anti-inflammatory and cell signalling effects of · kavita bisht,msc. anti-inflammatory and cell...

Kavita Bisht,MSc.

Anti-Inflammatory and Cell Signalling Effects of

Biliverdin and Biliverdin Reductase

Heart Foundation Research Centre, School of Medical Science

Griffith University

Submitted in fulfillment of the requirements of the degree of

Doctor of Philosophy

June 2014

Kavita Bisht

MSc.

ii

Despite advances in medical care and research, sepsis still poses a great threat to

the health of society and remains a major cause of mortality and morbidity throughout

the world. The progression of sepsis is driven by inflammatory processes. Stimuli,

including endotoxin, play a crucial role in the initiation of inflammation via their

interaction with molecules associated with the immune system. Among them, toll like

receptors, complement receptor 5 a (C5aR) and cytokines are key factors in both

promoting and aggravating inflammation. Therefore, compounds that can inhibit the

activation of these molecules could represent promising therapies for inflammatory

disorders, including sepsis. Bile pigments, including biliverdin (BV) and unconjugated

bilirubin (UCB) are tetrapyrroles and are derived from haem catabolism. Biliverdin is

rapidly converted to bilirubin by the action of biliverdin reductase (BVR). Although

BV, BVR and UCB induce beneficial effects in animal and cell culture models of injury

and transplantation, the anti-inflammatory potential of these molecules remains poorly

understood, particularly in humans. The main aims of this thesis were to explore the

effects of BV and BVR on cell signalling molecules, C5aR expression, pro- and anti-

inflammatory cytokines, macrophage polarisation and chemotaxis.

In the first study, RAW 264.7 and bone marrow derived macrophages

(BMDMs) were treated with BV in the presence or absence of lipopolysaccharide (LPS;

100 ng/mL) and gene and protein expression of C5aR were assessed. Biliverdin (50

µM) significantly decreased the gene and cell surface expression of C5aR in both

primary and immortalised macrophages (P < 0.05). To reveal the role of

phophatidylinositol 3-kinase (PI3K) and mammalian target of rapamycin (mTOR) in

BV’s effects on C5aR, RAW 264.7 cells were treated with BV in the presence or

absence of LY294002 (LY; PI3K inhibitor) or rapaymycin (mTOR inhibitor).

Biliverdin increased the phosphorylation of Akt and S6 (downstream of mTOR

pathway) in a time-dependent manner, which was inhibited after LY or rapamycin

treatment. The inhibitory effects of BV on C5aR expression were partially blocked by

rapamycin, suggesting that mTOR signalling is required to regulate BV’s effects on

C5aR. Furthermore, BV also decreased the expression of complement-associated pro-

inflammatory cytokines (TNF-α and IL-6) in LPS activated RAW 264.7 macrophages.

Therefore, the inhibitory effect of BV on C5aR expression supports an additional anti-

General Abstract

iii

inflammatory mechanism, which might partially explain BV’s anti-inflammatory and

cytoprotective effects in transplant rejection and endotoxin injury.

The second study attempted to investigate the impact of BVR deletion on

chemotaxis and macrophage phenotype and to explore whether blocking of C5aR would

modulate macrophage phenotype and chemotaxis. Bone marrow derived macrophages

from BVRfl/fl

(control) and CreLyz:BVRfl/fl

(conditional deletion of BVR in myeloid

cells) were treated with or without LPS (100 ng/mL) and IFN-γ (20 ng/mL) in the

presence or absence of neutralising antibody against C5aR (1 µg/mL). Macrophages can

be polarised into two different cell populations in response to endotoxin and cytokines

in vitro. LPS and IFN-γ drive macrophage polarisation towards M1 (classically

activated macrophages that promote inflammation) while IL-4 stimulation results in

development of M2 phenotype (alternatively activated macrophages that resolve

inflammation/assist in wound healing). BMDMs from both mice were also assessed for

chemotaxis and C5aR expression in the presence or absence of complement component

5a (C5a; 100 nM). Macrophages from CreLyz:BVRfl/fl

mice showed significant increase

in basal C5aR gene and protein expression and chemotaxis in response to C5a, which

was partially inhibited by C5aR antibody (P < 0.05). Furthermore, conditional deletion

of BVR promoted macrophage polarisation towards the M1 phenotype by increasing the

gene and protein expression of iNOS and TNF-α release into media (important markers

of M1 activation) after LPS and IFN-γ stimulation, which were partially blocked by

C5aR antibody. Therefore BVR plays a crucial role in regulating chemotaxis in

response to C5a and macrophage polarisation towards the M1 phenotype via modulation

of C5aR expression.

The strong anti-inflammatory and cyprotective potential of BV in in vitro and

murine models prompted the investigation of BV on LPS-induced cytokines and C5aR

gene expression in human blood. In the final study, whole human blood was treated ex

vivo with BV (10 and 50 µM) in the presence or absence of LPS (3 µg/mL). In addition,

serum samples from human subjects and wild type and Gunn rats (animal model of

hyperbilirubinaemia) were also collected to explore the relationship between baseline

circulating bilirubin and cytokines expression/release. Biliverdin at 50 µM significantly

decreased the gene expression of IL-1β, IL-6, IFN-γ, IL-1Ra and IL-8 in LPS stimulated

whole blood (P < 0.05). However, LPS significantly decreased C5aR gene expression

iv

(P < 0.05) and BV alone also tended to decrease C5aR expression (P = 0.08).

Furthermore, BV significantly reduced LPS-mediated release of IL-1β and IL-8 by

human leukocytes (P < 0.05). However, increasing baseline concentration of UCB (in

the absence of BV treatment) was significantly and positively associated with LPS-

mediated gene expression of IL- (R = 0.929), IFN- (R = 0.809), IL-1Ra (R = 0.786)

and IL-8 (R = 0.857; all P < 0.05). In addition, serum samples from naive Gunn rats had

significantly increased IL-1β concentrations (P < 0.05) compared to wild-type controls.

Furthermore, a positive and significant relationship existed between UCB

concentrations and IL-1β (R = 0.488 and P = 0.01) in Gunn rats. The inhibitory effects

of BV on the ex vivo response of human blood to LPS further support the anti-

inflammatory capacity of BV in a ‘first in human’ pre-clinical model of inflammation,

suggesting that BV could represent a promising target in the treatment of human septic

shock.

Key words: Sepsis, inflammation, bile pigment, BVR, C5aR, IL-1β, IL-8, macrophage

polarisation, chemotaxis.

v

This thesis describes original work conducted within the School of Medical Science

at the Griffith University, Australia from August 2010 to May 2014 and within the Beth

Israel Deaconess Medical Centre at Harvard Medical School (Boston, USA) from

February 2013 to October 2013. This thesis is to best of my knowledge and belief,

original and my own work and not written by another person where due reference is

made in the thesis itself. This work has not been previously submitted, in whole or part,

for any other degree at this or any other University.

I acknowledge that an electronic copy of my thesis must be lodged with the

Griffith University library and immediately made available for research and study.

Kavita Bisht

Statement of Originality

vi

Anti-Inflammatory and Cell Signalling Effects of Biliverdin and Biliverdin

Reductase .......................................................................................................................... i General Abstract ......................................................................................................... ii

Statement of Originality ............................................................................................. v

Table of Contents ...................................................................................................... vi

List of Figures ............................................................................................................ ix

List of Tables ............................................................................................................ xv

List of Abbreviations ............................................................................................... xvi

Acknowledgments .................................................................................................... xx

Statement of Contribution to Jointly Published Work............................................ xxii

Publications by the Candidate Contained in the Thesis ....................................... xxvii

Additional Publications by the Candidate During Ph.D. Candidature not Included in

the Thesis ............................................................................................................. xxviii

Conference Presentations by the Candidate During Ph.D. Candidature ............... xxix

Awards/Scholarship during Ph.D. Candidature ..................................................... xxxi

Chapter 1: Introduction ................................................................................................. 1 1.1 Thesis organisation ............................................................................................... 2

1.2 Haem catabolism: an evolutionary perspective .................................................... 2

1.3 Aims and Hypotheses ........................................................................................... 4

1.4 Results and summaries ...................................................................................... 6

1.4.1 In vitro study ................................................................................................. 6

1.4.2 In vivo study .................................................................................................. 6

1.4.3 Ex vivo study ................................................................................................. 7

Chapter 2: Literature Review ....................................................................................... 8 2.1 Immune responses to pathogens ........................................................................... 9

2.2 Inflammation ...................................................................................................... 10

2.3 Inflammatory cells .............................................................................................. 11

2.3.1 Neutrophils ................................................................................................... 11

2.3.2 Macrophages ............................................................................................... 15

2.3.3 Endothelial cells .......................................................................................... 16

2.4 Nuclear factor kappa B in inflammation ............................................................ 19

2.4 Nitric oxide and nitric oxide synthase in inflammation ..................................... 21

2.5 Toll like receptors in inflammation .................................................................... 23

2.6 Complement in inflammation ............................................................................. 25

2.6.1 Anaphylatoxin and their receptors .............................................................. 27

2.7 Role of cytokines in inflammation ..................................................................... 29

2.7.1 Tumour Necrosis Factor-α .......................................................................... 30

2.7.2 Interleukin-1 ................................................................................................. 31

2.7.3 Interleukin-6 ................................................................................................. 32

2.7.4 Interleukin-10 ............................................................................................... 32

2.8 Role of haem oxygenase and haem catabolism in inflammation ....................... 33

2.8.1 Carbon monoxide ......................................................................................... 36

2.8.2 Biliverdin and unconjugated bilirubin ......................................................... 38

Table of Contents

vii

2.8.3 Ferritin ......................................................................................................... 49

2.9 Biliverdin reductase ............................................................................................ 50

2.9.1 Structure of BVR .......................................................................................... 50

2.9.2 Functions of BVR ......................................................................................... 53

2.10 Phosphatidylinositol 3-kinase and inflammation ............................................. 57

2.11 Sepsis and inflammation ................................................................................... 60

Chapter 3 Biliverdin modulates the expression of C5aR in response to endotoxin in

part via mTOR signalling ............................................................................................ 64 3.1 Abstract ............................................................................................................... 65

3.2 Introduction ........................................................................................................ 66

3.3 Material and methods ......................................................................................... 67

3.3.1 Cell Culture and Treatment ......................................................................... 67

3.3.2 Isolation of Bone Marrow-Derived Macrophages ....................................... 67

3.3.3 RNA Extraction and qRT-PCR .................................................................... 68

3.3.4 qRT-PCR Calculation using Genorm Analysis ............................................ 68

3.3.5 Sources of Antibodies ................................................................................... 69

3.3.6 Flow Cytometry ............................................................................................ 69

3.3.7 Western Blot ................................................................................................. 69

3.3.8 ELISA Analysis ............................................................................................ 70

3.3.9 Statistical Analysis ....................................................................................... 70

3.4 Results ................................................................................................................ 71

3.4.1 Biliverdin inhibits the expression of C5aR in murine macrophages ........... 71

3.4.2 Biliverdin induces the phosphorylation of Akt and S6 and inhibits C5aR

expression in macrophages in part via mTOR signalling ........................................... 74

3.4.3 Biliverdin suppresses the release and expression of complement-associated

pro-inflammatory cytokines ........................................................................................ 76

3.5 Discussion ........................................................................................................... 78

Chapter 4 Conditional deletion of biliverdin reductase in myeloid cells promotes

chemotaxis by C5a dependent mechanism ................................................................. 81 4.1 Abstract ............................................................................................................... 82

4.2 Introduction ........................................................................................................ 83

4.3 Material and methods ......................................................................................... 85

4.3.1 Generation of BVRfl/fl

mice ........................................................................... 85

4.3.2 Stable transfection of RAW 264.7 cells with mir-bvr shRNA ..................... 85

4.3.3 Isolation of bone marrow-derived macrophages ......................................... 86

4.3.4 Source of antibodies ..................................................................................... 86

4.3.5 Animal treatment .......................................................................................... 87

4.3.5 RNA extraction and reverse transcriptase quantitative PCR ...................... 87

4.3.6 Flow cytometry analysis of CD88 ................................................................ 88

4.3.7 Immunohistochemistry ................................................................................. 88

4.3.8 Cell migration assay .................................................................................... 88

4.3.9 Immunoblotting ............................................................................................ 89

4.3.10 ELISA analysis ........................................................................................... 89

4.3.11 Statistical analysis ..................................................................................... 89

4.4 Results ................................................................................................................ 90

4.4.1 BVR deletion in CreLyZ:BVRfl/fl

mice .......................................................... 90

4.4.2 Conditional deletion of BVR in BMDM promotes C5aR expression both in

vitro and in vivo .......................................................................................................... 91

viii

4.4.3 Deletion of BVR induces migration of BMDMs towards C5a in part via

C5aR ........................................................................................................................... 97

4.4.4 Peritoneal cells from CreLyz:BVRfl/fl

show increase expression of C5aR and

influx of monocytes after in vivo LPS administration ............................................... 101

4.4.5 BMDM from CreLyz:BVRfl/fl

mice show M1 phenotype ............................ 102

4.5 Discussion ......................................................................................................... 106

Chapter 5 Endogenous tetrapyrroles influence leukocyte responses to

lipopolysaccharide in human blood: pre-clinical evidence demonstrating the anti-

inflammatory potential of biliverdin ........................................................................ 110 5.1 Abstract ............................................................................................................. 111

5.2 Introduction ...................................................................................................... 112

5.3 Material and methods ....................................................................................... 114

5.3.1 Human blood sample collection and ex vivo incubation with LPS and BV 114

5.3.2 Animal experiments .................................................................................... 115

5.3.3 RNA extraction and qRT-PCR ................................................................... 115

5.3.4 Cytokine analysis ....................................................................................... 117

5.3.5 Cell count, haem and bilirubin analysis .................................................... 117

5.3.6 Statistical analysis ..................................................................................... 117

5.4 Results .............................................................................................................. 118

5.4.1 Clinical parameters, haem and UCB concentration ................................. 118

5.4.2 Biliverdin and cytokine expression ............................................................ 119

5.4.3 Association between baseline UCB concentration and cytokine expression

.................................................................................................................................. 133

5.4.4 Unconjugated bilirubin, biliverdin and chemokine IL-8 expression ......... 140

5.4.5 Biliverdin and C5aR expression ................................................................ 143

5.5 Discussion ......................................................................................................... 145

Chapter 6 Thesis Summary and Conclusion ............................................................ 155 6.1 Introduction ...................................................................................................... 156

6.2 Project summary ............................................................................................... 156

6.3 Future research ................................................................................................. 159

6.4 Concluding remarks .......................................................................................... 161

Chapter 7 References ................................................................................................. 162

ix

Figure 2.1: Elimination of microorgansims by neutrophils. Neutrophils destroy

pathogens via three major pathways including engulfment of the pathogen

(phagocytosis), degranulation or production of NETs. Sourced from Nature

Publishing Group [43]. ............................................................................................ 14

Figure 2.2: Monocytes differentiate to macrophages under the influence of M-CSF/GM-

CSF. Macrophages are polarised in vitro by IFN-/LPS or IL-4/IL-13 into M1 or

M2 cells. M1 macrophages are considered pro-inflammatory and express TLRs,

complement receptors in addition to promoting the release of cytokines and

chemokines. M2 macrophages are considered anti-inflammatory and express anti-

inflammatory cytokines, nuclear receptors and prostaglandins. ............................. 16

Figure 2.3: Leukocytes and endothelium interaction. Leukocytes interact with ECs in

response to stimulation, which increases the expression of selectins on both

leukocytes and ECs. Leukocytes then attach to ECs firmly via integrin binding to

CAMs (VCAM-1/ICAM-1) and then migrate into tissues. In addition, cytokines,

chemokines and growth factors released by macrophages also activate endothelium.

................................................................................................................................. 19

Figure 2.4: Activation and translocation of NF-B from cytoplasm to nucleus, triggered

by phosphorylation of IkB in response to NF-B activating stimuli. Modified from

Abraham et al. and sourced from Oxford University Press [93]. ........................... 21

Figure 2.5: Important functions of the three isoforms of nitric oxide synthase (NOS).

Adapted from Forstermann et al. and sourced from Oxford University Press [94].

................................................................................................................................. 23

Figure 2.6: Toll like receptors, their ligands and signalling pathways. .......................... 25

Figure 2.7: Complement activation pathways. Complement is activated by classical,

lectin, alternative and extrinsic pathways. Each pathway generates small

anaphylatoxins called C3a, C5a and opsonins, including C3b and C5b. C5b

interacts with other complement components, leading to the formation of the

membrane attack complex (MAC). ......................................................................... 27

Figure 2.8: Role of cytokines in inflammation. Cytokines produced by macrophages,

including TNF-, IL-1, IL-6 and IL-8 are potent inducers of inflammation and also

promote the differentiation of naive Th0 cells into Th1 and Th2 cells. They also

activate ECs and SMCs. On the other hand, the anti-inflammatory cytokines IL-10

and TGF-β are produced by macrophages and promote Treg cell differentiation;

adapted from Ait-Outfella et al. and sourced from American Heart Association, Inc.

[124]. ....................................................................................................................... 30

List of Figures

x

Figure 2.9: Possible mechanisms contributing to the protective effects of haem

oxygenase-1. Haem is catabolised to BV, CO and Fe2+

by HO-1. Biliverdin is

rapidly reduced to UCB. Haem oxygenase-1 via BV and CO protects IRI-mediated

injury by inhibiting the expression of inducible nitric oxide synthase (iNOS),

cyclooxygenase (COX) and NADPH oxidase activity. Both CO and BV also inhibit

IRI-mediated expression of IL-6, IL-1β and ICAM-1. Adapted from Li Volti et al.

and sourced from S. Karger AG, Basel [153]. ........................................................ 36

Figure 2.10: Haem catabolism. Haem is oxidised by HO and produce two intermediate

compounds: α-meso-hydroxyhaem and verdohaem. These intermediates are then

metabolised to produce CO, BV and iron. Adapted from Montellano et al. and

sourced from Elsevier [147]. ................................................................................... 40

Figure 2.11: Formation of BR. BV IXα is reduced to BR IXα in the presence of BVR.

