randomly divided into 3 groups (6 sows with their litters each): experimental groups A and B fed stand-ard diets supplemented with the additive differentiated only by the concentration of nSiO2, and control group fed the same diets but without any additive (Table 1). The additive contained fumaric, citric, malic and sorbic acids (POCh, Poland) encapsulated in a lipid matrix, FOS (Orafti P95, Beneo, Belgium), Yucca Schidigera extract (BioSol-YS-30S,

TABLE 1. Study scheme and feed additive composition

Item Gestating sows Lactating sowsIngredient(g/t of feed) control A B control A B

nSiO2 – 500 1000 – 500 1000Organic acids* – 600 600 – 800 800FOS – 2000 2000 – 400 400Yucca Sch. – 1000 1000 – 1200 1200

Nursed pigletsprestarter I

Weaned pigletsprestarter II

Weaned pigletsstarter

Ingredient(g/t of feed) control A B control A B control A B

nSiO2 – 400 800 – 600 1200 – 500 1000Organic acids* – 2000 2000 – 1500 1500 – 1200 1200FOS – 2000 2000 – 3000 3000 – 6000 6000Yucca Sch. – 1200 1200 – 1000 1000 – 800 800

* Mixture of organic acids encapsulated in lipid matrix: 200, 100, 100 and 100 g/kg of fumaric, sorbic, citric and malic acid, respectively


SiO2 nanostructures as a feed additive to prevent bacterial infections in piglets 409

Ultra Bio-Logics Inc, USA) and nSiO2 (A300, Evonik, Germany) with particle size of 5–10 nm and absorption area of 380 m2/g. The additive was given to sows from the 100th day of pregnancy to

the end of lactation, while to piglets from 7 to 70 days of age. The piglets were weaned on the 28th day of life. The composition and nutritional value of diets is presented in Table 2. Piglets

TABLE 2. Composition and nutritional value of diets

Ingredient (g/kg) Sows Nursed piglets prestarter I

Weaned piglets prestarter II

Weaned piglets starter

Barley 30.0 12.91 25.0 23.0Triticale 25.0 – – –Maize 20.0 20.0 15.0 20.0Soybean meal 46% 16.0 5.00 5.00 19.0Wheat – 30.0 25.0 25.0Wheat bran 5.08 – 5.20 5.21Fodder chalk 1.00 – – 1.00Monocalcium phosphate 0.60 0.70 1.00 0.95NaCl 0.45 0.26 0.30 0.35HP300 – 10.0 9.00 –Phytase 0.01 – – –Vegatable oil 1.00 2.50 2.00 2.00Milk powder – 16.0 10.0 2.00Calcium formate – 1.50 1.10 –L-Lys 98% 0.23 0.31 0.40 0.46L-Thr 98% 0.03 0.07 0.12 0.15DL-Met 99% – 0.02 0.14 0.14L-Trp 98% – 0.03 0.04 0.04Vitamins and minerals 0.50 0.50 0.50 0.50Additive* 0.65 vs. 0.70 0.56 vs. 0.60 0.61 vs. 0.67 0.85 vs. 0.90 Composition:– Metabolic energy, MJ/kg– Crude protein, g/kg– Lys, g/kg– Met+Cys, g/kg– Thr, g/kg– Trp, g/kg– Ca, g/kg– P, g/kg– Na, g/kg

13.01619.085.425.911.916.885.172.07

13.921213.57.188.522.768.665.921.50

13.419212.67.618.032.727.776.451.61

13.117912.07.217.712.557.906.011.69

* Mixture of organic acids encapsulated in a lipid matrix, FOS, Yucca Schidigera extract and nSiO2

according to group allocation



received diets: prestarter I (4–27 days of age), prestarter II (28–49 days of age) and starter (50–70 days of age).

During the experiment, the animals were monitored for body weight changes and feed intake as well as general health status, taking into account the number of days with diarrhea. Sows’ body weight during lactation and number of piglets born alive was also recorded. At the end of the experiment (70 days of age), 6 piglets from each group (3♂ and 3♀) were sacrificed by intraperitoneal admin-istration of pentabarbiturate (Thiopental, Sandoz, Switzerland), and samples from the cecum and colon were collected and secured for microbiological analysis. The content of the various microorganisms was determined by generally applicable Koch plate dilution method on specific agar: total number of bacteria (MPA medium), lactic acid bacteria (Demeter medium), Salmonella and Shigella (SS medium), Bacteroides (Schaedler agar medium with blood, anaerobic conditions), Enterococ-cus (Mac-Conkey agar), and Clostridium perfringens (BBL Clostridium difficile Selective Agar). Escherichia coli was identified using titer method (bromocresol purple broth with lactose) and confirmed by culture on Endo agar. The incubation time for all bacteria was 24 h at 37°C. During the section, digesta from the stom-ach, duodenum, jejunum, caecum and colon was also collected to determine the pH, while in the cecum and colon digesta, the content of volatile fatty acids (VFA) was determined by gas chromatography. Analysis of the feed composition, dry matter and N-ammonium content in feces collected in the last week of the experi-ment was carried out using AOAC (2000) methods.

The data was statistically analyzed using one-way ANOVA or Kruskal-Wallis test for non-gaussian distribution followed by Tukey or Dunn test, respec-tively, for multiparous comparisons (GraphPad Prism 7.0, CA, USA). Dif-ferences were considered statistically significant at P ≤ 0.05.


The average feed intake and body weight losses in sows during lactation were similar among the groups (6.3, 6.7 vs. 6.0 kg and 30.2, 31.6 vs. 26.7 kg, in groups A, B vs. control, respectively, P > 0.05). The piglets rearing and production parameters are shown in Tables 3 and 4, respectively. The use of the additive containing nSiO2 reduced both, the piglets losses in the post-weaning period and the diarrhea incidence by an average of 70% in both experimental groups A and B compared to control (Table 3). There was a significant increase and an upward trend in body weight gain of piglets in both pre- and post-weaning period in groups B and A, respectively, compared to control (Table 4). Feed intake throughout the study period was also significantly higher in groups A and B compared to control (P ≤ 0.05).

The obtained results are consistent with other studies where the use of acidi-fiers as well as a mixture of organic acids and probiotics positively influenced feed intake and rearing parameters in piglets (Rekiel and Kulisiewicz 1996, Janik and Pieszka 2006). It has been for example shown that diet supplementation with a mixture of organic acids during post-weaning period resulted in better gain and feed efficiency than pigs fed the control



TABLE 3. Rearing parameters

ItemGroup

control A BNumber of litters 6 6 6Number of piglets born alive 63 65 66Piglets losses between birth and weaning 2 (3.17%) 2 (3.08%) 2 (3.03%)Piglets losses between weaning and 70 days of age 3 (4.92%) 0 0Diarrhea incidence (number of piglets x number of days with diarrhea) 96 (2.18%) 34 (0.75%) 24 (0.52%)

TABLE 4. Production parameters of piglets

ItemGroup

Pcontrol A B

Body weight (kg)Day 1 of age 1.58 ±0.04 1.60 ±0.04 1.68 ±0.04 0.121Day 70 of age 18.9 ±1.12A 22.7 ±1.28B 24.5 ±1.34A 0.001

ADG (g/day)1–28 days of age 198 ±15a 224 ±17b 238 ±21a 0.02828–42 days of age 124 ±7a 140 ±9b 178 ±10a 0.02442–70 days of age 370 ±18ab 482 ±20a 487 ±21b 0.0111–70 days of age 246 ±11A 296 ±15B 333 ±16A 0.009

ADFI (g/day/piglet)1–28 days of age 27 27 32 0.42228–42 days of age 220 231 236 0.76642–70 days of age 579a 654bc 706ac 0.0111–70 days of age 348ac 396a 415c 0.039

FCR (kg/kg)1–28 days of age 0.14 0.13 0.10 0.59728–42 days of age 1.48 1.54 1.71 0.4951–70 days of age 1.22 1.18 1.17 0.153

A, B – means in the rows with the same capital letters differ signifi cantly at P ≤ 0.01. a, b, c – means in the rows with the same small letters differ signifi cantly at P ≤ 0.05. ADG calculated as (fi nish body weigh-start body weight)/days. ADFI calculated as feed intake per group/days/number of piglets in group. FCR calculated as feed intake/weight gain.

diet (Li et al. 2008). Similarly, a blend of short chain and medium chain fatty acids as well as phenolic compounds

added to weaned pigs’ diet also improved body weight gains and feed efficiency to comparable levels after using AGP (Long



et al. 2018). In the same study a reduced incidence of diarrhea was also observed and it is know that post-weaning diarrhea can also strongly influence mortality and retardation of growth in piglets (Long et al. 2018). Acidifiers by lowering the pH in GI tract, enhance activity of pro-teolytic enzymes, slow down gastric retention time, and thus improve protein and amino acid metabolism and appar-ent total tract digestibility (Gerritsen et al. 2010, Ahmed et al. 2014). The growth promotional effects of these compounds, and thus the feed additive used in this study, might also result from direct sup-pression of pathogenic microbes in GI tract (Ahmed et al. 2014).

The results of intestinal microflora analysis are presented in Table 5. A significant increase in total bacteria and Lactobacillus and Enterococcus number

in both cecum and colon in groups A and B compared to control was observed (P ≤ 0.01). Simultaneously, there was a significant decrease in the number of Enterobacteria, Salmonella and Shigella and Clostridium in groups A and B com-pared to control (P ≤ 0.05). The number of E. coli showed a downward trend in group B compared to control. The use of organic acids in feed additives stabilize the intestinal microflora not allowing the development of pathogenic bacteria by disrupting enzymes activity and signal transduction in pH-sensitive bacteria (Piva et al. 2007). A similar antimicro-bial action against gut pathogens without harming beneficial bacteria was showed in piglets treated by a different mixtures of organic acids (Li et al. 2008, Øverland et al. 2008, Ahmed et al. 2014, Long et al. 2018).

TABLE 5. Composition of intestinal microfl ora (expressed as log cfu/g)

ItemGroup

PGroup

Pcontrol A B control A B

Cecum ColonTotal bacteria number

6.73 ±0.02A

7.29 ±0.04A

7.04 ±0.08A <0.0001 6.88

±0.02A7.44

±0.04A7.20

±0.08A <0.0001

Lactobacillus/Enterococcus

6.10 ±0.57A

6.91 ±0.06A

6.69 ±0.04B <0.0001 6.25

±0.57A7.06

±0.06A6.84

±0.04B <0.0001

Enterobacteria 6.65 ±0.20A

6.22 ±0.14A

5.89 ±0.08A <0.0001 6.65

±0.20A6.22

±0.14A5.89

±0.08A <0.0001

Salmonella and Shigella

2.35 ±0.41ab

0.98 ±0.87a

0.80 ±0.95b 0.0049 2.34

±0.591.08

±0.940.92

±1.05 0.0221

Bacteroides/Prevotella

4.00 ±0.06A

3.10 ±0.18AB

4.13 ±0.09B <0.0001 4.16

±0.06A3.26

±0.18AB4.29

±0.09B <0.0001

Clostridium 3.65 ±0.29aB

1.92 ±0.98a

1.00 ±1.55B 0.0004 3.76

±0.28aB2.12

±1.08a1.07

±1.66B 0.0009

Escherichia coli (cfu/mL)

2.19 × 10–7

3.67 × 10–7

5.35 × 10–8 0.7737 2.19 ×

10–53.67 × 10–5

5.35 × 10–6 0.8941

A, B – means in the rows with the same capital letters differ signifi cantly at P ≤ 0.01. a, b – means in the rows with the same small letters differ signifi cantly at P ≤ 0.05.



