annual report 2012 final · eas electronic attendance system ppd plant protection division ec...

2012

NIAB

Nuclear Institute for Agriculture and Biology

FAISALABAD – PAKISTAN

Annual Activity Report

NIABAnnual Activity Report

2012

Editors

Dr. Javed Akhtar DCS/Director

Dr. Khalid Mahmood DCS/Head SSD

Dr. Muhammad Hamed DCS/Head PPD

Dr. Shahnaz A. Khanum DCS/Head ASD

Dr. Tariq Mahmud Shah PS/Head PBGD

Dr. Shahid Nadeem PS ASD

Mr. Asif Kamran SS

Mr. Jafar Hussain SS/Incharge DA&IT

Compiled by

Acronyms and Abbreviations

AARI Ayub Agricultural Research Institute *M1,2,… Mutant1, Mutant2, …ALP Agriculture Linkages Program MINFA Ministry of Food and Agriculture

ASD Animal Sciences Division NARC National Agricultural ResearchCenter

ATCP Al-Technique Corporation ofPakistan

NCVT National Coordinated Varietal Trial

AZRI Arid Zone Research Institute NIAB Nuclear Institute for Agricultureand Biology

*BC1,2,… Back Cross1, Back Cross2, … NIBGE National Institute for

Biotechnology & GeneticsEngineering

BLB Bacterial Leaf Blight NM NIAB MungBSRS Bio-saline Research Station NUYT National Uniform Yield Trial

Bt Bacillus thuringiensis PAEC Pakistan Atomic EnergyCommission

CAYT Chickpea Advance Yield Trial PAMCO Punjab Agriculture and MeatCorporation

CCYT Chickpea Cooperative Yield Trial PARB Punjab Agricultural Research BoardCID ( )D Carbon Isotope Discrimination PARC Pakistan Agricultural Research

CouncilCIMMYT International Maize and Wheat

Improvement Center

PBGD Plant Breeding & Genetics Division

CLCuV Cotton Leaf Curl Virus PCCT Provincial Coordinated CottonTrials

CMS Cytoplasmic Male Sterility PCR Polymerase Chain ReactionDA&IT Data Analysis and Information

TechnologyPIEAS Pakistan Institute of Engineering &

Applied SciencesDAP Di-ammonium Phosphate PMYT Preliminary Micro Yield Trials

EAS Electronic Attendance System PPD Plant Protection DivisionEC Electrical Conductivity PPR Peste des petit Ruminants*F1,2,… Filial1, Filial2, … PRI Pulses Research Institute (AARI)FMD Foot-and-Mouth Disease PSC Punjab Seed Council

GY Grain Yield PSF Pakistan Science FoundationHPR Host Plant Resistance PYT Preliminary Yield TrialsHPS Hydropericardium Syndrome RWC Relative Water ContentHS Hemorrhagic Septicemia SOPIB Sulphate of Potash Information

Board (Belgium)IAEA International Atomic Energy Agency SPP Single Plant ProgeniesIBD Infectious Bursal Disease SSD Soil Science DivisionICARDA International Center for Agricultural

Research in Dry Areas

SYT Station Yield Trials

ICRISAT International Crops ResearchInstitute for Semi Arid Tropics

UAF University of Agriculture,Faisalabad

IKI Iodine-Potassium IodideIPM Integrated Pest Management * Subscript indicates generation numberLAN Local Area NetworkLSK Low Seeded Kinnow

C O N T E N T S

Page

Foreword

I. PLANT BREEDING & GENETICS 1

Cotton 1

Rice 3

Chickpea 4

Mungbean 5

Lentil 5

Vegetable (Tomato) 6

Marker Assisted Breeding 7

Radiation Safety Services 8

II. SOIL SCIENCE 9

Bio-saline Agriculture 9

Soil Fertility and Plant Nutrition 10

Plant-Water Relationships 12

III. ANIMAL SCIENCES 15

IV. PLANT PROTECTION 18

Integrated Pest Management (IPM) in Vegetables 18

Insect and Food Toxicology 19

Fungal, Bacterial and Viral Diseases 20

V. TECHNICAL SERVICES 23

VI. IMPACT 24

VII. PUBLICATIONS 25

VIII APPENDICES 29

i. Funded Research Projects 29

ii. Farmer Days 31

iii. Training Courses and Workshops 32

iv. Scientists/Administration 34

v. Promotions 35

vi. Transfers/Postings 35

vii. Retirements 35

F o r e w o r d

Nuclear Institute for Agriculture & Biology (NIAB) is the premier Institute of Agriculture and

Biotechnology Division of Pakistan Atomic Energy Commission (PAEC) applying nuclear and other

advanced techniques for the growth of country's agriculture sector. The institute has been playing a

vital role since 1972 in the improvement of national agricultural productivity by developing new crop

varieties, products and processes useable for the stakeholders. Efforts to improve crop plants and

animal health are continuous process to ensure food security of ever-increasing population under

erratically changing climatic conditions.

NIAB is striving hard to develop knowledge based research and to achieve following objectives/goals:

Improvement of important crops for high yield and desirable traits.

Biological control based Integrated Pest Management (IPM) for protection of crops,

vegetables and orchards from insect pests.

Testing of pesticide residues and aflatoxins in food, feed and other commodities.

Economic utilization of salt-affected lands with brackish irrigation water.

High water-use and fertilizer-use efficiency for optimum crop productivity.

Improved livestock production and development of vaccines from local strains of

pathogens.

Analytical services for private/public sector for soil, water, plants, food & feed samples

and radio toxicity.

Dissemination of seed/products/techniques/knowledge developed by NIAB to

stakeholders for increased agriculture productivity.

This annual activity report 2012 presents briefly the highlights of research conducted during the report

period. The teamwork of fellow scientists and staff members deserves appreciation and

acknowledgment. Continued support from authorities at the PAEC Head Quarters has been

commendable for the Institute to achieve its goals.

F

F

F

F

F

F

F

F

Director

Dr. Javed Akhtar

1

Annual Report 2012Plant Breeding & Genetics

I. PLANT BREEDING AND GENETICS DIVISION

Cotton

Varietal maintenance and pure seed production

Approval of new cotton variety, NIAB-852

Evaluation of upcoming lines in national adaptability trials

Evaluation of elite mutant/recombinant lines in station/national yield trials

About 1340 kg seed of cotton varieties (NIAB-111, NIAB-846, NIAB-777 and NIAB-852) as well as upcoming

candidate lines (NIAB-9811, NIAB-112, NIAB-2008 and IR-NIAB-824)

was multiplied and provided to progressive growers, researchers and

seed producing agencies.

NIAB-852 was approved as variety by the Punjab Seed Council (PSC) in

its 42 meeting held on 16 February 2012. It has higher yield potential

with desirable fiber quality characteristics, such as GOT (38.8%),

fineness (4.68 µg/inch), fiber length (30.1 mm), fiber strength (94.3

TPPSI), uniformity index (83.1%) and fiber maturity (81.1%). It exhibited

10-18% higher seed cotton yield as compared to check variety CIM-496

in different national and adaptability trials.

Evaluation of three upcoming candidate lines (NIAB-9811, NIAB-2008 and IR-NIAB-824) for their yield potential

in the National Adaptability yield trials was continued during 2011-12. NIAB-9811 scored 2nd position at PSC

Farm, Khanewal along with exhibition of fine quality fiber traits tested by spot examination team. After

consecutive evaluation in requisite trials during the years 2010-11 and 2011-12, proposals of these lines were

submitted to Punjab Seed Council for their presentation in the forthcoming meeting of the Technical Experts Sub-

Committee. For the improvement of fiber quality parameters, re-spot examination of varieties NIAB-2008 and IR-

NIAB-824 was conducted at PSC Farm, Khanewal by the members of Technical Experts Sub-Committee. NIAB-112

and NIAB-Bt-1 were included in NCVT, PCCT and 1.25 acre yield trials during 2012-13 for their 2 and 1 year

requisite evaluation, respectively.

NIAB-4-61, which performed better than check varieties during previous years, was included in national trials

(NCVT, PCCT) 2012-13. Fifteen lines were included in preliminary yield trials (PYT) along with check variety MNH-

886 for evaluation of yield potential and other parameters. Different promising advanced mutants (1011-B,

nd th

nd st

Scientists of Plant Breeding and Genetics Division

A field view of NIAB-852

NIAB852

2


8411, 9811/3,616, 617, 618, 619, 613, 620, 622, 610, 619, 611, 590 and 1163) were evaluated for their stability in

performance as single plant progeny rows as well as progeny blocks. The mutants with Bt gene (Cry1Ac) in

recombinants and backcrossed (F , F , F , F , F ) generations were grown in field and glass house conditions for

generation advancement. About one hundred and twenty-two single plant progenies in F , fifty in F , twenty in F ,

twenty-five in F and fifty-five in F were selected for further evaluation. Performance of 18 F populations

resulting from different cross combinations was also confirmed in comparison with their parents. For the

incorporation of Bt gene in potential performance lines of cotton, 22 fresh cross combinations with their

different origins were also made by using the advanced non-Bt lines, i.e., NIAB-9811, NIAB-112, NIAB-2008,

NIAB-2009 and NIAB-2010, with Bt varieties lines MNH-886, FH-114, Tarzan-1 and IR-NIAB-824.

In planting density, sowing date and nitrogen

interaction studies, NIAB-2009 and NIAB-9811

produced the best yield at lower nitrogen dose of 100

kg N/ha at planting density of 45 cm and 30 cm as

compared to 150 kg/ha N dose (standard farmers'

practice) when sown during last week of May. NIAB-112

was found tolerant to moisture stress at internodes

elongation stage with yield of 5352 kg/ha at 100 kg

N/ha compared with control producing 4116 kg/ha at

150 kg N/ha. To improve bad opening and low yield,

application of 0.1 % Zn and 0.1 % B at 60, 90, and 120 -

day crop was observed more effective with 60-80%

reduction in bad opened bolls as well as 18-20%

increase in seed cotton yield of NIAB-112 and NIAB-

9811. NN-3 gave the best yield (2105 kg/ha) by two split

applications of , whereas NIAB-852 gave the best

yield (2558 kg/ha) by three split application of P O .

(

Agronomic biofortification of wheat grains with

appropriate dose of Zn to combat low productivity and

malnutrition, grain yield increased with the application

of zinc (5000 kg/ha) as compare to standard farmer's

treatment with 4000 kg/ha grain yield (GY).

Improvements in grain Zn concentration were observed

that ranged from 40 ppm (control) to 57 ppm (soil +

foliar treatment). The project was further extended for

2 phase (2011-14) with funding of Rs. 4 million.

Spot examination of advance mutant NIAB Castor-2012

was successfully cleared. This mutant is early maturing

(125 days) as compared to 200 days, as well as high

yielding (2745 kg/ha) against check DS-30 (1768 kg/ha).

Two mutants, NS-103-1 and NS-22, scored 2 and 3

highest yielding positions in NYUT 2011-12. These

mutants have also been included in NYUT 2012-13 for

second year's evaluation and approval process.

2 3 4 5 6

6 5 4

3 2 1

2 5

Agronomic studies of different crops

HarvestPlus Zinc Project

Castor

Sesame

Cotton

P O2 5

An international

collaborative project on wheat)

nd

nd rd

Participants of National Zinc Day visitingwheat experiments

AARI agronomists visiting castor field

Early maturing candidate line of sesame

3


Stevia

Rice


Spot Examination of candidate coarse rice line RSP-2

Evaluation of elite mutants/recombinants in station/

national yield trials

Selection of mutants and recombinants in segregating populations and germplasm maintenance

(a high value sweet plant)

We have succeeded to screen some plants which have excellent sweetness and are able to produce seed under

local environmental conditions of Faisalabad.

About 300 kg pre-basic seed from true to type

progenies of variety Niab-Irri-9 was multiplied and

provided to the Punjab Seed Corporation and

progressive growers.

Candidate line RSP-2 successfully was cleared in the

spot examination. The proposal for its approval as a

commercial variety has been submitted to the

Technical Experts Sub-committee, Punjab Seed

Council. This line has low water requirement, high

lodging resistance and salinity tolerance with yield

potential of 10000 kg/ha.

Two early maturing and dwarf Basmati mutants EF 1-30-39-04 and EF 1-20-52-04 scored 2 and 5 positions in

the national uniform yield trials producing paddy yields of 3992 (26.3%) and 3748 kg/ha (18.5%) than Super

Basmati (3162 kg/ha), respectively. NIAB 201001 scored 9 position producing 6.9% (3379 kg/ha) higher paddy

yield than Super Basmati.

