anolis heterodermus

Seediscussions,stats,andauthorprofilesforthispublicationat:http://www.researchgate.net/publication/265249772

UnknownEvolutionaryLineagesandPopulationDifferentiationinAnolisheterodermus(Squamata:Dactyloidae)fromtheEasternandCentralCordillerasofColombiaRevealedbyDNASeq...

ARTICLEinSOUTHAMERICANJOURNALOFHERPETOLOGY·SEPTEMBER2014

DOI:10.2994/SAJH-D-13-00013.1

CITATION

1

READS

99

2AUTHORS:

MarioVargas-Ramírez

MuseumofZoologySenckenbergDresden

30PUBLICATIONS184CITATIONS

SEEPROFILE

RafaelA.Moreno-Arias

NationalUniversityofColombia

18PUBLICATIONS12CITATIONS

SEEPROFILE

Availablefrom:MarioVargas-Ramírez

Retrievedon:17October2015

http://www.researchgate.net/publication/265249772_Unknown_Evolutionary_Lineages_and_Population_Differentiation_in_Anolis_heterodermus_%28Squamata_Dactyloidae%29_from_the_Eastern_and_Central_Cordilleras_of_Colombia_Revealed_by_DNA_Sequence_Data?enrichId=rgreq-296bd0ea-4eb1-498d-a134-8cda5efc6b8b&enrichSource=Y292ZXJQYWdlOzI2NTI0OTc3MjtBUzoxMzcwMzM4MzgyMzk3NDRAMTQwOTY4MjgyMTM4Nw%3D%3D&el=1_x_2

http://www.researchgate.net/publication/265249772_Unknown_Evolutionary_Lineages_and_Population_Differentiation_in_Anolis_heterodermus_%28Squamata_Dactyloidae%29_from_the_Eastern_and_Central_Cordilleras_of_Colombia_Revealed_by_DNA_Sequence_Data?enrichId=rgreq-296bd0ea-4eb1-498d-a134-8cda5efc6b8b&enrichSource=Y292ZXJQYWdlOzI2NTI0OTc3MjtBUzoxMzcwMzM4MzgyMzk3NDRAMTQwOTY4MjgyMTM4Nw%3D%3D&el=1_x_3

http://www.researchgate.net/?enrichId=rgreq-296bd0ea-4eb1-498d-a134-8cda5efc6b8b&enrichSource=Y292ZXJQYWdlOzI2NTI0OTc3MjtBUzoxMzcwMzM4MzgyMzk3NDRAMTQwOTY4MjgyMTM4Nw%3D%3D&el=1_x_1

http://www.researchgate.net/profile/Mario_Vargas-Ramirez2?enrichId=rgreq-296bd0ea-4eb1-498d-a134-8cda5efc6b8b&enrichSource=Y292ZXJQYWdlOzI2NTI0OTc3MjtBUzoxMzcwMzM4MzgyMzk3NDRAMTQwOTY4MjgyMTM4Nw%3D%3D&el=1_x_4



http://www.researchgate.net/profile/Rafael_Moreno-Arias?enrichId=rgreq-296bd0ea-4eb1-498d-a134-8cda5efc6b8b&enrichSource=Y292ZXJQYWdlOzI2NTI0OTc3MjtBUzoxMzcwMzM4MzgyMzk3NDRAMTQwOTY4MjgyMTM4Nw%3D%3D&el=1_x_4


http://www.researchgate.net/institution/National_University_of_Colombia?enrichId=rgreq-296bd0ea-4eb1-498d-a134-8cda5efc6b8b&enrichSource=Y292ZXJQYWdlOzI2NTI0OTc3MjtBUzoxMzcwMzM4MzgyMzk3NDRAMTQwOTY4MjgyMTM4Nw%3D%3D&el=1_x_6


BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions,research libraries, and research funders in the common goal of maximizing access to critical research.

Unknown Evolutionary Lineages and Population Differentiation in Anolisheterodermus (Squamata: Dactyloidae) from the Eastern and CentralCordilleras of Colombia Revealed by DNA Sequence DataAuthor(s): Mario Vargas-Ramírez and Rafael Moreno-AriasSource: South American Journal of Herpetology, 9(2):131-141. 2014.Published By: Brazilian Society of HerpetologyDOI: http://dx.doi.org/10.2994/SAJH-D-13-00013.1URL: http://www.bioone.org/doi/full/10.2994/SAJH-D-13-00013.1

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological,and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and bookspublished by nonprofit societies, associations, museums, institutions, and presses.

Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance ofBioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use.

Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercialinquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.

http://dx.doi.org/10.2994/SAJH-D-13-00013.1

http://www.bioone.org/doi/full/10.2994/SAJH-D-13-00013.1

http://www.bioone.org

http://www.bioone.org/page/terms_of_use

Unknown Evolutionary Lineages and Population

Differentiation in Anolis heterodermus (Squamata:

Dactyloidae) from the Eastern and Central Cordilleras of

Colombia Revealed by DNA Sequence Data

Mario Vargas-Ramírez1,2,3, Rafael Moreno-Arias2

1 Museum of Zoology, Senckenberg Dresden, A.B. Meyer Building, D-01109 Dresden, Germany.2 Grupo de Biodiversidad y Sistemática Molecular, Instituto de Ciencias Naturales, Universidad Nacional de Colombia, Apartado 7495, Bogotá, Colombia.3 Corresponding author. E-mail: [email protected]

Abstract. Anolis heterodermus is a poorly known, high elevation anole lizard from northern Andes, currently under threat due to habitat

destruction. Although it has been suggested that this taxon corresponds to a species complex, different evolutionary lineages have not been

identified. We examined phylogenetic relationships between individuals of A. heterodermus from the Eastern and Central Cordilleras of

Colombia and other species of the A. heterodermus series using mitochondrial DNA (partial ND2 gene with adjacent tRNA genes and partial

COI gene) and nuclear DNA (partial RAG1 gene) sequences and assessed divergence times between these lineages to elucidate their historical

biogeography. We performed genetic analyses for two populations from the middle portion of the Eastern Cordillera of Colombia based on

the COI gene. We identified three independently evolving evolutionary lineages within A. heterodermus based on two lines of evidence: (i) all

phylogenetic analyses showed A. heterodermus to comprise three strongly supported subgroups, being polyphyletic with respect to other

recognized species of the A. heterodermus series and (ii) the uncorrected p-distances of the ND2 gene revealed that the divergence between

A. heterodermus lineages exceed the divergence between recognized species of the A. heterodermus series. These lineages should be considered

as different evolutionary significant units (ESUs) and candidate species. We found that the diversification of the studied lineages dates to

the Middle Miocene to Pleistocene, falling within a period of major orogenic and climatic events in northern South America. The popula-

tion genetic analyses revealed two management units (MUs) in one of the newly reported lineages from the middle portion of the Eastern

Cordillera. Due to the accelerated destruction of their natural habitat, steps should be taken to ensure the conservation of the identified

ESUs and MUs.

Keywords. Anoles; Dactyloa; mitochondrial DNA; Northern Andes; nuclear DNA; Phenacosaurus.

Resumen. Anolis heterodermus es un lagarto poco estudiado de los Andes del norte, actualmente amenazado por destrucción de su hábitat.