Adapted from Zhu et al. and sourced from John Wiley and Sons [199]. ............... 41

Figure 2.12: The cytoprotective and anti-inflammatory effects of BV and BR against

various disease models. Adapted from Wegiel et al. and sourced from Frontiers

[34]. ......................................................................................................................... 42

Figure 2.13: Structure of hBVR (human biliverdin reductase). hBVR contains one N-

terminal domain, which includes the sequences, required for catalytic function and

is also called the reduction domain. This domain catalyses the reduction of BV to

BR. The C-terminal domain contains the sequences crucial for kinase/cell

signalling activity of BVR, containing six residues with Zn-binding domains;

adapted from Gibbs et al. and sourced from Frontiers [262]. ................................. 52

Figure 2.14: Signalling cascade initiated by BVR in response to extracellular stimuli

and their role in induction of gene expression. BVR is a modulator of protein

kinase C and in response to oxidative stress it modulates two main branches of

insulin/insulin growth factor (IGF-1): MAPK (ERK1/2, JNK and p38) and PI3K

(PDK1/2, mTOR, PKB). Both MAPK and PI3K are crucial for stress-induced

transcription factor activation (c-Jun, c-Fos, ATF-2 and NF-κB). ......................... 56

Figure 2.15: PI3K and downstream kinases. GPCRs and TLRs present on immune cells

activate PI3K, which then phosphorylates phosphatidylinositol-4,5-bisphosphate

(Ptdlns (4,5) P2) to phosphatidylinositol-(3,4,5)-trisphosphate (Ptdlns (3,4,5)P3),

leading activation of Akt. Akt activates mTOR, which regulates protein synthesis

by phosphorylating p70S6 kinase to S6 and inhibits initiation factor 4EBP-1. ...... 60

Figure 3.1: Biliverdin reduces C5aR expression and the effects were independent of

PI3K/Akt signaling. (A) Gene expression and (B) cell surface expression of C5aR

in RAW 264.7 cells, treated with BV (10 μM) ± LPS (100 ng/mL) for 24 h. (C and

D) Protein expression of pAkt and Akt in RAW 264.7 cells, pre-incubated with or

without LY prior to BV (50 μM) and LPS treatment. (E) Gene and (F) protein

expression of C5aR in RAW 264.7 cells, pre-incubated with LY and thereafter

treated with LPS or BV (50 μM) for 24 h. The data are representative of two

independent experiments. Value represents mean ± S.E., n=3/group. *P < 0.05

versus non LPS control (0.01% DMSO), &P < 0.05 versus LPS control and #P <

0.05 versus no LY LPS control. .............................................................................. 72

xi

Figure 3.2: Biliverdin inhibits C5aR expression. RAW M were treated BV (50 M) ±

LPS for 24 h. (A) Gene and (B) cell surface expression of C5aR in RAW M. (C)

Cell surface expression of C5aR in BMDM M treated with BV and LPS for 24

and 48 h. Data are representatives of three independent experiments. Value

represents mean ± S.E. n=3/group, *P < 0.05 vs. non LPS control (0.01 % DMSO)

at 24 h and 48 h and &

P < 0.05 vs. LPS control at 24 and 48 h. ............................. 73

Figure 3.3: Biliverdin enhances phosphorylation of Akt and S6. RAW 264.7 M were

treated with BV and LPS for different time points and protein expression of pAkt,

Akt (A and B) and pS6 (C and D) were analysed. Blots are representative of at least

two independent experiments. ................................................................................. 75

Figure 3.4: Biliverdin modulates C5aR expression in part via mTOR signalling. RAW

264.7 M were pre-incubated with rapamycin for 1 h and thereafter treated with

BV or LPS for 15 min or 24 h for pS6 and C5aR expression, respectively. (A)

Protein expression of pS6 and (B) cell surface expression of C5aR in RAW 264.7

cells. The data are representative of three independent experiments. Value

represents mean ± S.E. n=3/group, #P < 0.05 vs. no rapamycin control (0.01 %

DMSO), *P < 0.05 vs. no rapamycin and no LPS control (0.01 % DMSO), &

P <

0.05 vs. no rapamycin and LPS control and &#

P < 0.05 vs. no rapamycin BV + LPS

group. ...................................................................................................................... 76

Figure 3.5: Biliverdin attenuates complement associated pro-inflammatory cytokines.

mRNA expression of TNF- (A) and IL-6 (B) and protein concentration of TNF-

(C) and IL-6 (D) were analysed in RAW 264.7 macrophages, incubated with

BV±LPS for 24 h. The data are representative of two independent experiments.

Value represents mean ± S.E. n=3/group, *P < 0.05 vs. no LPS control (0.01 %

DMSO) and &

P < 0.05 vs. LPS control. .................................................................. 77

Figure 4.1: Deletion of BVR in BMDM from CreLyz:BVR

fl/fl. A) Plan of crossing of

BVRfl/fl

mice to CreLyz mice. The deletion of BVR in BMDMs was confirmed by

qPCR (B) and western blot (C). Results represent mean ± S.E. of three independent

experiments (n=3-5/group). *P < 0.05 CreLyz:BVRfl/fl

vs BVRfl/fl

. ......................... 91

Figure 4.2: Lack of BVR augments C5aR expression. RAW 264.7 cells were stably

transfected with shRNA against BVR (mir BVR) or shRNA control (mir C). Gene

(A) and protein expression (B) of BVR were analysed using qPCR and western

blot, respectively. Results are expressed as mean ± S.E. of three independent

experiments (n = 3/group (A)) *P < 0.05 vs mir C. Blots are representative of two

independent experiments (B). Gene expression (C) and cell surface expression (D)

of C5aR (CD88) were measured by qPCR and flow cytometry, respectively. The

data are representative of three independent experiments (n = 3/group). *P < 0.05

vs mir C. .................................................................................................................. 92

Figure 4.3: Increased gene and cell surface expression of C5aR in mice lacking BVR in

myeloid cells. A) C5aR (CD88) cell surface expression in differentiated BMDMs at

day 0-5 from C57BL/6 mice was measured by flow cytometry. Gene expression of

C5aR was analysed using qPCR (B) and the surface expression was assessed by

flow cytometry (C) in BMDMs from BVRfl/fl

and CreLyz:BVRfl/fl

. Results are

representative of three independent experiments (n=3/group). *P < 0.05

CreLyz:BVRfl/fl

vs BVRfl/fl

. ....................................................................................... 94

xii

Figure 4.4: Increased protein expression of C5aR in organs isolated from mice lacking

BVR in myeloid cells. Liver, lung and spleen were harvested from BVRfl/fl

and

CreLyz:BVRfl/fl

mice and CD88 expression was analysed by immunohistochemistry.

Representative images are shown in A. Images were taken at 100X magnification

and quantitative analysis for CD88 positive cells in multiple fields of view is

shown in B. Results represent mean ± S.E. of four mice per group. *P < 0.05

CreLyz:BVRfl/fl

vs BVRfl/fl

. ....................................................................................... 96

Figure 4.5: BMDM from CreLyz:BVR

fl/fl are characterisd by increased chemotaxis

towards C5a. Representative images (A) and absorbance at 562 nM of BMDM

supernatant (B) from BVRfl/fl

and CreLyz:BVRfl/fl

mice that migrated through to the

lower chamber of transwell chambers in response to C5a after 24 h of culture in

serum free media. Results are presented as mean ± S.E. of three independent

experiments (n = 3/group). *P < 0.05 CreLyz:BVRfl/fl

vs BVRfl/fl

. C) BMDM from

BVRfl/fl

and CreLyz:BVRfl/fl

mice incubated with anti-mouse IgG or C5aR for 30 min

and cell surface expression of C5aR was analysed by flow cytometry. Results are

representative of three independent experiments (n = 3/group). *P < 0.05

CreLyz:BVRfl/fl

vs BVRfl/fl

. ....................................................................................... 98

Figure 4.6: C5a mediated chemotaxis in CreLyz:BVR

fl/fl BMDMs is mediated by C5aR.

Representative images (A) and absorbance of BMDM supernatant (B) from BVRfl/fl

and CreLyz:BVRfl/fl

mice that migrated through to the lower chamber of the

transwell chamber in response to C5a after 24 h incubation in the presence or

absence of anti-mouse IgG or anti-mouse C5aR. Data are expressed mean ± S.E. of

three independent experiments (n = 3/group). *P < 0.05 CreLyz:BVRfl/fl

vs BVRfl/fl

and #P < 0.05 CreLyz:BVRfl/fl

anti-mouse C5aR vs CreLyz:BVRfl/fl

anti-mouse IgG.

............................................................................................................................... 100

Figure 4.7: Lack of BVR promotes C5aR expression and peritoneal monocyte

infiltration in CreLyz:BVRfl/fl

in response to LPS. Perionteal cells were isolated

from LPS injected BVRfl/fl

and CreLyz:BVRfl/fl

mice. Cell surface expression of

C5aR (A) and influx of granulocytes and monocytes (B) were analysed by flow

cytometry. Results are expressed as mean ± S.E. of three mice in each group. *P <

0.05 CreLyz:BVRfl/fl

vs BVRfl/fl

. ............................................................................. 102

Figure 4.8: Induction of iNOS expression in M1 polarised BMDMs from

CreLyz:BVRfl/fl

is partially mediated by C5aR. BMDMs were incubated in the

presence or absence of LPS/IFN-γ for 24 and 72 h. Gene expression (A) was

assessed at 24 h and protein expression (B) was analysed at 72 h. Data are

representative of three independent experiments (n = 3/group (A)). *P < 0.05

CreLyz:BVRfl/fl

vs BVRfl/fl

. Blots are representative of at least two independent

experiments (B). BMDMs were incubated with anti-mouse IgG or anti-mouse

C5aR prior to LPS/IFN-γ stimulation, and gene expression (C) and protein

expression (D) were assessed after 24 and 72 h, respectively. Results represent

mean ± S.E. of three independent experiments (n = 3/group (C)). *P < 0.05

CreLyz:BVRfl/fl

vs BVRfl/fl

and # P < 0.05 CreLyz:BVRfl/fl

anti-mouse C5aR vs

CreLyz:BVRfl/fl

anti-mouse IgG. Blots are representative of at least two independent

experiments (D). .................................................................................................... 103

xiii

Figure 4.9: Macrophages lacking BVR express increased levels of TNF-α. A) ELISA

was applied to measure TNF-α levels in the supernatant of cultured BMDMs from

BVRfl/fl

and CreLyz:BVRfl/fl

mice incubated with ± LPS/IFN-γ for 24 h. Data are


CreLyz:BVRfl/fl

vs BVRfl/fl

. B) TNF-α levels in supernatant from BMDMs pre-

incubated with anti-mouse IgG or anti-mouse C5aR prior to M1 polarisation for 24

h were measured by ELISA. Data are representative of three independent

experiments (n = 3/group. *P < 0.05 CreLyz:BVRfl/fl

vs BVRfl/fl

and # P < 0.05

CreLyz:BVRfl/fl


anti-mouse IgG.................. 105

Figure 5.1: Cytokine expression in each individual in response to LPS. The whole blood

of each subject was incubated with LPS (3 g/mL) for 4 h. The fold change of each

cytokine (A-F) was analysed using 2- ∆∆ C

T method. Data are presented as mean ±

S.E. ........................................................................................................................ 121

Figure 5.2: Cytokine gene expression in response to BV. The whole blood was

incubated with BV at different concentrations for 4 h and the mRNA expression

was assessed. The fold change of each cytokine (A-F) was analysed using 2- ∆∆ C

T

method. Data are presented as mean ± S.E. n=7, P < 0.05 vs sample treated with

control only (0 µM BV). ....................................................................................... 123

Figure 5.3: Cytokine gene expression in response to LPS and BV. The whole blood was

incubated with BV and LPS for 4 h and the mRNA expression was assessed. The

relative fold change of each cytokine (A-F) was analysed using 2- ∆∆ C

T method.

Data are presented as mean ± S.E. n=7, P < 0.05 vs sample treated with LPS only

(0 µM). .................................................................................................................. 125

Figure 5.4: Cytokine protein concentration in each individual in response to LPS. The

whole blood of each subject was incubated with LPS (3 g/mL) for 8 h.

Concentration of each cytokine (A-F) was analysed using Milliplex human

cytokine kit. Data are presented as mean ± S.E (0 µM). ....................................... 128

Figure 5.5: Cytokine protein concentration in response to BV. The whole blood was

incubated with BV at different concentrations for 8 h. Concentration of each

cytokine (A-F) was analysed using Milliplex human cytokine kit. Data are

presented as mean ± S.E. n=7, P < 0.05 vs sample treated with control only (0 µM

BV). ....................................................................................................................... 130

Figure 5.6: Cytokine concentration in response to LPS and BV. The whole blood was

incubated with BV and LPS for 8 h and cytokine concentration was measured using

a Milliplex human cytokine kit. The relative change in each cytokine (A-F)

concentration is presented. Data are presented as mean ± S.E. n=7, P < 0.05 vs

sample treated with LPS only (0 µM). .................................................................. 132

Figure 5.7: UCB concentration and cytokine gene expression in response to LPS. Whole

blood was incubated with BV and LPS for 4 h and mRNA expression was assessed.

Figure shows the scatter plots and the correlation between baseline UCB

concentration and cytokine gene expression (A-F), n = 7. ................................... 135

xiv

Figure 5.8: UCB concentration and cytokine concentration in response to LPS. Whole

blood was incubated with BV and LPS for 8 h and plasma cytokine concentration

was measured using a Milliplex human cytokine kit. Figure shows scatter plots and

the correlation between baseline UCB concentration and plasma cytokine

concentrations (A-F), n=7. .................................................................................... 137

Figure 5.9: IL-1β concentration in blood samples of wild type control and Gunn rats. A.

Graph showing the body weight of Wistar (n=10) and Gunn rats (n=17). Data are

presented as mean ± S.E; P <0.05 vs control (non-jaundiced Wister rats). Box plot

showing the serum UCB concentration (B) and IL-1β concentration in Wistar and

Gunn rats (C). Data are presented as median (25-75% interquartile range); n=10 for

Wister and n =17 for Gunn rats and P <0.05 vs control (non-jaundiced Wister rats).

D. Scatter plot and the correlation between baseline UCB concentration and IL-1β

concentration; n=10 for Wister and n =17 for Gunn rats. ..................................... 139

Figure 5.10: IL-8 gene and protein expression in response to BV. IL-8 gene (A) and

protein (B) expression was analysed using 2- ∆∆ C

T method and ELISA kit,

respectively. Data are presented as mean ± S.E. n=7, P < 0.05 vs sample treated

with control only (0 µM BV). ............................................................................... 141

Figure 5.11: IL-8 concentration in response to LPS and BV. IL-8 gene and protein

concentration was analysed using qPCR and high sensitivity ELISA kit,

respectively in blood samples incubated with BV and LPS for 4 or 8 h. IL-8 gene

(A) and protein (B) expression in response to BV + LPS. Data are presented as

mean ± S.E. n=7 and P < 0.05 vs sample treated with LPS only (0 µM). Scatter plot

showing the correlation between baseline UCB concentration and IL-8 gene (C)

and protein expression (D) in response to LPS, n=7. ............................................ 142

Figure 5.12: C5aR gene expression in response to BV±LPS. Gene expression of C5aR

was analysed using 2- ∆∆ C

T method (A and B). Data are presented as median (25-

75% interquartile range). n=7, *P < 0.05 vs control (C). .................................... 144

Figure 5.13: Possible mechanism of BV and UCB-triggered immune-modulatory

effects. Haem is catabolised into BV, iron (Fe++

) and carbon monoxide (CO) via

the action of haem oxygenase (HO). Biliverdin is rapidly reduced to UCB in the

presence of BVR. Pro-inflammatory mediators and endotoxin activate NF-B

p60/p65 dimer and promote its translocation to the nucleus, where it induces the

transcription and translation of pro-inflammatory genes. Biliverdin inhibits the

expression of pro-inflammatory mediators via inhibition of NF-B activation.

However UCB, similar to dioxins, may promote translocation of AhR from the

cytoplasm and binding to xenobiotics/dioxin responsive elements, which results in

activation of AhR. Activated form of AhR then leads to increase expression of

cytokines (TNF- and IL-1). .............................................................................. 152

xv

Table 3.1. Primer sequences and amplicon sizes of housekeeping (GAPDH and HPRT)

and target genes (C5aR, TNF-α and IL-6) expressed in RAW 264.7 cells. ............ 68

Table: 4.1 Primer sequences and amplicon sizes of housekeeping (β-actin) and target

genes (C5aR, BVR and iNOS) expressed in mouse BMDM cells.......................... 87

Table 5.1: Primer sequences and amplicon sizes of housekeeping (HPRT) and target

genes (IL-1β, IL-6, TNF-, IFN-γ, IL-1Ra IL-10, and C5aR) expressed in humans.