Seven mutants, alongwith parent Basmati 370 and Super Basmati, were evaluated for yield in the nursery. Of

these, mutants 201004 and 201019 produced paddy yields at par (3783 and 3788 kg/ha) as compared to Super

Basmati (3797 kg/ha). These mutants had comparable plant height with standard, early flowering (91-103 days)

than Super Basmati (127 days) and had long grains. The recombinants, 201008 and 201034, produced higher

paddy yields (4387 and 3985 kg/ha, respectively) as compared to Super Basmati (3787 kg/ha).

Twenty mutants derived from Basmati 370, Basmati Pak and Super Basmati alongwith check Super Basmati were

evaluated produced higher paddy yield (4819 and 4187 kg/ha, respectively) as compared to

check (3705 kg/ha) in two sets of yield trials. The mutants flowered between 98-108 days with plant height of

148-150 cm as compared to standard (124 days and 149 cm). The mutant 2010104 produced higher paddy yield

(4736 kg/ha) followed by 2010119 (4627 kg/ha) than standard (4488 kg/ha). These mutants flowered at 119-122

days and attained plant height at par with the standard. Twenty-six mutants of EF 1-20-119-02 were evaluated in

three sets of yield trials. Mutants 1126 and 1114 produced higher paddy yield (4707 and 4485 kg/ha) as

compared to Super Basmati (3841 kg/ha).

Forty-five recombinants between DM 1-30-34-99 and extra-long grain mutant (ELD) were evaluated in five sets

of yield trials. The recombinants, 1153 and 1144, produced higher paddy yields (4176 and 4133 kg/ha,

respectively) as compared to Super Basmati (3986 kg/ha). Twenty recombinants were evaluated in two sets of

yield trials where 201048 produced higher paddy yield of 4237 kg/ha followed by 201089 (4133 kg/ha) as

compared to Super Basmati (3733 kg/ha). These lines flowered in 99-122 days with plant height of 141-154 cm as

compared to standard (121 days and 144 cm).

More than 800 recombinants/mutants (F /F and M /M ) were selected from different cross combinations based

upon improved grain/yield characteristics. Single plants from M generations of Basmati 370, Super Basmati, RD

25, mutants RSP-2 and EF-39 were selected. One hundred and six mutants/recombinants alongwith varieties of

aromatic and non-aromatic groups were maintained for their use in future breeding programme. To create

nd th

th

201022 and 201024

3 2 3 2

1

A field view of RSP-2

4


variability through induced mutations and hybridization, seeds were collected from thirty-nine cross

combinations and from M generations of Basmati 370, Super Basmati, Basmati-515, RD-25, RSP-2 and EF-39.

Selection/purification of single plant progenies were carried out for low phytate mutants of Super Basmati.

These progenies were back crossed with Super Basmati to develop F and BC generations for low phytate

mutants.

Three F populations of coarse rice hybrids, RH-195, RH-198 and RH-216, were raised to develop indigenous

hybrid rice, and to identify maintainer and restorer lines. The putative CMS lines were identified by applying IKI

test and successfully crossed with commercial cultivars. About 300 single plants were selected from single plant

progenies of F populations of rice hybrids RH-195, RH-198 and RH-216. Likewise, about 200 plants were selected

from 11 F populations of commercial coarse rice hybrids.

About 1000 kg seed of kabuli variety CM-2008 was

produced and provided to progressive farmers. Nearly

500 single plants of CM-2008 were collected for the

production of BNS seed.

In the national uniform yield trial-desi, recombinant

line CH38/04 scored 4 position producing yield of 2021

kg/ha as compared to check Pb 2008 (2034 kg/ha) while

in kabuli trial, the mutant CM-1528/03 scored 3

position giving 12.2% higher yield (1789 kg/ha) than

check Noor 2009 (1675 kg/ha). Cooperative and

advance trials were conducted at different locations. In

desi types, the line CH541/05 produced the highest

yield of 1739 kg/ha than check Pb 2008 (1535 kg/ha)

while line CM-613/05 gave the highest yield of 1188

kg/ha than check Bhakkar 2011 (1124 kg/ha). The lines

CH16/06 and CH81/06 produced the highest yields of

1891 and 1858 kg/ha, respectively, as compared to

check Pb-2008 (1527 kg/ha). In kabuli types, the line

CM-956/06 gave the highest yield (1719 kg/ha) than

check CM-2008 (1634 kg/ha) while the mutant CM-

888/06 gave 4.3% (1782 kg/ha) higher yield followed by

CM-1004/06 (1.6%) and CM-719/06 (0.6%) than check

CM-2008 (1741 kg/ha).

Out of 305 lines in wilt screening nurseries, 7 lines were

found highly resistant to wilt followed by 3 resistant, 16

moderately resistant and 9 tolerant lines. Survey of

chickpea farmer fields in Thal area during 2011-12, revealed that almost 60% of chickpea crop was damaged due

to frost, whereas less damage was found in Mainwali and Khushab districts. PARB material at AZRI (Bhakkar) and

GBSS (Kalurkot) was less damaged.

Under PARB project, 70 lines out of 232 were selected on the basis of higher yield for rainfed conditions at PRI,

AZRI, Kalurkot, Rukh Uttra and NIAB. In the second drought screening experiment, out of 55 lines selected during

1

1 1

2

3

2

Low phytic acid mutants ( )

Indigenous hybrid rice programme

Chickpea


Evaluation of elite mutants/recombinant lines at

station/multilocational yield trials

Identification of drought tolerant and disease resistant genotypes for marginal lands

Lpa

th

rd

Chickpea Breeder (ICARDA) visiting chickpeadrought tolerant experiment

Farmer Day Celebrations during 2012

5


last year, 15 lines were selected on the basis of higher yield in the rainfed conditions. Out of 18 lines in preliminary

yield trials, only 8 drought tolerant lines were selected. Twenty-three genotypes showed immune reaction to

frost injury followed by seventy resistant and sixty-seven highly resistant reaction. Genotype CH82/02 showed

the lowest L when analyzed for Carbon Isotope Discrimination (CID). More than 300 lines were screened against

wilt and 54 lines were found to be highly resistant/resistant. Among 204 lines selected during the last

year, ten lines showed highly resistant/resistant reaction to blight and wilt with higher yield potential and high

drought tolerant rating (physiological and biochemical analysis).

About 100 kg seed of NM-2006 and 1200 kg of NIAB

Mung 2011 was produced for supply to public/private

seed companies and farmers.

Newly approved variety NIAB Mung 2011 which is high-

yielding (11-25%), early-maturing (65-75 days) and

disease-resistant performed very well at farmer field

and is becoming popular among farming community in

Punjab.

Candidate lines NM-9 and NM-10 produced seed yield

of 780 and 608 kg/ha, respectively, as compared to AZRI

Mung-2006 (559 kg/ha). Among twelve elite lines

evaluated in adaptation yield trial at three different

locations, NM-3960 produced the highest seed yield of 918 kg/ha followed by NM 04-1-1 (837 kg/ha) as

compared to AZRI Mung-2006 (769 kg/ha) and NM-2006 (635 kg/ha).

Sixty-five lines were evaluated for yield and other traits in screening nursery; eleven lines were selected for

further evaluation. Based on high bearing, long pods and disease resistance, 47 true breeding lines were selected

from F (13), F (4), F (15) and F (15) generations and 1050 single plants were selected from F (668), F (51), M

(8), M (243) and M (80) generations. Seeds were collected from nine F recombinants for creation of genetic

variability.

About 300 kg pre-basic seed of NIAB Masoor-2002 and NIAB Masoor-2006 was multiplied and supplied to

different seed companies and progressive growers.

NLM-07181 produced highest seed yield (948 kg/ha) in adaptation trials at seven locations followed by NLM-

0637162 (884 kg/ha) and NLH-062961 (880 kg/ha) as compared to Punjab Masoor-2009 (870 kg/ha) and

Markaz-2009 (847 kg/ha). NLH-062721 produced maximum seed yield (1592 kg/ha) in advanced yield trial-I

followed by NLH-061673 (1569 kg/ha) as compared to Markaz-2009 (1081 kg/ha) and Punjab Masoor-2009 (958

kg/ha). In trial-II, NLH-09006 produced maximum seed yield (1885 kg/ha) followed by NLH-09007 (1724 kg/ha),

Markaz-2009 (1164 kg/ha) and Punjab Masoor-2009 (1086 kg/ha). NLH-0331742 produced maximum seed yield

(1347 kg/ha) in preliminary trial followed by NLH-9857/98 (1319 kg/ha), Punjab Masoor-2009 (764 kg/ha) and

Markaz-2009 (708 kg/ha).

Sixty high yielding and disease resistant/tolerant genotypes were selected from 230 genotypes contributed by

Pulses Research Institute (PRI), AARI and another 150 by NIAB. NLH-11117 produced 942 kg/ha seed yield as

D

Fusarium

Mungbean


Evaluation of candidate genotypes in national/station

yield trials

Selection of true breeding lines in advanced and segregating generations

Lentil

Varietal maintenance and quality seed production

Performance of elite genotypes in adaptation/station yield trials

Performance of true breeding lines/segregating material

8 7 6 5 3 2 4

3 2 1

A field view of NIAB Mung 2011

6


compared to Markaz-2009 (398 kg/ha) and Punjab Masoor-2009 (390 kg/ha) from 235 true breeding lines. Two

hundred and thirty true breeding lines were selected from F , F , M , M and M generations based on their high

pod bearing and resistance to wilt. Six hundred and nine mutants were selected from M -M

generations and 222 recombinants were selected from F -F generations. Twelve F cross combinations were

raised and 20 fresh crosses were attempted for the creation of genetic variability. One hundred and fourteen

genotypes were maintained for purity and viability.

The lines HTT-9 and HTT-3 produced the highest fruit (3.2 and 2.8 kg/plant, respectively) in the macro yield trial

as compared to 1.6 kg/plant fruit obtained from Nagina (check). High incidence of early blight was observed on

all the lines. In F /M generations, lines B50-22-09-22, J16-7-09-20, B60-4-09-22 and Rio-350-82-09 were top

yielding with fruit potential of 5.3, 4.8, 4.2 and 3.7 kg/plant, respectively, as compared to check (3.2 kg/plant).

Among 44 lines from F generations, 9 indeterminate and 7 determinate lines were selected based upon their

fruit yield (2.9 to 4.0 kg/plant) against checks Nagina and Riogrande (2.8 and 1.1 kg/plant, respectively). Twenty-

seven single male sterile plants were selected from F population. Seventy-two indeterminate and 19

determinate lines in F progeny rows showed better phenotypic field resistance against early blight while 11 lines

produced 2.0 to 2.8 kg/plantfruit yield against 1.6 kg/plant of check variety B25. From M single plant progenies,

24 lines were selected having 2.0 to 3.2 kg/plant fruit yield as compared to 1.5 kg/plant of parent Money Maker.

Three determinate and 24 indeterminate single plants were selected in F populations. M generation of

indeterminate type genotype B26 was raised to create genetic variability for desired traits. Seeds were collected

from 114 fresh crosses to develop recombinants for earliness, higher yield and disease resistance.

Eight F indeterminate recombinants along with standard Advanta-1209 were selected for days to maturity and

fruit yield in macro yield trial. Of these, four hybrids matured earlier (156 to 160 days) than standard (170 days).

The hybrids B23 × B27, B26 × B25 and TMS1 × MM gave the highest fruit yields (4.0, 3.6 and 3.4 kg/plant,

respectively) as compared to check (1.8 kg/plant). In another

trial, hybrids 88572 × B26 and 88572 × B27 produced the

highest fruit yields (4.6 and 4.3 kg/plant, respectively) against

Pakit (2.53 kg/plant) as check. The hybrid 88572 × B26 also

showed field resistance to both early and late blight,

cucumber mosaic virus and leaf curl virus. In determinate

trial, hybrids (88572 × B22, 88572 × B24 and 88572 × B21)

produced fruit yield of 4.0, 3.3 and 3.2 kg/plant, respectively,

as compared to Commander (1.4 kg/plant) as check. From

hybrids LBL-1 x Nagina, LBL-6 x Nagina, TMS3 x Riofuego, LBL-

7 x Nagina, TMS3 x Riogrande, TMS3 x 019291 and TMS2 x

Peto 86 produced fruit yields of 4.3, 4.2, 3.9, 3.7, 3.5, 3.1 and

2.9 kg/plant, respectively, as compared to Nagina (2.1

kg/plant) as check in an augmented trial. Except TMS3 x

Riofuego, all the selected hybrids showed field resistance

against late blight.