Aunque se ha sugerido que este taxón corresponde a un complejo de especies, no se han identificado linajes evolutivos diferentes. En este

estudio examinamos las relaciones filogenéticas entre individuos de A. heterodermus de las Cordilleras Oriental y Central de Colombia y otras

especies de la serie A. heterodermus, usando ADN mitocondrial (ND2 parcial, genes tARN adyacentes y COI parcial) y ADN nuclear (RAG1

parcial). Adicionalmente, evaluamos los tiempos de divergencia entre estos taxones para dilucidar aspectos biogeográficos históricos. Por

otra parte, llevamos a cabo análisis genéticos de dos poblaciones de la parte media de la Cordillera Oriental de Colombia usando COI. Repor-

tamos tres linajes evolutivos independientes dentro de A. heterodermus basados en dos líneas de evidencia: (i) todos los análisis filogenéticos

revelaron tres subgrupos fuertemente soportados dentro de A. heterodermus, siendo polifilético con respecto a otras especies reconocidas

de la serie A. heterodermus y (ii) las distancias p no corregidas del gen ND2 revelaron que la divergencia entre linajes de A. heterodermus,

exceden la diferenciación entre varias especies reconocidas de la serie A. heterodermus. Estos linajes deben ser considerados como unidades

evolutivas significativas (UES) y especies candidatas. Encontramos que los tiempos de diversificación de las especies estudiadas datan del

Mioceno medio al Pleistoceno, un periodo de eventos orogénicos y climáticos importantes en el norte de Sudamérica. El análisis de genética

de poblaciones reveló dos unidades de manejo (UM) en uno de los linajes identificados de la Cordillera Oriental de Colombia. Debido a la ace-

lerada destrucción de su hábitat natural, medidas de conservación independientes para las UES y UM identificadas deben ser garantizadas.

2001) and considered one of the most threatened regions

with the highest conservation needs in the world (Stadt-

müller, 1987; Olson and Dinerstein, 1997). Therefore,

studies aimed at increasing knowledge about the tropical

Andean biota, to support their conservation and manage-

ment, are crucial.

The high elevation anole lizards of the Andes pre-

viously placed in the genus Phenacosaurus (Lazell, 1969;

Myers and Donnelly, 1996; Williams et al., 1996) are

currently placed in either the heterodermus series of the

unranked “Dactyloa clade” (Castañeda and de Queiroz,

INTRODUCTION

The tropical Andes are regarded as one of the world’s

greatest biodiversity hotspots, harboring high levels of

vertebrate and plant endemism (Olson and Dinerstein,

1997; Myers et al., 2000; Primack et al., 2001; Orme et al.,

2005). Their complex geological and environmental his-

tory is thought to have played a key role in promoting

speciation (Lynch, 1999; Willmott et al., 2001; Guarnizo

et al., 2009). Nevertheless, the tropical Andes are seri-

ously endangered by habitat destruction (Primack et al.,

South American Journal of Herpetology, 9(2), 2014, 131–141

© 2014 Brazilian Society of Herpetology

Submitted: 01 May 2013

Accepted: 25 July 2014

Handling Editor: Guarino Rinaldi Colli

doi: 10.2994/SAJH-D-13-00013.1

2011, 2013) within the genus Anolis (Poe, 1998, 2004;

Jackman et al., 1999; Nicholson et al., 2005; Castañeda

and de Queiroz, 2011, 2013) or the heterodermus species

group of the genus Dactyloa (Nicholson et al., 2012). They

occur in Colombia, Ecuador, Peru and western Venezuela

at elevations of 1,300–3,750 m, reaching the highest el-

evations of any anole (Castañeda and de Queiroz, 2011).

The A. heterodermus series includes six species from Co-

lombia, Ecuador and Venezuela: A. euskalerriari, A. hetero-

dermus, A. inderenae, A. nicefori, A. vanzolinii and A. tetarii

(Castañeda and de Queiroz, 2011, 2013). These lizards

are characterized by lamellar subdigital scales, well-devel-

oped casquing, and the presence of heterogeneous dorsal

scales in all species but A. euskalerriari (Castañeda and de

Queiroz, 2013).

Anolis heterodermus is a large species (maxi-

mum snout–vent length [SVL]: females = 86 mm,

males = 85 mm; Lazell, 1969; M. Vargas-Ramírez, un-

published data) inhabiting Andean scrubland and for-

est (Dunn, 1944) and conforming to a twig ecomorph

(Miyata, 1983; Torres-Carvajal et al., 2010, Nicholson

et al., 2012). It occurs in the northern Ecuadorian Andes

and all three cordilleras of the Colombian Andes at eleva-

tions above 1,600 m (Fig. 1; Torres-Carvajal et al., 2010;

Castañeda and de Queiroz, 2011). Some information on

its ecology and natural history has been gathered (Dunn,

1944; Osorno-Mesa and Osorno-Mesa, 1946; Lazell,

1969; Miyata, 1983; Torres-Carvajal et al., 2010, More-

no-Arias and Urbina-Cardona, 2013), and it was included

in three recent molecular phylogenetic studies of anoles

(Castañeda and de Queiroz, 2011, 2013; Nicholson et al.,

2012).

Previous efforts to recognize different species with-

in Anolis heterodermus based on morphology were un-

successful. Lazell (1969) showed that the morphological

characters used to describe A. richteri (Dunn, 1944) and

A. paramoensis (Hellmich, 1949) fall within the variation

in A. heterodermus, which he considered a senior synonym

of the former two. Later, due to the large morphologi-

cal variability observed within this taxon, Williams et al.

(1996) suggested that A. heterodermus is an unresolved

complex of sibling species. Likewise, Castañeda and de

Queiroz (2011) suggested that the species might repre-

sent a species complex, based on the observation that for

the RAG1 dataset A. heterodermus was not monophyletic

(A. inderenae was nested within it) and the fact that geo-

graphic distance between multiple samples of A. hetero-

dermus were in conflict with their evolutionary relation-

ships revealed by the ND2 and COI genes. Despite these

suggestions, the identification of independent evolution-

ary lineages within the species is still lacking.

Herein, we used mitochondrial and nuclear DNA se-

quence data to (i) assess the phylogenetic relationships

between populations of Anolis heterodermus from the

Eastern and Central cordilleras of Colombia and of allied

taxa of the A. heterodermus series (excluding A. tetarii)

and (ii) study the population genetics of A. heterodermus

from the middle portion of the Eastern Cordillera of Co-

lombia. Furthermore, past expansion of such populations

and divergence times between taxa of the A. heterodermus

series were assessed to elucidate historical biogeographic

aspects of these Andean anoles.

MATERIALS AND METHODS

Sampling and laboratory procedures

A total of 63 samples of Anolis heterodermus from

eight localities in the middle portion of the Eastern Cor-

dillera of Colombia (Fig. 1, inset) were collected in several

field trips from 2010–2012. Samples were obtained by

toe-clipping and stored in 96% ethanol Individuals were

released immediately after sampling. To assess phylo-

genetic relationships, fragments of mitochondrial DNA

Figure 1. Geographic distribution of the six species of the A. hetero-

dermus series. Red stars within the inset indicate sampled localities for

Anolis heterodermus in the middle portion of the Eastern Cordillera. Red

stars outside inset indicate localities for Anolis heterodermus individuals

from Central Cordillera included in this study. Letters A, B, and C show

the location of subgroups. Other species records from Dunn (1944), La-

zell (1969), Rueda and Hernández-Camacho (1988), Mueses-Cisneros

(2006), Torres-Carvajal et al. (2010), Castañeda and De Queiroz (2011,

2013), HerpNet database (accessed 21 April 2013), Instituto Alexander

von Humboldt data base (information provided by the institution), Uni-

versidad de Antioquia herpetological database (accessed 21 April 2013),

and Universidad Industrial de Santander herpetological database (ac-

cessed 21 April 2013).

Unknown Evolutionary Lineages and Population Differentiation in Anolis heterodermus (Squamata: Dactyloidae)

from the Eastern and Central Cordilleras of Colombia Revealed by DNA Sequence Data

Mario Vargas-Ramírez, Rafael Moreno-Arias

132


(mtDNA) partial NADH dehydrogenase subunit II (ND2),

the adjacent transfer-RNA, and cytochrome oxidase sub-

unit I (COI), and the nuclear (nDNA) recombination ac-

tivating gene 1 (RAG1) were sequenced for representa-

tive samples of each locality. For the population genetics

analyses, COI sequences were obtained for all 63 sampled

individuals (Appendix S1).