............................................................................................................................... 116

Table 5.2: Clinical characteristics of recruited subjects at baseline (n=7) ................... 118

Note: BMI (bone marrow index), WBC (white blood cell), RBC (red blood cell), HGB

(total haemoglobin), NE (neutrophil), LYM (lymphocyte), MO (monocytes), EO

(eosinophil), BA (basophil). .................................................................................. 118

Table 5.3: Unconjugated bilirubin (UCB) and haem concentrations in subjects after 0

(baseline), 4 and 8 h incubation with BV ± LPS (N=7/group). ............................ 119

Note: The effect of BV and haemolysis on haem and UCB concentration was performed

by repeated measures ANOVA. *P < 0.05 vs. baseline UCB or haem

concentrations and #P <0.05 vs. haem concentrations at 4 h. ............................... 119

List of Tables

xvi

ABCC2: ATP-binding cassette subfamily C member 2

Akt: Protein kinase B

APC: Antigen presenting cell

aPC: Activated protein C

ANOVA: Analysis of variance

AP-1: Activator protein-1

ARE: Antioxidant responsive element

ATF-2: Activated transcription factor-2

ATP: Adenosine triphosphate

BR: Bilirubin

BRT: Bilirubin ditaurate

BMDM: Bone marrow derived macrophage

BV: Biliverdin

BVR: Biliverdin reductase

CAM: Cell adhesion molecules

C3aR: Complement receptor 3a

C5aR (CD88): Complement receptor 5a

CB: Conjugated bilirubin

cGMP: Cyclic guanosine 3′,5′-monophosphate

CLP: Caecal ligation and puncture

cMyc: Myelocytomatosis viral oncogene

CO: Carbon monoxide

CoPPIX: Cobalt 7,12-diethenyl-3,8,13,17-tetramethyl-21H,23H-porphine-2,18-

dipropanoic acid

COX: Cyclooxygenase

DAF: Decay accelerating factor

DAMP: Damage associated molecular pattern

DC: Dendritic cell

DPBS: Dulbecco’s phosphate-buffered saline

DMSO: Dimethylsuphoxide

EAE: Experimental autoimmune encephalomyelitis

EC: Endothelial cell

List of Abbreviations

xvii

EDTA: Ethylenediaminetetra-acetic acid

ELISA: Enzyme-linked immunosorbent assay

ERK: Extracellular signal regulated kinase

eNOS: Endothelial nitric oxide synthase

FACS: Fluorescence-activated cell sorting

Foxp3: Forkhead box P3

FRAP: Ferric Reducing Ability of Plasma

GAPDH: Glyceraldehyde 3-phosphate dehydrogenase

GPCR: G-protein coupled receptor

G-CSF: Granulocyte colony stimulating factor

GM-CSF: Granulocyte-macrophage colony stimulating factor

GS: Gilbert’s syndrome

H2O2: Hydrogen peroxide

HO: Haem oxygenase

HOCl: Hypochlorous acid

HPLC: High-performance liquid chromatography

HPRT: Hypoxanthine-guanine phosphoribosyltransferase

HRP: Horseradish peroxidase

HSP: Heat shock protein

JNK: c-Jun N-terminal kinase

LDL: Low-density lipoprotein

LPS: Lipopolysaccharide

LTA: Lipoteichoic acid

LY294002: 2-(4-morpholinyl)-8-phenyl-chromone

ICAM: Intercellular cell adhesion molecule

IFN-γ: Interferon gamma

IL: Interleukin

IL-1Ra: interleukin receptor antagonist

IκB: Inhibitor of kappa B

IKK: IκB kinase

iNOS: inducible nitric oxide synthase

IGF: Insulin growth factor

IRI: Ischaemia-reperfusion injury

IRS: Insulin receptor substrate

xviii

PI3K: Phosphatidylinositol 3-kinase

MAPK: Mitogen activated kinase

M-CSF: Macrophage colony-stimulating factor

MCP-1: Monocyte chemoattractant protein-1

MDA: Malondialdehyde

MIP: Macrophage inflammatory protein

MMP: Matrix metalloproteinase

MHC: Major histocampatibility complex

MPO: Myeloperoxidase

MRP-2: Multrdrug resistant-related protein-2

mTOR: Mammalian target of rapamycin

NADH: Nicotinamide adenine dinucleotide

NADPH: Nicotinamide adenine dinucleotide phosphate

NET: Neutrophil extracellular trap

NF-κB: Nuclear factor kappa B

NO: Nitric oxide

nNOS: neuronal nitric oxide synthase

Nrf2: Nuclear factor-erythroid2 related factor

Ox-LDL: Oxidised LDL

PBMC: Peripheral blood mononuclear cell

PMN: Polymorphonuclear leukocytes

PRR: Pattern recognition receptor

qRT-PCR: Quantitative real-time quantitative polymerase chain reaction

RANTES: Regulated on activation normal T-cell expressed and secreted

RNS: Reactive nitrogen species

ROS: Reactive oxygen species

RPMI: Roswell Park Memorial Institute

siRNA: Small interfering RNA

SMC: Smooth muscle cell

SOD: Superoxide dismutase

StRE: Stress-responsive element

STZ: Streptozotocin

TCDD: 2,3,7,8-tetrachlorodibenzo-p-dioxin

TIR: Toll/interleukin-1 receptor

xix

TLR: Toll like receptorTGF-β: Transforming growth factor-beta

TNF-α: Tumour necrosis factor-alpha

TNF-α-R: Tumour necrosis factor-alpha receptor

TRAIL-R: Tumour necrosis factor-alpha related apoptosis-inducing ligand

Treg: Regulatory T-cells

TRIF: Toll receptor associated activator of interferon

VCAM: Vascular cell adhesion molecule

VSMC: Vascular smooth muscle cell

UCB: Unconjugated bilirubin

UGT1A1: Uridine diphosphate glucuronosyltransferase

XRE: Xenobiotic responsive element

xx

My first and sincere appreciation goes to the excellence guidance of my

principal supervisor Dr Andrew C. Bulmer, for all I have learned from him and for his

continuous help, support and encouragement throughout my PhD. Thanks for being an

open person to ideas and helping me shape my ideas and interests. Thanks, also for

supporting my scholarship applications and all the recommendations that helped me get

tuition fee relief and living allowances. Without a financial support, I would not be able

to pursue my PhD. I am deeply indebted to you for trusting my abilities and giving me

the golden opportunity to visit and complete my research projects in A/Prof Leo E.

Otterbein’s and Dr Barbara Wegiel’s lab in Beth Israel Deaconess Medical Centre at

Harvard Medical School (Boston, USA). I would also like to thank my secondary

supervisor Prof John P. Headrick for reviewing this thesis and the advice he has

provided for my thesis. I am very grateful to my external supervisor Dr Barbara Wegiel

for sharing her knowledge and ideas with me and explaining Molecular Biology and

Immunology to me. Thanks, for making my stay at Boston enjoyable and without her I

would not have become so enthusiastic about science. Thanks for your motivation, time

and friendship, which has been invaluable on both academic and personal level, for

which I am very grateful. I am also very thankful to Dr Jens Tampe, Prof Leo E.

Otterbein and Prof Karl Heinz for their guidance and suggestions that helped me finish

my research projects.

I would also like to acknowledge Austrian Science Fund (P21162-K.-H.W. and

A.B.), Julie Henry Fund, Eleanor Shore Foundation and NIH (HL-071797 and HL-

07616) and AHA (10SDG2640091) grants for providing financial contribution for this

thesis, without which this work would not have existed. I am very grateful to Griffith

University for providing me with a scholarship to pursue my study. I am also very

thankful to fellow lab members and postgraduate students; I met in Australia and

Boston. Special thanks to my friends: Connie Boon, Mailin Li and Amanda Galenkamp

for their friendship. We had lots of fun times and you helped me get through all the

struggles and frustrations I had in my PhD with your affection and friendship. I would

also like to thank Mrs Eva Csizmadia of Boston lab for teaching me

immunohistochemistry experiments. Special thanks to Mr Dave Gallo of Boston lab for

Acknowledgments

xxi

teaching me animal experiments and also for making mice experiments fun. I will never

forget the laughs and jokes we shared together that made lab environment friendly and

enthusiastic.

I would also like to thank Australian Society of Immunology and Griffith

University for supporting my research and providing me funding to attend both National

and International conferences.

My greatest appreciation goes to my closest friend Rajni Verma, who was

always willing to talk and gave her best suggestions, in spite of living in completely

different time zone. Thanks to my friends: Bishakha Roy, Paulina Janeczek, Akanksha

Upadhyaya, Victoria Ozberk, Avinash Kundur and Lana Bivol, who provided me a

much needed form of escape from my studies.

I would also like to thank my parents and brother for the continuous love and

their supports in my decisions, without whom I could not have made to do a PhD.

Finally, I would like to thank my Partner, Alister Punton, for all the support,

commitment and the patience you have shown me in our relationship. Thanks for being

with me during the good and hard times and encouraging me throughout my PhD, for

which mere expression of thanks does not suffice.

xxii

I have contributed to the papers that appear in the following chapter as follows:

Chapter 3 ─ Biliverdin modulates the expression of C5aR in response to endotoxin in

part via mTOR signalling. This chapter includes a co-authored paper and is published

by Biochemical and Biophysical Research Communication (please see below).

Bisht K., Wegiel B., Tampe J., Neubauer O., Wagner K-H., Otterbein L. E., Bulmer A.

C. Biliverdin modulates the expression of C5aR in response to endotoxin in part via

mTOR signaling. Biochemical and Biophysical Research Communications. 449: 94-99

(2014).

Kavita Bisht (candidate)

Study design and development

RAW 264.7 cell culture

Isolation of macrophages from bone marrow from mice and culture of

macrophages

Treatment of cells with BV, LPS, PI3K/mTOR inhibitor

FACS, RNA isolation, qPCR, western blot and ELISA analysis of the cell

culture samples

Data entry and calculation of the outcome data

Statistical analysis

Preparation of the manuscript

Barbara Wegiel

Preparation of the ethics application

Financial support of the project

Assistance in the study design and development

Assistance in the revision and editing of the manuscript

Statement of Contribution to Jointly Published Work

xxiii

Jens Tampe



Oliver Neubauer

Assistance in normalising gene expression data


Karl-Heinz Wagner




Leo E. Otterbein




Andrew C. Bulmer

Primary supervisor of the project



Assistance in the interpretation of data and in statistical analysis

Assistance in the preparation, revision and editing of the manuscript

(corresponding author)

xxiv

Corresponding author of the paper: Dr. Andrew C. Bulmer

___________________________02/06/2014

Supervisor: Dr. Andrew C. Bulmer

____________________________02/06/2014

xxv

Chapter 5 ─ Endogenous tetrapyrroles influence leukocyte responses to


inflammatory potential of biliverdin. This chapter includes a co-authored paper and is

published by Journal of Clinical and Cellular Immunology (please see below).

Bisht K., Tampe J., Shing C., Bakrania B., Winearls J., Fraser J., Wagner K-H., Bulmer

A. C. Endogenous tetrapyrroles influence leukocyte responses to lipopolysaccharide in

human blood: pre-clinical evidence demonstrating the anti-inflammatory potential of

biliverdin. Journal of Clinical and Cellular Immunology. 5: 1000218 (2014)

Kavita Bisht (candidate)

Study design and development

Preparation of ethics application and subject information package

Recruitment of the subjects

Blood cell analysis

Incubation of blood with LPS and BV

Isolation of RNA and plasma

qPCR, ELISA, HPLC analysis of human and rat samples

Data entry and calculation of the outcome data

Statistical analysis

Interpretation of the data

Preparation of the manuscript (corresponding author)

Jens Tampe



Cecilia shing



xxvi

Bhavisha Bakrania

Preparation of animal ethics application

Collection of rat serum samples

Assistance in HPLC analysis of the rat serum samples

James Winearls

Preparation of manuscript


John Fraser


Karl-Heinz Wagner



Andrew C. Bulmer


Primary supervisor of the project


Assistance in the interpretation of data and statistical analysis

Assistance in the preparation, revision and editing of the manuscript

Kavita Bisht __________________02/06/2014

Corresponding author of the paper: Kavita Bisht

____________________________02/06/2014

Supervisor: Dr. Andrew C. Bulmer

____________________________02/06/2014

xxvii

Articles in press or published

Original Investigation

1. Bisht K., Wegiel B., Tampe J., Neubauer O., Wagner K-H., Otterbein L. E., Bulmer

A. C. Biliverdin modulates the expression of C5aR in response to endotoxin in part

via mTOR signaling. Biochemical and Biophysical Research Communications. 449:

94-99 (2014) (Chapter 3)

2. Bisht K., Tampe J., Shing C., Bakrania B., Winearls J., Fraser J., Wagner K-H.,

Bulmer A. C. Endogenous tetrapyrroles influence leukocyte responses to


inflammatory potential of biliverdin. Journal of Clinical and Cellular Immunology.

5: 1000218 (2014) (Chapter 5).

Publications by the Candidate Contained in the Thesis

xxviii

Articles in press or published

1. Bisht K, Wagner K.-H., Bulmer A.C. Curcumin, resveratrol and flavonoids as anti-

inflammaotry, cyto- and DNA protective dietary compound. Toxicology 278: 88-100

(2010).

2. Boon A.C., Hawkins C.L., Bisht K., Coombes J.C., Bakrania B., Wagner K-H.,

Bulmer A.C. Reduced circulating oxidized LDL is associated with

hypocholesterolemia and enhanced thiol status in Gilbers syndrome. Free Radical

Biology and Medicine 52: 2120-2127 (2012).

Additional Publications by the Candidate During Ph.D. Candidature not Included in

the Thesis

xxix

Poster Presentations

1. Bisht K., Ziesal G., Boon A.C., Merrin W., Bulmer A.C. Bile pigments inhibits LPS-

induced inflammatory signals in RAW 264.7 by decreasing the expression of TLR-4

and complement receptor 5a. The Fifth International Conference on Medical

Mechanisms Of Actions Of Neutraceuticals (ICMAN 5), Brisbane, Australia,

October 13th

to October 15th

2011.

2. Bisht K., Boon A.C., Merrin W, Bulmer A.C. Bile pigments inhibit the expression of

inflammatory genes (TLR-4, C5aR, TNF-α and IL-6) but elevate anti-inflammatory

gene (IL-1Ra) in macrophages. 37th

Annual Scientific Meeting of the Australian

Atherosclerosis Society, Adelaide, Australia, October 19th

to October 21st 2011.

3. Bisht K., Boon A.C., Bulmer A.C. Biliverdin protects RAW 264.7 cells against LPS-

induced inflammation and the effects of biliverdin are mediated by

phosphatidylinositol 3-kinase. Gold Coast Health & Medical Research Conference,

Gold Coast, Australia, December 1st

to December 2nd

2011

4. Bisht K., Wegiel B., Wagner K-H, Otterbein L.E., Bulmer A.C. Biliverdin protects

RAW 264.7 cells against LPS-induced inflammation: a role for BVR induced PI3K

signaling? TLROZ, Melbourne, Australia, from May 2nd

to May 4th

2012

5. Bisht K., Wegiel B., Wagner K-H., Otterbein L.E., Bulmer A.C. Biliverdin protects

RAW 264.7 cells against LPS-induced inflammation: a role for BVR induced PI3K

signaling? 7th International Congress on Heme Oxygenases and Related Enzymes

Edinburgh, from May 28th

to June 1st 2012

6. Bisht K., Wegiel B., Tampe J., Wagner K-H., Otterbein L.E., Bulmer A.C.

Biliverdin attenuates LPS-induced pro-inflammatory cytokine expression in whole

human blood. Gold Coast Health & Medical Research Conference, Gold Coast,

Australia, November 29th

to November 30th

2012.

Conference Presentations by the Candidate During Ph.D. Candidature

xxx

7. Bisht K., Wegiel B., Tampe J., Shing C., Wagner K-H., Otterbein L.E., Bulmer A.C.

Biliverdin attenuates LPS-induced pro-inflammatory cytokine expression in whole

human blood. Experimental Biology, Boston, USA, from April 20th

to April 24th

2013.

8. Bisht K., Bulmer A.C., Otterbein L.E., Wegiel B. Biliverdin acting via biliverdin

reductase inhibits the expression of C5aR in macrophages. HMS Surgery Research

Day, Harvard Medical School, Boston, May 11th

2013.

Oral Presentations

1. Bisht K., Li M., Bulmer A.C., Nemeth Z., Csizmadia E., Otterbein L.E., Wegiel B.

conditional deletion of biliverdin reductase in myeloid cells promotes chemotaxis by

C5a dependent mechanism. 43rd

Annual Scientific Meeting, Australasian Society for

Immunology, Wellington, New Zealand, from 2nd

to 5th

December 2013.

2. Bisht K., Li M., Bulmer A.C., Nemeth Z., Csizmadia E., Otterbein L.E., Wegiel B.

conditional deletion of biliverdin reductase in myeloid cells promotes chemotaxis by

C5a dependent mechanism. 8th

International Conference on Heme Oxygenase,

BioIron & Oxidative Stress, Sydney, Australia from 8th

October to 11th

October

2014.

xxxi

1. Griffith University International Postgraduate Research Scholarship.

2. Travel bursary award from TLROZ Conference, Melbourne, Australia.

3. Griffith Graduate Research Scholarship Conference Travel Grant.

4. Publication of the year: Boon A.C., Hawkins C.L., Bisht K., Coombes J.C.,

Bakrania B., Wagner K-H., Bulmer A.C. Reduced circulating oxidized LDL is

associated with hypocholesterolemia and enhanced thiol status in Gilbert’s

syndrome. Free Radical Biology and Medicine 52: 2120-2127 (2012) at Gold Coast

Health and Medical Research Conference, 28th

to 29th

November 2013.

5. International Research Staff Exchange Scholarship (to Vienna, Austria) from EU 7th

Framework Initiative and Australian Academy of Science.

Awards/Scholarship during Ph.D. Candidature

1

Chapter 1: Introduction

2

1.1 Thesis organisation

This thesis has been divided into three main studies. Chapter 3 describes study one

(published) concerning the in vitro effects of biliverdin (BV) on signalling pathway

activation, complement receptor 5a (C5aR) expression and pro-inflammatory cytokine

expression. Chapter 4 contains study two (ready to submit for publication) that

investigated the role of biliverdin reductase (BVR) on C5aR and macrophage

polarisation using bone marrow derived macrophages (BMDMs) obtained from

knockout murine models. Chapter 5 contains the third study (published), which

addresses the anti-inflammatory potential of exogenous BV and endogenous

unconjugated bilirubin (UCB) in an ex vivo LPS-whole human blood model.

1.2 Haem catabolism: an evolutionary perspective

Biliverdin (BV) and bilirubin (unconjugated and conjugated) are tetrapyrrolic

compounds, which are derived from catabolism of precursors with porphyrin structure

[1] and are considered as pigments of life [2,3]. The evolution of photosynthetic

porphyrin chlorophyll is one of the central events in the development of life on Earth

[4,5]. Most of the oxygen in our atmosphere is produced by oxygenic photosynthetic

organisms, including plants, cyanobacteria and other prokaryotes, leading to the

development of an oxygenated environment [6]. Without chlorophyll, development of

advanced eukaryotic life would not have occurred on Earth due to the presence of an

anaerobic environment [4,7]. As evolution progressed towards eukaryotic life, another

oxygen carrying porphyrin, haem, evolved [8]. Haem is mainly utilised for its oxygen

carrying capacity when incorporated into haemoglobin within erythrocytes, myoglobin

in muscle cells, mitochondrial cytochromes and cytochrome P-450 in hepatocytes [1].