Prebiotics such as FOS which are not digested in small intestine, may serve as the substrate for commensal gut microflora and stimulate their growth. Mikkelsen and Jensen (2004) showed that diet supplementation with FOS result in increased number of Lactoba-cillus and reduced number of E. coli in GI tract of piglets. In turn, the antibacte-rial effects of nSiO2 are not fully under-stood but they might be related to their specific electrostatic interactions that modify electric charge on the surface of the bacterial membrane and disrupt their integrity (Thill et al. 2006, Hajipour et al. 2012). The second possible mecha-nism implies the increased production of free radicals and induction of oxidative stress what have a strong adverse effect on membranes and other cell structures (Soenen et al. 2011). The reports on the antibacterial effect of silica nanoparti-cles in animals are very limited, however several studies showed that natural and synthetic zeolites are very effective in prevention of bacterial infections in farm animals (Papaioannou et al. 2005), and on the other hand, engineered nanoma-terials might have a positive effect on the composition of GI microflora and animals’ growth, however the effect is strongly dependent on the individual properties of nanoparticles used (e.g. particles size) as well as dose and time of administration (Pietroiusti et al. 2016).

For example, a study by Fondevila et al. (2009) showed that the addition of silver nanoparticles (size of 60–100 nm) in diets for weanling pigs led to improved growth parameters in a dose dependent manner and reduced ileal concentration of coliforms, total bacteria, Clostridium and Atopobium without affecting the lactobacilli content.

An exposure of the same animal model to copper-loaded nanoparticles also resulted in increased average daily gain and feed intake and decreased diarrhea rate, as well as favorable changes in intestinal bacteria content with increasing amount of lactobacillus and bifidobacterium and reduced number of E. coli (Wang et al. 2012). Another study performed in mice showed that oral exposure to 5–500 ppm of silica nanoparticles or to 46–4600 pbb of silver nanoparticles mixed in food may also affect the gut microbiota (Lecloux et al. 2015). Moreover, several classes of antimicrobial nanoparticles have proven their effectiveness for treating infectious diseases, including antibiotics resistant one (Hajipour et al. 2012).

It should be however noted that nano-particles might show cyto- and immu-notoxic effects through the direct effect on gut microbiota or through systemic effects of metabolites generate (Xu et al. 2010, Pietroiusti et al. 2016). In study on mice it has been showed that nano and micron sized silica (30 nm and 30 μm, respectively) induce similar biological effect, however diet supplementation with nanosilica results in an elevated plasma ALT level suggesting its effect hepatotoxic, even though there were no differences in general health of mice after feeding of 140 g silica/kg body weight (So et al. 2008). A risk assessment stud-ied of synthetic amorphous silica in food (<100 nm, food additive E551) showed that it is characterized by low GI absorp-tion and it may pose a health risk through liver accumulation but the results are not conclusive (van Kesteren et al. 2014). All these suggest that nanoparticles might be an interesting alternative to AGP used in animals nutrition however more detailed



TABLE 6. Gastrointestinal pH profi le, VFA, ammonia and dry matter content

ItemGroup

Pcontrol A B

pHStomach 3.97 ±0.04 3.94 ±0.03 3.92 ±0.03 0.18Duodenum 6.02 ±0.06 5.93 ±0.05 5.91 ±0.04 0.11Jejunum 6.55 ±0.08 6.40 ±0.09 6.38 ±0.09 0.06Cecum 6.00 ±0.05 5.96 ±0.06 5.92 ±0.07 0.12Colon 5.98 ±0.07 6.09 ±0.09 6.14 ±0.10 0.07

VFA (mmol/kg)Cecum 80.2 ±7.6ab 111 ±8.8a 113 ±9.1b 0.048Colon 90.9 ±4.5AB 149 ±5.8A 152 ±5.9B 0.009

VFA, molar proportions in colon (%)Acetic acid 63.1 ±7.06AB 50.0 ±5.27A 49.0 ±5.41B 0.01Propionic acid 23.8 ±2.34 28.6 ±2.75 29.0 ±2.90 0.24Butyric acid 9.95 ±0.25ab 16.4 ±0.28a 17.1 ±0.30b 0.039Isobutyric acid 0.45 ±0.03ab 1.24 ±0.04a 1.20 ±0.04b 0.028Valeric acid 2.01 ±0.09ab 2.76 ±0.11a 2.62 ±0.10b 0.046Isovaleric acid 0.69 ±0.06ab 0.91 ±0.07a 1.07 ±0.08b 0.012

Ammonia (mg/g of dry matter)Cecum 0.72 ±0.07ab 0.45 ±0.05b 0.41 ±0.05a 0.048Feces 1.06 ±0.07ab 0.56 ±0.06a 0.50 ±0.05b 0.011Dry matter (%)Cecum 15.0 ±0.02 15.6 ±0.03 16.2 ±0.04 0.52Feces 27.0 ±0.17 26.2 ±0.16 26.4 ±0.15 0.74

A, B – means in the rows with the same capital letters differ signifi cantly at P ≤ 0.01. a, b – means in the rows with the same small letters differ signifi cantly at P ≤ 0.05.

studies are still needed to determine their specific mode of action and all possible side effects should be taken into consid-eration.

The data on gastrointestinal pH profile, VFA, ammonia and dry matter content are shown in Table 6. The use of the addi-tive resulted in increased VFA content in cecum and distal part of colon, as well as reduced ammonia content in cecum and feces in both experimental groups A

and B compared to Control (P ≤ 0.05). Ammonium ions adversely affect the gut environment creating alkaline conditions that are more favorable for the invasion of pathogenic bacteria (Papaioannou et al. 2005). Moreover, exposure to ammo-nia malodor is an environmental stressor for both humans and animals as well as an important source of air pollution (Cambra-Lopez et al. 2010). The reduc-tion in intestinal ammonia formation



have been also reported by others with the use of organic acid, prebiotics, natu-ral and synthetic zeolites as well as Yucca Schidigera extracts (Yen and Pond 1990, Papaioannou et al. 2005, Windisch et al. 2008). This may result from the stimu-lation of intestinal microflora activity which uses the nitrogen for a synthesize of its own proteins. Similarly, prebiotics and selected organic acids may facilitate the production of VFA in piglets GI tract (Van Loo et al. 1999, Suiryanrayna and Ramana 2015).

CONCLUSIONS

The use of additive with multidirectional activity containing a mixture of nSiO2, organic acids encapsulated in a lipid matrix, FOS and Yucca Schidigera extract in the feed ratios for piglets positively influence production and rearing param-eters by increasing ADG and ADFI, as well as reducing piglets losses, diarrhea incidence and nitrogen emission. The additive used improved intestinal micro-flora composition by favoring the growth of commensal bacteria and limiting the growth of pathogens. The tested additive is an interesting and effective alternative for AGP in the prevention of bacterial infections and promotion of health and growth in young animals, and its use in both tested nSiO2 doses seems to be rea-sonable during rearing period of piglets.

REFERENCES

AHMED S.T., HWANG J.A., HOON J., MUN H.S., YANG C.J. 2014: Comparison of single and blend acidifiers as alternative to antibiotics on growth performance, fecal microflora, and humoral immunity in weaned piglets. Asian-Aust. J. Anim. Sci. 27(1): 93–100.

AOAC 2000: Official methods of analysis of the association of official analytical chemists. In: Helrich K. (ed.) Association of official Ana-lytical chemists, 17th edn, Arlington, Virginia, USA.

CAMBRA-LÓPEZ M., AARNINK A.J., ZHAO Y., CALVET S., TORRES A.G. 2010: Airborne particulate matter from livestock production systems: A review of an air pollution problem. Environmental pollution. 158(1): 1–17.

CHEEKE P.R., 2000: Actual and potential appli-cations of Yucca schidigera and Quillaja sapon-aria saponins in human and animal nutrition. J. Anim. Sci. 77: 1–10.

FONDEVILA M., HERRER R., CASALBAS M.C., ABECIA L., DUCIA J.J. 2009: Silver nanoparticles as a potential antimicrobial addi-tive for weaned pigs. Anim. Feed Sci. Technol. 150: 259–269.

GERRITSEN R., VAN DIJK A.J., RETHY K., BIKKER P. 2010: The effect of blends of or-ganic acids on apparent faecal digestibility in piglets. Livest. Sci. 134: 246–248.

HAJIPOUR M.J., FROMM K.M., ASHKAR-RAN A.A., DE ABERASTURI D.J., DE LAR-RAMENDI I.R., ROJO T., SERPOOSHAN V., PARAK W.J., MAHMOUDI M. 2012: Anti-bacterial properties of nanoparticles. Trends Biotechnol. 30(10): 499–511.

JANIK A., PIESZKA M. 2006. Effectiveness of probiotic, acidifier and mannan oligosaccha-ride use in piglet rearing. Anim. Sci. Suppl. (2): 335–340.

LI Z., YI G., YIN J., SUN P., LI D., KNIGHT C. 2008: Effects of organic acids on growth performance, gastrointestinal pH, intestinal microbial populations and immune responses of weaned pigs. Asian-Aust. J. Anim. Sci. 21: 252–261.

MIKKELSEN L.L, JENSEN B.B. 2004: Effect of fructo-oligosaccharides and transgalacto-oligosaccharides on microbial populations and microbial activity in the gastrointestinal tract of piglets post-weaning. Anim. Feed Sci. Tech-nol. 117: 107–119.

ØVERLAND M., KJOS N.P., BORG M., SKJERVE E., SØRUM H. 2008: Organic acids in diets for entire male pigs: Effect on skatole level, microbiota in digesta, and growth performance. Livest. Sci. 115(2–3): 169–178.



PAPAIOANNOU D., KATSOULOS P.D., PAN-OUSIS N., KARATZIAS H. 2005: The role of natural and synthetic zeolites as feed additives on the prevention and/or the treatment of cer-tain farm animal diseases: A review. Micropor. Mesopor. Materials. 84: 161–170.