Total genomic DNA was extracted using a Qiagen

DNA tissue extraction kit (Qiagen, Hilden, Germany)

following the manufacturer’s instructions. All gene frag-

ments were amplified using newly designed primer pairs.

Primer sequences and PCR conditions are shown in Ta-

ble 1. PCRs were carried out in a total volume of 50 μl

containing 1 unit Taq polymerase (Bioron, Ludwigshafen,

Germany), 1 × buffer (as recommended by the supplier),

0.5 μM of each primer, and 0.2 mM of each dNTP (Fer-

mentas, St. Leon-Rot, Germany). PCR products were puri-

fied using the ExoSAP-IT enzymatic cleanup (USB Europe

GmbH, Staufen, Germany; modified protocol: 30 min at

37°C, 15 min at 80°C) and sequenced on an ABI 3130xl

Genetic Analyzer (Applied Biosystems, Foster City, CA,

USA) using the BigDye Terminator v3.1 Cycle Sequencing

Kit (Applied Biosystems). Remaining DNA extractions

are stored at -80°C in the tissue sample collection of the

Museum of Zoology, Senckenberg Dresden, Germany (for

voucher numbers see Appendix S1).

Phylogenetic analyses and divergence dating

Phylogenetic relationships between populations

of Anolis heterodermus from the middle portion of the

Eastern and Central Cordilleras of Colombia, and the

species belonging of the A. heterodermus series (A. euskal-

erriari, A. inderenae, A. nicefori and A. vanzolinii) were as-

sessed using a fragment of 1,036 bp of ND2 and 397 bp

corresponding to the adjacent five transfer-RNA genes

(tRNA-Trp, tRNA-Ala, tRNA-Asn, tRNA-Cys, tRNA-Tyr).

Additional analyses were conducted using the same taxa

minus A. nicefori (for which only a single sequence of

ND2 + tRNA was available) and the following datasets:

(i) a 534 bp fragment of COI, (ii) a 1,967 bp mtDNA data-

set comprosed of partial ND2, adjacent tRNA genes, and

partial COI, (iii) a 1,761 bp nDNA fragment of RAG1 and,

(iv) a combined matrix of 3,728 bp, containing the mtD-

NA and nuDNA. For tree rooting, A. neblininus, A. calimae,

and Polychrus marmoratus were used as outgroups. For

phylogenetic inference, the newly obtained sequences of

A. heterodermus from the middle portion of the Eastern

Cordillera were combined with GenBank data from indi-

viduals of the same species from the Central Cordillera.

GenBank sequences included one individual from an un-

known locality, four species of the A. heterodermus series,

and the outgroups (see Appendix S1).

The ND2 + tRNAs, COI, mitochondrial, RAG1, and

combined datasets were analyzed using the following par-

tition schemes: (i) unpartitioned, (ii) partitioned by gene

(i.e., each gene treated as a distinct partition, all tRNA

genes grouped into a single partition), and (iii) maximum

partitioning (i.e., each codon of each protein-coding gene

and all tRNA genes treated as distinct partitions). The

software PARTITIONFINDER (Lanfear et al., 2012) was

used to find the best partitioning scheme and substitu-

tion models for phylogenetic analyses, resulting in the

selection of the maximum partitioning scheme for all da-

tasets. Based on this scheme and individual best-fit mod-

els for nucleotide substitution (Table S1), Bayesian analy-

ses (BA) were performed in MrBayes v.3.1 (Ronquist and

Huelsenbeck, 2003). The substitution models were incor-

porated into a single tree search (mixed model partition

approach; Nylander et al., 2004) and two parallel runs

were carried out using four Markov chains, each starting

from a random tree. The Markov chains were run for 10

million generations, sampling every 100 generations. The

burn-in was set to sample only the plateau of the most

likely trees, which were used for generating a 50% major-

ity rule consensus. The posterior probabilities in this tree

are a measure of clade frequency and, thus, credibility.

The software TRACER 1.5.4 (Rambaut and Drummond,

2007) was used to assess an acceptable level of the MCMC

Table 1. Primers developed and used in this study and thermocycling conditions. ID = initial denaturing, C = No. cycles, D = denaturing, A = annealing,

PE = primer extension, FE = final elongation.

Frag-

mentPrimers Forward/Reverse primers (5’–3’)

Thermocycling conditions

ID C D A PE FE

ND2 PheIfor/PheIIrev CTAGCCTTGCAACCGGAA/ 5 min, 94°C 35–38 45 s, 94°C 45 s, 53–55°C 60 s, 72°C 10 min, 72°C

AGGTAAAATGGCCGAACGT

ND2 HetN1F/HetN1R TTGCAACCGGAACCATTATT/ 5 min, 94°C 35–38 45 s, 94°C 45 s, 53–55°C 60 s, 72°C 10 min, 72°C

GCTATTAAAATTGGTAGGGG

COI Hetco1f/Hetco1r CATTGGCACCCTTTACTTAA/ 5 min, 94°C 35 45 s, 94°C 45 s, 52°C 60 s, 72°C 10 min, 72°C

AGGTGTTTAAGTTACGGTCT

Rag1 HetRaf/HetRar TTGAGAAGCCACTTCCTGAT/ 5 min, 95°C 35 45 s, 95°C 60 s, 63–66°C 60 s, 72°C 10 min, 72°C

TAGGAAAGCAAGGATAGCGA

Rag1 HetRbf/HetRbr AGAACCTGCATCCTSAAATG/ 5 min, 95°C 35 45 s, 95°C 60 s, 63–66°C 60 s, 72°C 10 min, 72°C

TTGCATTGCCATGAGTGACA




133


chains mixing and to estimate effective sample sizes for

all parameters. Additionally, also using the maximum par-

titioning scheme for each dataset, maximum likelihood

(ML) analyses were run in RAxML 7.2.6 (Stamatakis,

2006), implemented in the graphical user interface rax-

mlgui v.0.93 (Silvestro and Michalak, 2012). The default

GTR + G model was used across all partitions. To explore

the robustness of the branching patterns, five indepen-

dent ML searches were run using the fast bootstrap algo-

rithm. Subsequently, 1,000 thorough bootstrap replicates

were calculated and plotted on the tree with the highest

likelihood value. For assessing intra- and interspecific

variability within Anolis heterodermus and between spe-

cies of the A. heterodermus series, respectively, uncorrect-

ed p-distances based on the partial ND2 gene calculated

with MEGA v.4.0.2 (Tamura et al., 2011) were compared.

Divergence time estimation of the Anolis hetero-

dermus series lineages was performed using the relaxed

Bayesian molecular clock approach implemented in the

program BEAST 1.7.5 (Drummond et al., 2012), using

the subprogram BEAUti v1.7.5 to set the analysis param-

eters. Due to the lack of appropriate Anolis fossil records

to calibrate the phylogeny, the average rate of evolution

of the fragment of the ND2 gene of 0.65% mutations per

lineage per million years (Macey et al., 1998) was used.

This evolutionary rate has already been implemented to

estimate divergence times in several Anolis species (e.g.,

Creer et al., 2001; Glor et al., 2003; Jackman et al., 2002;

Jezkova et al., 2009; Rodríguez-Robles et al., 2008; Gart-

ner et al., 2013). The following parameters were used to

run the analysis: lognormal clock model, speciation Yule

process tree prior, random starting tree and the model of

sequence evolution HKY; selected as substitution model

using the Bayesian information criterion in PARTITION-

FINDER. Two BEAST analyses were run for 100 million

generations each, sampling every 10,000 generations.