Haem is iron-bound and can be highly toxic due to its ability to participate in oxidation-

reductions [1]. To regulate the concentration of potentially toxic haem, organisms

developed a mechanism by which haem could be degraded and recycled [9]. The rate-

controlling enzyme in haem catabolism is haem oxygenase (HO), which is also essential

for iron neutralisation in mammals and synthesis of essential light harvesting pigments

in cyanobacteria and higher plants [10]. The first step in haem catabolism requires

NADPH-dependent reduction of ferric iron to ferrous iron, which is mediated by

cytochrome p450 [1,10]. Haem oxygenase then cleaves the porphyrin ring at its α-

methylene carbon to release carbon monoxide (CO) and iron, generating BV as the

remaining enzymatic product [11]. Interestingly, BV functions as a precursor for the

3

synthesis of light-harvesting bilins in cyanobacteria, algae and higher plants, [9,10].

Biliverdin also contributes to the blue-green colouration of eggs and feathers of birds

[1,9,12]. Biliverdin is excreted intact in birds, reptiles and fish [12]. However, humans

and other mammals express biliverdin reductase (BVR), which chemically reduces BV

to UCB and, therefore, BV is normally undetectable in human blood [13]. Recently, a

unique case of hyperbiliverdinaemia, due to a defect in the BVR gene, was reported

[14]. The patient presented with a blocked bile duct (due to gall stone formation) and

mutation in the BVR gene, which together resulted in green coloration of plasma and

urine [14]. Interestingly, this observation indicates that BVR may not be necessary for

survival. However, it still remains unknown why humans reduce BV to UCB, which is

largely considered a waste product and is responsible for the yellow colouration of the

skin and sclera of the eyes of jaundice pre-term neonates (due to hepatic immaturity)

[15,16]. Interestingly, UCB can become neurotoxic in these babies, if levels exceed the

binding capacity of circulating albumin [17]. Due to the constant formation of UCB

from haem, mechanisms to regulate UCB excretion are thus required to maintain UCB

at apparently non-toxic concentrations. Bilirubin is both passively and actively absorbed

into the liver and requires glucuronidation prior to excretion [16]. This

glucuronidation/conjugation reaction is catalysed by uridine diphosphate

glucuronosyltransferase (UGT1A1) in another energy consuming reaction [13].

Conjugated bilirubin is then actively transported into the bile against a concentration

gradient, by the canalicular ATP-dependent transport protein MRP-2 (multidrug

resistant-related protein 2, ABCC2) and is eventually eliminated from the body via the

faeces [1,13,16]. The uniqueness of haem catabolism in humans and higher vertebrates

suggests that development of multiple energy-consuming reactions is necessary to

produce UCB, which may provide a survival/reproductive advantage.

Recent findings show salutary effects of both BV and UCB in animal models of

transplantation, sepsis and ischaemia-reperfusion injury (IRI), supporting the

importance of antioxidant, anti-inflammatory and cytoprotective properties of these

compounds [18,19]. Furthermore, BVR has also emerged as a pleiotropic molecule with

strong cell signalling and cytoprotective capabilities [20,21]. In addition, mildly

elevated concentrations of circulating UCB (≥17.1 µM; due to a mutation in the gene

promoter of UGT1A1) in Gilbert’s Syndrome, correlate with decreased risk of

cardiovascular disease [22], chronic pulmonary disease [23] and all cause mortality

[24]. These data suggest that BV’s chemical reduction to UCB is important and imparts

4

biologically relevant antioxidant potential upon this molecule. The antioxidant capacity

of UCB in mammals may be responsible for protecting against oxidative stress and the

subsequent liberation of inflammatory stimuli. Interestingly, however, UCB

concentration in blood shows a ‘U’ shape relationship with IL-1β (a pro-inflammatory

molecule) in humans [25]. Individuals with a lower UCB concentration of <17.1 µM

have low baseline concentration of IL-1β, however, UCB concentration >17.1 µM is

associated with increased baseline plasma IL-1β release in Gilbert’s Syndrome [25],

suggesting that UCB at higher concentration may promote inflammation.

The documented preliminary beneficial effects of BV, UCB and BVR led to this

Ph.D. research project, which aimed to assess the anti-inflammatory potential of BV,

UCB and BVR, and their cell signalling effects. This thesis provides novel insights into

the role of these molecules in in vitro, in vivo and ex vivo models of LPS-induced

inflammatory challenge.

1.3 Aims and Hypotheses

The major objective of this research project was to investigate the role of BV/BVR

kinase activity in cell signalling pathways and their protective effects against endotoxin-

mediated inflammation. The thesis addresses the following aims and hypotheses.

1.3.1 Aim 1: To investigate the anti-inflammatory and cell signalling effects of BV in

RAW 264.7 and murine BMDMs by assessing the phosphorylation status of

intercellular signalling molecules, and gene and protein expression of inflammatory

molecules, including C5aR and pro-inflammatory cytokines, in the absence/presence of

LPS.

Studies have identified cytoprotective effects of BV in various in vitro and in vivo

models of vascular injury, transplantation and inflammation [21,26,27]. Biliverdin also

reduces gene expression of TLR-4 and cytokines in vitro [28]. However, the effect of

BV on complement receptor expression has not been studied previously. The roles of

C5aR in various pathologies, including IRI, neurodegenerative disorders, inflammatory

bowel disease, atherosclerosis, age-related macular degeneration, rheumatoid arthritis

and sepsis are well documented [29,30,31,32]. Therefore, we aimed to assess the effect

of BV on C5aR and reveal a novel mechanism whereby BV inhibits C5aR expression in

primary and immortalised macrophages.

5

Hypotheses: Biliverdin reduces gene and protein expression of C5aR and cytokines,

including TNF-α and IL-6 in response to LPS exposure. Biliverdin induces phosphor-

activation of Akt and S6, which partially inhibits LPS-mediated C5aR expression via the

mTOR pathway.

1.3.2 Aim 2: To investigate the role of BVR deletion on C5aR, and macrophage

chemotaxis and phenotype.

Growing evidence demonstrates that BVR is not merely an enzyme required for

haem catabolism but that it plays a crucial role in physiology, pathophysiology, cell

growth, apoptosis, metabolism, regulation of gene expression and cell signalling

[33,34]. Therefore, this study aimed to assess the effects of conditional deletion of BVR

using a Cre-recombinase system in mice to examine C5aR function, and macrophage

chemotaxis and macrophage phenotype.

Hypotheses: Conditional deletion of BVR in murine derived myeloid cells augments

C5aR expression, macrophage chemotaxis towards C5a and promotes the development

of an M1 macrophage phenotype after LPS and IFN- stimulation. The regulatory

effects of BVR are mediated in part by C5aR.

1.3.3 Aim 3: To investigate the effects of BV and UCB on LPS-induced cytokine

transcription and release in a pre-clinical ex vivo model of inflammatory challenge in

whole human blood.

Although, BV and UCB generally protect against inflammation and tissue injury

induced by LPS, transplantation and IRI in cell culture and rodent models [21,26,27]

there remains a paucity of information regarding the immuno-modulatory effects of BV

and UCB in humans. In this study, whole blood was drawn from human subjects and

treated with BV (50 µM) or solvent control in the presence or absence of LPS for 4-8 h.

Gene expression and secretion of both pro- and anti-inflammatory cytokines into plasma

were assessed. To confirm a possible effect of endogenous UCB on IL-1β release in

vivo, blood samples were also collected from mutant hyperbilirubinaemic Gunn rats.

Hypotheses: Exogenous BV decreases gene expression and secretion of pro-

inflammatory cytokines in response to whole blood LPS exposure. Increasing

concentration of endogenous UCB in humans and rats is associated with increased

expression and release of pro-inflammatory cytokines, including IL-1β.

6

2.4 Results and summaries

1.4.1 In vitro study

The first study, outlined in Chapter 3, investigated the impact of BV on C5aR gene

and protein expression and the mechanisms regulating this effect. In addition, the effect

of BV on cell signalling was also assessed. An immortalised mouse macrophage cell

line (RAW 264.7) and primary macrophages derived from murine bone marrow were

used in this study. The results suggest that BV (at 50 µM) reduces the expression of

C5aR in cultured primary and immortalised macrophages. Biliverdin and LPS also

induced the phosphorylation of Akt and S6 kinase (downstream kinases of mTOR

pathway). Biliverdin and LPS-induced phosphorylation of Akt and S6 was inhibited in

the presence of LY294002 (inhibitor of PI3K) and rapamycin (inhibitor of mTOR),

respectively. Biliverdin exerted inhibitory effects on LPS-mediated C5aR expression,

which were partially mediated via signalling through the mTOR pathway. Biliverdin

also mitigated the LPS-induced increase in cytokine expression and release, including

TNF-α and IL-6, suggesting additional anti-inflammatory effects of BV. In summary,

BV mitigates LPS-dependent expression of C5aR and associated pro-inflammatory

cytokines, with the inhibitory effect of BV on C5aR being partially dependent upon

activation of the mTOR signalling pathway.

1.4.2 In vivo study

The second study, outlined in detail in Chapter 4 describes work conducted at Beth

Israel Deaconess Medical Centre, Harvard Medical School, Harvard University,

(Boston, USA). This study aimed to assess whether BVR regulates macrophage

chemotaxis towards complement component C5a, and whether such an effect is

mediated by reduced C5aR expression, as documented in Chapter 3. The study also

investigated the effects of BVR deletion on macrophage phenotype. The study was

performed in primary macrophages isolated from BVRfl/fl

(control) and CreLyz:BVR

fl/fl

mice (conditional deletion of BVR in myeloid cells). Bone marrow derived

macrophages (BMDM) from CreLyz:BVRfl/fl

mice showed enhanced basal gene and

protein expression of C5aR. Furthermore, deletion of BVR in BVR competent BMDMs

promoted macrophage chemotaxis towards C5a, an effect that was abrogated after

blocking the C5aR using a neutralising antibody. Macrophages isolated from

CreLyz:BVRfl/fl

mice also had significantly increased pro-inflammatory iNOS gene and

7

protein expression and increased TNF-α release in response to LPS and IFN- exposure.

These effects were blocked in the presence of a neutralising antibody against C5aR,

curiously suggesting that C5aR plays an important role in macrophage chemotaxis and

polarisation towards M1 in CreLyz:BVRfl/fl

mice. In summary, this study showed that

deletion of BVR promotes macrophage chemotaxis in response to C5a and macrophage

polarisation towards the M1 phenotype and these effects appear to be mediated partially

via C5aR.

1.4.3 Ex vivo study

The third and final study outlined in Chapter 5 explored the effects of exogenous

BV and endogenous UCB on cytokine expression and release in a pre-clinical model of

LPS-induced inflammation in whole blood. This study is important because human

responses to BV have not been published thus far, and it extends the findings in

Chapters 3 and 4 regarding anti-inflammatory effects of BV/BVR by testing their

potential relevance in an ex vivo human blood model. Whole human blood was co-

incubated with BV LPS for 4 and 8 h. RNA was extracted for gene expression

analysis (4 h) and plasma was collected to quantitate cytokine release (8 h). The results

indicated that BV significantly decreased LPS-induced gene expression of IL-1, IL-6,

IFN-, IL-1Ra and IL-8. Biliverdin at 50 µM also reduced IL-1 and IL-8 release from

leukocytes in response to LPS. A further interesting finding was that increasing baseline

UCB concentration (in the absence of added BV) was associated with increased LPS-

mediated gene expression of IL-1, IFN-, IL-1Ra and IL-8. Furthermore, Gunn rats (an

animal model of endogenous hyperbilirubinaemia) exhibited higher baseline IL-1

serum concentrations compared to wild-type controls. In addition, gene expression of

C5aR was also assessed in human blood samples. Lipopolysaccharide stimulation

significantly decreased C5aR gene expression and BV alone also tended to reduce C5aR

expression. These findings further support the anti-inflammatory efficacy of BV in a

pre-clinical human model and suggest that UCB at higher concentrations may heighten

inflammatory responses to LPS by a mechanism which currently remains unknown.

8

Chapter 2: Literature Review

9

2.1 Immune responses to pathogens

All multi-cellular organisms, including humans protect themselves against invading

pathogens using dedicated immune defence systems (innate and adaptive immune

systems). The Innate immune system is responsible for coordinating the initial response

against pathogens and serves as first lines of defence. Adaptive immune responses are

required only when the innate defence is overwhelmed or evaded [35,36]. The innate

immune system is equipped with anatomic, physical and chemical barriers, effector

molecules (e.g. lysozyme, complement, acute phase proteins) and specialised cells with

phagocytic and lytic abilities [37,38]. The anatomic, physical and chemical barriers

provide the initial defence by secreting various soluble proteins, including sebum and

mucous, secreted by sebaceous glands of skin and goblet cells of small intestine,

respectively [39]. In addition, innate immune cells (e.g. neutrophils and macrophages)

sense pathogens by pattern recognition receptors (e.g. Toll like receptors; TLRs), which

recognise the molecular patterns unique to pathogens, leading to their internalisation

and elimination [40,41]. Furthermore, influx of phagocytic cells into tissue triggers

inflammation, characterised by the secretion of pro-inflammatory cytokines (e.g. TNF-

α, IL-1 and IL-6) [42,43,44,45].

Adaptive immunity also recognises and selectively eliminates foreign pathogens.

Unlike innate immune responses, adaptive responses are reactions to higly specific

antigens. Adaptive immunity mediates its effector functions, including specificity,

diversity, memory and recognition of self/non-self antigens via two major groups of

cells: lymphocytes and antigen presenting cells (APCs) [46]. The two major populations

of lymphocytes are B- and T-lymphocytes, and are both formed in bone marrow.

Notably, B-cells mature in bone marrow whereas T-cells migrate to the thymus gland to

mature and, therefore, are also called as thymocytes [47]. Interaction of B- and T-cells

with antigens generates humoral and cell mediated responses, respectively. In humoral

responses, interaction with an antigen promotes proliferation of B-cells and

differentiation into antibody-secreting plasma cells [48]. Generated antibodies then bind

to antigens and facilitate their elimination. However, T-lymphocytes can only recognise

antigens that are bound to major histocompatibility complex (MHC) I and II [49]. The

antigen presenting cells, including macrophages, B-cells and dendritic cells (DCs),

internalise antigens by phagocytosis and then display part of that antigen by expressing

MHC-II molecules on their surface [38]. In addition, APCs also deliver co-stimulatory

10

signals (CD80, CD86 and CD40) to activate T-lymphocytes [50]. T-lymphocytes are

composed of three-cell populations: T-helper (Th; CD4+ cells), T-cytotoxic cells (TC

cells; CD8+) and T-suppressor cells (T-regulatory cells) [36]. Once T-helper cells

recognise and interact with antigen-MHC-II complexes, they become activated and

secrete Th1, Th2 and

Th17 cytokines [47]. Cytotoxic T cells recognise antigen-MHC-I

molecules (present on all nucleated cells) under the influence of Th cytokines and

differentiate into cytotoxic T lymphocytes to eliminate the antigens, including virus

infected cells, tumor cells and cells from a foreign tissue graft [47,49]. However,

regulatory T cells (Treg), designated as CD25+

and forkhead box P3 (Foxp3) positive

cells inhibit the activation of T-cells and have been shown to protect from immune-

mediated disorders [47,51].

The innate and adaptive immune responses are tightly regulated and allow

maintenance of tissue homeostasis. However, failure to properly regulate these immune

responses may result in persistent pathological damage to the tissues due to the

induction of chronic inflammation [36].

2.2 Inflammation

Inflammation is a natural response of the host to tissue injury that is caused by

pathogen associated molecular patterns (e.g. bacterial and fungal infection) or by

damage associated molecule patterns (DAMP) that are generated in response to sterile

injury and necrosis, such as burn, hypoxia, heat shock proteins and chemical insult

[52,53]. The main purpose of inflammation is to restore tissue homeostasis/structure

and protect against noxious stimuli, including infection or sterile inflammation causing

agents [44]. There are two stages of inflammation: acute and chronic phase. Acute

inflammations is highly regulated process, involving both signals that initiate and

maintain inflammation as well as those that lead to resolution of the inflammatory

cascade and promote healing [54]. The main feature of acute inflammation is the

exudation of plasma and fluid proteins (oedema), followed by migration of leukocytes

from the circulation to the tissue [44,55]. In the first phase, leukocytes are recruited

from the circulation to the site of damage and by removing necrotic/apoptotic cells,

allow healing of the affected tissues that otherwise may cause excessive injury to the

host tissue [54,55].

11

Neutrophils are the first cells to extravasate to the site of injury (within mintues

to hours) and are followed by monocytes. Leukocytes interact with endothelial cells

(ECs) to transmigrate into the tissue, a process which is mediated by selectins, integrins

and cell adhesion molecules, including intercellular adhesion molecule-1 (ICAM-1) and

vascular cell adhesion molecule-1 (VCAM-1) [55]. Once in the tissue, leukocytes

release growth factors, cytokines, chemokines, lipid mediators and reactive oxygen

species (ROS), which further promote inflammation [44,55]. However, when acute

inflammation is uncontrolled and persists (e.g. when the pathogen cannot be destroyed),

inflammation can progress into a chronic phase. This phase of inflammation then

promotes persistent tissue damage, followed by tissue fibrosis, scarring and necrosis

and eventually may result in several pathological conditions such as neurodegenerative,

autoimmune, sepsis, respiratory and cardiovascular disorders [52].

2.3 Inflammatory cells

2.3.1 Neutrophils

Neutrophils are pivotal cells of the immune system and serve as a first line of

defence against pathogens during acute inflammation. They also play a key role in

activating other immune cells, including monocytes, macrophages, epithelial cells and

ECs [43,56]. Neutrophils were first identified by Elie Metchnikoff in starfish larvae

[56]. In this seminal work, it was demonstrated that injury of the larvae resulted in

recruitment of phagocytic cells. These cells were named as “polymorphonuclear

leukocytes (PMNs)” due to the presence of uniquely lobulated nucleus [56,57]. Further,

Paul Ehrlirch discovered that PMNs have a tendency to retain neutral dye (mixture of

basic and acid dyes) and, therefore, named them as neutrophils [58]. Neutrophils have

very short life span with a half-life in blood of approximately 11 h in mice and 6-8 h in

humans [59]. However, the results of Pillay et al. [60] recently challenged the previous

study regarding the short half life of neutrophils in humans, proposing that neutrophils

exist in the circulation for 5.4 days. The results of this study received criticism due to

the methodological approach used to estimate neutrophils life-span. For example,

deuterium-labeled water was given orally to human subjects, which also labels bone

marrow neutrophils, leading to overestimation of neutrophils longevity in blood [61,62].