Seven hundred and ten LSK plants were produced of which

287 were supplied to the farmers. In addition, 1946 plants

were again grafted with a success rate of about 70%. A

mother block of 475 LSK plants was developed to be used as a

source of bud wood for multiplication purpose. Application of

GA and 2, 4-D, significantly increased yield by reducing the

pre-harvest fruit drop as well as improved the fruit quality

characteristics of the LSK plants. Maximum fruit drop (31%)

5 4 6 5 4

2 5

2 4 1

5 5

4

4

3

3

2 1

1

3

Fusarium

Vegetable

Performance of pure lines and selections from segregating generations of tomato

Performance of crosses in F generation

Development of Low Seeded Kinnow (LSK)

1

NIAB LSK in fruit bearing and seedless conditions

7


was recorded in control plants while minimum (11%) loss was observed in plants treated with 50 mg/l GA . Plants

sprayed with 50 mg/l GA had maximum fruit weight (176 g), volume (186 ml), diameter (74 mm), length (62

mm), peel thickness (3 mm), peel contents (23%), rag (2%), juice pH (4.15) and total solid salt (TSS)/Acidity ratio

(17.19%) as compared to other treatments and control. Among various agro-chemicals tested, combination of

1.5% CaCl + 0.6 mM Salicyclic Acid (SA) + 30 ppm NAA + 30 ppm GA resulted in the highest fruit retention (91 %),

longer shelf life (60 days) and excellent fruit quality characteristics of LSK as compared to control. Fruits

harvested from plants sprayed with 0.2 mM SA showed the highest fruit weight (217.5 g), volume (238 ml);

diameter (80.8 mm), length (68.6 mm) and pulp weight (172 g) as compared to other treatments and control. A

significant enhancement in TSS contents and TSS/Acidity ratio was observed in plants treated with 0.4 mM SA

followed by plants sprayed with 0.1% CaCl . An efficient protocol for micro-propagation of LSK plants was

developed using nodal segments by inoculating on MS medium supplemented with different concentrations and

combinations of 6-benzylaminopurine (BAP), kinetin, and naphthalene acetic acid (NAA). Maximum multiple

shoot regeneration response (75%) was observed with BAP at 0.5 mg/l.

Among 13 upland rice mutants, WAB-56-104 showed the higher photosynthetic efficiency ( >0.82) as

compared to the parent ( <0.80) and produced

This mutant also had higher grain yield (54 g/plant) than the mutants developed from lowland genotypes (<30

g/plant).

Wilt disease of chickpea is mainly caused by

Thal areas of Pakistan whereas the root rot

in this area is caused by

which has been reported first time.

DNA fingerprinting of twenty approved varieties of

chickpea using SSR markers has been completed and a

total of 25 SSR primers are required to identify individual

varieties.

Three SSR markers have been found to be linked with

QTLs for drought tolerance and yield related traits in

chickpea genotypes in the field conditions and can be

used for marker assisted selection of drought tolerant

plants (Fig. 1).

Heat stress-induced programmed cell death (probably

necrosis) in wheat leaves was evident by DNA smear.

Catalase, protease and ascorbate peroxidase

significantly correlated with heat susceptibility index and

could be used efficiently to assess the relative heat stress

tolerance. Drought stress may induce programmed cell

death (PCD) by apoptotic pathway (Fig. 2) and is the first

report of PCD. Compromised antioxidant activities and

enhanced protein, DNA, and lipid degradation played

central role in drought induced cell death in drought

sensitive genotype, whereas antioxidative enzymes like

3

3

2 3

2

Marker Assisted Breeding (MAB)

Rice

more productive tillers per plant (32) than

Chickpea

Fingerprinting of chickpea varieties

Detection of Quantitative Trait Loci (QTL) for drought

tolerance

Wheat

Fv/Fm

Fv/Fm

Fusarium

oxysporum

Neocosmospora vasinfecta,

in

the parent (10).

M R R R S S S R S

Fig. 1: DNA profile of SSR marker H3DO5 forchickpea genotypes for drought. S- susceptible, R-resistant, M-100 bp Mol wt marker

Fig. 2: Electrophoregram of DNA isolated from wheatseedlings grown under control conditions (1, 2) anddrought stress (3-6). Lane 1 - Nesser, lane2 - FD-83,lanes 3 & 4 - Nesser, and lanes 5 & 6 - FD-83, M - DNAmolecular mass marker (50-1000 bp).

1 2 M 3 4 5 6

Control Drought

8


CAT, POD, SOD played significant role in conferring drought tolerance.

Two rhizobacteria and were characterized for the bioactive

secondary metabolites such as indole acetic acid, hydrocyanic acid, enzymes (chitinase, protease and lipase) and

antifungal compounds (tripyrrole, phenazine). antifungal activity of and

against fungal pathogens of chickpea ( ) and rice ( ) revealed 28-67%

reduction in the growth of fungal mycellium due to the production of antifungal compounds. The suppression of

the growth of phytopathogens by these bacterial strains indicated these as potential biocontrol agents.

Waste water samples of textile dying and printing industry were treated with different doses of radiation. At 30-

50 KGy gamma dose, the pH, EC and total suspended solids were reduced and dissolved oxygen increased. Poly

vinyl alcohol aided methyl red and methyl blue dye films were tested at different doses for colour change and

found to be the best indicator of 50-200 KGy. The shelf life of garlic extended up to 60 days with radiation at

ambient temperature. To create genetic variation in ornamental plants, 700 cuttings of six rose varieties were

treated with gamma radiation. Genetic variations in plant size, plants texture and flower shape and size were

induced. About 1900 samples of 25 crop varieties from all over the country were irradiated at different doses.

Low radioactivity isotopes ( C, P and I) from NIAB/NIBGE were treated for disposal according to IAEA protocol.

The exposure files of NIAB/NIBGE radiation workers have been maintained and radiation absorbed dose ranged

0.32-0.55 msv/year. Forty six (46) radiation certificates were issued to National Companies for export purposes.

Evaluation of bacterial strains against fungal pathogens of chickpea and rice

Radiation Safety Services

Serratia marcescens Pseudomonas aurantiaca,

In vitro P. aurantiaca S. marcescens

Fusarium oxysporum Helminthosprium oryzae

14 32 125

9

Annual Report 2012Soil Science

II. SOIL SCIENCE DIVISION

Bio-saline Agriculture

Agro-forestry on saline land at Pakka Anna

Improvement in wheat yield with K on saline soil

At Pakka Anna Bio-saline research substation, 87 acres of degraded land were cleared of thorny mesquite bushes,leveled and brought under cultivation. was transplanted on another 14 acres and preexisting250 acres tree stand was managed efficiently. Salt tolerant forages/grasses were grown on 12 acres to feedlivestock being reared at the station. The farm produce, mainly trees, fuel wood and wheat etc. was sold to tuneof Rs. 1.42 million. This is a good beginning to achieve economic sustainability of salt-affected soils applying bio-saline technology. In addition, several delegations including researchers, progressive farmers, post-graduatestudents, and foreign scientists visited the demonstration site.

Alley cropping system growing wheat (Sehar-2006) under was evaluated on saline soil(pH 8.6-8.8, ECe 13.2-16.4 dS/m, SAR 54-67) being irrigated with brackish water (EC 6.38 dS/m, RSC 14.4 meq/l)under different nutrient management practices. Wheat production (biomass 5674 and grain yield 2241 kg/ha)with application of 20 tons FYM + 60 kg N/ha was significantly higher than the control (biomass 4071 and grainyield 1449 kg/ha). Appreciable improvement in soil properties (pH 8.35-8.51, ECe 11.7-14.2 dS/m, SAR 39-44)was observed under this system. Alley cropping systems with integrated use of fertilizers and organicamendments would enhance crop productivity insaline environments.

Four wheat cultivars, grown under saline conditions (EC6.64 dS/m, SAR 57, pH 8.2) at Pakka Anna, were testedapplying NPK nutrition. Application of NPK enhancedaverage grain yield by 56% in all cultivars, significantlyhigher than NP alone. The use of K @ 50 kg/haalongwith NP @ 100-50 resulted into optimum yield(3.18 ton/ha) followed by NP @ 100-50 (2.05) andminimum in control (0.94). Among the varieties,advanced line S-24 produced higher yield than theother varieties, Lasani-2008, Sehar-2006 andFaisalabad-2008. Application of K could significantlyenhanced wheat yield on marginal lands.

Acacia ampliceps

Eucalyptus camaldulensis

Screening of wheat germplasmat Pakka Anna

Scientists of Soil Science Division

10

Annual Report 2012

Screening germplasm for stress tolerance

Salt tolerance in barley

Drought tolerance in cotton and chickpea

Screening of rice germplasm for high temperature stress tolerance

Phosphoric acid (PA) as P source for crops

Enhancing P availability using different sources

Thirty barley varieties/lines were screened for salt tolerance at salinity levels of 2, 10 and 20 dS/m in gravelculture. Increase in salinity greatly reduced shoot dry matter yield of all the tested varieties. At 10 dS/m salinity,the genotypes ICARDA-20, 91/2A, 76/2A, 186/AD had minimum (15-26%) reduction in shoot dry matter yield.However, more than 50% reduction (relative-to-control) in shoot dry matter of almost all varieties/lines wasrecorded at 20 dS/m level. Four genotypes (ICARDA-20, 91/2A, 76/2A, 186/AD) were found salt tolerant andsuitable for cultivation on moderately saline soils.

Using physiological traits and yield stability, fifteen cotton advanced lines were screened for drought inlysimeters. The line NIAB-2009 performed the best followed by NIAB-9811, NIAB-2010 and NIAB-2008, where asNIAB-852 and NIAB-777 were the medium tolerant to drought.

Out of 232 chickpea lines screened under PARB project 120, 14 were found tolerant and 40 moderately tolerantto drought. Dry biomass stress tolerance, cell membrane stability and excised leaf water loss were found reliablephysiological indices to screen cotton and chickpea germplasm for drought tolerance.

(IAEA project)

Using physiological indices, 17 aromatic rice lines and 23 non-aromatic mutants from the screened germplasmwere found heat tolerant up to 45 C.

PA and DAP were applied to wheat, rice and maize in multi-location trials using different methods. The specialwheat drill- and maize planter- cum-liquid fertilizer applicators were used in field trials for simultaneous sowingof seed and banding PA 5cm below seed. This technique enhanced wheat/maize grain yield (GY), grain P content,agronomic efficiency and value cost ratio. Phosphoric acid exhibited better performance as compared tocommercial P sources.

P adsorption was determined using Freundlich Model in the soils of two sites. Low adsorption of P fromPhosphoric acid (PA) as compared to TSP was observed. To derive adequate soil solution P 0.2 mg/L for optimumcrop yield, lesser quantity of PA was needed compared with TSP at the two study sites:

Sialkot soil: PA @ 306 and TSP @384 kgP O /ha

Sahiwal soil: PA @ 61 and TSP @90 kgP O /ha

o

2 5

2 5

Soil Science

Comparison of phosphoric acid and DAP for wheat production

Control DAP Phos. acid

11

Annual Report 2012

P uptake by wheat using radio tracer technique

Acidic N-fertilizers increase wheat and maize yield

Enhancement in wheat yield by foliar application ofNPK

Zn application reduces Cadmium in Basmati ricegrain

Control of fruit drop in kinnow at farmer fields

Microbial inoculation increases propagation of Jatti Khatti

P uptake by wheat from phosphoric acid and DAP wasdetermined using P tracer. The maximum P uptake(60%) from 42-day old wheat was observed where PAwas placed 5cm below the seed while minimum (40%)P uptake was recorded in DAP applied by broadcasting.

Wheat grain yield (GY) and grain quality improvedwith acidic N-fertilizers (pH<1, N 15%), SUN preparedby reacting H SO with urea and HUN HCl by reactingwith urea. SUN produced 12.6% and HUN 7.4% moreGY than urea. P, Zn and Mn content were higher ingrains from SUN treated plants followed by HUN andurea. Under saline soil conditions at Pakka Anna, SUNincreased GY (12%) and grain nitrogen (6%) ascompared to urea. In maize SUN produced 48%higher biomass yield than urea.

Five formulations of soluble NPK fertilizers, each havingdifferent pH (range 2.3 to 7.9), were prepared by thecombination of various chemical sources and theirefficiency was evaluated on wheat (Sehar) applyingfour foliar sprays (1% solution) of each formulation.Maximum increase in grain yield (9.4%) over controlwas obtained with urea phosphate based NPKformulations (pH 2.3 and 2.4).

Zn fertilizer reduced Cd (toxic) in rice grain and enhanced Zn in rice growing areas. Field studies conducted atGujranwala, Panwan, Pindi Bhattian and Farooqabad showed lesser grain Cd in Zn fertilized soil as compared tocontrol. ZnSO .7H O applied @ 10 kg/ha at Gujranwala site reduced grain Cd significantly from 0.42 to 0.30mg/kg. At Panwan and Pindi Bhattian grain Cd was reduced by 65 and 23 percent; however, at Farooqabad site Cdconcentration remained unchanged. Improved Zn concentration in grain ranged from 2.8 to13.4 percent at thesesites.