Posterior distributions were examined in TRACER, con-

sidering a burn-in of the initial 10% of samples. The sam-

ples of probable trees were summarized using TreeAnno-

tator v.1.7.5 (Drummond et al., 2012), and the resulting

trees visualized using FigTree v.1.3.1 (Rambaut, 2009).

Population genetics analyses

The 63 COI sequences (533 bp) were collapsed into

haplotypes using TCS v.1.21 (Clement et al., 2000). Based

on the phylogenetic results, population structure was

evaluated for each evolutionary lineage of Anolis hetero-

dermus from the middle portion of the Eastern Cordil-

lera using BAPS v.5.3 (Corander and Marttinen, 2006;

Corander et al., 2008). For the genetic mixture analyses

performed at the level of individuals, the maximum num-

ber of populations (Kmax), was set from 1–4, with 10

replicate runs each. The analyses were performed using

the non-spatial model. The admixture analyses based on

mixture clustering were performed with 500 iterations,

30 reference individuals and 20 iterations per reference

individual. To detect genetic differentiation within the

revealed populations, the nearest-neighbour statistic

Snn (Hudson, 2000) was calculated with DNASP v.5 (Li-

brado and Rozas, 2009). The same program was used to

calculate haplotype diversity (Hd), nucleotide diversity

(π), and segregation sites (S) for each population. TCS

was also used to assess genealogical relationships within

populations, by calculating parsimony networks for the

observed COI haplotypes. To test the hypothesis of a re-

cent demographic expansion for the same populations, a

mismatch distribution test was run in ARLEQUIN v.3.11

(Excoffier et al., 2005) and the expansion parameters , 1

and 0 were calculated. ARLEQUIN estimates parameters

of a sudden demographic expansion using a generalized

least-square approach (Schneider and Excoffier, 1999).

Additionally, two tests of selective neutrality (Tajima’s D

and Fu’s FS) were also calculated in ARLEQUIN to test for

signatures of recent demographic expansion.

RESULTS

Phylogenetic analyses and divergence dating

Both tree-building methods revealed for the individ-

ual mitochondrial and nuclear datasets, as well as for the

concatenated mitochondrial and combined matrix datas-

ets, a congruent phylogenetic pattern consisting of three

subgroups (Fig. 2, Figs. S1–S2): subgroup C was shown as

a sister to (A + B). Similarly, in all but the COI tree, Ano-

lis euskalerriari was placed as sister of all three subgroups

with maximum support. However, trees differed in the

placement of some taxa within subgroups and branch sup-

port values. Since only one sequence of the ND2 + tRNA

fragment was available for A. nicefori, detailed descrip-

tion of this dataset’s resulting phylogeny, which is the

most taxonomically complete one, is presented. Trees and

corresponding descriptions for the COI, RAG1, and com-

bined mtDNA datasets are presented in Appendix S2 and

Figures S1–S2. The resulting phylogenetic trees for the

ND2 + tRNA mtDNA and combined datasets are depicted

in Figure 2.

For the ND2 + tRNA dataset, both phylogenetic

analyses revealed the three, well-supported subgroups.

Within the maximally supported subgroup A, Anolis

heterodermus from Majuy (A. heterodermus Maj) was re-

vealed with strong support (Bayesian posterior probabil-

ity of 0.98, ML bootstrap support of 95%) to be sister of

a moderately supported clade formed by individuals of

A. heterodermus from Conejera sites 1 and 2 (Con1 and

Con2; A. heterodermus Con). Both phylogenetic analyses

recovered the sequence of A. heterodermus AY296144 of




134


unknown locality as sister taxon of A. heterodermus from

Majuy with moderate support and placed A. heterodermus

from Madrid sites 1 and 2 (Mad1 and Mad2; A. hetero-

dermus Mad) as a moderately supported sister clade (BA:

0.95; ML: 72%).

Within subgroup B, both tree building methods re-

vealed Anolis heterodermus from Antioquia JN112690

(A. heterodermus Ant) and A. heterodermus from Huila

JN112688 (A. heterodermus Hul) as sister taxa with low

support (BA: 0.86, ML: 53%), and A. heterodermus from

Caldas JN112689 (A. heterodermus Cal) as sister of this

clade, with maximum support. Anolis vanzolinii and A. in-

derenae appeared as moderately supported successive sis-

ter taxa (BA: 1, ML: 72% and 79%, respectively).

Within group C, an individual of Anolis heterodermus

from Gachancipa (A. heterodermus Gac) and individuals

from Tabio sites 1 and 2 (Tab1 and Tab2; A. heterodermus

Tab) were placed in both analyses in a maximally support-

ed polytomy (A. heterodermus Gac/Tab lineage). Finally, in

both analyses A. nicefori was inferred to be sister taxon of

Figure 2. Bayesian inference trees showing the evolutionary relationships between Anolis heterodermus from middle portion of the Eastern and Central

cordilleras of Colombia and other species of the A. heterodermus series. Left: Tree based on 1,433 bp mtDNA (partial ND2 gene and tRNA genes). Right:

Tree based on 3,728 bp of combined evidence (1,967 bp mtDNA of concatenated mitochondrial sequences and 1,761 bp RAG1 nDNA). Trees rooted with

A. neblininus, A. calimae, and Polychrus marmoratus (not shown). Posterior probability values for the Bayesian analysis (BA) above and bootstrap support

percentage values for the maximum likelihood (ML) analysis below. Support values along branches are thorough bootstrap values > 50. Bold branches are

supported by maximum posterior probability in BA and maximum bootstrap support in ML analyses.

Table 2. Mean uncorrected p-distances between individuals per locality of Anolis heterodermus, species of the Anolis heterodermus series, A. neblininus, and

A. calimae, based on a 1,036 bp fragment of ND2. Values below the diagonal are average percentages, above the diagonal are standard error (500 bootstrap

replicates), and along the diagonal and in bold are within-locality divergences (X ± SE). Con = A. heterodermus Conejera, Mad = A. heterodermus Madrid,

Gb = A. heterodermus Genbank AY296144, Cal = A. heterodermus Caldas, Ant = A. heterodermus Antioquia, Hul = A. heterodermus Huila, vanz = A. vanzolinii,

inde = A. inderenae, Gac/Tab = A. heterodermus Gachancipa/Tabio, nicef = A. nicefori, eusk = A. euskalerriari, nebli = A. neblininus, calim = A. calimae, n =

number of sequences.

n Con Maj Mad Gb Cal Ant Hul vanz inde Gac/Tab nicef eusk nebli calim

Con 2 0.41 ± 0.40 0.42 0.45 0.35 0.83 0.90 0.84 0.80 0.95 1.12 1.19 1.60 2.46 2.27

Maj 1 0.43 0.37 0.74 0.76 0.71 0.19 0.18 0.93 1.15 1.17 1.59 2.44 2.25

Mad 2 0.86 0.32 0.54 ± 0.40 0.54 0.11 0.13 0.82 0.83 0.96 1.13 1.20 1.61 2.42 2.23

Gb 1 1.51 1.29 2.53 0.83 0.90 0.82 0.80 0.93 1.12 1.17 1.58 2.44 2.21

Cal 1 8.49 8.24 6.81 6.37 0.46 0.44 0.65 0.86 1.11 1.22 1.53 2.53 2.21

Ant 1 8.46 8.71 7.71 7.26 1.95 0.46 0.66 0.91 1.14 1.25 1.54 2.55 2.25

Hul 1 8.43 8.18 7.03 6.63 1.94 1.83 0.64 0.83 1.13 1.21 1.53 2.46 2.21

vanz 1 7.50 7.26 6.54 5.89 3.83 4.31 3.94 0.81 1.15 1.17 1.60 2.37 2.16

inde 1 11.35 11.09 8.54 8.25 6.86 7.13 6.49 5.40 1.14 1.12 1.61 2.45 2.24

Gac/Tab 3 11.26 12.07 11.61 11.26 11.52 11.13 10.99 11.42 11.13 0.55 ± 0.40 0.93 1.35 2.41 2.26

nicef 1 12.38 12.56 12.68 11.82 12.61 12.89 12.21 12.12 11.67 7.40 1.42 2.36 2.18

eusk 1 19.06 20.20 18.28 18.43 17.36 17.36 17.07 18.07 18.78 16.82 16.49 2.46 2.22

nebli 1 35.84 39.06 36.24 35.63 37.15 37.41 36.07 34.71 36.55 35.28 34.54 35.43 2.20

calim 1 31.34 31.24 30.66 30.28 29.71 30.95 29.57 29.56 30.75 30.64 30.12 30.87 29.29




135


this polytomy, with moderate support (BA: 1, ML: 78%).