PIETROIUSTI A., MAGRINI A., CAMPAGNO-LO L. 2016: New frontiers in nanotoxicology: gut microbiota/microbiome-mediated effects of engineered nanomaterials. Toxicol. Appl. Pharmacol. 299: 90–95.

PIVA A., PIZZAMIGLIO V., MORLACCHINI M. 2007: Lipid microencapsulation allows slow release of organic acids and natural iden-tical flavors along the swine intestine. J. Anim. Sci. 85: 486–493.

REKIEL A., KULISIEWICZ J. 1996: Zastoso-wanie dodatków zakwaszających i probiotycz-nych w wychowie prosiąt [The use of acidify-ing and probiotic preparates in piglet rearing]. Med. Wet. 52(4): 266–269 [in Polish].

SO S.J., JANG I.S., HAN C.S. 2008: Effect of micro/nano silica particle feeding for mice. J. Nanosci. Nanotechnol. 8(10): 5367–5371.

SOENEN S.J., RIVERA-GIL P., MONTENE-GRO J.M., PARAK W.J., SMEDT de S.C., BRAECKMANS K. 2011: Cellular toxicity of inorganic nanoparticles: common aspects and guidelines for improved nanotoxicity evalua-tion. Nano Today. 6(5): 446–465.

SUIRYANRAYNA M.V., RAMANA J.V. 2015: A review of the effects of dietary organic acids fed to swine. J. Anim. Sci. Biotech. 6(1): 45.

THILL A., ZEYONS O., SPALLA O., CHAU-VAT F., ROSE J., AUFFAN M., FLANK A.M. 2006: Cytotoxicity of CeO2 Nanoparticles for Escherichia coli. Physico-Chemical Insight of the Cytotoxicity Mechanism. Environ. Sci. Technol. 40: 6151–6156.

KESTEREN van P.C., CUBADDA F., BOU-WMEESTER H., EIJKEREN van J.C., DEKKERS S., JONG de W.H., OOMEN A.G., 2015: Novel insights into the risk assessment of the nanomaterial synthetic amorphous silica, additive E551, in food. Nanotoxicology 9(4): 442–452.

VAN LOO J., CUMMINGS J., DELZEENE N., ENGLYST H. 1999: Functional food proper-ties of non-digestible oligosaccharides: a con-sensus report for the ENDO project (DGXII AIRII-CT94-1095). Br. J. Nutr. 81: 121–132.

WANG M.Q., DU Y.J., WANG C., TAO W.J., HE Y.D., LI H. 2012: Effects of copper-loaded chitosan nanoparticles on intestinal microflora and morphology in weaned piglets. Biol. Trace Elem. Res. 149: 184–189.

WINDISCH W., SCHEDLE K., PLITZNER C., KROISMAYR A. 2008: Use of phytogenic products as feed additives for swine and poul-try 1. J. Anim. Sci. 86(14): E140–E148.

XU Z., WANG S.L., GAO H.W. 2010: Effects of nano-sized silicon dioxide on the structures and activities of three functional proteins. J. Hazard. Mater. 180(1–3): 375–383.

YEN J.T., POND W.G. 1990: Effect of carbadox on net absorption of ammonia and glucose into hepatic portal – vein of growing pigs. J. Anim. Sci. 68: 4236–4242.

Streszczenie: Nanostruktury SiO2 jako dodatek paszowy zapobiegający infekcjom bakteryjnym u prosiąt. Celem badań było określenie wpływu dodatku paszowego zawierającego nanostruktury SiO2 (nSiO2) wraz z kwasami organicznymi chro-nionymi w matrycy lipidowej, fruktooligosachary-dem i ekstraktem z Yucca Schidigera na częstość występowania infekcji bakteryjnych przewodu pokarmowego u prosiąt, parametry produkcyjne, ilość emitowanego azotu oraz kondycję loch w cza-sie ciąży. Doświadczenie przeprowadzono na 18 lochach (pbz × wbp) oraz 194 prosiętach pocho-dzących z ich miotów, przydzielonych losowo do 3 grup (6 loch wraz z miotami każda): Grupy do-świadczalne A i B otrzymujące standardowe pasze wzbogacone o badany dodatek zróżnicowany je-dynie pod względem zawartości nSiO2, oraz grupę kontrolną otrzymującą standardową paszę bez do-datku. Dodatki podawano lochom od 100. dnia cią-ży do końca okresu laktacji, prosiętom natomiast od 7. do 70. dnia życia. Zastosowane dodatki paszowe miały istotny wpływ na poprawę parametrów od-chowu odsadzonych prosiąt, w tym przyrosty masy ciała i pobranie paszy (P ≤ 0.05). Analiza mikrobio-logiczna treści pokarmowej jelit wykazała istotny wzrost liczby bakterii kwasu mlekowego i spadek liczebności bakterii patogennych w grupach A i B w porównaniu do kontroli (P ≤ 0.05), ograniczając częstość występowania biegunek oraz emisję azotu (P ≤ 0.05). Poprawa wydajności oraz ograniczenie występowania biegunek bakteryjnych wskazują na uzasadnione zastosowanie badanego dodatku w obu testowanych dawkach w czasie odchowu prosiąt.



Słowa kluczowe: nanostruktury SiO2, mikrofl ora jelitowa, prosięta, dodatki paszowe


Authors address: Marek PieszkaZakład Fizjologii Żywienia, Instytut Zootechniki PIB, ul. Krakowska 1, 32-083 Balice, Polande-mail: [email protected]



Management of hunting animals population as breeding workPart III: Hunting and breeding work on introduced fauna

KATARZYNA TAJCHMAN, LESZEK DROZDFaculty of Biology, Animal Science and Bioeconomy, University of Life Sciences in Lublin

Abstract: Management of hunting animals popu-lation as breeding work. Part III: Hunting and breeding work on introduced fauna. This part of the study presents the practice of introduction of non-native species in Poland. The examples of the fallow deer and moufl on illustrate problems that may be encountered by hunters and foresters in alien species breeding. Particular attention in the management of populations of these species in Poland should be paid to their density and abun-dance so that they do not endanger native animals. Furthermore, the population quality is one of the objectives of hunting management, and introduc-tion of individuals (with higher ontogenic qual-ity) originating outside the occurrence range into populations can be an important tool for improve-ment of the quality of game animals and prevent problems related to high inbreeding.

Key words: breeding, game animals, introduction, non-native species

INTRODUCTION

Introduction of game species in the terri-tory of Poland was usually carried out in a period when the notion of ecology was unknown and was aimed at enhancement of the attractiveness of hunts. The Con-vention on Biological Diversity (CBD) and the Bern Convention define alien species are those that have been trans-ferred (introduced) intentionally or acci-dentally outside their natural occurrence

range through direct or indirect human activity. The Act of April 16 (2004) specifies alien species as those occurring outside their natural geographical range. The introduction of little-known animals into new areas is always associated with a certain danger to domestic fauna and flora. Cases of invasions, acclimatiza-tion, or high mortality of animals can be observed. However, individuals that adapt to living in new areas only to some extent should constantly be supervised. In the initial phase of introduction when the population size of introduced species is low, inbreeding and associated frequent pathologies may be observed. Problems of this type are encountered in classic livestock breeding. One of the many breeding procedures involves improve-ment of hereditary traits (genotype), i.e. improvement of the ontogenic quality leading to greater resistance and better health status of animals. These practices are applied in the breeding of introduced game species.

INTRODUCTION OF FALLOW DEER

The history of the fallow deer (Dama dama) is associated with domestication thereof. The first animals in Poland were


420 K. Tajchman, L. Drozd

introduced to closed breeding and hunt-ing grounds in Silesia in the 13th century. Since the 17th century, they were mainly kept in menageries or as a park species. Possession of fallow deer indicated the richness and status of the menag-erie owner. They were released into open hunting grounds in the second half of the 19th century. It is estimated that one of the largest fallow deer populations in Poland comprising 1,500 individuals lived in the Białowieża Primeval Forest. Additionally, the species was present in Pszczyna forests. Unfortunately, World War I contributed to a significant decline in the population size. The last individual of the species was shot in the Białowieża Primeval Forest in 1930. In the interwar period, the population of this species comprised 2,650 individuals (1936). World War II took its toll as well: the oc-currence range of the species decreased and the population size declined to ap-proximately 2,000 individuals. Periodic protection was introduced, which led to an increase in the population size to 2,500 animals in 1949.

The fallow deer owes the current distribution worldwide to humans. The species was introduced in Australia, New Zealand, and even to Africa. The main reason for this venture was sports, in particular when there were no com-parable endemic species available for hunting. Furthermore, the presence of this species raised the economic status and offered an attractive addition to the diet. Ecology was unknown and endemic fauna was not appreciated at that time (Dzięciołowski 1994).

Fallow deer occur in Europe sympat-rically with red deer and roe deer. Com-petition for feed between these species

can therefore be assumed. In the division of ruminants into concentrate selec-tors and roughage eaters, Dama dama represents the group of intermediates. It mainly feeds on grasses and herbs as well as leaves and shoots of all shrubs and deciduous trees. Nevertheless, the feeding of this species is less harmful than that of the typical shoot eaters such as the elk or roe deer. This trait and the seasonal changes in animal behaviour prevent overlapping of the niches of these species. In different seasons of the year, they feed on different plants in different communities. The complemen-tary use of resources by fallow deer and roe deer increases the capacity of their co-habitats. This may have contributed to the successful introduction of Dama dama in Europe with no harm to native species (Dzięciołowski 1994).

Fallow deer can inhabit forest areas but also stays in the open areas of crop fields. In their homeland, i.e. Asia Minor, Dama dama inhabited dry and warm Mediterranean-Aegean and Medi-terranean-South-Anatolian landscapes. The vegetation of this region is domi-nated by pine and xerophytic scrubs. At present, the species lives in deciduous and mixed forests, coniferous forests, shrubs communities, savannas, or tundra (Dzięciołowski 1994).

Management of the fallow deer must take into account its parallel occurrence with others native species. Therefore, its density should be lower in areas of co-occurrence of elk and roe deer popula-tions than in habitats characterised by a low population size of other Cervidae species. The improvement of natural feeding conditions offered to fallow deer mainly involves introduction of grass


Management of hunting animals population as breeding wor. Part III... 421

feeding grounds with an admixture of legume plants.

The influence of the quality of the environment on the weight of this spe-cies was evidenced in the studies of 15 hunting grounds in Holstein and Hesse (Ueckermann and Hansen 1983). No winter-feeding was carried out in these hunting grounds, as the impact of the natural environmental potential was ana-lysed. In poor hunting grounds with boni-tation values below 55, the mean dressed weight of does ranged from 29.8 to 39 kg. At bonitation rates of 73 and 76, the carcass weight was more stable, i.e. on average 37.5 - 39.7 kg. Additionally, no damage to the forest area was recorded at a density of 10 fallow deer per 100 ha. At a density from 14 to 25 per 100 ha of the forest area, the damage was negligible, but became economically significant at a density exceeding 30 individuals per 100 ha. These studies, which were carried out in rich environments with high boni-tation rates (Ueckermann and Hansen 1983), prove that management of an environment to be favourable to animals and maintenance of suitable density are the most important elements in breeding practice.