Foliar application of 2, 4-D or salicylic acid (10 mg/Leach), Zn + K (0.25 % Zn as ZnSO + 0.25 % K as K SO solution)reduced the fruit drop in kinnow and increased yield by 30 %. There was significant improvement in fruit weight,number of fruits per plant, juice percentage, total soluble solids (TSS), ascorbic acid content, acidity, and TSS/acidratio (Fig. 3). The treatments helped to improve hormonal and nutrient imbalance, reduced excessive fruitdropping and enhanced yield.

Lush.)

Stem cutting is important, particularly, in horticulture for mass production in short time. Propagation of Jattikhatti through stem cutting was studied with 20 minutes soaking in microbial inoculation of

(7x10 cfu/ml) and soil application @ 1 ml/cutting in two seasons (autumn and winter).

There was 44 and 50 percent root propagation in autumn while 33 and 43 percent in winter in soaking and soilinoculated Jatti khatti stems, respectively, in comparison to control (29%) (Fig. 4).

32

6

2 4

4 2

4 2 4

(Citrus jambhiri

Trichodermaharzianum

Soil Science

Difference in growth of wheat

Difference in growth of maize

SUN Urea

SUNUrea

12

Annual Report 2012

Stem propagation of citrus root stock was enhancedthrough microbial inoculation and plant attained thegrafting stage shortly (7 months) as compared to thenormal practice (24 months).

Wheat productivity is facing a number of challenges,i.e. high temperatures at reproductive stage, waterscarcity and pest attack. Eight genotypes wereevaluated for agronomic (number of grains/spike, 1000grain weight, GY) and physiological parameters (cellmembrane thermo-stability, proline accumulation)against terminal heat stress. Sehar-2006 and CB-72were moderately tolerant while others, includingInqilab-91, were susceptible to high temperature.

Out of 40 lines screened for drought, two varieties(Faisalabad-08, Lasani-08) and an advance line of NIAB(NW-1-27-1) were tolerant and will be used in breedingprogramme. None of the 224 screened lines againstaphid was found resistant to this pest. Germplasm andadvanced lines screened for tolerance against yellowand brown rust alongwith their performance is given inTable 1.

Plant-water relationships

Development of stress tolerant germplasm

Soil Science

Fig. 3: Effect of growth regulators and nutrients on Kinnow fruit dropping and yield

Fig.4: Stem propagation in Jatti Khattiby fungal treatment in pots

SA+K+Zn 2, 4D+K+Zn

K+Zn Control

13

Annual Report 2012

Preliminary yield trials were conducted on 187 stable lines of wheat (Fig. 5) and 16 high yielding lines wereselected. Two advanced lines NN-1 and NN-2 have been sent to provincial and national organizations for furtherevaluation. Advanced lines were also screened against salinity stress at BSRS, Pakka Anna. NN-4 performedbetter at EC range 8-12 dS/m with average yield of 1.8 ton/ha (Fig. 6).

Material crossed during the wheat growing seasons (2004-2010) is in F to F generations. Different progenieswere selected from population developed out of 80 crosses; their performance indicators are summarized inTable 2.

In wheat season 201 crosses were attempted to combine the desired yield contributing characters, out of which174 were harvested. These crosses are in field for further evaluation/selection.

In collaboration with NIBGE TILLING population M of wheat line NN-1 has been developed using chemicalmutagenesis under IAEA TC project. The mutations/genetic variability will be studied.

Advancement of generations

Fresh crosses

Developing wheat germplasm through TILLING

2 7

2

Soil Science

Table 1: Response of wheat lines to yellow and brown rusts in different trials.

ExperimentNo. of lines

tested

Response against

yellow and brown rust

No. of lines proved

tolerant

Disease Screening Nursery 40 Highly tolerant 17

Yield Trials 135 Highly tolerant 30

Segregating plots/lines

(F3, F5 and F6)

133 Highly tolerant 3

Fig. 5: Farmers visiting local yield trials on wheat lines Fig. 6: Performance of wheat line NN-4 at Pakka Anna

Table 2: Summary of selected wheat genotypes.

Generation Single plant

progeny

Segregating Stable

Progenies

F1 58 47 (bulk selection of best crosses) -

F2 50 43 (generation advancement at kaghan) -

F3 27 20 (bulk selection of synthetic crosses) -

F5 140 21 (single plant progenies) 8 for Micro

Yield Trials

14

Annual Report 2012

Enhancing water use efficiency in wheat with improved irrigation practices

Rice coarse candidate line RSP-2

Regulated deficit irrigation studies at four growth stages of wheat, crown root initiation/tillering and floweringstages appeared to be more sensitive to water stress. Maximum reduction in wheat biomass (20%) and grainyield (16%) was observed when irrigation at crown root initiation/tillering was skipped. Moisture stress atflowering produced 19% less biomass and yield was reduced by 14%. Irrigation missed at grain filling resulted inless reduction in biomass (6%) and grain yield (8%). Regulated deficit irrigation at booting, grain formation andboth at booting and grain formation resulted in 25% of water saving with negligible yield reduction.

Drought/salt tolerant and lodging/disease resistant line selected using Carbon Isotope Discrimination (CID)technique with yield potential of 10 ton/ha is at final stages of approval as a variety for general cultivation. It hasshown all round performance in preliminary, station, national uniform trials for yield and stability, adaptation,DUS studies and spot examination.

The crop was grown at four varying plant spacing (10x10, 20x20, 30x30, and 40x40 cm). It adapted well at all plantpopulations, however, crop planted at 20x20cm spacing produced maximum yield (7 ton/ha) and decreased at40x40 cm (13%), 30x30 cm (12%) and 10x10 cm (20 %). Plants grown at 10x10cm row to plant distance showedminor lodging at maturity but no heading day difference was observed.

Application of different levels of phosphorus and nitrogen fertilizers produced minor differences in yield incomparison to recommended fertilizer levels (P O 100 and N 165 kg/ha). Non-significant differences in yieldat higher fertilizer application levels were observed.

2 5

Soil Science

15

Annual Report 2012Animal Sciences

III. ANIMAL SCIENCES DIVISION

Fibrolytic enzyme improved the livestock performance

Improving fertility of buffalo with methylacetoxy progesterone (MAP) sponges

Enzymes produced from the improved strain of (DG-76) in fermenter were studied invarious feeding formulae in a series of three feeding trials. In the first trial, the effect of enzyme supplementationwas evaluated in Beetal-Dwarf goat in semi intensive and salt stressed conditions of BSRS, Pakka Anna. The effecton performance parameters of breeding goats was non-significant ( >0.1), whereas in case of growing kids, therewas 16.2% ( =0.092) and 20.3% ( =0.031) improvement in weight gain and feed conversion ratio (FCR) in enzymesupplemented (ES) group than the control. In the second trial on fattening of male goats, fed on a total mixedration (TMR) with and without fibrolytic enzymes supplement (FES) and control, respectively, there was asignificant improvement ( =0.0001) in daily weight gain (83.49 g/day in FES as compared to 68.33 g/day incontrol). However, a non-significant ( =0.2875) decrease of 3.75% in feed intake in the control group was noted.

Similarly, in the third trial on goat and sheep, ES group attained a 20.2% better weight gain ( =0.039) and 11.76%narrower FCR ( =0.010) as compared to the control in case of goat kids, whereas a 14.3% increase in daily gain( =0.0431) in sheep kids was observed. During metabolic studies, better apparent digestibility of dry matter, aciddetergent fiber and neutral detergent fiber were observed in enzyme supplemented groups than the control inboth goat and sheep. From the results of this study it is concluded that the mutant DG-76 is an over producer ofcellulase and xylanase enzymes as compared to the wild type and enzymes produced by thismutant might help attain better weight gain, ADF and NDF digestibility in goat and sheep.

Overall synchronization rate was significantly higher in MAP-treated Nili-Ravi buffaloes for 16 days. Two buffaloesexhibited estrous cycles (EC) of 22 days, one of 20 days, whereas two others displayed a cycle of 24 days. Onebuffalo of acyclic group showed a short EC of 14 days.

Serum progesterone (SP) of synchronized buffaloes up to one EC (Fig. 7 a and b) shows that on the day of estrusmean progesterone levels in synchronized cyclic and acyclic groups were 0.26±0.08 and 0.32±0.27 ng/ml,respectively. The progesterone concentration gradually increased during the next few days and attained peaklevels of 3.00±1.80 and 3.45±0.44 ng/ml on day 14 in both the lots. The peak levels of progesterone weremaintained up to day 16 and then a drop (2.43±0.62 and 2.79±0.40 ng/ml) was observed in these levels on day18, which gradually fell down to basal values on the next estrus.

One buffalo of acyclic group showing a short cycle (Fig. 8) attained the peak level of 3.55 ng/ml on day 8 and thenshowed a decreasing trend from day 10 to 14 upto a level <1 ng/ml, considering to be the estrus phase level. Afterday 14, progesterone profiles again showed an increasing trend upto day 24. This might have been the initiation

Chaetomium thermophile

PP P

PP

PP

P

C. thermophile,

Scientists of Animal Sciences Division

16


of another cycle in this buffalo. The results of the study confirmed the efficacy of MAP sponges for synchronizingestrous cycle in cyclic and acyclic Nili-Ravi buffaloes (Table 3).

Groups No. of buffaloes Cyclic Acyclic Overall

(n) --------------------------No.(%)--------------------------

Treated 10 3/4 (75) 3/6 (50) 6/10 (60)

Control 10 0/4 (0) 0/6 (0) 0/10 (0)

Values in the same columns and rows with different superscripts are significantly different at <0.05.

In continuation of the previous work for veterinary drug residue analysis in foodstuffs, attempts were made tostandardize a reverse–phase HPLC method for oxytocin hormone determination in milk. Performance ofavailable HPLC columns was evaluated at 197 nm with a mobile phase of acetonitrile: 0.03 M Phosphate buffer(21:79) at pH 3.5 (adjusted with dil. Orthophosphoric acid). With Inertsil Ph-3 HPLC column (5 um: 4.6 x 150 mm)at valve position 1, oxytocin peak depicted itself at 2.9 min instead of 4.78 min as mentioned in the method. Thisdeviation was because of different HPLC columns available. However, attempts are being made to improve thismethod for peak appearance and retention time.

The work for assessment of other available HPLC columns (at valve positions 2 and 3) as well as for extraction ofmilk samples, collected from different resources for oxytocin analysis is also in porgress.

Table 3: Estrus synchronization rate over a period of 5 days after treatment with MAP sponges in cyclic andacyclic Nili-Ravi buffaloes.

Veterinary drugs residue analysis in animal-derived food

Aa Aa A

Ba Ba B

A, B, aP

Fig. 7: Mean (±S.D.) levels of progesterone during synchronized estrous cycles in cyclic (a) and acyclic (b) buffaloes.

Fig. 8: Progesterone levels showing a short cycle in a buffalo of acyclic group.

17


Typing of foot-and-mouth disease (FMD) virus

Isolation and identification of Newcastle disease (ND) virus for vaccine development

Immunogenicity of recombinant proteins from fowl adenovirus-4

Livestock and meat production

NIAB HS Vaccine

Reverse transcriptase-polymerase chain reaction (RT-PCR) was established for serotype specific diagnosis ofFMD virus using primers listed in Table 4. Using universal primer set (1F/1R) of 76 FMD-suspected samples, 62 (%)were found positive, out of which 56 % of the total were successfully typed into type O (32 samples), type Asia I(21 samples) and type A (3 samples).

Infected samples were collected from different poultry farms around Faisalabad during disease outbreak. NDvirus (NDV-Thekriwala) was isolated from infected gizzard of layer hen and adapted to 9-day-old embryonatedchicken eggs. Isolate was confirmed as pathogenic by RT-PCR when eye drop infection was given to 3-week oldhealthy birds. Further research work for the development of vaccine is underway.

Hydropericardium syndrome (HPS) is a disease of poultry caused by fowl adenovirus-4. Inactivated liverhomogenate is used as a vaccine in the field. This type of vaccine disseminates numerous pathogens alongwithinactivated virus. To address this problem an effort was made to develop a subunit vaccine. For this purpose, anexperiment was conducted using broilers. Three recombinant proteins (Penton base, Short fiber and 100K) fromfowl adenovirus were injected to broilers and antibody titers were determined against these proteins by ELISA.After four weeks of immunization, the broilers were challenged with pathogenic fowl adenovirus. Penton baseprotein was found most immunogenic. The challenge protection test against pathogenic virus demonstrated theability of recombinant penton base protein to confer 90% protection. Results suggest that recombinant pentonbase protein is a candidate for subunit vaccine against HPS.

Raising of sheep and goat on saline lands represents a sustainable solution for utilization of the producedbiomass. During 2012, out of the main herd, 47 sheep and goat males were sold generating net sale receipt of Rs.0.45 M and a similar number of females having net worth of Rs. 0.4 M was retained in the herd for breedingpurpose. In addition, about 8000 nutritional units of NIAB Feed Blocks were provided to the farmers. The divisionalso organized two farmers days for improvement of livestock productivity and know how about ensuring thesafe use of veterinary drug residues in animal based products.