For the combined evidence partition dataset, both analy-

ses showed the same phylogenetic relationships between

and within subgroups (Fig. 2; Appendix S2).

The mean uncorrected p-distances based on ND2

reflected the phylogenetic results (Table 2). In subclade

A, sequence divergence values were 0.43%, 0.86%, and

1.51% between A. heterodermus from Conejera vs. Majuy,

Madrid and A. heterodermus AY296144, respectively, and

2.53% between the latter and A. heterodermus from Ma-

drid. In subclade B, sequence differentiation values were

1.94% and 1.95% between A. heterodermus from Caldas

vs. Huila and Antioquia, respectively, and 1.83% between

A. heterodermus from Huila vs. Antioquia. The sequence

divergence range of the same taxa compared to A. vanzo-

linii and A. inderenae was of 3.83–4.31% and 6.49–7.13%,

respectively. Sequences of A. vanzolinii and A. inderenae

diverged by 5.40%. In subgroup C, sequence divergence

between A. heterodermus from Gachancipa/Tabio and

A. nicefori was 7.40% (Table 2). Distances between sub-

clades A, B and C was 6.54–12.89%.

For the final divergence analyses, data from both runs

were combined (Fig. 3). The divergence times between sub-

groups C and A + B and between subgroups A and B were

estimated at 7 million years (mya; highest posterior density

interval [HPD] = 5–13 mya) and 4.1 mya (HPD = 2–7 mya),

respectively. Within subgroup A, the divergence times be-

tween A. heterodermus from Madrid and A. heterodermus

from Conejera + Majuy, and between A. heterodermus from

Conejera and Majuy were 1.3 mya (HPD = 0.8-2.7 mya) and

0.26 mya (HPD = 0.1–0.6 mya), respectively. Within sub-

group B, the divergence time between A. heterodermus from

Antioquia and A. heterodermus from Huila was 0.76 mya

(HPD: 0.3–1.5 mya) and the divergence of A. heterodermus

from Caldas at 1.03 mya (HPD: 0.9–2.1 mya). The diver-

gence of A. vanzolinii and A. inderenae was estimated at

2.3 mya (HPD: 1.3–4 mya) and 3.2 mya (HPD: 1.5–6 mya),

respectively. The divergence time between A. heterodermus

from Gachancipa/Tabio and A. nicefori was 4.6 mya (HPD:

3–7 mya). The separation of A. euskalerriari was 10.5 mya

(HPD: 7–16 mya). These estimations of lineage divergence

times are only an approximation based on a single rate of

molecular evolution and should be interpreted extremely

cautiously (see Gartner et al., 2013).

Population genetics analyses

Population structure was evaluated using BAPS v.5.3

for 30 individuals from Conejera, Majuy and Madrid that,

Figure 3. Time-calibrated Bayesian phylogeny of Anolis heterodermus from the middle portion of the Eastern and Central Cordilleras of Colombia and

other species of the A. heterodermus series. Shaded horizontal bars at nodes represent 95% highest posterior density interval. Time depicted in million

years before present.




136


according to the phylogenetic analyses, corresponded to

one evolutionary lineage (subgroup A), and 33 individu-

als from Gachancipa and Tabio that corresponded to a dif-

ferent evolutionary lineage (subgroup C). The subgroup

A alignment included 12 variable and 12 parsimony in-

formative sites without missing data and the subgroup C

alignment included five variable and two parsimony in-

formative sites without missing data.

The genetic mixture analyses of BAPS revealed one

population (K = 1) as the most likely division for each

subgroup. The admixture analysis revealed all individu-

als assigned to the corresponding population with 100%

probability. In the Snn comparison test between localities

in subgroup A, Conejera vs. Madrid and Majuy was sta-

tistically significant (P < 0.001), suggesting demographic

independence. Therefore subpopulations from Conejera

and Madrid/Majuy should be considered as different

management units (sensu Moritz, 1994). Under the 95%

criterion, the parsimony haplotype network assigned in-

dividuals from Conejera and Madrid/Majuy to two clearly

distinct haplotype clusters, differing by a minimum of six

mutational steps (Fig. 4.I). Sequences of individuals from

Conejera corresponded to two haplotypes (a–b) and indi-

viduals from Madrid/Majuy to six haplotypes (c–h), the

latter with a maximum of six mutational steps between

them (Fig. 4.I). For the Madrid/Majuy subpopulation,

TCS revealed e as the ancestral haplotype. This subpopu-

lation has higher haplotype and nucleotide diversity than

the Conejera subpopulation (Table 3).

The same analyses revealed a star-like network

for the Gachancipa/Tabio population in subgroup C

Figure 4. Parsimony network based on 533 bp of COI from 30 individu-

als of Anolis heterodermus in subgroup B (I) and 33 individuals in sub-

group C (II). Each circle corresponds to a distinct haplotype and lines

connecting haplotypes to one mutational step. Small black circles are

missing node haplotypes. Inset symbol size indicates haplotype frequen-

cy. Ancestral haplotypes in each network are indicated by a thicker line.

Inset photographs: Above: female of A. heterodermus from the Conejera

population, Cerro de la Conejera, Bogotá D.C., Colombia. Below: female

of A. heterodermus from the Gachancipa/Tabio population from Ga-

chancipa, Cundinamarca, Colombia.

Table 3. Genetic parameters and results of the model of population expansion for each population/subpopulation of Anolis heterodermus. n = sample size;

S = number of segregating sites; h = number of haplotypes; Hd = haplotype diversity and π = nucleotide diversity. Parameters of the population expansion

model: = age of expansion, 0 = population size before expansion,

1 = population size after expansion. When SSD values in the goodness-of-fit test

for the mismatch distribution are non-significant (P > 0.05), the data do not deviate from the expectation of population expansion. Negative significant

D and FS values are expected when population expansion occurs. Significant SSD, D and F

S values asterisked. The number of bootstrap replicates in the

mismatch test was 1,000.