The size of fallow deer populations in the country has doubled over the last several years (from 2005/2006 to 2015/2016). However, a marked slow-down in this trend was recorded in 2011–2015. In 2015, the population size in leased hunting districts was estimated at 20.4 thousand animals, which was by 2% lower than the value recorded in the pre-vious year (20.8 thousand). However, the number of hunting districts in which the species was recorded was still increasing from 250 in the 1990s (Dzięciołowski

1994) to 687 in 2011, 751 in 2013, and 785 in 2015 (i.e. 17% of all districts). In spring 2015, fallow deer were present in 47 hunting districts; they were recorded for the first time in the Białystok district. They were not reported from only two districts, i.e. Łomża and Przemyśl. The districts in the west of the country were usually characterised by higher densities of fallow deer per forest area unit, com-pared with the eastern part. The highest density in 2015 was noted in the Leszno district – 23.1 individuals per 1000 ha, followed by Poznań (11.1) and Toruń (10.1). Some districts, especially those with a low fallow deer population size, are characterised by a recent increase in the number of these animals (Panek and Budny 2015). In the future, a substantial increase in the population size of the spe-cies can be expected. This may be asso-ciated with a greater negative impact of fallow deer on the native Crevidae popu-lations involving competition in forest ecosystems (Obidziński et al. 2012). Such a phenomenon is likely to appear at considerable population sizes, which should be controlled by humans.

Chapman and Chapman (1975) report-ed that the common method for fallow deer stocktaking based on counting animals’ traces underestimates the popu-lation size of this species. The authors indicate that fallow deer round-up and direct counting of escaping animals yield more realistic assessment of their num-bers. The authors do not find any data supporting the idea that the quality of the antlers can be improved by selective cull-ing or resettlement of fallow deer for the so-called “blood refreshment”. The stud-ies described above indicate that Dama dama is well adapted to the conditions



prevailing in Poland. Particular attention in the management of populations of these species should be paid to their den-sity and population size so that they do not endanger native animal populations.

INTRODUCTION OF MOUFLONS

The mouflon (Ovis aries musimon) is an non-native species in Poland. At the beginning of the 20th century, it was introduced in the Sudety Mountains to enhance the attractiveness of hunts. It was transferred from Slovakia to the surroundings of Bielawa in the Sowie Mountains in Lower Silesia in 1901. Next, the species was introduced in the area of other mountain ranges (Karkonosze, Góry Wałbrzyskie, Masyw Śnieżka) and in lowlands (Nowakowski et al. 2009). Before World War II, approximately 300 individuals inhabited these areas. As in the case of other species, the mouflon population size declined during the war. In 1950, the abundance of the species was estimated at 700 individuals (Szc-zepkowski 1973, Błaszczyk 2007). Ten years later there was a rapid decrease in the number of mouflons in Lower Silesia to the level of 130 individuals. Subse-quent introduction attempts did not bring expected results and this situation did not change for another twenty years (Huruk 1995). Unlike in Poland, the mouflon population size in the neighbouring countries was substantially higher, i.e. 14,370 individuals in Czechoslovakia and 3,000 in the former East Germany (Röhrs 1986). Despite the failure, the species introduction in Poland was con-tinued. The population size of mouflons increased from 500 to 1,600 individuals in 1985–1995 (Nowakowski et al. 2009).

More than ten years later, the population of wild sheep in Poland comprised ap-proximately 3,000 individuals, with a majority living in Lower Silesia (70%) (Łabędzki et al. 2007). Currently, the population from the Sowie Mountains counts about 1,830 individuals and is the largest population of this species (Bobek et al. 2014). The second largest popula-tion with its approximately 250 animals inhabits the area of Jawor Forest District. The total mouflon population in Poland comprises 1,000 individuals (Solarz 2008).

The natural mouflon occurrence range extends from the Mediterranean Sea to central Asia. In Europe, the species mainly lives in Sardinia and Corsica. As a thermophilic animal living in specific conditions, the mouflon cannot survive in the Polish climate without human help and breeding procedures. The sizes of non-fed populations decline and the spe-cies disappears. Another threat is posed by predators and poaching, as the species exhibits low resistance to these dangers and may become prey of all larger ene-mies (Okarma and Tomek 2008).

The feed base for mouflons consists of herbaceous plants, primarily grasses and perennials, which account for up to 80% in spring and summer. In winter, mou-flons feed on tree and shrub shoots (up to 56%), search for herbaceous vegeta-tion under the snow cover, and eat dry leaves or bark. At a high snow cover, they have difficulty in finding food. Bark biting has also been observed in root sprouts and lower parts of trunks as well as seedlings and cuttings of deciduous trees in forest plantings. Mouflons feed all day with short intervals and at night (Heroldová 1988, 1996, Heroldová et al.



2007). Although, the species prefers the components of herbaceous vegetation, it has been found that approximately one third of the diet is composed of sprouts of tree species and their bark. This suggests a negative impact of the species on its habitats, especially at an excessive den-sity of these animals (Homolka 1991).

Investigations of the influence of this species on the habitat in Czech Dra-hanská Vrchovina Highland (southern Moravia) demonstrated a density of 2 mouflons/km2, 1 deer/km2, and 7,5 roe deer/km2 in the area. It was shown that mouflons were not a demanding species and were able to thrive in a habitat with a typical plant species composition that is suitable to roe deer and red deer. Tree species were the most important compo-nent of the mouflon’s diet (on average 85%). The diet comprising shoots of deciduous trees and shrubs dominated in the vegetation season while spruce trees constituted a large proportion of food in winter. In winter, especially after snowfall hindering access to food, mou-flons visited hayracks and used the feed supplied by hunters or foresters. These studies suggest an adverse effect of overpopulation of the species on forests (Homolka 1991).

Furthermore, mouflons live in isolated herds, attach to their habitat, and rarely wander over long distances (Frąckowiak et al. 2007). The absence of gene flow between populations was found to weaken them and cause occurrence of anomalies, e.g. abnormal coiling of horns, which consequently stabbed the animal’s neck. The deformation was revealed in approximately 95% of males. In 2006, another 177 animals were intro-duced from Slovakia and the Czech

Republic in order to increase the gene pool and prevent inbreeding (Pleśniarski et al. 2007).

The calculations made for the purpose of improving the genetic structure of the local population was based on the assumption that the number of mouflons in the area was about 550 individuals, thus the introduction of 177 animals from Slovakia and the Czech Republic should have eliminated adverse effect of inbreeding (Nowakowski 2002). However, 8 years after the introduction, no essential improvements were seen in the horns of the harvested rams. If the hypothesis of a high degree of homozy-gosity in the local population is true, the effect of introduction was severely limited, because in 2006 the population number of mouflons in the studied area was actually about 1,400 animals, thus 2,5 times higher than given in the hunt-ers estimates. Therefore, the introduced animals did not constitute 32% of the local population size but only 12.6%. The second, competing hypothesis should also be taken into account, i.e. that the reason for the abnormal coiling of their horns is the excessive density of the mouflon population co-habiting the same area with a population of red deer. Between 2007 and 2013 in the Sowie Mountains there was an increase in the density of mouflons to the level of 68.8 animals/1000 ha and precious red deer to 54.1 individuals/1000 hectares of forest, which certainly degraded the quality of the potential food of these animals. The winter diet of mouflons in the studied area was composed predominantly of grasses, sedges and browse, i.e. by fod-ders of low nutritional value (Bobek et al., 2014).



The quality of animal populations can be controlled in multiple ways. One of them is the so-called “blood refresh-ment”, i.e. mating related with unrelated animals. Mating of related animals often lowers the quality of one or more phe-notypic traits or even degeneration, as described above in the case of the mouflon (Nowicki 1985, Nowicki and Kosowska 1995). Although “blood refreshment” is an effective procedure used commonly in husbandry (Nowicki 1985), the possibil-ity of its effective application in the case of game animals is very poorly known. In hunting management, one of the objec-tives of management is the quality of the population and introduction to the popu-lation of individuals from the other place (of higher individual quality), it can be an important tool to improve the quality of game, but maintaining the appropriate densities adapted to the amount of food in the hunting ground plays a key role.

An additional factor, which unfortu-nately exerts an adverse effect on the population quality, is trophy hunting, in which individuals with the greatest antlers are harvested. This has been con-firmed by investigations conducted in France, where a decrease in body weight (17.8% in females, 18.3% in males) as well as a reduction of the antler size (e.g. by 18–20% of the length) and changes in antler shape were observed over 28 years. A body weight decline in herbiv-ores is very important, as it contributes to short- and long-term demographic effects and has a crucial impact on the life span (Gaillard et al. 2000). It is known currently that weight loss reduces resist-ance to parasites. In combination with isolation of animal groups, it contributes to a decline in general resistance and

increases the susceptibility to diseases (Coltman et al. 2001), which can also be associated with the effects of inbreeding aggravating the unfavourable trends. In Poland, there have been no comprehen-sive mouflon population studies or a full assessment of the impact of these ani-mals on native habitats, since nature sci-entists are not informed about planned introductions carried out without any phytosociological or habitat documen-tation. As indicated in the available Polish studies published by researchers interested in maintenance of mouflon populations, this animal does not have a negative impact on the environment, as the species is not competitive to the native fauna and causes negligible damage to forests (Kamieniarz 1993). Nevertheless, the recent monitoring of Natura 2000 habitats indicates that mouflons in our country exert a certain impact on the environment (Świerkosz et al. 2010).

There is a gap in the data on the appro-priate density of mouflons in Europe. The mouflon density was estimated at 3.2 individuals/km2 in the Cazorla Nature Park Segura y Las Villas, 1.6 individu-als/km2 in the Teide National Park (Ten-erife), and 1.6 individuals/km2 in Ser-ranía de Cuenca (Tores et al. 2014). The investigations conducted by Tsaparis et al. (2008) showed an average density of mouflons in the Mediterranean area to be 22.1 individuals/km2. The largest con-centrations of this species were observed on wasteland or fallow land as well as in coniferous forest complexes, whereas the lowest density was found in maquis com-munities (scrub vegetation characteristic of the Mediterranean region). Interest-ingly, the density of mouflons in open



habitats was substantially higher than that of roe deer. The strong preference of grassland areas in this (grazing) species probably reflects the availability of food and contrasts with the more diversified use of habitats by roe deer (selective her-bivore) (Tsaparis et al. 2008).