Nevertheless, inflammatory reactions including the presence of pro-inflammatory

cytokines and bacterial compounds such as lipopolysaccharide (LPS) extend neutrophil

12

life, increasing the likelihood of damage occurring to host tissues [43,63]. Neutrophils

are continuously produced from their myeloid precursor in bone marrow under the

control of granulocyte colony stimulating factor (G-CSF). The daily production of

neutrophils in bone marrow varies from 5 x 1010

- 1 x 1011

cells with circulating

numbers approximating 2.5 x 109/L - 7.5 x 10

9/L. Neutrophil numbers increase

significantly under acute inflammatory conditions [64]. For example, the number of

neutrophils in blood increased from 1 x 109/L up to 11 x 10

9/L in mice challenged with

LPS (30 g/100L; i.p) [65]. Once activated, neutrophils release a plethora of

chemotactic factors that recruit other immune cells to the site of inflammation,

including macrophage inflammatory protein-1alpha (MIP-1α) and MIP-1β and

chemokine receptors such as CXCR-2 and CXCR-4 [59,64]. Neutrophils also synthesise

multiple complement components (C3a and C5a) and their receptors (C3aR and C5aR),

TLR-2 and TLR-4, pro-inflammatory cytokines including tumour necrosis factor-alpha

(TNF-α), interleukins (IL-1, IL-6 and IL-8) and generate ROS and bactericidal enzymes

(myeloperoxidase; MPO) to assist in pathogen removal and breakdown [56].

Neutrophils eliminate pathogens via three pathways: i) phagocytosis, ii)

formation of neutrophil extracellular traps (NETosis) and iii) degranulation (Figure 2.1)

[43,57]. During phagocytosis, the pathogen is first recognised by cell surface receptors

and is then internalised by the cell membrane into a vacuole called a phagosome. A

toxic environment to the pathogens is created via two mechanisms: i) the phagosome

undergoes maturation upon fusion with neutrophil granules, which results in the release

of anti-microbial content (cathepsins, defensins, lactoferrin and lysozyme) into the

phagosomal lumen and ii) the phagosomal membrane assembles with NADPH oxidase

that leads to superoxide radical generation [57]. Neutrophils also produce NETs to

eliminate dangerous stimuli, including microorganisms (e.g. Shigella flexeneri,

Streptococcus pyogenes, Bacillus anthraci, Mycobacterium tuberculosis and Candida

albicans) [56]. NETs are composed of decondensed chromatin DNA and granular

proteins, which are capable of trapping both gram-positive and gram-negative bacteria.

NET formation is dependent on the generation of ROS with the enzyme MPO being a

very important component. Myeloperoxidase is released by activated neutrophils to

mediate immobilisation/destruction of bacteria and plays an indispensable role in the

rapid generation of ROS, also referred to as the oxidative burst [57]. Degranulation is a

crucial event in neutrophil activation and is involved in several inflammatory disorders,

13

including septic shock, rheumatoid arthritis and acute lung injury [66]. Neutrophils are

composed of three types of granules: i) azurophilic (primary), which contain MPO, ii)

specific (secondary) granules containing lactoferrin and iii) gelatinase (tertiary)

granules, comprising of matrix metalloproteinase (MMP)-9 [56]. MMP-9 is a critical

extracellular matrix-digesting enzyme that promotes the removal of DAMP-containing

intracellular matrix proteins [43]. At the site of inflammation, activation of neutrophils

promotes mobilisation of primary and secondary granules. These granules either fuse

with the phagosome or with the plasma membrane to release their anti-microbial

contents into tissue to promote clearance of the bacteria [43,57]

14

Figure 2.1: Elimination of microorgansims by neutrophils. Neutrophils destroy

pathogens via three major pathways including engulfment of the pathogen

(phagocytosis), degranulation or production of NETs. Sourced from Nature Publishing

Group [43].

Induction of these three pathways requires activation of the NADPH-oxidase

complex to facilitate elimination of dangerous stimuli. The NAPDH oxidase complex

within the phagosome or plasma membrane initiates ROS production by reducing

molecular oxygen to superoxide [57]. Superoxide is rapidly converted to H2O2, a

damaging oxidant, by superoxide dismutase (SOD). Superoxide can also react with

nitric oxide (NO), which is generated at high levels at the site of inflammation by

inducible nitric oxide synthase (iNOS), to form the oxidant peroxynitrite [67,68]. In

addition, upon degranulation, MPO can also react with H2O2 and chloride to form

hypochlorus acid (HOCl), the active component of household bleach, which possesses

potent microbicidal activity [69].

15

2.3.2 Macrophages

Macrophages are essential constituents of the immune system and play a

multifaceted role in both the innate and adaptive immune responses [70]. These cells

were first discovered by Elie Metchnikoffas, who observed their phagocytic behaviour

in starfish larvae and were believed to be responsible for neutralisation and elimination

of pathogens [45]. Macrophages are mononuclear and heterogenous cells that

differentiate from monocytes under the influence of differentiation factors, including

granulocyte-macrophage colony stimulating factor (GM-CSF), macrophage colony

stimulating factor (M-CSF) and colony stimulating factor (CSF)-1 [71]. In addition, in

response to inflammation, monocytes are recruited to the tissues upon release of

chemoattractants at the site of injury (e.g. monocyte chemoattractant protein-1 (MCP-

1), MIP-1 and MIP-1) by neutrophils [57]. Macropahges are ubiquitously distributed

in every tissue and organ and are named according to the tissue they reside within. For

example, Kupffer cells in the liver, microglial cells in the brain, splenic macrophages in

the spleen, alveolar macrophages in the lungs, Langerhans cells in the skin and

osteoclasts in the bones, are all macrophages that are specifically differentiated, serving

as sentinel cells within tissues [45,70,71,72].

The function of macrophages is affected by their polarisation state, which is

influenced by local cytokine exposure. For example, IFN- induces classical (M1

polarisation) macrophage differentiation while IL-4 or IL-13 promotes alternative (M2

polarisation) macrophage formation (Figure 2.2) [45,55,73]. M1 macrophages are pro-

inflammatory cells with increased expression of pattern recognition receptors and pro-

inflammatory cytokines (TNF-α, IL-6 and IL-1; Figure 2.2). However, M2 cells are

characterised by an anti-inflammatory phenotypes and show enhanced production of IL-

10, transforming growth factor-β (TFG-), nuclear receptors (liver X receptors), and

prostaglandins (e.g prostaglandin E2; Figure 2.2) [74].

Once activated by stimuli, including LPS, interferons or other microbial products,

macrophages express a myriad of receptors; including TLRs, complement receptors,

cytokines, chemokines, growth factors and ROS. These molecules are required for the

major activities of macrophages, including phagocytosis or opsonisation of pathogens,

generation of cytokines and chemokines, chemotaxis and antigen presentation, leading

elimination of microbes and the healing of tissues [44,45]. However, continuous

16

activation of macrophages leads to the release of IFN-, IL-1 and TNF- that can

result in tissue fibrosis and injury, characterised by chronic inflammation.

Figure 2.2: Monocytes differentiate to macrophages under the influence of M-

CSF/GM-CSF. Macrophages are polarised in vitro by IFN-/LPS or IL-4/IL-13 into

M1 or M2 cells. M1 macrophages are considered pro-inflammatory and express TLRs,

complement receptors in addition to promoting the release of cytokines and

chemokines. M2 macrophages are considered anti-inflammatory and express anti-

inflammatory cytokines, nuclear receptors and prostaglandins.

2.3.3 Endothelial cells

The endothelium was previously considered merely an inert lining of blood

vessels, however, recent findings indicate that endothelial cells (ECs) are critical players

17

in inflammation and change their phenotypes to modulate inflammatory processes [75].

The endothelium controls a number of processes, including platelet adhesion and

aggregation, vascular tone, leukocyte entry and migration into tissues and the vascular

wall, in addition to regulating vascular smooth muscle cell (VSMC) proliferation

[76,77]. The endothelium normally acts as a barrier to the free entry of molecules and

separates the blood elements from the extra-vascular tissues. The endothelium can be

activated via a number of factors, including exposure to infectious pathogens, TLRs,

cytokines, LPS, complement, shear stress, ROS and by products of coagulation

pathways (thrombin and fibrinogen). Each of these factors increases endothelial

vascular permeability and leukocytes infiltration under pathological conditions,

including sepsis, atherosclerosis, trauma or adult respiratory distress syndrome [75].

The endothelium maintains vascular tone/homeostasis by releasing prostacyclins,

leukotrienes and generating NO from its precursor, L-arginine via the enzymatic action

of endothelial nitric oxide synthase (eNOS) [78,79]. Endothelial cells adhere to each

other through junctional structures, which are formed by trans-membrane cell adhesive

proteins. Three types of junctions are expressed by ECs: i) tight junctions (e.g.

occludins, claudins, junctional adhesion molecule), ii) adherence junctions (e.g.

cadherins and catenins) and iii) gap junctions (e.g. connexins) [77,80]. These juncitonal

proteins play a crucial role in regulating leukocyte extravasation, controlling the

exchange of plasma proteins from the blood to tissues, cell-to-cell communication,

endothelial cell growth and apoptosis [80,81].

Quiescent ECs do not interact with leukocytes and express low levels of cell

adhesion molecules (CAMs), such as P and L-selectin, ICAM-1 and VCAM-1 [79].

Failure of the organisms to appropriately regulate the normal function of ECs results in

endothelial dysfunction. Two important hallmarks of endothelial dysfunction include: i)

impaired NO production, which promotes vasoconstriction, platelet aggregation and

leukocyte-endothelial interaction [78] and ii) increased expression of CAMs, which

further promotes firm adhesion of leukocytes, leading to their migration into the

interstitium [55]. During inflammation, leukocytes migration into tissues relies upon

leukocyte interaction with ECs (Figure 2.3), which is mediated by the expression of

selectins (e.g. L-selectin is present on leukocytes and P- and E-selectins are present on

ECs) [82,83]. Activated leukocytes respond to chemoattractant molecules, including

C5a and IL-8 and platelet activated factors and result in up-regulated expression of

18

integrins on ECs [84]. Subsequently, integrins promote firm attachment of leukocytes to

ECs by binding to their ligands, including ICAM-1 and VCAM-1 (Figure 2.3).

Leukocytes roll on ECs (mediated by non-covalent interaction with selectins) until

activated integrins bind convalently with I/VCAM, where they can migrate into the

interstitium. Once leukocytes are attached via their integrins, they migrate into tissues

with the assistance of platelet endothelial cell adhesion molecules, which are present in

close association with endothelial intercellular junctions [55]. Therefore, the

endothelium is a key regulator of leukocyte extavasation into the tissues and

endothelium dysfunction can exacerbate inflammation and associated disorders via

promoting leukocyte migration.

19

Figure 2.3: Leukocytes and endothelium interaction. Leukocytes interact with ECs

in response to stimulation, which increases the expression of selectins on both

leukocytes and ECs. Leukocytes then attach to ECs firmly via integrin binding to CAMs

(VCAM-1/ICAM-1) and then migrate into tissues. In addition, cytokines, chemokines

and growth factors released by macrophages also activate endothelium.

2.4 Nuclear factor kappa B in inflammation

A major transcription factor that regulates leukocytes activation is nuclear factor

kappa B (NF-B). NF-B targets numerous genes, including pro-inflammatory

cytokines (TNF-, IL-6 and IL-1), inducible enzymes (cyclooxygenase (COX)-2 and

iNOS), pro-apoptotic (caspase-8, Bcl-Xs and TNF--related apoptotic inducing ligand)

and anti-apoptotic genes (Bcl-XL) and cell adhesion molecules (VCAM-1 and ICAM-1)

20

[85,86]. NF-B was first identified by Sen and Batimore [87] as a B-cell specific

transcription factor, which binds the B site in the Ig light chain enhancer. However,

recent studies show that NF-B is not exclusive to B-cells and can be induced by

classical and alternative pathways in many cell types, including macrophages and ECs

[88]. The classical pathway is triggered by pro-inflammatory cytokines, bacterial and

viral products (LPS, double stranded RNA, sphingomyelinase), physical stress (UV

light gamma irradiation and ROS) and growth factors (vascular endothelial growth

factor and platelet derived growth factor) [89]. The alternative pathway is activated in

response to TNF--family members (lymphotoxin-α and-β), B-cell activating factor

belonging to TNF--family receptor (BAFF-R) or CD40 ligand [90].

NF-B is a hetrodimer of NF-B1 (p50) and NF-B2 (p52), which are synthesised

from precursor p105 and p100, respectively and RelA (p65)/RelB/cRel [91]. NF-B is a

conserved transcription factor, with members of the NF-B family found in Drosophila

(Dorsal, Dif and Relish) and Cnidarians (Nv-NF-B). The most ubiquitous NF-B

dimer in mammalians is the p50/p65 heterodimer. To exert a transcriptional effect, NF-

B needs to be translocated to the nucleus from the cytoplasm (Figure 2.4). In an

unstimulated state, NF-B is held in cytoplasm in an inactive form, bound to the

inhibitor of κ B family (IB, IB, IB, IB and IB) [88,92]. Activation of NF-

B by classical stimuli and by the alternative pathway occurs by the activation of IB

kinase complex (IKK) (Figure 2.4) [89,90]. The activated IKK complex phosphorylates

IB and subsequently degrades it by ubiquitination via two homologous kinase subunits

(IKK and IKK, also known as IKK1 and IKK2, respectively) and one regulatory

subunit (IKK, also known as NEMO) [88,89,91]. The phosphorylation of IB releases

NF-B dimers (p50/p65) and leads to translocation of p50/p65 to the nucleus, where it

binds to DNA and activates transcription of several immuno-modulatory genes [92].

Excessive or prolonged activation of NF-B has been implicated in several immune

disorders, including sepsis, autoimmune disorders (e.g rheumatoid arthritis, multiple

sclerosis) and cardiovascular diseases [92]. Furthermore, NF-B promotes leukocytes

infiltration by increasing the expression of CAMs and chemokines on ECs, leading to

progression of inflammation in tissues [88].

21

Figure 2.4: Activation and translocation of NF-B from cytoplasm to nucleus,

triggered by phosphorylation of IkB in response to NF-B activating stimuli. Modified

from Abraham et al. and sourced from Oxford University Press [93].

2.4 Nitric oxide and nitric oxide synthase in inflammation

Nitric oxide is a gaseous bioactive product of mammalian cells and is produced

by three different isoforms of nitric oxide synthase (NOS), including neuronal (n)NOS,

eNOS and iNOS (Figure 2.5).

Both nNOS and eNOS are constitutively expressed. In the central nervous

system, nNOS maintains synaptic plasticity (i.e. phenomena such as long term

potentiation and long term inhibition), which plays an important role in modulating

functions, including memory, learning and neurogenesis (Figure 2.5) [94]. In the

peripheral nervous system, NO from nNOS acts as a neurotransmitter and induces

relaxation of smooth muscle cells (SMCs) [94]. Nitric oxide production from eNOS

plays a pivotal role in endothelial homeostasis as described in previous sections [77].

22

However, inflammation impairs NO production from eNOS and reverses NO-mediated

regulatory effects due to excessive NO generation by iNOS. Exposure of macrophages

to LPS or inflammatory cytokines (TNF-, IL-1 and IFN-) induces the production of

NO from iNOS [95,96]. Nitric oxide from iNOS reacts with superoxide anion and forms

the potent oxidant, peroxynitrite, which is an anti-microbial molecule. However,

excessive generation of peroxynitrite leads to oxidative cellular damage, nitration and

S-nitrosylation of proteins [94,97]. Nitric oxide from iNOS targets sulfhydryl groups on

proteins for oxidation and forms nitrosothiol compounds [98]. Nitric oxide also

activates poly-ADP-ribose polymerase (PARP) and results in single stranded DNA

breakage [99]. Furthermore, continuous generation of NO from iNOS contributes to

various inflammatory disorders, including septic shock (Figure 2.5) by promoting

arteriolar vasodilation, hypotension and microvascular damage [94,98].

23

Figure 2.5: Important functions of the three isoforms of nitric oxide synthase

(NOS). Adapted from Forstermann et al. and sourced from Oxford University Press

[94].

2.5 Toll like receptors in inflammation

Toll like receptors belong to the pattern recognition receptor (PRR) family of

receptors due to their ability to recognise highly conserved molecular patterns, which

are present on pathogens [40,41]. Toll like receptors were first identified in Drosophila

by Nusslein-Volhard [100]. Thus far, 10 human and 13 mouse TLRs have been

identified and are broadly expressed on neutrophils, macrophages, DCs, SMCs and ECs

[41]. The ligands of TLRs can be divided into two categories: exogenous and

endogenous (Figure 2.6) [100]. Microbial products including LPS, lipoteichoic acid,

peptidoglycan and lipopeptides represent exogenous ligands. Endogenous ligands

include minimally modified low-density lipoprotein (LDL), heat shock protein, nuclear

proteins, fibrinogen, heparan sulphate, hyaluronan, high-mobility group box 1

24

(HMGB1) protein, surfactant protein-A and haem [101,102,103]. Toll like receptors are

type I transmembrane receptors with highly conserved Toll/interleukin-1 (TIR) receptor

motifs [104]. All TLRs bind to a variety of ligands (Figure 2.6); e.g. TLR-1, 2, 4 and 6

recognise lipoproteins and lipoteichoic (LTA) acids from gram-positive bacteria and

lipoarabinomannan from mycobacteria. Double stranded RNA from viruses and gram

negative bacterial components including LPS serve as ligands for TLR-3 and TLR-4,

respectively. TLR-5 mediates responses to flagellin present in both gram positive and

negative bacteria. TLR-7 and 8 binds to single stranded RNA of viruses and TLR-9

recognises unmethylated CG dinucleotides (CpG motifs) [104,105].