A joint venture between NIAB and ATCOP runs successfully for the control of Hemorrhagic Septicemia in cattleand buffalo. During 2012, 0.75 million doses of vaccine worth nearly Rs. 4 M were produced.

Table 4: The oligonucleotide primers used for RT-PCR sero-typing of FMDV.

Use Primer Specificity Primer sequenceProduct

Length

FMDV

Typing

P33 Reverse

Primer for

all types

AGCTTGTACCAGGGTTTGGC

P38 O GCTGCCTACC TCCTTCAA 402 bp

P74

Asia I

GACACCACTCAGGACCGCCG 299 bp

P75 GACACCACCCAGGACCGCCG

P76 GACACCACACAAGACCGCCG

P77 GACACGACTCAGAACCGCCG

P87

A

GTCATTGACCTCATGCAGACCCAC 728 bp

P88 GTTATTGACCTCATGCAGACCCAC

P89 GTCATTGACCTCATGCACACCCAC

P90 GTCATTGACCTCATGCAGACTCAC

P91 GTCATTGACCTCATGCAAACCCAC

P92 GTCATTGACCTTATGCAGACTCAC

18

Annual Report 2012Plant Protection

III. PLANT PROTECTION DIVISION

Integrated Pest Management (IPM)

Biological control based IPM in vegetables

Cauliflower

Tomato

Okra

IPM of fruit flies, mosquito and other insect pests

Preference studies on mango varieties, colour and pericarp hardness to fruit fly infestations

Comparative preference studies on different artificial diets to fruit fly species

Infestation of armyworm was decreased below economic threshold level (ETL) (0.3 to 0.9 larvae/plant/week) inmid-season cauliflower during the months of January and February with 5 releases of parasitoid,

Average weekly population of aphid was decreased to 3.2/leaf in treated plots (integration of 3 insecticide spraysand 3 releases) in 4 tomato varieties as compared to 14/leaf (control). Average larvalpopulation of fruit borer was 1.75/plant (control) compared with 0.75 larvae/plant in treated plot (6 releases of

and 3 insecticide sprays). Comparatively higher yield of tomato fruit was received by integratingbiocontrol with the minimum insecticide sprays.

Population of jassid and whitefly was recorded as moderate (6.5/leaf) to high level (13.6/leaf) during 2 week ofMay to 2 week of June (above ETL level), whereas, infestations of American and spotted bollworms weredecreased below ETL by integrating 3 insecticide sprays, 6 releases of and 3 releases of .

Female fruit fly, exhibited an elevated oviposition to rippened and fully-rippened mangofruits, while responded less to unrippened fruit of Desi and Malda varieties. Green colour (unrippened) was lessattractive over green-yellow (semi-ripe) and yellow (fully-ripe) fruits. Tough fruit pericarp with low total solublesolids was less attractive to fruit fly. Harvesting of green or green-yellow fruit is recommended to avoid fieldinfestation.

Adult male and female flies ( and ) fed on protein hydrolyzate, casein and sugar showed nomortality. However, protein hydrolyzate diet prolonged longevity significantly higher than casine and sugar.Protein diet accelerated average pupal recovery, higher larval and pupal weight and percent adult emergence

Trichogrammachilonis.

Chrysoperla carneaT.

chilonis

T. chilonis C. carnea

Bactrocera zonata

B. zonata B. cucurbitae

nd

nd

Scientists of Plant Protection Division

19

Annual Report 2012

than the other diets.

Mosquitoe, (L.) exhibited a well-defined increasing population trend during post monsoon rainfallseason (September to November). Thereafter, a rapid decline occurred during December to February. Next peakwas recorded in March and April that gradually decreased to low level from May to June and then an increasingtrend was observed in July and August. This species accounted for 3% of the mosquitoe species (Culex andAnopheles), whereas Skuse was less abundant and found at 1% frequency. Both speciescoexisted.

Life studies of under controlled conditions (25±2 C and 75±5% R.H.) showed that female mosquitobegins to lay eggs three days after taking blood from Balb/C mouse. Egg life is 3 days. After hatching, larvaepassed through four instars with 1.3, 1.1, 1.2 and 2.4 days, respectively. Pupation occurred in 2 days.

11 days. Adult female lived for 28 and male for 21 days.

Toxicological studies revealed that flubendiamide, chlorfenapyre, rynaxypyr, spinetoram, lufenuran,methoxyfenazid, flufenoxuran and emamectin benzoate were highly effective against armyworm larvae ascompared to spinosad, indoxacarb, deltamethrin, cypermethrin and cyhalothrin. Chlorfenapyre, nitenpyram,spirotetramate and spiromesifen were very effective against thrips, jassids, whitefly and mites, respectively, ascompared to acetamiprid and imidacloprid. Buprofezin and pyriproxyfen were relatively better in controllingwhitefly. Bt toxins in Bt cotton varieties gave high mortality up to 100% in early three larval instars of armywormswhile 4 , 5 and 6 instar larvae survived and pupated. However, these pupae showed severe deformations thataffected moth emergence. Bioassay studies on a, and showed thatinsecticides in pyrethroid group gave high insect mortality than newly developed safe chemicals like spinosad,chlorfenapyr and spinetoram. Cotton stainer was found a new threat to Bt varieties rather than to non-Bt cottonbecause of minimum insecticide spray in Bt Cotton.

Highly contaminated chili samples with aflatoxins (69 µg/kg) were chosen for the treatment with citric acid.Different concentrations (0.1, 0.2 and 0.3%) of citric acid were used for the reduction of aflatoxins and found that0.3% citric acid removed maximum aflatoxins. Stability of organic acid (citric acid) was also evaluated at 18 ± 2(ambient) and 30 C and found very stable after analyzed with HPLC. The retention time of citric acid was 2.30 ±0.01 min.

Bt-cotton (Tarzan-1) got the minimum average bollworms attack (0,0, 1.4%) at 60, 80 and 100 days age crop,respectively, than non-Bt genotype (NIAB-777) by having average attack of 2.1, 2.7 and 3.90%, respectively, perplant/week. However, these genotypes showed no difference in getting bollworm attack at crop age of 120 and140 days. Results concluded that Bt Toxins gave maximum mortality to bollworms in early formed squares andbolls.

Relative seasonal abundance and biology of dengue vector species of mosquitoes

Insect toxicology

Food toxicology

Aflatoxins in chili and its detoxification using chemical methods

IPM of cotton insect pests

Effect of age of Bt and non-Bt cotton on population fluctuations of insect pests

Aedes aegypti

Aedes albopictus Aedes

A. aegypti

Trichogramm Chrysoperla Aenasius

o

th th th

o

The entirelife cycle was completed within

Whole pod chilies

Plant Protection

Treated chilies

20

Annual Report 2012

Screening of insect resistant/susceptible cotton genotypes

Fungal, Bacterial and Viral Diseases

Infection of with cotton leaf curl disease through grafting

Varietal response of mungbean to phyllody disease

Out of 16 candidate Bt cotton genotypes (Provincial Coordinated Cotton Trial), 2 entries PC13 and PC10 showedthe maximum incidence of whitefly, whereas the minimum on PC2. Entry number PC10 showed the lower jassiddamage, whereas PC3, PC14, PC2, PC1 and PC11 held the highest damage. One entry PC6 exhibited lesssusceptibility to bollworms as compared to PC15 and PC12.

Out of 16 Bt hybrid lines average white fly/leaf was low on PC19, PC20, PC23 and high on PC24, PC26, PC27, PC11.Four lines PC18, PC32, PC21, PC31 were the most susceptible and PC27 most tolerant to jassid incidence than theother genotypes. Genotypes PC17, PC18, PC26 were found more resistant and the remaining nine got the highestdamage (4.28 – 3.29%).

Out of 7 non-Bt cotton germplasm, 2 lines V2 and V4 were resistant to whitefly, while 3 were susceptible. Onenon-Bt recorded the highest jassid population while, three (V6,V3,V7) recorded minimum jassid density. Themaximum bollworm damage on all genotypes ranged 15 to 2%.

In NCVT trials, out of 28 Bt cotton genotypes, whitefly was low on 5 genotypes (V27, V5,V10, V15, V8) ascompared to high on V26, while jassid was more on V16 and V1, but less on V27. An increased infestation ofbollworm was on V4 and V20, whereas 3 (V5, V22 and V10) were resistant.

Out of 10 Bt cotton genotypes, the minimum infestation of whitefly was on 5 genotypes (D6, D1, D7, D8 and D10),while the maximum on 2 genotypes (D3, D4). Maximum jassid was found on 4 genotypes (D1, D2,D4,D8) and theminimum on 2 (D3,D9) entries. Only one line (D5) was found resistant to bollworm and 3 (D7,D2,D1) wereextremely susceptible.

Young seedlings of genotype Ravi, graft inoculated with CLCuBuV showed 100% diseasetransmission under glass house conditions. Disease symptoms started 25 days after inoculation and remainedmild till the end of the experiment. Total genomic DNA extracted from all the inoculated plants confirmed thepresence of virus. This was the first ever symptomatic evidence of .

Phyllody disease was successfully transmitted from diseased to healthy plants of mungbean using grafting andleafhopper, A field trial of 162 exotic and indigenous mungbean genotypes from 8 differentgeographical regions was conducted against phyllody disease and sixty-one genotypes showed infection rangingfrom 1% to 4%.

Gossypium arboreum

G. arboreum

G. arboreum

Orosius albicinctus.

G. arboreum showing vein enation G. arboreum with minor vein greening

Plant Protection

21

Annual Report 2012

Evaluation of tomato germplasm against early blight (EB), late blight (LB) and leaf curl disease (TLCV)

Necrosis

Biological pathotyping of isolates

Out of 150 tomato genotypes and hybrids, only 8 (B-9 green, TMS3 × 88572, Jiefen, Vt71, B53, Anas, TMS2 ×019291, Rio-450-448-09-12) were found moderately resistant to EB, while the rest were susceptible. Out of 74tomato genotypes and hybrids, only 14 (Nag × V5, B7 green, Jiafen, Vt71, B7, B51, B59, BSS-802, Tol-Stoi, TMS3 ×Pak, TMS × MM, B23 × 019893, V7 × Nag, V18 × Nag ) were found tolerant to LB, while the others weresusceptible. Only 30 genotypes were resistant to TLCV.

A new fungus, caused round to oval straw colored spots with maroon margins on leavesand stems of resulting in chlorosis, severe defoliation and withering of stems. The causalpathogen was isolated on V-8 agar medium, identified morphologically and its pathogenicity was proven.

Twelve isolates were tested for their pathogenicity against six chickpea cultivars (resistant,tolerant and susceptible). Eight isolates found highly virulent belonged to Attock, Chakwal, Mianwali, Islamabad

Alternanthera philoxeroides

Ascochyta rabiei

Nimbya alternantheraeA. philoxeroides,

Ascocyta rabiei

Infected flowers Malformation of petals & sepals Germination of green seeds incent r and sickle shaped pods on righte

Tomato early blight Tomato late blight Tomato leaf curl virus

Blight on leaves and stem of A. philoxeroides Conidium of Nimbya alternantherae

Plant Protection

22

Annual Report 2012

and Swabi. Four isolates collected from Chakwal, Mianwali, Peshawar and Swabi were found moderatelyvirulent. Highly aggressive isolates of were selected for thorough screening of chickpea germplasmagainst blight.

Out of 52 NIAB chickpea lines 4 were resistant, 11 were tolerant to wilt disease, while 34 were found tolerant toblight. ICARDA germplasm (112 genotypes) showed that 23 lines were moderately resistant and 11

were tolerant to blight disease. Only one line was found resistant and 9 were tolerant to wilt disease.

Aqueous plant extracts (10 and 5 %) of mano ( , and cockscomb (and 1mM salicylic acid was used for seed treatment in wilt sick field. Early wilt was significantly

reduced in December by all the treatments except lower concentration of cockscomb. The maximum reductionwas observed with salicylic acid in late wilt (33%) in March and in total wilt (44%), followed by higherconcentration of cockscomb, moringa and lower concentration of mango plant extracts. Grain yield wassignificantly higher in all the treated plants as compared to control ones.

Bacterial Leaf Blight (BLB) was observed in all districts of Northern Punjab and disease incidence was 20-60%. InHafizabad, Sheikhupura and Gujranwala districts 100% BLB disease infection was observed. Incidence of brownspot disease was 10-40% which may be a future threat to rice crop. Sheath blight disease was observed in somefields with low incidence. Grain discoloration disease was common in all farmers' fields. Diseased samples werecollected from all sites for further studies and their management.

Pathodiversity of 60 isolates was tested on the basis of their disease reaction on a set of six rice differentials(IRBB-4, 5, 10, 11, 62 and IR-24) under artificial inoculation field conditions and grouped into 14 pathotypes.Screening of 627 entries/lines rice germplasm revealed that 183 wereresistant, 155 were moderately resistant and the rest were moderatelysusceptible to susceptible.