It has been shown that the most opti-mal density of mouflons in their occur-rence range in Poland is 6 animals/100 ha although, German breeders suggest a level of 11–12 individuals/100 ha at intensive feeding practice. The density was reported to exceed 6 individuals/100 ha in subpopulations in the Wałbrzych Forest District (2003), likewise in other the Forest Districts (Jugów, Bardo Śląskie), whereas this value was sub-stantially lower in other districts (Nowa-kowski et al. 2009). These observations confirm the need for constant supervi-sion aimed at maintenance of this alien species in Poland as well as continuous monitoring and regulation of the popula-tion size to keep it at a level that will not threaten its habitat, as the species is more invasive than fallow deer.

CONCLUSIONS

Introduction of alien species can be a posi-tive breeding practice, as demonstrated in the case of fallow deer. Introduction of animals that do not exert a negative impact on the native fauna, easily adapt, and inhabit a niche that has not been fully occupied contributes to the attractiveness of hunting management and increase bio-diversity. However, when the introduced species is not adapted, its populations have to be constantly supported by pre-vention of inbreeding, as in the case of the mouflon. Breeding small populations

in small areas isolated by long distances yields such effects. “Blood refreshment”, supply of a proper feeding base, and control of the population size to prevent inbreeding are the tasks for hunters and foresters taking care of the alien fauna. Additionally, the aspect of transmission of unknown pathogens and infections to native fauna should be considered and an excessive increase in the population size of alien species should be prevented to avoid interspecies competition.

REFERENCES

BŁASZCZYK J. 2007: Mouflons in Polish hun-ting grounds. Łow. Pol. 1: 28–30.

BOBEK B., FRĄCKOWIAK W., FURTEK J., MERTA D. 2014: Integration of introduced mouflons with the local population in the Su-dety mountains. Balkan J. Wildlife Res. 1(1): 82–86.

CHAPMAN D., CHAPMAN N. 1975: Fallow deer, Their history, distribution and biology. Terence Dalton Ltd., Lavenham, Suffolk, 271.

COLTMAN D.W., PILKINGTON J., KRUUK L.E.B., WILSON K., PEMBERTON J. 2001: Positive genetic correlation between parasite resistance and body size in a free living ungu-late population. Evolution 55: 2116–2125.

DZIĘCIOŁOWSKI R. 1994: Daniel [Fallow-deer]. Wydawnictwo SGGW, Warszawa [in Polish].

FRĄCKOWIAK W., FURTEK J., KOLECKI M., WOJCIECHOWSKI J. 2007: Badania teleme-tryczne nad wybiórczością siedlisk leśnych przez muflony (Ovis musimon Schreber) w Gó-rach Sowich. [Telemetry studies on the selecti-vity of forest habitats by mouflons (Ovis mu-simon Schreber) in the Sowie Mountains] In: B. Bobek, A. Płaksej, W. Frąckowiak, D. Merta (Eds). Gospodarka łowiecka i ochrona popu-lacji dzikich zwierząt na terenie Regionalnej Dyrekcji Lasów Państwowych we Wrocławiu. [Hunting economy and protection of wild ani-mal population in The Regional Directorate of State Forests in Wrocław]. Lasy Państwowe, Wrocław, 85–102 [in Polish].



GAILLARD J.-M., FESTA-BIANCHET M., YOCCOZ N.G., LOISON A., TOЇGO C. 2000: Temporal variation in fitness components and population dynamics of large herbivores. Ann. Rev. Ecol. Syst. 31: 367–393.

HEROLDOVÁ M. 1988: The diet of mouflon (Ovis musimon) outside the growing period 1983–1984. Folia Zool. 37: 309–318.

HEROLDOVÁ M. 1996: Dietary overlap of three ungulate species in the Palava Biosphere Re-serve. For. Ecol. Manage. 88: 139–142.

HEROLDOVÁ M., HOMOLKA M., KAMLER J., KOUBEK P., FOREJEK P. 2007: Foraging strategy of mouflon during the hunting season as related to food supply. Acta Vet. 76: 195–202.

HOMOLKA M. 1991: The diet of moufflon (Ovis Musimon) in the mixed forest habitat of the Drahanská Vrchovina Highland. Folia Zool. 40(3): 193–201.

HURUK S. 1995: Introduction and disap-pearance of mouflon Ovis ammon in the Świętokrzyski National Park. Chrońmy Przyr. Ojcz. 51: 90–94.

KAMIENIARZ R. 1993: Mieszkańcy nielicznych polskich łowisk – muflon i jeleń sika [Inhabi-tants of the few Polish fisheries – mouflon and Sika deer]. Łow. Pol. 12: 8–9 [in Polish].

ŁABĘDZKI L., DZIUBACKI A., BOBEK B., MERTA D. 2007: Łowieckie rejony hodowlane [Hunting complexes]. In: B. Bobek, A. Płaksej, W. Frąckowiak, D. Merta (Eds.). Gospodarka łowiecka i ochrona populacji dzikich zwierząt na terenie Regionalnej Dyrekcji Lasów Pań-stwowych we Wrocławiu [Hunting manage-ment and protection of wild animal population in The Regional Directorate of State Forests in Wrocław]. Lasy Państwowe, Wrocław: 23–45 [in Polish].

NOWAKOWSKI P., CHUDOBA K., PIASECKI M. 2009: European mouflon (Ovis orienta-lis musimon Schreber,1782) in the ecosystem of Lower Silesia. Ann. UMCS, sect. EE. 27: 7–13.

NOWICKI B. 1985: Genetyka i metody doskona-lenia zwierząt [Genetics and methods of ani-mal improvement. PWRiL]. Warszawa, 511 [in Polish].

NOWICKI B., KOSOWSKA B. 1995: Genetyka i podstawy hodowli zwierząt [Genetics and basics of animal breeding]. PWRiL Warszawa, 407 [in Polish].

OBIDZIŃSKI A., KIEŁTYK P., BORKOWSKI J., BOLIBOK L., REMUSZKO K. 2012: Fal-low deer’s diet compared to red deer and roe deer in the forests of the Raciborska Valley. Ac-tive methods of nature protection in sustainable forestry. Rogów, 2012: 51.

OKARMA H., TOMEK A. 2008: Łowiectwo [Hunting]. Wydawnictwo Edukacyjno-Nauko-we H2O, Kraków [in Polish].

PANEK M., BUDNY M. 2015: Sytuacja zwierząt łownych w Polsce ze szczególnym uwzględ-nieniem Kuropatwy (na podstawie wyników monitoringu) [The situation of game animals in Poland with particular regard to partridges (based on monitoring)]. Stacja Badawcza PZŁ Czempiń [in Polish].

PLEŚNIARSKI Z., ŁABĘDZKI L., LENART J., DZIĘCIELSKI J., WOJCIECHOWSKI J. 2007: Gospodarowanie populacją muflona (Ovis musimon Schreber) w Górach Sowich [Managing a mouflon population (Ovis musi-mon Schreber) in the Sowie Mountains]. In: B. Bobek, A. Płaksej, W. Frąckowiak, D. Merta (Eds.). Gospodarka łowiecka i ochrona popu-lacji dzikich zwierząt na terenie Regionalnej Dyrekcji Lasów Państwowych we Wrocławiu [Hunting management and protection of wild animal population in The Regional Directorate of State Forests in Wrocław]. Lasy Państwowe, Wrocław: 75–84 [in Polish].

RÖHRS M. 1986: Ovis ammon musimon (Pal-las,1811) – Mouflon. In: Niethammer J., Krapp F. (ed.). Handbuch der Säugetiere Europas. Bd. 2. AULA-Verlag. Wiesbadaen: 435–449.

SOLARZ W. 2008: Mouflon Ovis ammon Lin-naeus, 1758. In: Z. Głowaciński, H. Okarma, J. Pawłowski, W. Solarz (Eds) Gatunki obce w faunie Polski [Book of invasive alien species in Polish fauna]. Instytut Ochrony Przyrody PAN w Krakowie [in Polish].

SZCZEPKOWSKI J. 1973: Muflony – czyli hi-storia zawiedzionych nadziei [Mouflons – that is, a story of disappointed hopes]. Łow. Pol. 2: 4–5 [in Polish].

ŚWIERKOSZ K., SZCZĘŚNIAK E., RECZYŃ-SKA K. 2010: Skały wapienne i neutrofilne z roślinnością pionierską (Alysso-Sedion) [Li-mestone and neutrophilic rocks with pioneer vegetation (Alysso-Sedion)]. In: W. Mróz (ed.). Monitoring siedlisk przyrodniczych. Przewod-nik Metodyczny cz. 1 [Monitoring of natural



habitats. Methodical guide, vol. 1]. GIOŚ, War-szawa: 95–105 [in Polish].

TORES R.T., HERRERO J., PRADA C., GAR-CIA-SERANO A., FERNANDEZ-ARBERAS O., GARCIA-POST R. 2014: Estimating the population density of Iberan wild goat Capra pyrenaica and mouflon Ovis aries in a Medi-terranean forest environment. Forest Systems 23(1): 36–43.

TSAPARIS D., KATSANEVAKIS S., STA-MOULI C., LEGAKIS A. 2008: Estimation of roe deer Capreolus capreolus and mouflon Ovis aries densities, abundance and habitat use in a mountainous Mediterranean area. Acta Theriol. 53: 87–94.

THE ACT of April 16, 2004 on Nature Conserva-tion.

UECKERMANN E., HANSEN P. 1983: Das Damwil. Verlag Paul Parey, Hamburg and Ber-lin, 336.

Streszczenie: Gospodarowanie populacjami zwierząt łownych jako hodowla. Część III: Prace łowiecko-hodowlane na przykładzie fauny obcej. W tej części pracy przedstawiono zabiegi zwią-zane z introdukowaniem obcych gatunków na terenie Polski. Na przykładzie hodowli daniela i muflona wskazano problemy, z jakimi mogą

się spotkać myśliwi leśnicy w hodowli zwierząt obcych. W gospodarowaniu populacjami tych ga-tunków na terenie Polski należy szczególną uwagę zwrócić na zagęszczenia i liczebność, tak by nie zagrażały rodzimym populacjom zwierząt. Ponad-to w gospodarowaniu łowieckim jakość populacji jest jednym z celów zarządzania, a „dosiedlanie” do populacji osobników z zewnątrz (o wyższej ja-kości osobniczej), może być ważnym narzędziem poprawy jakości zwierzyny oraz zapobiega pro-blemom związanym z wysokim inbredem.

Słowa kluczowe: hodowla, zwierzęta łowne, in-trodukcje, gatunki nierodzime.