Furthermore, TLRs also recognise DAMPs, which are important inflammatory

stimuli released by immune cells or tissues in response to infection or injury. These danger

signals stimulate release of pro-inflammatory mediators, including cytokines, growth factors

and ROS via TLR activation, promoting tissue injury and inflammation [106]. Toll like

receptors, with the exception of TLR-3, trigger a well defined signalling cascade (Figure 2.6)

in response to pathogen activation via a family of adaptor proteins, including myeloid

differentiation factor (MyD88), TIR domain containing adaptor protein (TIRAP), toll

receptor associated activator of interferon (TRIF), TRIF related adaptor molecule (TIRAP)

and toll-receptor associated activator (Figure 2.6). These adaptor proteins induce activation

of NF-B, phophatidylinositol 3-kinase (PI3-K) and mitogen activated kinases (MAPK),

which are crucial for transcription, mRNA stability and translation of pro-inflammatory

cytokine genes within leukocytes [101,104,105]. Toll like receptors serve as a link between

innate immunity and adaptive immunity via activating and promoting the maturation of DCs,

increasing expression of MHC, co-stimulatory molecules and amplifying DCs ability to

activate T-cells [104].

25

Figure 2.6: Toll like receptors, their ligands and signalling pathways.

2.6 Complement in inflammation

Complement is an important constituent of the innate immune system and was

first identified as a heat-sensitive factor in fresh serum that “complements” the killing of

bacteria [107]. Complement also plays an important role in adaptive immunity,

modulating both the humoral and cell-mediated immune responses [108]. The main

function of complement is to recognise pathogens and eliminate them either by their

opsonisation or permeabilisation. In addition, components of complement also

participate in the clearance of apoptotic and necrotic cells [109,110]. However,

excessive complement activation is associated with the development of many

pathological conditions including sepsis, neurodegenerative, cardiovascular and

autoimmune disorders (e.g. rheumatoid arthritis, multiple sclerosis) [107,111].

Complement is activated via four different pathways: the classical, lectin, alternative

26

and recently discovered extrinsic pathways (Figure 2.7). The classical, lectin and

alternative pathways share the common central component C3, whereas, the protease

pathway is independent of C3 [107,112]. Each pathway is activated by different

complement proteins. For example, the classical pathway is activated by component C1

after activation by immunoglobin (Ig)G, IgM immune complexes and C-reactive protein

(CRP). The lectin pathway is triggered by either mannose binding lectin or ficolin

[113]. The alternative pathway can be initiated by LPS or by carbohydrates, lipids or

proteins present on bacterial surface [110]. Complement activation by classical, lectin

and alternative pathways induce the formation of complement activation products

including anaphylatoxins (e.g. C3a and C5a) and their receptors (C3aR, C5aR and

C5L2) (Figure 2.7), which play critical roles in amplifying inflammation [114]. The

extrinsic pathway is activated by proteases (Figure 2.7), generated from neutrophils and

macrophages, which act with C5 to promote the release of C5a. In addition, thrombin,

component of the coagulation pathway, also generates C5a to link haemostatic

processes to inflammation [107,115].

27

Figure 2.7: Complement activation pathways. Complement is activated by classical,

lectin, alternative and extrinsic pathways. Each pathway generates small anaphylatoxins

called C3a, C5a and opsonins, including C3b and C5b. C5b interacts with other

complement components, leading to the formation of the membrane attack complex

(MAC).

2.6.1 Anaphylatoxin and their receptors

Stimulation of complement activation pathways generates complement

components, including C3, C4 and C5. In response to stimulation by infection or tissue

injury, complement activation is accelerated and results in the generation of two types

of fragments: i) small fragments (C3a, C4a and C5a) and ii) large fragments (C3b, C4b

and C5b). C3a, C4a and C5a are classified as anaphylatoxins due to induction of

systemic anaphylactic shock when produced in large amounts [116]. C3 is mainly

synthesised in the liver and is comprised of 110 kDa α- and 75kDa β-chains. As

indicated previously, C3a is a smaller complement fragment of C3 and is composed of

77-amino acids [117]. The second component C4 is also produced in the liver and is

synthesised as a single chain, which is consequently processed into three shorter

28

polypeptide chains (α, β and γ) [117]. The C5 component is an 188kDa protein and

comprised of 115kDa α- and 75kDa β-chains. C5 is mainly produced by hepatocytes;

however, other cells including neutrophils, macrophages and ECs also secrete C5

[111,113]. All of the previously mentioned anaphylatoxins contain a carboxyl-terminal

arginine residue, which is cleaved by serum carboxypeptidase to generate desarginine

(desArg). Both C3a and C5a are small polypeptides consisting of 77 and 74 amino-

acids, respectively [116,118], and C5a possesses immunomodulatory activities;

however, the function of C4a is not well described [117]. Both C3a and C5a target a

broad range of immune and non-immune cells and induce a multitude of inflammatory

responses. For example, anaphylatoxins mediate the oxidative burst in macrophages,

neutrophils and eosinophils, contraction of SMCs, histamine release from mast cells,

basophils, in addition to increasing vascular permeability [116,118]. Among the

anaphylatoxins, C5a is the most potent and also serves as a strong chemoattractant for

macrophages, neutrophils, activated B and T cells [118]. C5a signalling induces varied

effects on different cell types. For example, C5a induces phagocytosis by neutrophils

and macrophages, degranulation of leukocytes, H2O2 production via neutrophils,

chemokine and cytokine release from leukocytes and cell adhesion molecule (P-

selection) expression on ECs [117,119,120]. In addition, C5a also stimulates

coagulation in sepsis by increasing platelet counts and plasma fibrinogen levels [121]

The anaphylatoxins C3a and C5a exert their effects by binding to a family of

receptors, including C3a receptor (C3aR), C5a receptor (C5aR, CD88) and C5a

receptor-like 2 (C5L2). No specific receptor for C4a has been described thus far. C3aR

and C5aR belong to family of G-protein coupled receptors (GPCRs). C3aR, C5aR and

C5L2 are 54 kDa, 42kDa and 37kDa proteins, respectively [117]. All the three receptors

are expressed in myeloid cells, including monocytes/macrophages, eosinophils, mast

cells, dendritic cells, microglia and non-myeloid cells such as astrocytes, endothelial,

epithelial and SMCs [111,116]. C3aR and C5aR signalling lead to activation of

PI3K/Akt (protein kinase B), protein kinase C and MAPKs [122]. The excessive

generation of C5a and C5aR contribute to a number of pathologies, including IRI,

neurodegenerative disorders, inflammatory bowel disease, atherosclerosis, age-related

macular degeneration, rheumatoid arthritis and sepsis [29,30,31,32]. In contrast, the

roles of C5L2 are not well described; however, recent reports suggest that C5L2 might

act as an anti-inflammatory receptor [120]. Interestingly, mice lacking C5L2 receptor

release more TNF- and IL-6 in response to immune complex mediated injury

29

compared to wild types [120]. However, overexpresion of C5L2 inhibited LPS-induced

IL-6 production, suggesting anti-inflammatory potential of C5L2 [123].

2.7 Role of cytokines in inflammation

Cytokines are group of cell-signalling peptides that based on their functions

belong to different subgroups, including lymphokines, interleukins, monokines,

chemokines and interferons [124]. Generally, cytokines are classified as pro-

inflammatory or anti-inflammatory in function. Tumour necrosis factor-, interleukin

family (IL-1, 6, 8, 12, 15, 18 and 38), interferon (IFN)-γ and M-CSF are pro-

inflammatory cytokines while IL-10 and TGF-β are anti-inflammatory (Figure 2.8)

[125]. The main characteristics of all cytokines include that they: i) have a short life

span, ii) produced by various cells, iii) exhibit redundancy, iv) modulate immune

responses, v) are recognised by specific receptors, and vi) act synergistically with other

cytokines, often amplifying their activities [124].

30

Figure 2.8: Role of cytokines in inflammation. Cytokines produced by macrophages,

including TNF-, IL-1, IL-6 and IL-8 are potent inducers of inflammation and also

promote the differentiation of naive Th0 cells into Th1 and Th2 cells. They also activate

ECs and SMCs. On the other hand, the anti-inflammatory cytokines IL-10 and TGF-β

are produced by macrophages and promote Treg cell differentiation; adapted from Ait-

Outfella et al. and sourced from American Heart Association, Inc. [124].

2.7.1 Tumour Necrosis Factor-α

Tumour Necrosis Factor- is a pleiotropic cytokine that is expressed by different

cell types and shows diverse biologic effects [126]. TNF- is synthesised as pro-TNF-

and cleavage of mature TNF- from leukocytes relies on matrix metalloproteinase

(MMP) activation [127]. TNF- secretion is rapidly increased in response to LPS

exposure, infection and trauma, and is a prototypic pro-inflammatory molecule,

perpetuating the expression of other inflammatory cytokines including interleukins and

interferons [72]. TNF- acts via binding to two transmembrane receptors: TNF

receptor 1 (TNFR1) and TNF receptor 2 (TNFR2). TNFR1 is constitutively expressed

in mammalian tissue, whereas TNFR2 is mainly expressed in the cells of the immune

31

system. Both TNFR1 and 2 contribute to TNF--mediated cellular responses including

cytotoxicity, up-regulation of NF-B, increased proliferation of lymphoid cells and up-

regulation of adhesion molecules and cytokine genes [72,126].

TNFR signalling is suggested to play a role on LPS-induced production of iNOS by

macrophages, promoting macrophage migration to the site of inflammation [126]. TNF-

also prolongs macrophage survival in sepsis and increases MCSF-mediated

macrophage proliferation [126]. Furthermore, enhanced production of TNF-α

contributes to endothelial dysfunction by mitigating NO-mediated dilation of coronary

arterioles via activation of the c-Jun N-terminal kinases (JNK) pathway and increasing

production of superoxide via xanthine oxidase [128].

2.7.2 Interleukin-1

The term interleukin (IL)-1 refers to two cytokines: IL-1α and IL-1β. IL-1 was first

identified as a fever-inducing substance released by activated leukocytes. IL-1 is

secreted by various cells including monocytes, macrophages, ECs and SMCs and

induces a broad spectrum of biological responses [129,130]. Both IL-1 and IL- are

synthesised as precursors: pro IL-1 and pro IL-1 and can be cleaved to the mature

forms: mIL-1 and mIL-1 by calpain-like protease and caspase-1, respectively [131].

IL-1 promotes recruitment of inflammatory cells at the site of injury by increasing

expression of CAMs in addition to inducing fever, hypotension and production of NO

and prostaglandin E2 via increased iNOS and COX-2 activity [131].

The inflammatory action of IL-1α and IL-1β is mediated by binding to the IL-1

receptor type 1 (IL-1R1), which is expressed on the surface of various cell types (e.g

monocytes and macrophages) [131]. Mice lacking IL-1R1 showed no induction of

fever in response to LPS and exhibit a decreased acute phase response, suggesting that

IL-1 via its receptor IL-1R1 plays a crucial role in the generation of a febrile state [132].

The activities of IL-1α and IL-1β are regulated by the IL-1 receptor antagonist (IL-

1Ra), which competitively inhibits binding of IL-1 (IL-1α and IL-1β) to its receptor. IL-

1Ra is secreted by monocytes, macrophages and neutrophils [133]. The IL-1 and IL-

1Ra ratio plays a crucial role in the maintenance of normal physiology in various organs

and tissues. Under normal conditions, the circulating IL-1Ra concentration is seven-fold

higher than IL-1 [134]. However, IL-1Ra plasma concentrations are often elevated

32

(~100-fold higher than IL-1) in patients suffering from septic shock or infections. This

observation indicates that IL-1Ra production may be important in counter-regulating the

inflammatory effects of IL-1 in sepsis [133]. The importance of IL-1Ra in counter-

regulating IL-1’s pro-inflammatory effect is demonstrated in persons with genetic

deficiency of IL-1Ra due to mutation in IL-1RN (the gene that encodes IL-1Ra).

Infants that were born with non-functional IL-1Ra exhibited an auto-inflammatory

syndrome that leads to life threatening inflammation in the skin and bones [135].

Furthermore, mice lacking IL-1Ra experience excessive inflammation and are more

prone to develop inflammation in the joints and skin [131]. In addition, recombinant IL-

1Ra has been tested in phase II and phase III clinical trials and its administration has

shown promising therapeutic effects in patients with septic shock and rheumatoid

arthritis [134]. The clear role of IL-1Ra and IL-1 on inflammatory cascades strengthens

the importance of IL-1 signalling and therapies that influence it for disease treatment.

2.7.3 Interleukin-6

Interleukin (IL)-6 is a pleiotropic cytokine that regulates various immune responses,

including haematopoiesis and induction of acute phase protein, including CRP (an

important marker of inflammation), heptoglobin and fibrinogen synthesis [136]. IL-6

was initially designated as a B-cell differentiation factor, however, it is produced by

various cells, including macrophages, ECs, SMCs, neutrophils, T and B cells, glial cells

and osteoblasts [137,138]. IL-6 production by macrophages is mediated by TLR

activation. During infection-associated inflammation, stimulation of TLRs with

pathogen associated molecules increases IL-6 production, whereas in non-infectious

inflammation, danger associated molecules stimulate TLRs to induce IL-6 production

[139,140]. IL-6 acts as both an inflammatory and anti-inflammatory cytokine. When IL-

6 is produced transiently, it protects host tissue against infection and injury. However,

persistent production of IL-6 leads to chronic inflammatory and autoimmune diseases

[138]. In healthy humans, the IL-6 concentration is very low in serum (average < 3-4

pg/mL); however, during sepsis the IL-6 concentration can increase up to 10,000 fold of

the normal level and triggers inflammation by impairing endothelial function [141].

2.7.4 Interleukin-10

Interleukin (IL)-10 is secreted by monocytes, macrophages, eosinophils,

granulocytes, T-helper type 2 (Th2) cells, and dendritic cells. IL-10 is an important anti-

inflammatory cytokine and signals through two-receptor complexes: IL-10R1 and IL-

33

10R2 [142]. IL-10 is a potent inhibitor of macrophage activation and reduces the

secretion of pro-inflammatory cytokines, chemokines and MIP-1 [143]. Furthermore,

IL-10 augments the secretion of IL-1Ra in LPS-induced human monocytes [144]. IL-10

also inhibits the activation of NF-B by preventing the degradation of IB and

subsequent translocation of NF-κB from the cytoplasm to the nucleus [143]. IL-10 also

activates PI3K signalling and downstream molecules, Akt and p70S6 kinase that

promote cell proliferation [145].

IL-10 also mitigates the expression of COX-2 and metalloproteinases, such as

MMP-2 and MMP-9, which play significant roles in aggravating inflammation

[142,143]. Therefore; IL-10 plays a crucial role in the modulation of inflammatory

disorders. Mounting evidence suggests a therapeutic role for IL-10 in inflammatory and

infectious diseases and deficiency or dysregulation of IL-10 increases the risk of

immunopathology in response to infection in addition to inducing autoimmune

disorders [146].

In summary, cytokines are crucial players in inflammation and elevated levels of

pro-inflammatory/decreased production of anti-inflammatory cytokines are associated

with varied chronic inflammatory pathologies, including atherosclerosis, acute

myocardial infarction, coronary artery disease, chronic heart failure, rheumatoid

arthritis and sepsis [72,126,138]. It remains clear that a balance between pro- and anti-

inflammatory cytokines is critical to the maintenance of human health and that the

modulation of their release can have important implications for the prevention and

treatment of acute conditions, including sepsis.

2.8 Role of haem oxygenase and haem catabolism in inflammation

Haem oxygenase (HO) catalyses the rate limiting step of haem catabolism. There

are two isoforms of HO: HO-1and HO-2 [147,148]. HO-1 is an inducible enzyme that is

expressed ubiquitously in conditions of stress and serves as a protective gene by

inducing anti-inflammatory and anti-apoptotic effects [148,149,150]. However, HO-1

acts both as inhibitor and inducer of cell proliferation, inhibiting the proliferation of

SMCs [151] and promoting the proliferation of ECs [152]. HO-2 is constitutively

expressed and found in high concentrations in the brain and testes [153,154]. HO-1 and

HO-2 are encoded by hmox-1 and -2 genes, respectively, both of which catabolise haem

to biliverdin (BV), carbon monoxide (CO) and free iron (Fe2+

) (Figure 2.9).

34

Subsequently, BV is chemically reduced to unconjugated bilirubin (UCB) by biliverdin

reductase (BVR) [155].

HO-1 is a 32 kDa protein, present in microsomes, caveoli, mitochondria and

nuclei [149]. HO-1 belongs to a larger family of stress proteins and was first identified

as heat shock protein (Hsp32) due to its transcriptional responsiveness to hyperthermia

[155]. Furthermore, the promoter region of HO-1 gene contains similar heat regulatory

elements, which were originally discovered in the regulatory regions of various other

HSPs [155]. HO-1 expression is up-regulated in response to multiple stimuli, including

LPS, UV light, ethanol, H2O2, heat shock, cobalt protoporphyrin, pro-inflammatory

cytokines, heavy metals, NO and prostaglandins [149,155].

Accumulating evidence suggests that HO-1 possesses strong cytoprotective,

immuno-modulatory and anti-inflammatory properties both in vitro and in vivo. Both

human and murine studies show that hmox-1 deficiency results in severe pathologies,

including haemolysis, anaemia, nephritis, endothelial and monocytes/macrophages

injury and systemic inflammation [156,157]. Furthermore, HO-1 deficiency increases

vulnerability to infection and susceptibility to environmental toxins [158]. For example,

deletion of hmox-1 in mice induces anaemia, hypoferremia (low levels of iron in serum)

followed by iron deposition in tissue, chronic inflammation retarded growth and

splenomegaly [159]. Furthermore, hmox-1-/-

mice are highly susceptible to LPS-

mediated mortality and hepatic injury [158]. Splenocytes from HO-1 knockout mice

secrete higher levels of pro-inflammatory cytokines, including IL-1, TNF- α, IL-6 and

IFN- upon LPS stimulation compared to their wild type counterparts [160]. In addition,

HO-1 also contributes to the maintenance of endothelial homeostasis. Endothelial cells

isolated from hmox-1-/-

mice showed greater expression of cell adhesion molecules

(VCAM-1, ICAM-1 and E-selectin) and increased levels of ROS compared to wild-type

littermates [161]. In addition, HO-1 knockout mice show increased gene expression of

MCP-1 and NF-κB activation in kidney in response to haemoglobin (i.v. 90 mg/100 g

body weight) [162]. HO-1 deficiency has also been documented in humans and was first

published in 1999 [163]. The patient was a six-year boy and had been suffering from

growth retardation and severe haemolytic anaemia since the age of two. In addition, the

patient also showed erythrocyte fragmentation, iron deposition in the kidney and liver,

asplenia, abnormalities in coagulation/fibrinolysis, disturbance in endothelial function

35

and increased systemic inflammation and died at age of six [163]. Another case of HO-1

deficiency was reported in a 15-year old girl who suffered from a high-grade fever of

six-weeks duration. During the fifth week of illness, she developed haematouria,

proteinuria and hypertension, indicating nephritis. In spite of receiving treatment, the

patient died five months later due to uncontrolled haemolysis and nephritis [157].