A total of 400 wheat genotypes including NIAB mutant lines, NIBGEgermplasm and commercial varieties were subjected to field screening byartificial inoculations. Only 20 were found moderately susceptible tosusceptible while rest of germplasm was resistant to yellow rust. In caseof leaf rust 189 lines were resistant, 91 were moderately resistant and 120were moderately susceptible to susceptible.

A. rabiei

Ascochyta

Mangifera indica) Moringa oleifera Celosiaargentea),

Evaluation of chickpea genotypes against blight and wilt diseases

Induced systemic resistance studies in chickpea through plant extracts and salicylic acid

Survey of rice growing areas of Punjab for occurrence of different diseases

Pathodiversity of pv. ( ) and evaluation of rice genotypes against BLB

Studies on yellow and leaf rust in wheat

Fusarium

Xanthomonas oryzae oryzae Xoo

Rice crop with BLB Brown spot Sheath blight Grain discoloration

Plant Protection

Leaf rust of wheat

23

Annual Report 2012Technical Services

V. Technical Services Division

An off-season vegetable tunnel (5500 Sqft) was constructed for tomato hybrid research programme. Three Labs

were repaired/repainted. Facility for mushroom growth was prepared.

Technical Services Division facilitated research divisions and supporting departments in terms of electric supply,

water supply/sanitation, sui-gas supply, HVAC and R&M of Equipments, etc. Fifteen scientific events (training

courses, workshops and formers day) were facilitated. Five houses of residential colony were renovated. Major

R&M work of rest house is in progress. Street lights have been installed on the side of officers hostel.

Scientist/Engineer of Technical Services Division

A view of tomato tunnel

24

Annual Report 2012Impact

VI. IMPACT

Cotton:

Rice:

Chickpea:

Mungbean and Lentil:

Low Seeded Kinnow:

Biosaline Agriculture Technology:

Biological Control of Insect Pests:

Food Toxicology:

Livestock and Meat Production:

NIAB provided a total of 1340 kg cotton seed of approved varieties (NIAB-852, NIAB-777, NIAB-846 andNIAB-111) to different stakeholders including seed companies for multiplication on about 350 acres. Seed ofcandidate varieties measuring 225 kg was provided to 58 farmers/seed companies for adaptability studies inPunjab and Sindh. NIAB cotton varieties improved the farmer's income. NIAB generated an amount of Rs. 0.46million through sale of experimental cotton produce.

NIAB supplied about 300 kg pre-basic seed of Niab-Irri-9 variety to PSC and farmers that covered 39thousand hectares and replaced both coarse varieties grown in Punjab. This variety got high price than othersdue to its fine and translucent grain characteristics. PSC procured 23 tonnes paddy of Niab-Irri-9 (10.4% of total200 tonnes target) for multiplication and distribution to farmers. Maintenance of Kashmir Basmati, evolved forAzad Jammu and Kashmir, was continued at NIAB farm for its purity.

NIAB produced 1500 kg seed of approved varieties (CM-2008 and CM-98) for supply to seedcorporations and farmers. Variety CM-2008 was grown on 32 acres at PSC Farm that produced quality seed byyielding 13 maunds per acre. PSC produced 6465 kg seed of CM-2008 for multiplication and supply to thefarmers. NIAB varieties shared about 10% of the total area in Punjab. NIAB developed biochemical markers forearly assessment of effectiveness and superiority of EMS/gamma irradiation to induce mutations in chickpea.

A total of 847 kg seed of NM-2006 and NM-2011 was supplied to PSC and progressivegrowers. PSC planted these varieties on an area of 3021 acres and sold 29659 kg seed. A total of 315 kg seed ofNIAB Masoor-2002 and NIAB Masoor-2006 was produced for supply to the farmers.

NIAB provided 1419 LSK plants for multiplication to Punjab Agriculture and Meat Company(PAMCO), Lahore and progressive farmers and earned Rs. 0.21 million.

NIAB improved a block of 100 acre saline soil at BSRS, Pakka Anna forcultivation of salt tolerant trees, forages and crops and generated Rs. 1.5 million by sale of different producedcommodities. Physiological and biochemical markers have been identified to select stress tolerant cropgermplasm.

Foliar application of 2,4-D and salicylic acid (10 mg/L each) and 2n+K (0.25% Zn as Zn SO and 0.25% K as K SO )reduced the fruit drop in Kinnow and increased yield up to 30%. Fungal inoculation ofincreased Jatti Khatti ( ) stem rootstock propagation by 50% for grafting. NIAB designed andfabricated a drill applicator for subsurface placement of liquid P fertilizer along with seed. Liquid phosphoric acidwas found better than commercial fertilizers (DAP & TSP) in wheat, maize and rice. Acidic urea sulphate insolution form was better source of N in wheat, maize, and cotton than urea alone. Broadcasting urea with ureaseinhibitor 'NBPT' saved 25% urea and resulted in increased wheat yield. Re-scheduled irrigation in wheat saved 25% water without significant yield loss.

Bio-control based IPM programme at NIAB saved 5-6 extra insecticide sprays inokra, cauliflower and tomato by controlling insect pests below their ETLs. This programme included also thejudicial use of modern insecticides (new chemistry) to save beneficial insects than conventional toxicinsecticides. Field trials on 39 pesticides from different companies generated receipt of Rs. 0.39 million.

Studies on detoxification of aflatoxins in different foods and insecticides residue tests werecontinued. Aflatoxins were reduced in chili (99 %) with 0.3 % citric acid. Provided analytical services to 565 foodexporting industries for a receipt of Rs. 3.41 million.

A total of 0.5 million doses of NIAB HS Vaccine that is very effective againstHemorrhagic Septicemia Disease in cattle (about 1% animals of Pakistan) was produced and marketed throughATCOP. NIAB has established sero-typing assays and molecular investigation methods for foot and mouth diseasevirus (FMDV).

NIAB is focusing on farmers interest to increase the production of meat from sheep and goats on forage biomasson salt-affected soils. This endeavor gave Rs. 0.45 million through sale of 47 animals. To enhance milk of largeanimals the institute provided 5000 NIAB feed blocks (2 kg each) to the farmers.

4 2 4

Trichoderma harzianumCitrus jambhiri

25

Annual Report 2012Publications

VI. PUBLICATIONS

1. Ahmad, I., M. S. A. Ahmad, M. Hameed, M. Hussain, M. Y. Ashraf, M. Farooq and H. Malik. 2012. Status of

plant diversity in the soone valley, salt range, Pakistan. Pak. J. Bot., 44: 59-62.

2. Ahmad, Z., S. Tahir, S. Bahadur and M. Amanullah. 2012. Physiological and molecular response of wheat

to soil applied encapsulated calcium carbide under salinity stress. J. Plant Nutrition, 35: 874-888.

3. Ahmed, Z., M. A. Sheikh, A. Hameed and S. Din. 2012. Investigation of antioxidant enzymes and

biochemical changes in the wheat seeds (freed) induced by different pre-sowing treatments. World

Applied Sciences Journal, 18 (1): 31-36.

4. Akhter, J. and P. Monneveux. 2012. Crop productivity and water use efficiency: the role of carbon isotope

discrimination technique. In: Crop Production for Agriculture Improvement (eds., Ashraf, M., Oztruck,

M., Aksoy, A., Ahmed, M. S. A.) Springer, Netherland pp: 395-416.

5. Akhter, J., S. A. Sabir, B.M. Atta, Y. Ali and Z. Lateef. 2012. Carbon isotope discrimination as a selection tool

for high yielding wheat genotypes for water limited environments. IAEA-TECDOC-1671:109-124.

6. Akhtar, K. P., G. Sarwar, G. Abbas, M. J. Asghar, N. Sarwar and M. Hameed. 2012. Mungbean phyllody

disease in Pakistan: its symptomatology, transmission, varietal response and effect on morphology &

yield traits of mungbean plants. Int. J. Pest Management, 58 (2): 139-145.

7. Akhtar, K. P., M. Y. Saleem, M. Asghar, S. Ali, N. Sarwar and M. T. Elahi. 2012. Resistance of

species to evaluated in the detached-leaf and whole-plant assays. Pak. J. Bot., 44

(3): 1141-1146.

8. Akhtar, M., F. Hussain, M. Y. Ashraf, T. M. Qureshi, J. Akhter and A. R. Awan. 2012. Influence of salinity on

nitrogen transformations in soil. Comm. Soil Science and Plant Analysis, 43: 1674–1683.

9. Akhtar, M. and A. Naeem. 2012. Reduction in ammonia loss by applying urea in combination with

phosphate sources. Comm. Soil Science and Plant Analysis, 43: 2043-2049.

10. Akram, M., S. Farooq, M. Ashraf, R. Arshad, M. Afzaal and F. Azam. 2012. Detecting differences in wheat

for salt tolerance through multi parameters evaluation-II: Physiological parameters. Pak. J. Bot, 44(5):

1533-1541.

11. Ali, H., M. A. Haq, T. M. Shah, M. Rahman and W. Chen. 2012. Validation of molecular markers for

resistance among Pakistani chickpea germplasm to races of f. sp. . European

Journal of Plant Pathology (Published online DOI 10.1007/s10658-011-9868-1) 132: 237–244.

12. Ali, H., S. S. Alam, R. Attanayake, M. Rahman and W. Chen. 2012. Population structure and mating type

distribution of the chickpea blight pathogen from Pakistan and the United States.

Journal of Plant Pathology, 94 (1): 99-108.

13. Ashraf, M. Y., M. Yaqub, J. Akhtar and M. A. Khan. 2012. Control of excessive fruit drop and improvement

in yield and juice quality of kinnow ( X ) through nutrient management. Pak. J.

Bot., 44: 2659-2665.

14. Ashraf, M. Y., A. R. Awan and K. Mahmood. 2012. Rehabilitation of saline ecosystems through cultivation

of salt tolerant plants. Pak. J. Bot. 44: 69-75.

15. Ashraf, M. Y., K. Mahmood, M. Ashraf, J. Akhter and F. Hussain. 2012. Optimal supply of micronutrients

improves drought tolerance in legumes. , (eds. Ashraf,

M., M. Ozturk, M. S. A. Ahmad), DOI 10.1007/978-94-007-4116-4_25, © Springer Science+Business

Media B.V. pp. 637-657.

16. Asi, M. R., S. Z. Iqbal, A. Arino and A. Hussain. 2012. Effect of seasonal variations and lactation times on

aflatoxin M contamination in milk of different species from Punjab, Pakistan. Food Control, 25: 34-38.

17. Sarwar, G., M. Hassan and A. Hussain. 2012. Genotypic × environment interaction of castor grown over

multiple years. Proc. 12 National and 3 International Conf. of Botany Sept. 1 to 3 , 2012, Quaid-e-

Solanum

Phytophthora infestans

Fusarium oxysporum ciceris

,

Ascochyta rabiei

Citrus deliciosa Citrus nobilis

In: Crop Production for Agricultural Improvement

1

th rd st rd

26

Annual Report 2012Publications

Azam University, Islamabad, pp. 25-26.

18. Haidar, S., M. Aslam, H. M. Hussan, M. Hassan and A. Ditta. 2012. Genetic diversity among upland cotton

genotypes for different economic traits and response to cotton leaf curl virus (CLCV) disease. Pakistan

Journal of Botany, 44 (5): 1779-1784.

19. Hameed, A., A. Saddiqa, S. Nadeem, N. Iqbal, B. M. Atta and T. M. Shah. 2012. Genotypic variability and

mutant identification in L. by seed storage protein profiling. Pak. J. Bot., 44 (4): 1303-

1310.

20. Hameed, A., M. Goher and N. Iqbal. 2012. Heat stress induced cell death, changes in antioxidants, lipid

peroxidation and protease activity in wheat leaves. Journal of Plant Growth Regulation, 31(3): 283-291.

(DOI 10.1007/s00344-011-9238-4.

21. Hassan, M. and A. Rashid. 2012. Zinc biofortification of wheat to combat low productivity and

malnutrition. Nuclear Institute for Agriculture & Biology, Faisalabad. pp.6.

22. Hassan, M., A. Rashid and I. Cakmak. 2012. Improvement in flag leaf area of wheat by zinc application: Its

Effect on Yield and Grain-Zinc Concentration. Proc. 12 National and 3 International Conf. of Botany

Sept. 1 to 3 , 2012, Quaid-e-Azam University, Islamabad. pp. 39.

23. Hussain, D., A. Ali, M. M. Hassan, S. Ali, M. Saleem and S. Nadeem. 2012. Evaluation of toxicity of some

new chemistry insecticides to egg parasitoid (Ishii) (Hymenoptera:

Trichogrammitidae). Pakistan J. Zool., 44 (4): 1123-1127.