Authors’ address: Katarzyna TajchmanZakład Hodowli Zwierząt DzikichKatedra Etologii i Dobrostanu ZwierzątUniwersytet Przyrodniczy w Lublinie ul. Akademicka 13, 20-950 LublinPolande-mail: [email protected]


Annals of Warsaw University of Life Sciences – SGGWAnimal Science No 57 (4), 2018: 429–4....(Ann. Warsaw Univ. of Life Sci. – SGGW, Anim. Sci. 57 (4), 2018)DOI 10.22630/AAS.2018.57.4.41

Effect of heat stress on dairy farming at the period of global warming

JUSTYNA ŻYCHLIŃSKA-BUCZEK¹, EDYTA BAUER1, ANDRZEJ OCHREM1,

ZYGMUNT GIL1, ELŻBIETA SOWULSKA-SKRZYŃSKA2

1 Faculty of Animal Science, University of Agriculture in Krakow 2 National Research Institute of Animal Production

Abstract: Effect of heat stress on dairy farming at the period of global warming. The thermal en-vironment is a major factor that can negatively affects milk production of dairy cows. Our ob-jective was to provide a review of factors infl u-encing heat stress (HS) in lactating dairy cows in time of global warming. Heat stress affects dairy cows in many regions of the world and leads to substantial economic losses through its detrimental effect on cow’s rumen health, me-tabolism, production and reproduction. Dairy breeds are typically more sensitive to HS than some other animals. It directly affects feed in-take thereby, reduces growth rate, milk yield, reproductive performance, and even death in ex-treme cases. In future years, climate change will exacerbate these losses by making the climate warmer. More research is needed to identify im-proved comprehensive cow-side measurements and welfare that can indicate real-time responses to elevated ambient temperatures and that could be incorporated into heat abatement management decisions. Forecasted the severity of HS issue as an increasing problem in near future because of global warming progression. Hence, sustainable dairy farming remains a vast challenge in these changing conditions globally.

Key words: dairy cattle, climate change, heat stress

INTRODUCTION

Climate change will likely pose the most important challenge facing people this century (Intergovernmental..., 2007). Global warming results in frequent peri-ods of high temperatures, which occur in the temperate zone (Central Europe) and elsewhere. The problem of abnormally high temperatures (Schär et al. 2004) is well-known and it is gaining strength all over the world together with climate change. With the changing weather con-ditionsconsiderable fluctuations in air temperatures inside production barns can be observed, i.e. in dairy cattle breeding (Renaudeau et al. 2012). This is espe-cially clear during summer months, when temperatures can rise up to +35°C. With the growing intensity of global warming, the problem of heat stress in dairy cattle breeding is becoming a growing concern for breeders (Polsky et al. 2017). The air temperature and humidity levels form various combinations that might affect the thermoregulation of cows kept inside barns (i.e. their ability to adjust to certain


430 J. Żychlińska-Buczek et al.

weather conditions). This is a problem that affects high yield cows, especially at peak lactation (Silanikove and Koluman 2015). Recent studies suggest that heat stress carries direct implications for feed intake, metabolism, milk yield capacity during lactation and, by extension, eco-nomic aspects of production (St-Pierre et al. 2003, Boonkum et al. 2011, von Keyserlingk and Hötzel, 2015, Gao et al. 2017, Polsky et al. 2017).

The aim of this paper is to evidence the growing problem associated with the unavoidable and progressing warming of our climate, which affects in particular animal production, namely the health of the animals, milk production and repro-duction of dairy cattle.

HEAT STRESS

Heat stress includes high temperature, relative humidity, reduced air veloc-ity and elevated solar radiation, which significantly obstruct the transfer of heat out of the bodies of animals (Kadzere at al. 2002). Thermal comfort zone varies depending on the breed, species as well as on the age, production state and yield capacity. All living organisms have a thermal comfort zone which is geneti-cally predetermined and influenced by the environment in which they live. Comfort zone refers to conditions wherein a given organism feels most comfortable. The environment in which livestock are kept is characterised by one more anthropo-logical factor, namely human beings. The maintenance of adequate zoo techni-cal conditions on dairy farms is reflected by the right feed and water intake among animals (Polsky et al. 2017). Heat stress promotes oxidative stress, i.e.

the accumulation of free radicals in the body (Sordillo 2013), especially during periods of elevated temperatures (Zheng et al. 2009). As a result, the immunity of animals becomes low triggering a series of health problems, which are especially pronounced during pregnancy, such as retained placenta, endometritis puer-peralis or mastitis (Malinowski at el. 2003, Sordillo et al. 2007).

DAIRY CATTLE

Heat stress has negative effects on the health and biological functioning of dairy cows through depressed milk production and reduced reproductive performance. Cows, just like other animals, not necessarily those kept on farms, have a specific thermal comfort zone (from –7 to +18°C), with relative humidity of 60% to 80% (Berman 2005, Daniel 2008, Renaudeau et al. 2012). Observations suggest that dairy cows are more tolerant of low indoor tem-peratures. Adult cattle tolerate well tem-peratures below 0 provided that the air is dry and there is no draught inside the barn (Daniel 2008). Temperatures below –10°C increase feed intake and stimulate the growth of hair (Angrecka and Herbut 2012). Ambient temperatures exceeding +25°C reduce feed intake, weight gain and lower milk yield. (Lacetera et al. 1996). The susceptibility of dairy cattle to rising temperatures and high milk production increases the metabolic heat of animals (Sunil et al. 2011). The activ-ity of dairy cows allows them to properly use nutrients, especially before and after calving (Collier et al. 1982, Lewis et al. 1984). According to reference literature, the greater the milk yield of an animal,


Effect of heat stress on dairy farming at the period of global warming 431

the greater the amount of heat that the animal emits. The response to heat stress depends on the physiological condition of the animal and it is much more pronounced during peak lactation (Bonkum et al. 2011). Milk production plus high ambient temperatures create a heavy strain on high yield cows, often resulting in overheating (De Rensis and Scaramuzzi 2003).

Researchers discovered that cows under heat stress experience a decline in fertility (Hansen and Aréchiga 1999), hormonal imbalances (Roth et al. 2000, West et al. 2003) and a decline in follicu-lar survival and quality of ovarian folli-cles (Wolfenson et al. 2000, Włodarczyk et al. 2007). High ambient temperatures lead to embryo loss and death (De Rensis and Scaramuzzi 2003, Włodarczyk et al. 2007). Recent findings point to fertility problems not only with natural service but also with artificial insemination (Schuller et al. 2016). Heat detection rates in a herd can decline to 50% and, as a result, the percentage of culled animals may increase even up to 15% (Lautner and Miller 2003, Jaśkowski et al. 2005).

The primary symptoms of heat stress in cows, at an ambient temperature above +20°C, are believed to be sleepiness, excessive sweating, salivary secretion and abnormally rapid breathing (increase

in CO2 production) or even panting (more than 60 breaths per minute) (Atrain and Shahryar 2012, Soriani et al. 2013).

According to reference literature, in mixed breed cows with ≥93,7% of the Holstein Friesian breed (hf), individual susceptibility to heat stress depends more on environmental factors than it does on genetic factors (Boonkum et al. 2011). Heat stress was evaluated through tests with the stress threshold estimated on the basis of the value of the tempera-ture humidity index (THI) as 72 for pro-duction and around 68 for reproduction (Table 1). THI values that describe mild heat stress range from 72 to 79, 78 to 89 refer to moderate heat stress and > 89 refer to severe heat stress (Boonkum et al. 2011).

MILK PRODUCTION

Lactating dairy cows have an increased sensitivity to heat stress compared with dry cows (non lactating). Even high yield cows with genetic potential produce a lower yield during periods of high temperatures (Lacetera et al. 1996, Boonkum et al. 2011). Factors that are key to milk production, aside from the above-mentioned genetic factors, include specific environmental conditions such as: access to a specific type of feed, un-

TABLE 1. Temperature humidity index (THI) for production and reproduction (68%)

Temperature (°F) Temperature (°C) Relative humidity (%)72 22.2 45–50 (68%)74 23.3 30–35 (68%)76 24.4 15–20 (68%)78 25.6 5–10 (68%)80 26.7 0 (68%)



limited amount of water and an adequate indoor climate (Roth et al. 2000, Atrain and Shahryar 2012).

Cows subject to heat stress in peak lactation can yield even 5 litres less milk per day, which is 5 to 20% less per annum (St-Pierre et al. 2003, Cowley et al. 2015). The overall loss during the entire lactation time can reach even around 1,000 litres. Milk production declines and therefore the number of somatic cells in milk goes up to around 100,000 per millilitre. It is estimated that the components of milk produced under heat stress undergo change (Bernabucci et al. 2010, Cowley et al. 2015).

It was found that milk yielded by hf cows under heat stress contains on aver-age 0.4% and 0.2% less fat and protein and increased numbers of somatic cells (±100,000 per millilitre) and showed a significant decrease due to heat stress condition (Wolfenson et al. 1995, Fla-menbaum and Galon 2010, Gantner et al. 2017).

When temperatures rise, animals consume more water, which stimulates metabolism and the growth of micro-organisms in the body (Kadzere et al. 2002, Bernabucci et al. 2010). The refer-ence literature clarifies that in high yield animals body temperature is higher as a result of metabolic processes. Reduced feed intake and the associated insuffi-cient amount of nutrients supplied to the body compromise the management of microelements (Sorini et al. 2013, Gao et al. 2017). Heat stress and increase in body temperature even of 1–2°C lead to increased temperature in the rumen. An increase of even +0.5°C in the rumen can trigger changes in the liver or inflamma-tion of the udder or limbs (Sanders et

al. 2009). In effect, lowered rumination reduces feed intake and the secretion of saliva (pH of 8–8.5), which is a natural buffer for the contents of the rumen, is inhibited (Maekawa et al. 2002, Sanders et al. 2009), therefore increasing the risk of development of acidosis (Kadzere et al. 2002, Bilik et al. 2012).

FEED INTAKE

High temperatures also lead to drying of feed blends on the feeding table, e.g.: TMR (total mix ration). Feed blends with pickled ingredient content spoil in high temperatures. In consequence, the nutritional value and taste of the feed deteriorate. Farm direction will have to increase the energy density of diet by reducing the concentration of forage and increasing the concentrate portion of the diet (Renaudeau et al. 2012). Partially spoiled feed blends are a real threat to animal health because they may compromise the immunity of animals and lead to fertility problems and ab-normalities within the internal organs and reduce pH in the rumen (Nardone et al. 2010, Soriani et al. 2013). Moretti et al. (2017) presented in the study a significant unfavourable association between high temperature with humidity and rumination time in Holstein dairy cows. When temperature increases (i.e. increasing heat stress) a reduction in the rumen occurs. In the long-term, health conditions such as acidosis may lead to ketosis during the peri-calving period (Maekawa et al. 2002, Bilik et al. 2012). In addition, the decline in pH of rumen liquid lowers the digestibility of fibre (pH of <6.0 affects cellulolytic bacteria). The above-mentioned factors affect the



physical condition, metabolism and milk yield capacity of cows (Lacetera et al. 1996).