Population Con Mad/Maj Con/Mad/Maj Gac/Tab

Subgroup A A A C

n 7 23 30 33

S 1 5 12 5

h 2 6 8 5

Hd 0.476 0.842 0.883 0.460

π 0.00089 0.00430 0.00830 0.00116

Model parameters

0.717 (0–22.799) 4.258 (0–7.707) 9.219 (0.08–14.434) 0.701 (0.000–1.848)

00 (0–0.021) 0 (0–4.127) 0.002 (0–9.290) 0 (0–0.313)

199999 (1.102–99999) 5.527 (3.030–99999) 6.743 (3.770–99999) 3.523 (0.840–99999)

Goodness-of-fit test

SSD 0.017170 0.013330 0.014260 0.000074

P 0.271 0.541 0.670 0.964

Tajima’s D 0.55902 2.23079 1.55363 -1.32863

P 0.833 0.991 0.962 0.083

Fu’s FS

0.58867 0.28889 1.51809 -1.81211

P 0.459 0.585 0.776 0.050*




137


consisting of five haplotypes (A–E), suggesting popula-

tion expansion (Fig. 4.II). This population showed lower

haplotype and nucleotide diversity than both subpopula-

tions of Anolis heterodermus in subgroup A (Table 3). The

pairwise sequence mismatch distributions were not sig-

nificantly different from the sudden expansion model of

Rogers and Harpending (1992; Table 3). Finally, the popu-

lation from Gachancipa/Tabio in subgroup C also showed

a significantly negative Fu’s Fs value and negative Tajima’s

D (Table 3), suggesting that this population could have ex-

perienced a more pronounced and sudden demographic

expansion event.

DISCUSSION

Previous morphological and molecular data indicat-

ed that more than one species might be grouped within

Anolis heterodermus (Lazell, 1969; Williams et al., 1996;

Castañeda and de Queiroz, 2011). The present study con-

firms A. heterodermus as a species complex and identifies

three independent evolutionary lineages within it based

on the following lines of evidence. First, congruent results

from mtDNA and nDNA analyses revealed that A. hetero-

dermus comprises three strongly supported subgroups

and is polyphyletic with respect to the other species of the

A. heterodermus series (Fig. 2). Second, uncorrected p-dis-

tances within A. heterodermus exceed the values found be-

tween different recognized species of the A. heterodermus

series (Table 2) and fall within the differentiation between

closely related Anolis species of 5.0–22.5% (for review see

Gartner et al., 2013). Consequently, relying on molecu-

lar criteria we conclude that the individuals of the three

clades correspond to independently evolving evolutionary

lineages and therefore qualify as distinct species (Avise

and Ball, 1990). However, to fully resolve the taxonomic

problems within the A. heterodermus series, an integrative

approach is necessary, combining evidence from molecular

markers with an extensive examination of the morphol-

ogy and color patterns of live and museum specimens.

The diversification times of the studied species of

the Anolis heterodermus series date to the Middle Miocene

to Pleistocene, falling within a period of significant oro-

genic and climatic events in northern South America. The

divergence between subgroups C and A + B was estimated

to have occurred during the Middle–Late Miocene, dur-

ing an episode of volcanism and uplift of the Central and

Eastern Cordilleras (Hoorn et al., 1995; Guerrero, 1997).

The estimated dates of divergence of subgroups A and B,

within subgroup C and A. inderenae fall within a period

in the Pliocene when the northern Andes experienced

extensive uplift, especially along the eastern Cordilleras

(Gregory-Wodzicki, 2000; Mora et al., 2008; Hoorn et al.,

2010). The widespread Pleistocene differentiation of

A. vanzolinii, A. heterodermus from Antioquia, Huila, and

Caldas within subgroup B and A. heterodermus from Cone-

jera, Majuy, and Madrid within subgroup A suggest that

the species complex was deeply affected by the dramatic

climatic changes that characterize this period. Similarly,

the evidence for recent, sudden demographic expansion

in A. heterodermus populations from the middle portion

of the Eastern Cordillera suggests that these populations

might have suffered isolation and decline due to extreme

environmental conditions followed by recent popula-

tion expansion. The overall cooling of temperatures in

the Pleistocene may have led to downhill glacier expan-

sion and severe uphill compression of montane vegeta-

tion areas (Hooghiemstra and van der Hammen, 2004;

Hooghiemstra et al., 2006). Resulting dispersal barriers

might have caused the isolation and reduction of A. het-

erodermus populations at higher elevations. After such

dramatic climatic changes, favorable conditions might

have allowed secondary contact, as evidenced by the cur-

rent possible sympatric/parapatric distribution of A. het-

erodermus lineages in the middle portion of the Eastern

Cordillera and other species of the A. heterodermus series

elsewhere (see Fig. 1).

Due to the fact that effective conservation measures

depend largely on a good knowledge of the systematics

of the species (Mace, 2004), the definition of indepen-

dent genealogical lineages within Anolis heterodermus is

critical for their assessment and future management. Our

analyses revealed three cryptic, independent evolutionary

lineages that should be considered as evolutionary signifi-

cant units (sensu Moritz, 1994) and unconfirmed candi-

date species for conservation purposes (Vieites et al.,

2009). Furthermore, each population of A. heterodermus

within subgroup A (Conejera and Madrid/Majuy) should

be considered a different management unit (sensu Moritz,

1994), each meriting conservation measures. In this pre-

liminary study, only a small portion of the distribution

range of the species was sampled. A range wide molecular

and morphological evaluation aimed at describing these

and identifying any further independently evolving evo-

lutionary lineages within A. heterodermus complex, as well

as determining their distribution ranges, is warranted.

Etter (1993) reported that in Colombia only 27% of

the northern Andean montane tropical forest remains, and

Armenteras et al. (2003) reported that on the Eastern Cor-

dillera only 41% and 45% of the original, pre-transformed

Andean and sub-Andean forest remains. Currently, those

fragments, which comprise the restricted habitat of Anolis

heterodermus, are further threatened by high human pop-

ulation density and extreme continuous transformation.

Therefore, scientific research aimed at (i) providing infor-

mation to increase the general knowledge about Andean

anoles and (ii) guiding the design and implementation of

conservation measures, as well as protection of what is

left of Andean montane tropical forests and environmen-

tal education, should be promptly implemented




138


Excoffier L., Laval G., Schneider S. 2005. ARLEQUIN: an integrated

software package for population genetics data analysis, Version

3.11. Evolutionary Bioinformatics Online 1:47–50.

Etter A. 1993. Diversidad ecosistemica en Colombia hoy. Pp. 43–61,

in Cárdenas, S., Correa, H.D. (Eds.), Nuestra Diversidad Biológica.

Fundación Alejandro Escobar, Colección María Restrepo de Angel.

CEREC, Bogotá.

Gartner G.E.A., Gamble T., Jaffe A.L., Harrison A., Losos J.B.

2013. Left–right dewlap asymmetry and phylogeography of Anolis

lineatus on Aruba and Curaçao. Biological Journal of the Linnean

Society 110: 409–426. doi:10.1111/bij.12131

Glor R.E., Kolbe J.J, Powell R, Larson A, Losos J.B. 2003.

Phylogenetic analysis of ecological and morphological

diversification in Hispaniolan trunk–ground anoles (Anolis cybotes

group). Evolution 57: 2383–2397. doi:10.1554/02-369

Gregory-Wodzicki K.M. 2000. Uplift history of the central and

northern Andes: a review. Geological Society of America Bulletin 112:

1091–1105. doi:10.1130/0016-7606(2000)112<1091:UHOTCA>2.

0.CO;2

Guarnizo C.E., Amézquita A., Bermingham E. 2009. The relative

roles of vicariance versus elevational gradients in the genetic

differentiation of the high Andean tree frog, Dendropsophus labialis.

Molecular Phylogenetics and Evolution 50:84–92. doi:10.1016/j.

ympev.2008.10.005

Guerrero J. 1997. Stratigraphy, sedimentary environments, and the

Miocene uplift of the Colombian Andes. Pp. 15–43, in Kay R.F.,

Madden R.H., Cifelli R.L., Flynn J.J. (Eds.), Vertebrate Paleontology

in the Neotropics: The Miocene Fauna of La Venta, Colombia.

Smithsonian Institution Press, Washington D.C.