24. Hussain, H. N., S. A. Khanum and M. Hussain. 2012. Growth kinetics of isolated

from Nili Ravi Buffalo ( ). The Journal of Animal and Plant Sciences, 22 (3): 335-338.

25. Hussain, H. N., S. A. Khanum, M. Hussain, A. Shakur and F. Latif. 2012. Effect of fibrolytic enzymes

produced from an improved mutant of on the performance of Beetal-

Dwarf crossbred goat. Pak Vet. Journal, (accepted)

26. Hussain, M. and C. M. Fauquet. 2012. Development and validation of molecular screening system for

cotton leaf curl disease. One day national seminar on cotton leaf curl virus disease held at CCRI, Multan

on February 24, 2012. (Abstract Published).

27. Hussan, M., F. M. Azhar, A. A. Khan and Z. Ali. 2012. Expression of genes controlling the inheritance of

resistance to cotton leaf curls virus disease (CLCuD) in L.: A quantitative analysis,

Pak. J. Bot. 44 (1): 247-254.

28. Iqbal, N., A. Tabasum, A. Hameed, M. Akram, M. Afzaal and R. Arshad. 2012. Evaluation of stem reserve

utilization in Pakistani wheat genotypes under post anthesis chemical desiccation stress. Pak. J. Bot.,

44(4): 1363-1367.

29. Iqbal, Q., M. Amjad, M. R. Asi and A. Arino. 2012. Mold and aflatoxin reduction by gamma radiation of

packed hot peppers and their evolution during storage. Journal of Food Protection, 75 (8): 1528-1531.

30. Iqbal, S. Z., I. A. Bhatti, M. R. Asi, M. Shahid and M. Zuber. 2012. Effect of gamma irradiation on fungal load

a n d a f l a t ox i n s r e d u c t i o n i n r e d c h i l l i e s . R a d i a t i o n P hy s i c s a n d C h e m i s t r y

( ).

31. Iqbal, S. Z., M. R. Asi, A. Ariño and A. Hussain. 2012. Aflatoxin contamination in different fractions of rice

from Pakistan and estimation of dietary intakes. Mycotoxin Research, 28: 175-180.

32. Iqbal, S. Z., M. R. Asi, and A. Arino. 2012. A chapter was written on AFLATOXINS IN Brenner's Online

Encyclopedia of Genetics, 2nd edn., Article No. GNT2 00022, 1-6.

33. Iqbal, Z., M. Yaqub, A. Lodhi, S. Tahir, M. Akhtar, T. M. Qureshi and A. Naeem. 2012. Evaluation of urea

phosphate as a P source for wheat crop in comparison to DAP in a calcareous soil. Int. J. Biol. Biotech., 9

(3): 219-223.

34. Jahan, N., K. U. Rehman, S. Ali, M. R. Asi and I. Akhtar. 2012. Cardioprotective potential of

Cicer arietinum

Trichogramma chilonis

Pasteurella multocida

Bubalus Bubalis

Chaetomium thermophile DG-76

Gossypium hirsutum

th rd

st rd

http://dx.doi.org/10.1016/j.radphyschem.2012.09.015

27

Annual Report 2012

Gemmomodified extract of against chemically induced myocardial injury in rabbits.

Pak. Vet. J., 32 (20): 255-259.

35. Kamran, M. A. and G. P. Shivakoti. 2012. Design principles in tribal and settled areas spate irrigation

management institutions in Punjab, Pakistan. Asia Pacific Viewpoint. (Accepted).

36. Kamran, M. A. and G. P. Shivakoti. 2012. Local risk perceptions to identify institutional and development

planning needs. Development in Practice. (Accepted).

37. Kausar, A., M. Y. Ashraf, I. Ali, M. Niaz and Q. Abbass. 2012. Evaluation of sorghum varieties/lines for salt

tolerance using physiological indices as screening tool. Pak. J. Bot., 44: 47-52.

38. Kazmi, S. I., M. W. Ertsen and M. R. Asi. 2012. The impact of conjunctive use of canal and tube well water

in Lagar irrigated area, Pakistan. Physics and Chemistry of the Earth, Part A/B/C, 46-48: 86-98.

39. Khan, E. U., X. Z. Fu and J. H. Liu. 2012. -mediated genetic transformation and regeneration

of transgenic plants using leaf segments as explants in Valencia sweet orange. Plant Cell Tissue and Organ

Culture, 109: 383-390.

40. Khanum, S. A., M. Hussain, L. Jabbar, R. Kausar, A. M. Cheema and M. A. Jabbar. 2012. Effect of

concentrate supplementation on age at maturity in growing buffalo heifers. The Journal of Animal and

Plant Sciences, 22(3 Suppl.): 329-331.

41. Shah, M. S., A. Ashraf, M. Rahman, M. I. Khan and J. A. Qureshi. 2012. A subunit vaccine against

hydropericardium syndrome using adenovirus penton capsid protein. Vaccine, 30: 7153-7156

42. Mahjabeen, K. P., N. Akhtar, M. Y. Sarwar, M. Saleem, Q. Asghar, Q. Iqbal and F. F. Jamil. 2012. Effect of

cucumber mosaic virus infection on morphology, yield and phenolic contents of tomato. Archives of

Phytopathology and Plant Protection, 45 (7): 766-782.

43. Nadeem, S., M. Hamed, M. K. Nadeem, M. Hasnain, B. M. Atta, N. A. Saeed and M. Ashfaq. 2012.

Comparative study of developmental and reproductive characteristics of (Stephens)

(Neuroptera: Chrysopidae) at different rearing temperatures. J. Animal Plant Sci., 22 (2): 399-402.

44. Nazir, S., K. P. Akhtar, N. Sarwar, M. Y. Saleem, M. Asghar, Z. Siddique and F. F. Jamil. 2012. Biochemical

basis of resistance in tomatoes against shoestring disease caused by . Archives of

Phytopathology and Plant Protection, 45 (11): 1304-1318.

45. Qamar, Z. U., J. Akhtar, M. Y. Ashraf, S. A. Sabir and W. Ishaq. 2012. Use of carbon isotope discrimination

technique to sustain rice productivity under stressed and low land irrigated ecosystem of Pakistan. Pak. J.

Bot., 44: 85-93.

46. Rashid, M., H. Guangyuan, Y. Guanxiao, J. Hussain and Y. Xu. 2012. AP2/ERF transcription Factor in rice:

Genome-wide canvas and syntenic relationships between monocots and eudicots. Evolutionary

Bioinformatics, 8: 321-355.

47. Sarwar M. K. S., M. Y. Ashraf, M. U. Rahman and Y. Zafar. 2012. Genetic variability in different biochemical

traits and their relationship with yield and yield parameters of cotton cultivars grown under water stress

conditions. Pak. J. Bot. 44: 515-520.

48. Shah, T. M., B. M. Atta, M. A. Haq and J. I. Mirza. 2012. Radio sensitivity of various chickpea genotypes in

M generation II-field studies. Pak. J. Bot., 44 (2): 631-634.

49. Shahzad, M. A., M. Maqsood, S. Iqbal, M. Saleem, M. Hassan and W. Ahmad. 2012. Impact of nitrogen

nutrition and moisture deficit on growth, yield and radiation use efficiency of wheat (

L.). African J. Bio. & Biotech. 11 (3): 13980-13987.

50. Shehzad, M.A., M. Maqsood, S. Iqbal, M. Saleem, M. Hassan and W. Ahmad. 2012. Impact of nitrogen

nutrition and moisture deficits on growth, yield and radiation use efficiency of wheat (

L.). Afric. J. Biotech. 11 (75): 13980-13987.

51. Sarwar, M., X. Xuenong and W. Kongming. 2012. Suitability of webworm L.

Terminalia arjuna

Agrobacterium

Chrysoperla carnea

cucumber mosaic virus

Triticumaestivum

Triticumaestivum

Loxostege sticticalis

1

Publications

28

Annual Report 2012

(Lepidoptera: Crambidae) eggs for consumption by immature and adults of the predatory mite

(Xin, Liang and Ke) (Acarina: Phytoseiidae), Spanish Journal of

Agricultural Research, 10 (3): 786-793.

52. Sarwar, M. 2012. Effects of potassium fertilization on population build up of rice stem borers

(lepidopteron pests) and rice ( L ) yield, Journal of Cereals and Oilseeds, 3 (1): 6-9.

53. Sarwar, M. 2012. Study on the non aromatic rice ( L.) varietals resistance to rice stem borers

(Lepidoptera: Pyralidae) and yield factors, International journal of Agronomy and Plant Production, 3 (5):

159-163.

54. Sarwar, M. 2012. Management of rice stem borers (Lepidoptera: Pyralidae) through host plant resistance

in early, medium and late plantings of rice ( L ), Journal of Cereals and Oilseeds, 3 (1): 10-14.

55. Sarwar, M. 2012. Frequency of Insect and mite Fauna in Chilies L., Onion L.

and Garlic L. Cultivated Areas, and their Integrated Management, International journal of

Agronomy and Plant Production, 3 (5): 173-178.

56. Sarwar, M., N. Ahmad, M. Bux and M. Tofique. 2012. Potential of Plant Materials for the Management of

Cowpea Bruchid (Coleoptera: Bruchidae) In Gram during Storage.

The Nucleus, 49 (1): 61-64.

57. Sarwar, M. 2012. Management of aromatic rice ( L.) genotypes using varietal resistance

against the prevalence of rice stems borers. International journal of Agronomy and Plant Production, 3

(8): 295-299.

58. Sarwar, M. and M. Sattar. 2012. Appraisal of Different Plant Products against

Everts to Protect Stored Wheat- A Laboratory Comparison. The Nucleus, 49 (1): 65-69.

59. Sarwar, M. 2012. Assessment of resistance to the attack of bean beetle

(Fabricius) in chickpea genotypes on the basis of various parameters during storage. The Songklanakarin

Journal of Science and Technology, 34 (3): 287-291.

60. Sarwar, M. and M. Ashfaq. 2012. Studies on taxonomy of a new mite species in the genus

berlese (Acarina: Acaridae) recognized in Pakistan. Journal of Cereals and Oilseeds, 3 (2): 15-20.

61. Sarwar, M. 2012. Competency of Natural and Synthetic Chemicals in Controlling Gram Pod Borer,

(Hubner) on Chickpea Crop. International Journal of Agricultural Sciences, 2

(4):132-135.

62. Sarwar, M. and M. Ashfaq. 2012. An Undescribed Mite of Genus Berlese (Acarina: Acaridae)

Collected From Oriental Region, Pakistan. Biological Diversity and Conservation, 5 (2): 1-6.

63. Zaheer, A., S. Deho, S. Laghari, M.A. Abro, M. Arain, M. Hussain, S. A. Abro and Fakhruddin. 2012. Effect of

picking dates on seed germination, GIN turn-out, seed index and staple length in L.

Pak. J. Bot., 44 (1): 135-137.

64. Zia-ul-Qamar, J. Akhtar, M. Ashraf, M. Akram and A. Hameed. 2012. A multivariate analysis of rice genetic

resource. Pak. J. Bot., 44 (4): 1335-1340.

65. Zou, C. Q., Y. Q. Zhang, A. Rashid, H. Ram, E. Savasli, R. Z. Arisoy, I. Ortiz, Monasterio, S. Simunji, Z. H.

Wang, V. Sohu, M. Hassan, Y. Kaya, O. Onder, O. Lungu, M. Y. Mujahid, A. K. Joshi, Y. Zelenskiy, F. S. Zhang, I.

Cakmak. 2012. Biofortification of wheat with zinc through zinc fertilization in seven countries. Plant

&Soil, 361:43-55.

Neoseiulus pseudolongispinosus

Oryza sativa .

Oryza sativa

Oryza sativa .

Capsicum annum Allium cepa

Allium sativum

Callosobruchus analis Cicer arietinum

Oryza sativa

Trogoderma granarium

Callosobruchus maculatus

Caloglyphus

Helicoverpa armigera

Caloglyphus

Gossypium hirsutum

Publications

29

Annual Report 2012

VI. APPENDICES

i. Funded Research Projects

Title of the Project SourceFunds

(Rs.M)

Principal

Investigator

Strengthening capabilities to monitor and control veterinary

drug residues in food stuffs

IAEA 18 Dr. Uzma Maqbool

Improvement in nutrient and water use efficiency under

mulch based cropping system

IAEA 2.013 Mr. Wajid Ishaque

Breeding for high yielding long grain rice with adaptation to

high temperatures

IAEA 1.092 Dr. Muhammad

Ashraf

Molecular epidemiology and control of foot and mouth

disease in Pakistan

IAEA 0.96 Dr. Mudasser Habib

HarvestPlus zinc fertilizer project Sabanci Uni.