REPRODUCTION

Michalska (2011) points to cyclically rising air temperatures in early spring and spring in Poland. According to reference literature, the pregnancy rate is much lower in dairy cow breeds during the summer compared to winter months. High ambient temperatures affect the re-productive function of cows and the pos-sibility of synchronising heat and births in a herd. Thermal stress is also harmful to the reproductive parameters of bulls in a herd (Zheng et al. 2009). The varying composition of semen during periods of elevated ambient temperatures has already been pointed out in reference literature (Mishra et al. 2013, Bhakat et al. 2014).

The parameters in reproduction groups deteriorate. Seasonal studies carried out in the summer and during periods of increased temperatures revealed that high temperatures and negative energy balance affect the function of the hypoth-alamus and gonadoliberin (GNRH) and luteinizing hormone (LH) (De Rensis and Scaramuzzi 2003, Włodarczyk et al. 2007). These hormones play a fundamental role in the maturation of ovarian follicles and ovulation. Blood progesterone and oestradiol levels in animals drop (Włodarczyk et al. 2007). Lowered hormone levels shorten the heat by 8 hours. As a result, there is an increased incidence of silent heat which leads to a decline in fertilisation rates in a herd (St-Pierre et al. 2003, Jaśkowski et al. 2005). Hyperthermia (elevated

body temperature) in cows may lead to damage in maturing follicles, oocytes or embryos. Oocytes can become damaged even 105 days before ovulation, result-ing in temporary infertility (Wilson et al. 1998, Sunil et al. 2011). Fertilisation rates indicate that there are seasonal dif-ferences in recipient cows (Hansen and Aréchiga 1999). Selecting for heat toler-ance is hampered by the negative (i.e., unfavorable) genetic correlation with milk production. However, the results of the Bernabucci et al. (2014) study dem-onstrate that the inclusion of temperature with humidity covariate effects in the estimation of the sire ranking; sires with the same genetic value for milk produc-tion responded differently as the tem-perature has increased.

METHODS TO REDUCE HEAT STRESS

Taking steps to reduce heat stresswill keep cows healthy and in good condi-tion and allowanimals with high genetic potential to develop and improve milk production and reproductive perform-ance (Kadzere et al. 2002, Torres-Junior et al. 2008).

In the case of dairy cows kept in old-fashioned barns (stall barns), it is advis-able to open windows and doors wide (Flamenbaum et al.1986). A standard way to prevent heat stress used in the West (U.S., Germany, the Netherlands) is the widespread use of ventilators (Hansen and Aréchiga 1999, Kadzere et al. 2002). The right stream of air can transfer excess heat from animals out of the indoor areas in which they are kept. Scientists believe that an air exchange of 40 to 60 litres per hour will suffice in the



summer. The use of ventilators indoors is advised at temperatures of higher than +20°C. During hot days, ventilators can help prevent the loss of 1/2 to 3/4 of a litre of milk in lactating cows. Accord-ing to observations, high humidity levels make it more difficult for animals to transfer heat out of their bodies through evaporation (Flamenbaum et al. 1986, Daniel 2008, Bernabucci et al. 2010).

The most common ways of protecting cows from heat stress include: providing constant access to clean water (during hot summer days, high yield cows can drink more than 150 litres of water) (Angrecka and Herbut 2012). In the case of animals kept on pastures or yards, animals must be provided with access to a place in the shade. While freestall barns should fea-ture ventilators near the feeding tables. Indoor areas with a large number of ani-mals should be equipped with sprinkler systems at points where the animals tend to gather (waiting area, feeding table). Dry bedding which absorbs moisture is a good solution for barns that use thick bedding for support. The animals should restore the supply of mineral ingredients lost through perspiration on an ongoing basis, not only during periods of increased temperatures. It seems reasonable to prevent feed from becoming warm by

increasing the frequency of administra-tion to even 4 times per day. One more solution worth taking into consideration is serving more feed at night when the temperatures are lower.

Increased air velocity makes it easier for animals to cool their bodies. Accord-ing to Branwell (2002), as cited in Hei-denreich et al. (2005), in a temperature of +29.5°C, relative humidity of 50% and air velocity of 1.0 m/s, the tem-perature perceived by cows goes down to +24.4°C. Presumably, increased air velocity during hot days can lower the temperature perceived by cows.

A proven way of cooling animals, espe-cially in countries where temperatures during the summer can reach +40°C or more (e.g. Israel, Italy) is sprinkling the animals combined with gusts of cool air. The system is well known and has been widely used in barns for over 20 years (Flamenbaum et al. 1986). By cooling animals 5 times per day each time for around 30 minutes, cows that yield 25 to 30 kg of milk per day manage to main-tain their body temperature below +39°C (Flamenbaum and Galon 2010).

The application of hormones in addi-tion to cooling systems during periods that entail the greatest risk of heat stress for cattle might help keep reproduction

TABELA 2. Comparison of the intensity of cooling dairy cattle in Israel for high and low milk produc-tion

VariablesHigh milk production Low milk production

intensive cooling moderate cooling intensive cooling moderate coolingWinter 39% 39% 40% 39%Summer 19% 12% 25% 3%Winter/Summer ratio 0.49 0.31 0.62 0.08

(Flamenbaum and Galon 2010)



and milk production rates at a steady level. Research into the subject is already in progress.

CONCLUSIONS

Physical modification of the environment, nutrition, work organisation and selecting animals that tolerate climate change for reproduction are key to sustainable dairy cattle breeding in the warming climate (Atrain and Shahryar 2012).

More research is needed to iden-tify improved comprehensive cow side effects of measurements that can indicate real time responses to elevated ambient temperatures. In conclusion, it is essen-tial to introduce cow cooling systems in barns, especially during summer months when temperatures are high. All barns should feature ventilation systems (natu-ral or mechanical ventilation). In barns featuring mechanical ventilation, alter-native natural ventilation should also be present. Nonetheless, before these new technical solutions aimed at improving the comfort of animals and farm workers are introduced, there needs to be a focus on improving milk production and pro-viding improved conditions for repro-duction to ensure the high economic per-formance of a farm. The costs associated with rising ambient temperatures inside barns need to be estimated.

It should be expected that livestock maintenance systems (based on grazing, mixed breeding or industrialisation) will have increasingly negative effects on the climate (global warming). Further research and observation on dairy cattle breeding in warming climates all over the world are still required.

REFERENCES

ANGRECKA S., HERBUT P. 2012: Prognozowa-nie możliwości występowania stresu cieplnego u bydła mlecznego [Predicting the possibility of occurrence of heat stress in dairy cattle] [in Polish]. Wiad. Zoot. 4: 99–105.

ATRAIN P., SHAHRYAR H.A. 2012: Heat stress in dairy cows. Res. Zool. 2(4): 31–37.

BERMAN A.J. 2005: Estimates of heat stress relief needs for Holstein dairy cows. J. Anim. Sci. 38(6): 1377–1384.

BERNABCI U., BASIRICI L., MORERA P., DI-PASAQUALE D., VITALI A., CAPPELI P., CALAMARI L. 2015: Effect of summer sea-son on milk protein fractions in Holstein cows. J. Dairy Sci. 98: 1815–1827.

BERNABUCCI U., BIFFANI S., BUGGIOTTI L., VITALI A., LACETERA A. 2014: The ef-fects of heat stress in Italian Holstein dairy cat-tle. J. Dairy Sci. 97(1): 471–486.

BERNABUCCI U., LACETERA N., BAUM-GARD L.H., RHOADS R.P., RONCHI B., NARDONE A. 2010: Metabolic and hormonal acclimation to hear stress in domesticated ru-minants. J. Anim. Sci. 4(7): 1167–1183.

BHAKAT M., MOHANTY T.K., GRUPTA A.K., ABDULLAH M. 2014: Effect of season on se-men quality of crossbred (Karan Fries) bulls. Adv. Anim. Sci. 2(11): 632–637.

BIGGERS B.G., GEISERT R.D., WETTEMAN R.P., BUCHANAN D.S. 1987: Effect of heat stress on early embryonic development in the beef cow. J. Anim. Sci. (64): 1512–1518.

BILIK K., ŁOPUSZAŃSKA-RUSEK M., FUR-GAŁ-DZIERŻUL I. 2012: Kwasica żwacza u krów mlecznych [Rumen acidosis in dairy cows] [in Polish]. Rocz. Nauk. Zoot. 39(2): 157–170.

BOONKUM W., MISZTAL I., DUANGJINDA M., PATTARAJINDA V., TUMWASORN S., SANPOTE J. 2011: Genetic effects of heat stress on milk yield of Thai Holstein cross-breds. J. Dairy Sci. 94: 487–492.

COLLIER R. J., DOELGER S. G. 1982: Head H. H., Vi. ThatcherW., Wilcox C. J., Effects of heat stress during pregnancy on maternal hormone concentrations, calf birth weight and postpar-tum milk yield of Holstein cows. J. Anim. Sci. 54: 309–319.



COWLEY F.C., BARBER D.G., HOULIHAN A.V., POPPI D.P. 2015: Immediate and residu-al effects of heat stress and restricted intake on milk protein and casein compositions and en-ergy metabolism. J. Dairy Sci. 98: 2356–2368.

DANIEL Z. 2008: Wpływ klimatu obory na mleczność krów [The impact of barn microcli-mate on milking capacity of cows] [in Polish]. Inż. Rol. 9: 67–73.

DE RENSIS F., SCARAMUZZI R.J. 2003: Heat stress and seasonal effects on reproduction in the dairy cow – A review. Theriogenology 60: 1139–1151.

FLAMENBAUM I., GALON N. 2010: Manage-ment of Heat Stress to improve Fertility in Dairy Cows in Israel. J. Rep. Develop. 56.

FLAMENBAUM I., WOLFENSON D., MAMEN M., BERMAN A. 1986: Cooling dairy cattle by a combination of sprinkling and forced ventila-tion and its implementation in the shelter sys-tem., J. Dairy Sci. 69: 3140–3147.

GANTNER V., BOBIĆ T., GREGORIĆ M., GANTNER R., KUTEROVAC K., POTOC-NIK K. 2017: The differences in heat stress resistance due to dairy cattle breed. Mljekarst-wo 67(2): 112–122.

GAO S.T., GUO J., QUAN S.Y., MAN X.M., SANZ FERNANDEZ M.V., BAUMGARD L.H., BU D.P. 2017: The effect of heat stress on protein metabolism in lactating Holstein

cows. J. Dairy Sci. 100: 5040–5049. HANSEN P.J., ARÉCHIGA C.F. 1999: Strategies

for managing reproduction in the heat-stressed dairy cow. J. Anim. Sci. 77: 36–50.