Hooghiemstra H., Van der Hammen T. 2004. Quaternary ice-age

dynamics in the Colombian Andes: developing an understanding of

our legacy. Philosophical Transactions of the Royal Society of London B

359:173–180. doi:10.1098/rstb.2003.1420

Hooghiemstra H., Wijninga V.M., Cleef A.M. 2006. The

paleobotanical records of Colombia: implications for biogeography

and biodiversity. Annals of the Missouri Botanical Garden 96:297–325.

Hoorn C., J., Sarmiento G., Lorente M. 1995. Andean

tectonics as a cause for the changing drainage patterns in

Miocene northern South America. Geology 23: 237–240.

doi:10.1130/0091-7613(1995)023<0237:ATAACF>2.3.CO;2

Hoorn C., Wesselingh F.P., ter Steege H., Bermudez M.A., Mora A.,

Sevink J., ..., Antonelli A. 2010. Amazonia through time: Andean

uplift, climate change, landscape evolution, and biodiversity. Science

330: 927–931. doi:10.1126/science.1194585

Hudson R.R. 2000. A new statistic for detecting genetic differentiation.

Genetics 155:2011–2014.

Jackman T.R., Larson A., de Queiroz K., Losos J.B.

1999. Phylogenetic relationships and tempo of early

diversification in Anolis lizards. Systematic Biology 48:254–285.

doi:10.1080/106351599260283

Jackman T.R., Irschick D.J., de Queiroz K., Losos J.B., Larson A.

2002. Molecular phylogenetic perspective on evolution of lizards of

the Anolis grahami series. Journal of Experimental Zoology (Molecular

and Developmental Evolution) 294: 1–16.

Jezkova T., Leal M., Rodríguez-Robles J.A. 2009. Living together

but remaining apart: comparative phylogeography of Anolis

poncensis and A. cooki, two lizards endemic to the aridlands of

Puerto Rico. Biological Journal of the Linnean Society 96: 617–634.

doi:10.1111/j.1095-8312.2008.01147.x

Lanfear R., Calcott B., Ho S.Y.W., Guindon S. 2012. PartitionFinder:

combined selection of partitioning schemes and substitution

models for phylogenetic analyses. Molecular Biology and Evolution

29:1695–1701. doi:10.1093/molbev/mss020

Lazell J.D. Jr. 1969. The genus Phenacosaurus (Sauria: Iguanidae).

Breviora 325:1–24.

Librado P., Rozas J. 2009. DnaSP v5: a software for comprehensive

analysis of DNA polymorphism data. Bioinformatics 25:1451–1452.

doi:10.1093/bioinformatics/btp187

ACKNOWLEDGMENTS

We thank the Grupo de Conservación y Biodivers-

idad del Instituto de Ciencias Naturales de la Universidad

Nacional de Colombia and Fundación Biodiversa Colom-

bia for institutional and logistical support. We are grate-

ful to Olga Victoria Castaño-Mora, Gladys Cárdenas-Are-

valo, Michel Estefan-Agudelo and Ecotreck foundation for

fieldwork assistance. Thanks to Claudia Munera from In-

stituto de Investigaciones biológicas Alexander von Hum-

boldt (IAvH) in Colombia for information on distribution

of high elevation anole species. Thanks for help with the

manuscript style go to Fiona Mulvey. We thank the Asso-

ciate Editor and two anonymous reviewers for their con-

structive comments and suggestions that have improved

the quality of the manuscript. Sampling and access to ge-

netic resources allowed by Resolución 0255 of the ANLA,

Ministerio de Ambiente y Desarrollo Sostenible de Colom-

bia (Permiso Marco otorgado a la Universidad Nacional de

Colombia de recolección de especímenes de especies silves-

tres con fines de investigación científica no comercial para

el proyecto “Estructuración a pequeña escala en reptiles

de alta montaña en la cordillera Oriental de Colombia”).

Mario Vargas-Ramírez’s research in Germany is funded by

the Humboldt Foundation (Georg Forster fellowship).

REFERENCES

Armenteras D., Gast F., Villareal H. 2003. Andean forest

fragmentation and representativeness of protected natural areas in

the eastern Andes, Colombia. Biological Conservation 113:245–256.

doi:10.1016/S0006-3207(02)00359-2

Avise J.C., Ball R.M.1990. Principles of genealogical concordance in

species concepts and biological taxonomy. Pp. 45–67, in Futuyma,

D., Antonovics, J. (Eds.), Surveys in Evolutionary Biology. Oxford

University Press, Oxford.

Castañeda M.R., de Queiroz K. 2011. Phylogenetic relationships

of the Dactyloa clade of Anolis lizards based on nuclear and

mitochondrial DNA sequence data. Molecular Phylogenetics and

Evolution 61:784–800. doi:10.1016/j.ympev.2011.07.004

Castañeda M.R., de Queiroz K. 2013. Phylogeny of the Dactyloa

clade of Anolis lizards: New insights from combining morphological

and molecular data. Bulletin of the Museum of Comparative Zoology

160:345–398. doi:10.3099/0027-4100-160.7.345

Clement M., Posada D., Crandall K.A. 2000. TCS: a computer

program to estimate gene genealogies. Molecular Ecology 9:1657–

1660. doi:10.1046/j.1365-294x.2000.01020.x

Corander J., Marttinen P. 2006. Bayesian identification of admixture

events using multilocus molecular markers. Molecular Ecology

15:2833-2843. doi:10.1111/j.1365-294X.2006.02994.x

Corander J., Siren J., Arjas E. 2008. Bayesian spatial modeling of

genetic population structure. Computational Statistics 23:111–129.

doi:10.1007/s00180-007-0072-x

Creer D.A., de Queiroz K., Jackman T.R., Losos J.B., Larson A.

2001. Systematics of the Anolis roquet series of the southern Lesser

Antilles. Journal of Herpetology 35: 428–441. doi:10.2307/1565961

Dunn E.R. 1944. The lizards of genus Phenacosaurus. Caldasia 3:57–62.

Drummond A.J., Suchard M.A., Xie D., Rambaut A. 2012. Bayesian

phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology

and Evolution 29: 1969–1973. doi:10.1093/molbev/mss075




139


Primack R., Rozzi R., Feisinger P., Dirzo R., Massardo F.

2001. Fundamentos de Conservación Biológica: Perspectivas

Latinoamericanas. Fondo de Cultura Economica, México D.F.

Rambaut A., Drummond A.J. 2007. Tracer v1.4. Available from

http://beast.bio.ed.ac.uk/software/tracer/

Rambaut A. 2009. FigTree v1.3.1. Available from http://tree.bio.ed.ac.

uk/software/figtree/

Rodríguez-Robles J.A., Jezkova T., Leal M. 2008. Genetic

structuring in the threatened ‘Lagartijo del Bosque Seco’ (Anolis

cooki) from Puerto Rico. Molecular Phylogenetics and Evolution 46:

503–514. doi:10.1016/j.ympev.2007.11.006

Rogers A.R., Harpending H. 1992. Population growth makes waves

in the distribution of pairwise genetic differences. Molecular Biology

and Evolution 9:552–569.

Ronquist F., Huelsenbeck J.P. 2003. MrBayes 3: Bayesian phylogenetic

inference under mixed models. Bioinformatics 19:1572–1574.

doi:10.1093/bioinformatics/btg180

Rueda J.V., Hernández-Camacho J.I. 1988. Phenacosaurus inderenae

(Sauria: Iguanidae), nueva especie gigante, proveniente de la

Cordillera Oriental de Colombia. Trianea 2: 339–350.

Schneider S., Excoffier L. 1999. Estimation of past demographic

parameters from the distribution of pairwise differences when

the mutation rates vary among sites: application to human

mitochondrial DNA. Genetics 152:1079–1089.