The importance of HO-1 in protecting from inflammation can be demonstrated

by pharmacological induction of gene expression. For example, pharmacological

induction of HO-1 by CoPPIX (cobalt 7,12-diethenyl-3,8,13,17-tetramethyl-21H,23H-

porphine-2,18-dipropanoic acid) protects mice against Propionibacterium acnes/LPS

mediated liver injury by inhibiting the proliferation of CD4+ cells and reducing the

production of Th1cytokines (IL-2, TNF-α and IFN-). These data suggest that HO-1 is

crucial for the regulation of adaptive immune responses [164]. HO-1 is also involved in

regulating monocyte migration towards oxidised products. For example, induction of

HO-1 expression with mildly oxidised low-density lipoprotein (Ox-LDL) and haemin

attenuated monocytes chemotaxis towards Ox-LDL. However, inhibition of HO-1 with

Sn-protoporphyrin IX (SnPP IX) promoted monocytes migration [165].

HO-1 is induced by stimuli that are associated with oxidative stress (e.g.

depletion of cellular glutathione). Both ROS and reactive nitrogen species (RNS) induce

redox-dependent transcription factors, including Nrf2 (nuclear factor-erythroid2 (NF-

E2) related factor), NF-κB and activator protein (AP)-1 that can modulate HO-1

expression [148]. Once activated, these transcription factors translocate into the nucleus

to bind to consensus sequences on DNA, including haem-responsive elements (HREs),

antioxidant responsive elements (AREs), stress-responsive elements (StREs) and

xenobiotic responsive elements (XREs) [150,166]. These enhancer elements contain

binding sites for different transcription factors important for HO-1 regulation [166]. For

example, StREs contain binding sites for activator protein (AP-1) [167], AREs and

XREs regulate the activity of Nrf2 [166,168]. Therefore, stress-induced activation of

redox-sensitive transcription factors stimulates the transcription of HO-1 by binding to

enhancer elements. HO-1 is also regulated by cell signalling molecules, including

PI3K/Akt and MAPK and both pathways appear to mediate the cytoprotective, anti-

inflammatory and anti-oxidants effects of HO-1 [150,169].

The salutary effects of HO-1 are attributed mainly to the products of haem

36

degradation including CO, BV and UCB (Figure 2.9) [153], which are discussed below.

Figure 2.9: Possible mechanisms contributing to the protective effects of haem

oxygenase-1. Haem is catabolised to BV, CO and Fe2+

by HO-1. Biliverdin is rapidly

reduced to UCB. Haem oxygenase-1 via BV and CO protects IRI-mediated injury by

inhibiting the expression of inducible nitric oxide synthase (iNOS), cyclooxygenase

(COX) and NADPH oxidase activity. Both CO and BV also inhibit IRI-mediated

expression of IL-6, IL-1β and ICAM-1. Adapted from Li Volti et al. and sourced from

S. Karger AG, Basel [153].

2.8.1 Carbon monoxide

Carbon monoxide (CO) is a ubiquitous air pollutant and abundantly generated

from the burning of organic matter, combustion of coal and tobacco. Carbon monoxide

shows strong affinity for haemoglobin and myoglobin and at high doses it decreases the

capacity of blood to deliver oxygen to tissues, leading to tissue hypoxia [11,170,171].

37

However, low doses of CO are safe and apparently protective [172]. Cells and tissues

also produce CO endogenously as an elimination product of haem catabolism via HO

system [153]. The production rate of CO is approximately 20 mol/h in humans [170].

Interestingly, increased exhaled CO concentrations have been reported in critically ill

patients suffering from severe inflammation of the respiratory tract, septic shock, or

patients who underwent cardiac surgery, oesophagetomy, laryngemtomy and liver

transplant, among others [171,173,174]. It is suggested that CO generated by HO can

diffuse out of the cells and then enter the blood to form carboxyhaemoglobin [173]. CO

is then transported to the lungs where it is offloaded from haemoglobin and exhaled.

Therefore the increased CO concentration in severely ill patients could reflect the

induction of HO-1 in various organs due to systemic stress, which promotes haem

breakdown and subsequently greater CO exhalation [173,174]. Therefore, measurement

of CO concentration in exhaled air may be useful to monitor the change in HO-1

enzymatic activity [175].

Recent studies show that CO is not only a toxic gas but also possesses strong

cyto-protective and anti-inflammatory properties, demonstrating strong therapeutic

potential for treatment of lung injury, endotoxin shock, liver injury, hypertension and

transplantation associated injury and rejection and prostate cancer at the dose range of

20-400 PPM [176,177,178]Further, CO inhibited LPS-mediated activation of NF-B

and production of pro-inflammatory cytokine, GM-CSF via attenuation of IB

degradation and phosphorylation in RAW 264.7 macrophages [179]. CO also

suppressed anti-CD3 or anti-CD28 antibody-induced T-cell proliferation and secretion

of IL-2 partially via inhibition of extracellular signal regulated kinase (ERK)/MAPK

[180].

Carbon monoxide may also induce anti-inflammatory effects via two signalling

pathways: guanylyl cyclase-cyclic (c)GMP and p38 MAPK pathways [150,172]. For

example, CO reduces production of TNF-α and induces IL-10 in macrophages via

MAPK and cGMP pathways [181]. However, CO primarily binds/stimulates proteins in

which haem acts as a prosthetic group, including haemoglobin [11], myoglobin [182],

COX, iNOS [183], cytochrome p450 oxidase [184], guanylyl cyclase [185] and

NADPH [184]. Carbon monoxide interacts with the central iron group of haem within

these proteins and induces conformational changes in their structures [172]. A number

of studies show that CO mediates cytoprotective effects by inducing preconditioning,

38

which is defined as a condition of transiently increased resistance to injury and can be

triggered by sub-lethal stimuli [186,187]. Reactive oxygen species are critical for

preconditioning and are mostly generated in mitochondria [184,188]. Carbon monoxide

increases mitochondrial ROS production both in vitro and in vivo and also transiently

activates the mitochondrial transition pore [189]. Carbon monoxide also inhibits

mitochondrial membrane permeabilisation, mitochondrial transmembrane potential

depolarisation and cytochrome c release, suggesting that CO triggers protective effects

by targeting mitochondria, further supporting its role as a cytoprotective molecule

[187,190].

2.8.2 Biliverdin and unconjugated bilirubin

2.8.2.1 Bile pigment metabolism and chemistry

Bile pigments are coloured compounds derived from haem catabolism, including

bilirubin (BR); conjugated and unconjugated) and BV [191]. Biliverdin and

unconjugated BR (UCB) belong to the porphyrin family of molecules and primarily

originate from HO-mediated haem break-down [192]. In adults, ~250-300 mg of BR is

produced daily from erythroid and non-erythroid sources [193]. Approximately, 80% of

total BR is produced from the breakdown of haemoglobin in reticuloendothelial cells

[194]. The remaining BR is produced in the liver by the catabolism of other

haemoproteins, including; cytochrome, catalase, peroxidise and tryptophan pyrrolase

[18,194,195]. The first step in the haem catabolic pathway requires oxidation of haem to

α–meso-hydroxyhaem by HO. α–meso-hydroxyhaem reacts with oxygen and produce

verdohaem and CO. Verdohaem in the presence of NADPH-cytochrome-P450-

reductase reacts with oxygen, converting verdohaem into BV and free iron (Figure 2.10)

[147]. Biliverdin is then chemically reduced to UCB in the presence of BVR (Figure

2.11) [33].

Bilirubin and BV exist in three isomers: IIIα, IXα and XIIIα, with the IXα

variant representing the principle isomer found in mammals [193,196]. The IXα isomer

results from the specific oxidative cleavage of the α-meso bring (-CH=) of the haem

molecule by HO [1]. Other isomers of BR also exist, including IXβ, which is present in

neonatal urine while IXβ and IXγ are found in the bile of Gunn rats [194]. Bilirubin is

poorly water soluble because of inter-molecular hydrogen bonding, and, therefore,

requires glucuronidation for its excretion. Unconjugated BR has a strong affinity for

39

albumin and once bound is transported to the liver for conjugation [191]. In the liver,

UCB is metabolised by uridine diphosphate glucuronosyltransferase (UGT1A1) to BR

mono and diglucuronide. Conjugated BR (CB) is water soluble and excreted into bile

against a concentration gradient through multidrug resistant-related protein-2 (MRP-2),

also called ABCC2 (ATP-binding cassette sub-family C member 2), active transport

[194,197]. In the bile, CB is incorporated into micelles (with bile acids, phospholipids

and cholesterols) and passes into the intestine where CB is degraded into urobilinogens

by the intestinal microbial flora [197]. Urobilinogens are reduced to urobilins, which

contribute to the colour of urine and faeces. However, a small fraction of UCB from

bile is partially reabsorbed from the intestine and undergoes for enterohepatic re-

circulation, which can contribute to elevated UCB levels, particularly in neonates

[194,195]. Unconjugated BR is light sensitive and exposure of the skin to light (as in

treatment of neonates with elevated UCB levels) also disrupts UCB’s internal hydrogen

bonding and leads to its excretion into the bile [195]. In contrast to UCB, BV is more

hydrophilic and can be excreted unconjuagated [198]. Biliverdin is widely distributed

throughout nature and is found in insects, lower organisms and vertebrates, including

humans [9]. For example, BV can also colour some bird eggs blue-green [12], whereas

in plants, cyanobacteria and algae, BV is a biosynthetic precursor for photoresponsive

bilins, including chlorophyll [9,10]. In mammals BV is rapidly reduced to UCB,

therefore, BV is undetectable even under extreme haemolytic conditions [9]. However,

a recent study by Gafvels et al. [14] reported a case of hyperbiliverdinaemia, caused by

mutation in BVR gene. The mutation in BVR gene resulted in green jaundice,

accompanied by greenish coloration of plasma and urine [14].

40

Haem α-meso-hydroxyhaem

Biliverdin Verdohaem

Figure 2.10: Haem catabolism. Haem is oxidised by HO and produce two intermediate

compounds: α-meso-hydroxyhaem and verdohaem. These intermediates are then

metabolised to produce CO, BV and iron. Adapted from Montellano et al. and sourced

from Elsevier [147].

41

Biliverdin IXα Biliverdin Reductase Bilirubin IX α

Figure 2.11: Formation of BR. BV IXα is reduced to BR IXα in the presence of BVR.

Adapted from Zhu et al. and sourced from John Wiley and Sons [199].

2.8.2.2 Therapeutic potential

Bile pigments (UCB and BV) were previously thought as potentially toxic haem

catabolites. For example, excessive accumulation of UCB (> 200 µM) in newborn

infants causes jaundice and if the UCB concentration remains elevated and continues to

increase, it can enter to the brain and cause neuronal toxicity [200,201]. However, a

landmark study by Stocker et al. showed that UCB at low, physiological plasma

concentrations act as potential antioxidants in vitro [202]. Since then, several studies

have described beneficial effects of BV and UCB in pre-clinical models of tissue injury

and diseases, including organ transplantation, IRI and animal models of sepsis (Figure

2.12) [18]. The antioxidant and anti-inflammatory effects of BV and UCB appear to

contribute to their cytoprotective activity [19,192,197,201].

42

Figure 2.12: The cytoprotective and anti-inflammatory effects of BV and BR

against various disease models. Adapted from Wegiel et al. and sourced from

Frontiers [34].

2.8.2.2.1 Biliverdin

i) Cytoprotective effects

Several in vivo and in vitro studies show that BV protects against vascular injury

and transplant rejection. For instance, in a rat model of angioplasty (balloon injury), BV

administration (50 mg/kg, i.p.) prevented the development of intimal hyperplasia after

vascular injury. Furthermore, BV also inhibited SMC migration in vitro and prevented

EC apoptosis via inhibition of JNK phosphorylation [26]. In vitro studies also show

anti-proliferative effects of BV on VSMCs, where BV caused cell cycle arrest at the

G0/G1 phase via reduced phosphorylation of p38 MAPK and JNK 1/2 [203]. Biliverdin

also suppresses the expression of regulators of cell cycle progression, including cyclin

A, D1, E and cycle dependent kinase (cdk) 1/2, resulting in hypo-phosphorylation of

retinoblastoma tumour suppressor protein (Rb) in VSMCs [204]. Furthermore, mice

receiving BV (35 mg/kg, i.p.) showed improved survival (80%) when challenged with

43

LPS/D-galactosamine in addition to showing decreased serum alanine aminotransferase

levels [21].

Accumulating evidence also shows the protective effects of BV in animal

models of diabetes [205]. For example, in a rat model of diabetes (induced by

streptozotocin; STZ), daily dosing of BV (100mg/100g body weight, i.p.) for six weeks

decreased EC sloughing. In addition, BV administration reduced the levels of urinary 8-

epi-isoprostane PGF2α concentrations, a major component of isoprostanes and an

indicator of lipid peroxidation/oxidative stress in hyperglycemia [206]. Oral

administration of BV (20 mg/kg body weight) to db/db mice (a rodent model of type 2

diabetes) for four weeks prevented hyperglycemia and glucose intolerance. In the same

study, BV also inhibited the expression of apoptosis-related gene (Bax) and oxidative

stress as measured by markers (8-hydroxy-2′-deoxyguansosine and dihydroethidium

staining) in pancreatic beta cells [207].

Many studies show beneficial effects of BV in organ transplantation and

associated IRI injury [176]. Ischaemia-reperfusion injury induces ROS generation,

inflammation and tissue damage in organ transplantation and affects the outcome of

transplantation via causing early dysfunction of transplanted grafts [27,208].

Investigation of cardiac, lung, kidney and liver transplantation shows that BV improves

tissue graft survival and associated IRI [176,209,210,211]. For example, daily dosing

with BV (31 mg/kg, i.p.) to donor and recipient mice induced tolerance to cardiac

allografts in addition to reducing CD4+ and CD8

+ cell infiltration and T cell

proliferation [212]. Livers treated with BV (10 M and 50 M) in an ex vivo model of

IRI showed greater portal vein flow that was associated with greater bile production

[209]. Furthermore, a recent study by Andria et al. [27] also supports the therapeutic

effect of BV in transplantation showing improved liver function in both the donor and

recipients pigs. The animals were injected with single dose of BV (31 mg/kg, i.p.),

which resulted in increased bile production, urea and ammonia clearance and decreased

levels of serum aspartate aminotransferase compared to control animals [27].

ii) Antioxidant effects

Biliverdin shows antioxidant effects both in vitro and in animal models,

scavenging both ROS and RNS, including lipid peroxyl and -tocopheroxyl radicals

[19,213]. Additionally, BV at very low dose (1 M) inhibits LPS and phorbol ester-

mediated oxidative burst in neutrophils, and also reduces mitochondrial superoxide

44

formation [214]. These data are supported by in vivo evidence demonstrating that BV

reduces a number of radical species formed in the Trolox Anti-oxidant Capacity

(TEAC) assay and the Ferric Reducing Ability of Plasma (FRAP) assays [215].

In animal models of transplantation, BV administration (50 mg/kg, i.p.) showed

down-regulation of SITx-induced expression of manganese superoxide dismutase

(MnSOD) in addition to decreasing tissue malondialdehyde (MDA) levels, indicating

protection from oxidative stress [208]. In lung grafts from brain dead rat donors, BV (35

mg/kg, i.p) significantly reduced MDA levels and MPO/SOD activities, improving the

outcome of lung transplantation [216].

iii) Anti-inflammatory effects

Biliverdin also plays an important role in inhibiting inflammatory process both

in vivo and in vitro. Administration of BV (35mg/kg) intraperitoneally prevented LPS-

induced lung and liver injury in rats by decreasing gene expression of TNF-α, IL-6 and

IFN-γ [217]. Biliverdin at 5 mg/kg abrogated CLP (caecal ligation and puncture)-

mediated mRNA induction of IL-6 and monocyte chemoattractant protein (MCP)-1 and

increased mRNA expression of IL-10 in the small intestine [218]. Intravenous

administration of BV (35 mg/kg) prior to haemorrhagic shock and resuscitation reduced

lung injury in rats via attenuation of TNF-α and iNOS gene expression [219].

Furthermore, BV (100 M) inhibited IL-2 and IFN- production by cultured mice

splenocytes in response to anti-CD3 and anti-CD28 [212]. In another study, BV (50

mg/kg, i.p.) significantly improved survival of recipients in a small intestinal transplant

(SITx) model in rats which was related to attenuation of mRNA expression of iNOS,

COX2, ICAM and pro-inflammatory cytokines (IL-6 and IL-1) [208]. Biliverdin-

induced protection in transplantation and sepsis is likely mediated by modulation of NF-

B expression in tissues, which contributes to the regulation/expression of the above

inflammatory modulators [26,210,212,216].

Growing evidence suggests the anti-inflammatory effects of BV in vitro,

protecting from endotoxin shock. For example, 10 M BV reduced LPS induced IL-6

production in RAW 264.7 macrophages and mouse lung ECs [217]. In addition, BV

also decreased the TNF-α induced transcriptional activity of NF-B and DNA binding

in human embryonic kidney cells in a concentration and time dependent manner [220].

45

Wegiel et al. showed [21] that BV (50 M) increases IL-10 production in RAW 264.7

cells partially via induction of cell surface BVR and phosphorylation of Akt.

Furthermore, BV significantly decreased TLR-4 mRNA expression in both RAW 264.7

and bone marrow derived macrophages, the effects were partially mediated via eNOS

activity [28], supporting the anti-inflammatory effects of BV.

In summary, both the in vitro and in vivo studies show that BV administration is

robustly associated with inhibition of inflammation and consequent pathology. Many of

these effects are lost when depletion of BVR is induced [21,28]. Therefore, it is

important to consider that BV might exert its cyto-protective effects either via BVR

activity or via secondary UCB generation.