HANSEN P.J., DROST M., RIVERA R.M., PAULA-LOPES F.F. ALKATANANI Y.M., KRININGER III.C.E., CHASE C.C. 2001: Ad-verse impact of heat stress on embryo produc-tion causes and strategies for mitigation. The Eriogenology (55)91–103.

INTERGOVERNMENTAL PANEL ON CLI-MATE CHANGE 2007. The Intergovernmen-tal Panel on Climate Change 4th Assessment Report. Retrieved from: http://www.ipcc.ch/publications_and_data/publications_and_data_reports.htm#2 (accessed: ......).

JAŚKOWSKI J.M., URBANIAK K., OLECHNO-WICZ J. 2005: Stres cieplny u krów – zaburzenia płodności i ich profilaktyka [Fertility disturban-ces caused by heat stress in cows – prophylactic measurement] [in Polish]. Życie Wet. 1: 18–21.

KADZERE C.T., MURPHY M.R., SILANIKO-VE N., MALTZ E. 2002: Heat stress in lactat-ing dairy cows: a review. Livest. Prod. Sci. 77: 59–91.

LACETERA N., BERNABUCCI U., RONCHI B., NARDONE A. 1996: Body condition score, metabolic status and milk production of early lactating dairy cows exposed to warm environ-ment. Riv. Agric. Subtrop. Trop. 90(1): 43–55.

LAUTNER M., MILLER A.M. 2003: Kuehel-iebenkeineheissen Tagesondernkuhlen Kopf. Nachrichtsblatt. Besammungsby Neustadt a.d. Adisch. 149: 23–25.

LEWIS G. S., THATCHER W. W., BLISS E. L., DROST M., COLLIER R. J. 1984: Effects of heat stress during pregnancy on postpartum re-productive Changes in Holstein Cows. J. Anim. Sci. 58: 174–186.

MAEKAWA M., BEAUCHEMIN K.A., CHRIS-TENSEN D.A. 2002: Effect of concentrate level and feeding management on chewing ac-tivities, saliva production, and ruminal pH of lactating dairy cows. J. Dairy Sci. 85: 1165––1175.

MALINOWSKI E., KŁOSOWSKA A., KACZ-MARSKI M., KUŹMA K. 2003: Prevalence of intramammary infection in pregnant heifers. Bull. Vet. Inst. Puławy. 47: 165-170.

MICHALSKA B. 2011: Tendencje zmian temper-atur powietrza w Polsce. Pr. Stud. Geograf. 47: 67–75.

MISHRA S.R., KUNDU A.K., MAHAPATRA A.P.K. 2013: Effect of ambient temperature on membrane integrity of spermatozoa in different breeds of bulls. The Bioscan. 8(1): 181–183.

MORETTI R., BIFFIANI S., CHESSA S., BOZZI R. 2017: Heat stress effects on Holstein dairy cow’s rumination. Animal 11(12): 2320–2325.

NARDONE A., RONCHI B., LACETERA N., RANIERI M.S., BERNABUCCI U. 2010: Ef-fect of climate changes on animal production and sustainability of livestock systems. Livest. Sci. 130(1–3): 57–69.

POLSKY L., von KEYSERLINGK M.A.G. 2017: Effects of heat stress on dairy cattle welfare.J. Dairy Sci. 100: 8645–8657.

RENAUDEAU D., COLLIN A., YAHAV S., DE BASILIO V., GOURDINE J.L., COLLIER R.J. 2012: Adaptation to hot climate and strategies to alleviate heat stress in livestock production. Animal 6: 707–728.



RHOADS R.P., BAUMGARD L.H., SUAGEE J.K., SANDERS S.R. 2013: Nutritional inter-ventions to alleviate the negative consequences of heat stress. Adv. Nutr. 4(3): 267–275.

ROTH Z., MEIDAN R., BRAW-TAL R., WOLFENSON D. 2000: Immediate and de-layed effects of heat stress on follicular devel-opment and its association with plasma FSH and inhibit concentration in cows. J. Reprod. Fertil. 120: 83–90.

RYAN D.P., BLAKEWOOD E.G., LYNN J.W., MUNYAKAZI L., GODKE R.A. 1992: Effect of heat-stress on bovine embryo development in vitro. J. Anim. Sci. 70: 3490–3497.

SANDERS A.H., SHEARER J.K., DE VRIES A. 2009: Seasonal incidence of lameness and risk factors associated with thin soles, white line disease, ulcers, and sole punctures in dairy cat-tle. J. Dairy Sci. 92(7): 3165–3174.

SCHÄR C., VIDALE P.L., LÜTHI D., FREI C., HÄBERLI C., LINIGER M.A., APPENZEL-LER C. 2004: The role of increasing tempera-ture variability in European summer heatwaves. Nature 427: 332–336.

SILANIKOVE N., KOLUMAN N.D. 2015: Im-pact of climate change on dairy industry in temperate zones: Predications on the overall negative impact and on the positive role of dairy goats in adaptation to earth warming. Small Rumin. Res. 123: 27–34.

SORIANI N., PANELLA G., CALAMARI L. 2013: Rumination time during the summer sea-son and its relationships with metabolic condi-tions and milk production. J. Dairy Sci. 96(8): 5082–5094.

SORDILLO L. 2013: Selenium-dependent regu-lation of oxidative stress and immunity in periparturient dairy cattle. Vet. Med. Int. 15: 40–45.

SORDILLO L.M., O’BOYLE N., GANDY J.C., CORL C.M., HAMILTON E. 2007: Shifts in thioredoxin reductase activity and oxidant status in mononuclear cells obtained from ob-tained from transition dairy cattle. J. Dairy Sci. 90: 1186–1192.

ST-PIERRE N.R, COBANOV B., SCHNITKEY G. 2003: Economical losses from heat stress by US livestock industries. J. Dairy Sci. 86: E52–E77.

SCHULLER L.K., BURFEINED O., HEUWI-ESER W. 2016: Effect of short- and long-term

heat stress on the conception risk of dairy cows under natural service and artificial insemi-nation breeding programs. J. Dairy Sci. 99: 2996–3002.

SUNIL K. B.V., KUMAR A., MEENA K. 2011: Effect of hest stress in tropical livestock and different strategies for its amelionation. J. Stress Phys. Bioch. 7(1): 45–54.

de TORRES-JÚNIOR J.R.S., de PIERES M.F.A., de SÁ W.F., de FERREIRA A.M., VIANA J.H.M., CAMARGO L.S.A., RAMOS A.A., FOLHADELLA I.M., POLISSENI J., de FRE-ITAS C., CLEMENTE C.A.A., de SÁ FILHO., PAULA-LOPES F.F., BARUSELLI P.S. 2008: Effect of maternal heat-stress on folliculaÚÁr growth and oocyte competence in Bos indicus cattle. Theriogenology 69: 155–166.

von KYSERLINGK M.A.G., HÖTZEL M.J. 2015: The ticking clock: Addressing farm ani-mal welfare in emerging countries. J. Agric. Environ. Ethics (28):179–195

WEST J.W., MULLINIX B.G., BERNARD J.K. 2003: Effects of hot, humid weather on milk

temperature, dry matter intake and milk yield of lactating dairy cows. J. Dairy Sci. 86: 232––242.

WILSON S.J., MARION R.S., SPAIN J.N., SPIRES D.E., KEISLER D.H., LUCY M.C. 1998: Effect of controlled heat stress on ovar-ian function of dairy cattle. 1. Lactating cows. J. Dairy Sci. 81: 2124–2131.

WŁODARCZYK R., IZDEBSKA M., GRZAN-KA A., JASKOWSKI J.M. 2007: Wpływ stresu cieplnego na rozwój zarodków bydła we wcze-snym okresie przed implantacyjnym [Influence of heat shock on the development of bovine embryos in the early preimplantation stage] [in Polish]. Med. Wet. 1: 23–28.

WOLFENSON D., ROTH Z., MEIDEN R. 2000: Impaired reproduction by dominant follicle in cows. Anim. Reprod. Sci. 47: 9–19.

WOLFENSON D., THATCHER W. W., BADIN-GA L., SAVIO J. D., MEIDAN R., LEW B.J., BRAW-TAL R., BERMAN A. 1995: Effect of heat stress on follicular development during the estrous cycle in lactating dairy cattle. Biol. Reprod. 51: 1106–1113.

ZHENG L., CHENH M., ZHI-CHENG G. 2009: Effect of heat stress on milk performance and fatty acids in milk fat of Holstein dairy cows. J. Chin. Dairy Ind. 37(9): 17–19.



Streszczenie: Wpływ stresu cieplnego na hodow-lę mleczną w czasie globalnego ocieplenia. Ce-lem naszym było dokonanie przeglądu czynników wpływających na występowanie stresu cieplnego (HS) u krów mlecznych w okresie laktacji. Wpływ wysokiej temperatury otoczenia na hodowlę zwierząt gospodarskich początkowo zaznaczył się w północnych szerokościach geograficznych i była to reakcja na rosnącą globalnie temperaturę, dopóki nie uznano że nie jest ona ograniczona tyl-ko na obszarach tropikalnych. Stres cieplny w od-mienny sposób dotyka krowy mleczne w wielu regionach świata i prowadzi do znacznych strat ekonomicznych poprzez szkodliwy wpływ na zdrowotność żwacza, metabolizm, produkcję i re-produkcję stada. Krowy ras mlecznych są bardziej wrażliwe na HS i bezpośrednio wpływa on na ilość pobranej paszy co zmniejsza tempo wzrostu zwierząt, jak i wydajność mleczną, parametry re-produkcji, a w ekstremalnych przypadkach może prowadzić do śmierci zwierząt. Główną reakcją zwierząt w warunkach zmian termalnych organi-zmu jest podwyższenie częstości oddechów, pod-wyższona temperatura ciała (>38°C) i szybsza akcja serca. Poprzez nadchodzące ocieplenie kli-matu w kolejnych latach, straty w hodowli mogą się pogłębiać. Koniecznym, wydają się dalsze

prace badawcze które obejmą wszystkie wskaź-niki chowu i hodowli bydła mlecznego. Wnikliwe badania mogą pomóc wskazać nie kwestionowane reakcje zwierząt w okresie podwyższonych tem-peratur otoczenia. Rezultatem mogłyby być nowe ustalenia, które w przyszłości były by włączone do praktyk w zarządzaniu hodowlą bydła. Zrów-noważona hodowla i produkcja mleczna pozosta-je ogromnym wyzwaniem w tych zmieniających się warunkach klimatycznych na całym świecie.

Słowa kluczowe: bydło mleczne, zmiana klimatu, stres cieplny


Author’s address:dr inż. Justyna Żychlińska-BuczekZakład Hodowli BydłaWydział Hodowli i Biologii ZwierzątUniwersytet Rolniczy w Krakowie al. Mickiewicza 28/24, 30-059 Krakó[email protected]


annals of warsaw university of life sciences – sggw

Documents