Silvestro D., Michalak I. 2012. RAxMLGUI: a graphical frontend for

RAxML. Organisms Diversity & Evolution 12:335–337. doi:10.1007/

s13127-011-0056-0

Stadtmüller T. 1987. Cloud Forest in the Humid Tropics: A

Bibliographic Review. United Nations University y Centro

Agronómico de Investigación y Enseñanza. Turrialba. Costa Rica.

Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-based

phylogenetic analyses with thousands of taxa and mixed models.

Bioinformatics 22:2688–2690. doi:10.1093/bioinformatics/btl446

Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar

S. 2011. MEGA 5: Molecular evolutionary genetics analysis

using maximum likelihood, evolutionary distance, and maximum

parsimony methods. Molecular Biology and Evolution 28:2731–2739.

doi:10.1093/molbev/msr121

Torres-Carvajal O., Ayala F., Carvajal-Campos A. 2010. Reptilia,

Squamata, Iguanidae, Anolis heterodermus Duméril, 1851:

Distribution extension, first record for Ecuador and notes on color

variation. Ckeck List 6:189–190.

Vences M., Guayasamin J.M., Miralles A., de La Riva I. 2013.

To name or not to name: Criteria to promote economy of change

in Linnaean classification schemes. Zootaxa 3636:201–244.

doi:10.11646/zootaxa.3636.2.1

Vieites D.R., Wollenberg K.C., Andreone F., Köhler J., Glaw

F., Vences M., 2009. Vast underestimation of Madagascar’s

biodiversity evidenced by an integrative amphibian inventory.

Proceedings of the National Academy of Sciences USA 106:8267–8272.

doi:10.1073/pnas.0810821106

Williams E.E., Praderio M.J., Gorzula S. 1996. A phenacosaur from

Chimantá Tepui, Venezuela. Breviora 506:1–15.

Willmott K., Hall J.W., Lamas G. 2001. Systematics of Hypanartia

(Lepidoptera: Nymphalidae: Nymphalinae) with a test for

geographical speciation mechanisms in the Andes. Systematic

Entomology 26:369–399. doi:10.1046/j.1365-3113.2001.00157.x

Lynch J.D. 1999. Ranas pequeñas, la geometría de la evolución, y la

especiación en los Andes Colombianos. Revista de la Academia

Colombiana de Ciencias Exactas, Físicas y Naturales 23:143–159.

Mace G.M. 2004. The role of taxonomy in species conservation.

Philosophical Transactions of the Royal Society of London B 359:711–

719. doi:10.1098/rstb.2003.1454

Macey J.R., Schulte II J.A., Ananjeva N.B., Larson A., Rastegar-

Pouyani N., Shammakov S.M., Papenfuss T.J. 1998.

Phylogenetic relationships among agamid lizards of the Laudakia

caucasia species group: testing hypotheses of biogeographic

fragmentation and an area cladogram for the Iranian Plateau.

Molecular Phylogenetics and Evolution 10:118–131.

Miyata K. 1983. Notes on Phenacosaurus heterodermus in the Sabana de

Bogotá, Colombia. Journal of Herpetology 17:102–105.

Mora A., Parra M., Strecker M.R., Sobel E.R., Hooghiemstra

H., Torres V., Vallejo-Jaramillo J. 2008. Climatic forcing

of asymmetric orogenic evolution in the Eastern Cordillera of

Colombia. Geological Society of America Bulletin 120: 930–949.

doi:10.1130/B26186.1

Moreno-Arias R.A., Urbina-Cardona N. 2013. Population dynamics

of the Andean lizard Anolis heterodermus: fast-slow demographic

strategies in fragmented scrubland landscapes. Biotropica

45:253–261.

Moritz C.1994. Defining ‘Evolutionarily Significant Units’

for conservation. Trends in Evolution & Ecology 9:373–375.

doi:10.1016/0169-5347(94)90057-4

Mueses-Cisneros J.J. 2006. Anolis heterodermus. Distribution.

Herpetological review 37: 493.

Myers C.W., Donnelly M.A. 1996. A new herpetofauna from Cerro

Yaví, Venezuela: first results of the Robert G. Goelet American

Museum-Terramar Expedition to the northwestern Tepuis.

American Museum Novitates 3172:1–56.

Myers N., Mittermeier R.A., Mittermeier C.G., Fonseca G.A.B.,

Kent J. 2000. Biodiversity hotspots for conservation priorities.

Nature 24:853–858.

Nicholson K.E., Glor R.E., Kolbe J.J., Larson A., Hedges S.B.,

Losos J.B. 2005. Mainland colonization by island lizards. Journal of

Biogeography 32:929–938. doi:10.1111/j.1365-2699.2004.01222.x

Nicholson K.E., Crother B.I., Guyer C., Savage J.M. 2012. It is time

for a new classification of anoles (Squamata: Dactyloidae). Zootaxa

3477:1–108.

Nylander J.A.A., Ronquist F., Huelsenbeck J.P., Nieves-Aldrey J.L.

2004. Bayesian phylogenetic analysis of combined data. Systematic

Biology 53:47–67. doi:10.1080/10635150490264699

Olson D.M., Dinerstein E. 1997. Global 2000: A representation

approach to conserving the earth�s distinctive ecoregions. World

Wildlife Foundation, Washington, D.C.

Orme C.D.L., Davies R.G., Burgess M., Eigenbrod F., Pickup N.,

Olson V.A., ..., Owens I.P.F. 2005. Global hotspots of species

richness are not congruent with endemism or threat. Nature

18:1016–1019. doi:10.1038/nature03850

Osorno-Mesa H., Osorno-Mesa E. 1946. Anotaciones sobre lagartos

del género Phenacosaurus. Caldasia 17:123–130.

Poe S. 1998. Skull characters and the cladistic relationships of the

Hispaniolan dwarf twig Anolis. Herpetological Monographs 12:192–

236. doi:10.2307/1467021

Poe S. 2004. Phylogeny of anoles. Herpetological Monographs 18:37–89.

doi:10.1655/0733-1347(2004)018[0037:POA]2.0.CO;2




140


ONLINE SUPPORTING INFORMATION

The following Supporting Information is available

for this article online:

Appendix S1. GenBank accession numbers of DNA se-

quences used in this study.

Appendix S2. Description of the results of the phyloge-

netic analyses of COI, combined mitochondrial, and com-

bined evidence partitions.

Figure S1. Bayesian inference tree for the COI fragment

showing the evolutionary relationships between Anolis

heterodermus from middle portion of the Eastern and

Central Cordilleras of Colombia and other species of the

A. heterodermus series. Trees rooted with A. neblininus,

A. calimae, and Polychrus marmoratus (not shown). Pos-

terior probability values for the Bayesian analysis (BA)

above and bootstrap support percentage values for the

maximum likelihood (ML) analysis below. Support values

along branches are thorough bootstrap values > 50%. Bold

branches are supported by maximum posterior probabili-

ty in BA and maximum bootstrap support in ML analyses.

Figure S2. Bayesian inference trees showing the evolu-

tionary relationships between Anolis heterodermus from

middle portion of the Eastern and Central Cordilleras of

Colombia and other species of the A. heterodermus series.

Left: Combined mitochondrial tree based on 1,967 bp

mtDNA (partial ND2, adjacent tRNA genes, and COI).

Right: Tree based on 1,761 bp of RAG1. Trees rooted

with A. neblininus, A. calimae, and Polychrus marmoratus

(not shown). Posterior probability values for the Bayes-

ian analysis (BA) above and bootstrap support percentage

values for the maximum likelihood (ML) analysis below.

Support values along branches are thorough bootstrap

values > 50%. Bold branches are supported by maximum

posterior probability in Bayesian analyses and maximum

bootstrap support in ML analyses.

Table S1. Evolutionary models selected by the Bayesian

Information Criterion in partitionfinder (Lanfear et al.

2012) for the optimal partitioning schemes.




141