Turkey

4.00 Dr. Khalid Mahmood

Improvement of chickpea productivity through the

identification of drought tolerant and disease resistant

chickpea genotypes for marginal lands

PARB 19.840 Dr. Tariq M. Shah

Improvement of lentil germplasm for high seed yield and

disease resistance

PARB 15.119 Dr. M. Jawad Asghar

Evaluation of Phosphoric acid as an alternative to

commercial phosphoric fertilizer and enhancing its efficiency

for higher crop productivity

PARB 13.931 Dr. Muhammad

Akhtar

Control of bacterial leaf blight (BLB) in rice through

management and resistant varieties

PARB 10.485 Hafiz M. Imran

Arshad

Integrated Pest Management (IPM) of insect pests on okra

and brinjal with emphasis on biological control

MINFA 21.398 Dr. Muhammad

Hamed

Improvement of low phytate Basmati rice PSF 2.50 Dr. Zia-ul-Qamar

Improvement in water use efficiency and productivity of

wheat through potassium nutrition management in salt

affected soil (Approved)

IPI 5.052 Dr. M Yasin Ashraf

Isolation characterization and bioremediation potential of

the EPS producing biofilm bacteria from brackish and

polluted irrigation waters (Approved)

PSF 2.000 Dr. M Ashraf

Improvement in yield and salt tolerance potential through

potash fertilizer (SOP) in wheat & rice on salt-affected soils

(Completed)

BELGIUM 2.700 Dr. M Yasin Ashraf

Enhancing crop water productivity with improved

irrigation/management practices involving isotopic

techniques (Completed)

IAEA 2.016 Dr. Khalid Mahmood

Evaluation of nitrification inhibitors for reducing nitrogen loss

under irrigated cotton-wheat system using15

N- balance

technique (Completed)

PARC/ALP 5.557 Dr. Tariq Mahmood

Studying the role of anti-oxidant enzymes in controlling

programmed cell death (PCD) triggered in plants in response

of exogenous stress (Completed)

PSF 1 Dr. Amjad Hameed

Appendices

30

Annual Report 2012

Submitted Research Projects

Appendices

Title of the Project Source Funds

(Rs.M)

Principal

Investigator

Improving nutrient use efficiency by chemical amendment of

biogas slurry

IAEA 1.112 Dr. M. Akhtar

Nutrient management of wheat and mungbean genotypes

for high crop productivity in degraded semi-arid soils

-do- 1.112 Dr. M. Yasin

Ashraf

Managing saline irrigation water involving isotopic

techniques for sustainable food/feed and fuel production on

salt-affected soils in semi-arid environments

-do- 1.112 Dr. Khalid

Mahmood

Traceability as an approach to control food contaminants and

improve food quality

-do- 1.15 Dr. M. Rafiue

Asi

Screening and development of heat tolerant germplasm in

wheat (Triticum aestivum L.) using conventional,

physiological, biochemical and biometrical approaches

IFS 1.176 Mr. Sajid

Shokat

Management of important diseases of chickpea using plant

extracts un-treated and treated with gamma radiation

Great

Challenges

Explorations,

USA

9.1 Dr. Nighat

Sarwar

Development of DNA vaccine against Hydropericardium

syndrome

IFS 1.2 M. Salah-ud-

Din Shah

Bio-efficacy of plant extracts to control important fungal

diseases of tomato plant and fruits

ALP 6 Dr. Nighat

Sarwar

Bio-fortification of Rice Cultivar “Basmati-515” by Back Cross

Breeding

-do- 8 Dr. Zia-ul-

Qamar

Development of cost effective and potential bio-control

agents for area wide management of sucking pests in Bt

cotton

PSF 2.0 Dr. Nazia

Suleman

Quantification of Tennins in trees leaves, shrubs and

common feed stuffs and measures to reduce their toxic

effect in livestock feeding

PSF 3.2 Dr. Shahnaz

A. Khunam

Induction of resistance in tomato against important early &

late blight and CMV diseases, using environment friendly

chemicals and plant extracts

-do- 2 Dr. Nighat

Sarwar

Biochemistry of disease resistance to leaf curl virus in cotton -do- 2.854 Dr. S. Sarwar

Alam Anjum

Development of high yielding wheat genotypes for water

limited conditions

PARB 13.699 Dr. Javed

Akhtar

Development of soluble mixed fertilizer and its application

through drip irrigation

-do- 9.687 Mr. Zafar

Iqbal

Control of excessive fruit drop in citrus and improvement in

yield quality through management of plant nutrients and

growth regulators

-do- 25 Dr. M Yasin

Ashraf

31

Annual Report 2012Appendices

ii. Farmers' days organized during 2012

Framers' visiting Chickpea field

32


iii. Training Courses and Workshops conducted during 2012

33


34


iv. Scientists/Administration

Dr. Javed Akhtar, DCS/Director

Plant Breeding & Genetics

Division Mr. Noor Abid Saeed, JS Technical Services Division

Dr. Tariq Mahmud Shah, PS/HoD Mr. Kamran Saleem, JS Mr. Masood-ul-Hasan, PE/HoD

Dr. S.M. Sarwar A. Anjum, DCS Soil Science Division Mr. Arfan Waheed, PS

Dr. (Ms.) Nasim Akhtar, DCS Dr. Khalid Mahmood,

DCS/HoD

Mr. Naeem Ahmad, SS*

Dr. Manzoor Hussain, PS Dr. Tariq Mahmood, DCS Mr. Jafar Hussain, SS

Dr. M. Yussouf Saleem, PS Mr. ZafarIqbal, DCS Dr. Muhammad Asif Kamran, SS

Dr. Rubina Arshad, PS Dr. M. Yasin Ashraf (T.I), DCS Mr. Muhammad Akram, ARO

Dr. Muhammad Asghar, PS Dr. Asma Hassan, PS Administration

Ms. Hina Ali, PS Dr. Muhammad Ashraf, PS Mr. Sajjad Mahmud, PA d

Dr. Muhammad Rashid, PS Dr. Muhammad Akhtar, PS Lt. Col. (Retd) Abrar Hussain Shah

OC FSSU

Dr. Ehsan Ullah Khan, PS Mr. Abdul Rasul Awan, PS Mr. Rashid S. Awan, SAO/HLAO

Dr. Sajjad Haider, PS Miss. Asia Gulnaz, SS Mr. Muhammad Asif, SL/SAdO

Mr. Babar Manzoor Atta, SS* Dr. Zafar Iqbal, SS Mr. Tahir Mahmood, Supt (Admin)

Mr. M. Kashif Riaz Khan, SS* Mr. Muhammad Yaqub, SS Mr. M. Riaz Kausar, AAO

Mr. Mahmood-ul-Hassan, SS Dr. Muhammad Saleem, SS

Dr. Zia-ul-Qamar, SS Dr. Rehmat Ali, SS** Abbreviations

Dr. Amjad Hameed, SS Dr. Tariq M. Qureshi, SS/FM DCS: Deputy Chief Scientist

Dr. Muhammad Ashraf, SS Ms. Um-e-Robab, SS* PS: Principal Scientist

Mr. Ghulam Abbas, SS Mr. Muhammad Rizwan, SS PE: Principal Engineer

Dr. M. Jawad Asghar, SS Mr. Wajid Ishaque, SS SS: Senior Scientist

Ms. Noreen Bibi, JS* Ms. Shermeen Tahir, SS JS: Junior Scientist

Mr. Abdul Rehman Khan, JS* Mr. Asif Naeem, JS ARO: Assistant Research Officer

Dr. Qumer Iqbal, JS Dr. Muhammad Atif Riaz, JS FM: Farm Manager

Ms. Aqsa Tabasum, JS* Mr. Sajid Shokat, JS PAd: Principal Administrator

Hafiz Mumtaz Hassan, JS Mr. Sabir Ali Sabir, ARO SAdO: Senior Admin. Officer

Plant Protection Division Animal Sciences Division SAO: Senior Accounts Officer

Dr. Muhammad Hamed,

DCS/HoD

Dr. Shahnaz A. Khanum,

DCS/HoD

HLAO: Head, Local Account Office

Dr. Nighat Sarwar, DCS Mr. Mujahid Hussain, PS AAO: Assistant Accounts Officer

Dr. Sajid Nadeem, PS Dr. Shahid Nadeem, PS Supt: Superintendent

Dr. Muhammad Sarwar, SS Dr. Uzma Maqbool, PS HoD: Head of Division

Dr. Nazia Suleman, SS Ms. Rehana Kausar, SS * on study leave

Mr. Rashid Ahmad Khan, SS* Dr. Mudasser Habib, SS ** on post-doctoral studies

Ms. Asia Riaz, SS Mr. M. Ismail Chughtai, SS

Dr. M. Rafique Asi, SS Mr. M. Salah-ud-Din Shah, JS

Ms. Sumaira Yousaf, SS Ms. Shumaila Yousaf, JS

Mr. Khalid Pervaiz Akhtar, SS Hafiz Noubahar Hussain, JS

Hafiz M. Imran Arshad, SS Mr. Tarique Hussain, JS

35

Annual Report 2012

v. Promotions

From To On

1. Dr. S.M. Sarwar A. Anjum Pr. Scientist Dy. Chief Scientist 01-12-2012

2. Dr. (Ms.) Nasim Akhtar Pr. Scientist Dy. Chief Scientist 01-12-2012

3. Dr. Muhammad Rashid Sr. Scientist Pr. Scientist 01-12-2012

4. Mr. Abdul Rasul Awan Sr. Scientist Pr. Scientist 01-12-2012

5. Dr. Ehsan Ullah Khan Sr. Scientist Pr. Scientist 01-12-2012

6. Dr. Sajjad Haider Sr. Scientist Pr. Scientist 01-12-2012

7. Dr. M. Asif Kamran Jr. Scientist Sr. Scientist 01-12-2012

8. Mr. M. Ismail Chughtai Jr. Scientist Sr. Scientist 01-12-2012

vi. Transfers/Postings

From To On

1. Ms. Sadia Mahboob, JS NIAB, Faisalabad NIBGE, Faisalabad 02-04-2012

2. Mr. Rashid Shahzad Awan,

Sr. Accounts Officer/Head

LAO

LINAR, Larkana NIAB, Faisalabad 07-05-2012

3. Dr. Nayyer Iqbal,

Pr. Scientist

NIAB, Faisalabad Agri. & Biotech Div.

PAEC, Islamabad

01-07-2012

4. Mr. Sajid Azmat,

Sr. Accounts Officer

NIAB, Faisalabad NIBGE, Faisalabad 06-07-2012

5. Dr. Nazia Suleman, Sr.

Scientist

NIA, Tandojam NIAB, Faisalabad 23-08-2012

6. Dr. Aaysha Tariq, Sr.

Medical Officer

NIAB, Faisalabad PINSTECH Complex

Hospital,

Islamabad

05-10-2012

7. Mr. Ghulam Mustfa, Sr.

Engineer

NIAB, Faisalabad Carbon Graphite

Project, STP,

Kundian

08-10-2012

vii. Retirements

Date

1. Mr. Bakhshish Jilani, Sr. Accounts Officer/Head LAO 04-05-2012

2. Mr. Ghulam Sarwar, Deputy Chief Scientist/HoD 14-09-2012

3. Mr. Muhammad Hanif, Superintendent 01-11-2012

viii.Resignation

1. Dr. Bilal Rasool, Jr. Scientist 05-09-2012

Appendices

36

Annual Report 2012

A Farewell get together in the honor of Dr. Yusuf Zafar (Ex DG A&B, PAEC HQ)

Dr. Ansar Parvez, Chairman PAEC visiting NIAB fields Dr. Kwaku Aning, DDG IC, IAEA wasbriefed about R&D activities of NIAB

Dr. Noor-ul-Islam, DG AARI visiting LSK Orchard

Director NIAB briefing Dr. R.L.Wijayawardana, Chairman Atomic Energy

Authority, Sri Lanaka about the achievements

Mr. Abdul Hai, MD ATCOP visitingvaccine development lab.

Dr. Yusuf Zafar, DG A&B PAEC HQinaugurated the harvesting of Wheat

Appendices

37

Annual Report 2012

Dr. Muhammad Imtiaz, Chickpea Breeder ICARDA visiting Chickpea field

(L to R) Dr. Muhammad Amjad, Director Horticulture and Prof. Dr. Iqrar A. Khan, VC UAF

are presenting trophy on 1 and 3 position respectively in Flower Exhibitionsst rd

Appendices

38

Annual Report 2012

Celebrating 40 Anniversary of NIABth

Appendices

39

Annual Report 2012

Scientific and Administrative officers of NIAB with Director

Appendices

Administration Accounts

40


NIAB, P.O.Box 128, Jhang Road, Faisalabad

Tel: 0092 41 2654210; 9201751-69; Fax: 9201776

Email: [email protected]

Web: www.niab.org.pk

Nuclear Institute for Agriculture and Biology

annual report 2012 final · eas electronic attendance system ppd plant protection division ec...

Documents