2.8.2.2.2 Unconjugated bilirubin

i) Cytoprotective effects

Mildly elevated UCB concentrations in humans are associated with protection

from cardiovascular and other diseases underpinned by chronic inflammation. For

example, a large epidemiological study by Horsfall et al. [24] provides the most

convincing evidence of UCB protection showing that mortality rates in individuals with

Gilbert’s syndrome (GS; n=4,266) were half those a normobilirubinaemic comparison

cohort (n=21,968). Gilbert’s Syndrome is associated with a mildly elevated serum UCB

concentration ( 1mg/dL; 17.1 µM), which is caused by a mutation in the UGT1Al

gene promoter [22]. Horsfall et al. [23] also showed in another cohort study (> 500,000

participants) that each 0.1 mg/dL (1.71 M) increase in serum UCB levels in males was

associated with 8% and 6% decreased incidence of lung cancer and chronic obstructive

pulmonary disease, respectively, in addition to 2-3% reduction in all cause mortality.

Similar associations are also demonstrated in several additional epidemiological studies

showing that individuals with normal or mildly elevated plasma/serum UCB levels (>10

µM), including GS, have a reduced prevalence of atherosclerosis, diabetes, metabolic

syndrome and stroke compared to subjects with lower UCB concentrations

[22,221,222,223]. These observations have generated a hypothesis that UCB may be an

important haem catabolite, in contrast to earlier assumptions that it might be a useless or

toxic by-product in humans.

Animal and in vitro studies support cytoprotective functions of UCB. For

examples, higher blood concentrations of UCB (50-350 µM) in Gunn rats (an animal

46

model of hyperbilirubinaemia due to autosomal recessive deficiency of UGT1A1)

suppressed the development of neointimal hyperplasia after balloon injury compared to

wild type rats [204]. Furthermore, administration of UCB (10 M) before and during

IRI in the isolated perfused rat kidney system resulted in significant improvement in

vascular resistance, glomerular filtration rate and urine output in addition to increased

creatinine clearance and decreased fractional excretion of sodium [224]. Similarly,

infusion of isolated perfused hearts with 0.1 M UCB before ischaemia increased

cardiac functional recovery to 87% after 60 min reperfusion compared to 65% in

untreated hearts [225]. Unconjugated BR also suppresses proliferation of VSMCs in a

dose-dependent manner via inhibition of cell cycle progression and attenuation of p38

MAPK phosphorylation, suggesting that it might inhibit atherogenesis [204].

Many experimental and clinical studies support the salutary role of UCB in

diabetes and vascular complications associated with diabetes. For example, Gunn rats

showed improved glucose tolerance, decreased activation of NADPH oxidase

components (NOX4, p22phox and p67phox) and NO in the pancreas within the STZ

induced diabetic model [226]. Similarly, pre-treatment of the rat insulinoma cell line

(RIN-mF5) with 1.71 M UCB attenuated STZ-mediated apoptosis and H2O2

production [226]. Additionally, higher serum total BR levels were related to protection

from diabetes in a study performed by US National Health and Nutrition Survey in

16,000 subjects. In this study, subjects with serum total UCB levels above than 10 M

had a 20% reduced risk of developing diabetes compared to those with less than 10 M

[227]. In addition, administration of UCB using single (8.5 µmol/kg) or daily dose (17

µmol/kg/day) to islet donors (DBA/2 mice) improved long-term survival in islet

recipients (B6AF1 mice) [228]. Gunn rats are also protected from transplantation

mediated IRI and demonstrate improved survival of cardiac grafts. For example, 42 %

of cardiac grafts survived for >7 days in Gunn rats (serum UCB conc. 79 M) as

compared to 0% in controls (serum UCB conc. <2 M) [229].

ii) Antioxidant effects

An imbalance between oxidant production and anti-oxidant potential within

tissues results in oxidative stress. Unconjugated BR demonstrates potent antioxidant

activity against ROS generated by various oxidants, including metals (CoCl2, Cu2SO4

and CdCl2), UV radiation and drugs (menadione and acetaminophen) [202,230]. Both

47

UCB and BR ditaurate (BRT, synthetic analogue of BR diglucuronide) show

antioxidant capacity in in vitro systems, both of which inhibit peroxyl and peroxynitrite

radical-induced oxidation of human plasma, attenuating protein tyrosine nitration and

tryptophan oxidation [19,214,231,232].

Several in vivo studies demonstrate the translation of UCB’s antioxidant effects

in rodents and humans. For example, GS individuals with elevated UCB levels show

reduced susceptibility of serum to Cu2+

induced oxidation and improved antioxidant

status [192]. Further, GS individuals show reduced circulating Ox-LDL and protein

carbonyl concentrations and improved GSH:GSSG (reduced:oxidized glutathione) ratio

compared to non-GS controls [233]. Additionally, Gunn rats are also resistant to the

development of thiobarbituric acid-reactive substances (TBARS) and protein carbonyl

compared to their non-jaundiced counterparts after exposure to three days of hyperoxia

[234].

iii) Anti-inflammatory effects

An additional mechanism of UCB-induced cytoprotection might include its

strong anti-inflammatory and anti-apoptotic activity. For example, in vivo and in vitro

studies show that UCB protects against transplantat rejection and LPS challenge.

Unconjugated BR decreased mRNA expression of caspase-3 and -8, MCP-1, TNF-α,

iNOS, Fas, TNF-related apoptosis-inducing ligand (TRAIL-R), BID and IFN-γ inducing

protein-10 (CXCL10) in islet grafts [228]. In addition, the islets recipient mice treated

with UCB showed enhanced expression of TFG-, IL-10 and FoxP3 [235].

Furthermore, mice injected with single bolus injection of UCB (40 mg/kg, i.v.)

recovered from LPS (2 mg/mL)-mediated endotoxic shock compared to control mice.

Furthermore, LPS-induced expression of IL-1β and ICAM-1 and VCAM-1 expression

in mice were also reduced in UCB treated animals [236]. In addition, UCB (100 mg/kg,

i.p.) alleviated experimental autoimmune encephalomyelitis (EAE, a T-cell mediated

autoimmune disease) and halted disease progression in mice [237]. The same study also

showed that UCB suppressed T-cell proliferation and activation, accompanied by

decreased production of both Th1 and Th2 cytokines (IL-2, IL-10 and IFN-) and

reduced expression of co-stimulatory molecules (CD80 and CD86) in macrophages and

DCs of naive mice [237]. Gunn rats also show protection against LPS-induced

inflammation, reducing expression of iNOS in renal, myocardial and aortic tissues

48

[238]. In addition, the cardiac grafts transplanted to Gunn rats had significantly lower

levels of MDA and reduced mRNA expression of inflammatory mediators (TNF-α, IL-

6, iNOS, COX-2 and MCP-1) [229]. In contrast to this, a recent cohort study by

Wallner et al. [25] showed a concentration-dependent relationship between IL-1 levels

and UCB in both GS and control groups. For example, GS subjects with a UCB

concentration above than 17.1 M showed a marginal though, significant increase in

basal plasma levels of IL-1 (2.07 pg/mL in control vs. 2.21 pg/mL in GS) [25].

However, multiple regression analysis revealed that UCB concentrations up to 17.1 M

in control subjects were associated with decreased IL-1 concentration (r = -0.355, P <

0.05), suggesting that a UCB concentration ≥17.1 M might heighten inflammation in

vivo [25]. Similarly, neutrophils isolated from umbilical cord and adult blood showed

increase in IL-1 release at baseline when exposed to UCB (10-300 M) [239].

Unconjugated BR also induces immunosuppressive effects in leukocytes,

lymphocytes and granulocytes in vitro. Infusion of UCB decreased the number of

antibody (plaque)-forming cells in the mouse spleen when exposed to sheep

erythrocytes [240,241]. At higher concentrations (100-200 µM), UCB attenuates

cytotoxic T-lymphocyte activity in vitro and also inhibits concanacalin A (ConA) or

anti-CD-3 mAb-stimulated T-cell proliferation in mice splenocytes, via suppression of

costimuatory molecule CD28 and inhibition of NF-B activation [237]. In contrast to

this, UCB (30 mg/kg) protected rats from endotoxin-mediated hepatoxicity in part via

reduction of iNOS expression; however, this treatment had no effect on NF-κB

expression. The same study also reported inhibitory effects of UCB on iNOS and no

suppressing effect on NF-κB expression in LPS-stimulated RAW 264.7 macrophages

[242]. Furthermore, unbound UCB concentrations of 15 or 30 nM (prepared in serum

free media) inhibited TNF-α induced iNOS expression and reduced nitrite production in

murine heart ECs [243]. Similarly, UCB (50 M) ameliorated the expression of LPS-

induced iNOS and NO in RAW 264.7 macrophages compared to a vehicle treated group

[242]. In addition, monocytes isolated from umbilical cord blood and treated with UCB

at very high concentrations (102.6, 153.9, 220.6 and 307.8 μM) for one hour prior to

LPS stimulation showed reduced TLR-4 expression [244].

An additional inhibitory effect of UCB, relevant to inflammation, includes its

complement inhibitory activity [245]. Unconjugated UCB (0.3-2 mg/100 g), when

49

given to rats before infusion with sheep erythrocytes prevented complement haemolytic

activity in serum. In addition, UCB also attenuated the increase in haemoglobin

concentration in plasma and urine when compared to a control group [246].

Furthermore, UCB (10 M) also protects human umbilical vein ECs against

complement-mediated lysis by increasing the expression of decay accelerating factor

(DAF) [247]. DAF is a complement inhibitory protein that promotes the dissociation of

the C3 and C5 convertase complex, formed in classical and alternative pathway

activation and is found ubiquitously on the outer cell surface of epithelial and

endothelial cells [248].

2.8.3 Ferritin

Haem degradation by HO also leads to release of iron. Iron is a crucial molecule

and is involved in number of cellular process, including ATP generation, detoxification

and oxygen transport [155,158]. Dietary deficiency of iron causes anaemia, while

functional hypoferremia also results in anaemia, observed in chronic inflammatory

diseases [158]. However, free iron is a potent oxidant and induces toxicity to cellular

organisms due to its ability to generate free radicals. Iron in its free state (ferrous form;

Fe2+

) participates in Fenton or Haber-Weiss reactions (redox reactions), in which iron

reduces H2O2 to generate hydroxyl radicals [249]. Therefore, excess cellular iron needs

to be transformed into an inert form to prevent the formation of radical species, leading

to oxidative damage. Ferritin, an iron storage protein plays a crucial role in iron

regulation [250]. Ferritin is comprised of 24 symmetrically related subunits, including

a heavy ferritin chain and a light ferritin chain [251]. Iron is stored in its ferric form

(Fe3+

; oxidised form) in ferritin and can be released when cellular iron levels are low

[252]. Several studies show cytoprotective effects of ferritin. For example, exposure of

ECs to haem leads to heavy chain ferritin induction, which then protects ECs against

oxidative stress [253]. Furthermore, increased expression of ferritin induced by

haemoglobin also protected mice against hypoxia in a model of hyperoxic lung injury

[254]. Finally, rats treated with heavy chain ferritin were protected from liver

transplant-associated IRI and oxidative stress [251]. It should be noted that ferritin

studies show protection from haem overload. However, the relevance of ferritin

treatment in preventing/treating non-haemolytic diseases remains unknown.

50

2.9 Biliverdin reductase

Bilirverdin reductase (BVR) has been regarded for many years solely as an

enzyme responsible for conversion of BV to UCB. However, recent studies have

demonstrated new features of BVR, including a role for it in cytoprotection and cell

signalling [255]. Two isoforms of BVR: BVR A and B are expressed in adulthood and

embryogenesis, respectively [9]. BVR is abundantly present in all tissues with the

highest expression in macrophages of the spleen and liver under basal conditions.

Interestingly, BVR can also be induced by its substrate BV, in addition to endotoxin,

heavy metals, cytokines, hypothermia and ROS [21,33,256]. Therefore, BVR, similarly

to HO-1, is placed in the category of stress-responsive genes [33]. Biliverdin reductase

is localised in different cellular compartments, including cytoplasm, endoplasmic

reticulum (ER), mitochondria [257], nucleus [256], and cell membrane [21]. Reduction

of BV to UCB by BVR occurs in many cellular compartments; however, the majority of

this reactivity is detected in the ER and cell membrane [21]. Additionally, BVR present

on the cell membrane of macrophages and ECs is crucial for inducing both enzymatic

and cell signalling effects, which are regulated by phosphorylation or nitrosylation of

BVR [28,258]. Biliverdin reductase is not exclusive to mammals and is evolutionarily

conserved. For example, BVR is present in cyanobacteria and also present in metazoa,

and a homolog of mammalian form is also present in red algae, where BVR regulates

phycobilprotein synthesis [9,33]. Recently, Molzer et al. [259] showed the appearance

of UCB in agar plates in Salmonella reverse mutation assay, which were supplemented

with BV, suggesting that BVR must be expressed in Salmonella typhimurium bacteria.

2.9.1 Structure of BVR

As mentioned previously, BVR exists in two isoforms: A and B. The isoform

BVR A catalyses the regiospecific addition of hydrogen to –HC (10) = C-N = group of

BV-IX [9]. BVR A is a unique enzyme due to its ability to recognise one of two

cofactors for catalysis; NADH is used in the acidic pH range of 6.7-6.9 and NADPH is

used in the basic pH range of 8.7 [260]. Additionally, BVR A is a monomeric protein

and consists two structural domains: the N-terminal dinucleotide binding domain

(Rossmann fold), including the catalytic site for NADPH and NADH while the C-

terminal domain with six beta-strands and eight helices is cysteine rich and bind metals

ions, notably Zn2+

[9,260,261] and plays a crucial role in cell signalling (Figure 2.13)

[262]. BVR A reduces the -meso (C10) bridge of BV-IX by using two electrons from

51

a pyridine nucleotide cofactor, and forms a ternary complex with BV and NAD(P)H [9].

Human BVR A is encoded by a single copy of gene with four introns and five exons

and has a molecular mass of 33.5 kDa, consisting of 296 amino acids [261]. On the

contrary BVR B has a minor role in metabolism and catalyses the reduction of IX and

IX isomers of BV. Furthermore, BVR B also reduces BV-IX to UCB-IX, which

exists in significant concentrations within fetal bile, suggesting that haem catabolism is

different in utero than in adults [9,260].

52

Figure 2.13: Structure of hBVR (human biliverdin reductase). hBVR contains one

N-terminal domain, which includes the sequences, required for catalytic function and is

also called the reduction domain. This domain catalyses the reduction of BV to BR. The

C-terminal domain contains the sequences crucial for kinase/cell signalling activity of

BVR, containing six residues with Zn-binding domains; adapted from Gibbs et al. and

sourced from Frontiers [262].

53

2.9.2 Functions of BVR

Biliverdin reductase exhibits a diverse spectrum of functions including

apoptosis, metabolism, regulation of gene expression and cell signalling [33,34]. Recent

studies show that BVR has protective effects and promotes scavenging of free radicals

via generation of UCB. As little as 10 nM UCB efficiently protects against a 10,000

fold higher concentration (100 M) of H2O2 [263]. The high efficacy of UCB as an anti-

oxidant suggests a cytoprotective amplification loop exists in which UCB is oxidised to

BV by ROS, which is reduced back to UCB by BVR [264]). However, this concept was

recently questioned by McDonagh [265], who showed that BV is a minor product of

UCB in its reaction with alkylperoxyl radicals. These data suggest that UCB is

dehydrogenated to BV only under specific non-physiological conditions (e.g excess

H2O2, quinones, FeCl3 in strong mineral acid) [196,263,265].

However, several studies demonstrate cytoprotective effects of BVR, which are

lost after knockdown of BVR. For example, ablation of BVR by RNA interference leads

to cell death and oxidative stress in response to H2O2 and 2’, 7’-

dichlorodihydrofluorescein in HeLa and SH-SY5Y cells, respectively [263,266]. Lack

of BVR also promotes the development of a pro-inflammatory phenotype in

macrophages with increased expression of LPS-induced TNF-α and basal expression of

TLR-4 [28]. Biliverdin reductase is also involved in protection from hypoxia and

reoxygenation injury. For example, Song et al. [267] showed that hypoxia induces both

protein and mRNA expression of BVR in a time-dependent manner in pulmonary

arterial smooth muscle cells (PASMCs). Hypoxia-mediated BVR expression then

protected PASMCs from hypoxia-induced apoptosis, nuclear shrinkage, DNA

fragmentation and mitochondrial depolarisation in UCB-dependent manner via

activation of ERK ½ pathway. However, the protective effects of BVR/UCB were lost

after silencing BVR using small interfering RNA (siRNA) [267]. Furthermore, rats

treated with BVR i.t. (intrathecal injection) at different doses (2.5, 5 and 10 g/day)

showed delayed onset of EAE than rats treated with similar doses of traditional

antioxidant enzymes (SOD, HO-1, catalase, glutathione reductase), suggesting BVR is a

therapeutic molecule in autoimmune disorders [266].

Biliverdin reductase is a leucine zipper protein and acts as a transcription factor.

Biliverdin reductase has a similar structure to stress-induced transcription factors,

54

including AP-1 family of transcription factors such as c-jun, c-fos, myelocytomatosis

viral oncogene (cMyc) and activated transcription factor-2 (ATF-2) [33,268]. AP-1

forms homo- or hetro-dimers and binds to DNA in response to oxidative stress.

Biliverdin reductase similarly to AP-1 transcription factors drives HO-1 gene

transcription [269]. Additionally, Ahmed et al. showed that hBVR in its dimeric form

binds to a 100-mer DNA fragment of mouse HO-1 promoter region encompassing two

AP-1 sites [268]. The hBVR-DNA complex then activates the HO-1 gene. However,

COS (African green monkey kidney fibroblast-like cell line) cells transfected with

antisense hBVR showed decreased HO-1 gene expression in response to oxidative

stress, suggesting that hBVR plays a crucial role in HO-1 gene regulation [268].

Recently, Wegiel et al. [28] showed that BV inhibits TLR-4 expression via direct

interaction of BVR with AP-1 sites on TLR-4 promoter. The same study also showed

that BVR is rapidly S-nitrosylated in response to BV and LPS through eNOS derived

NO, dependent upon Ca2+

/calmodulin-dependent kinase activity. This modification of

BVR resulted in nuclear translocation of BVR and binding to the TLR-4 promoter and

repressesion of TLR-4 expression. This effect was lost in macrophages derived from

mice lacking eNOS, suggesting that S-nitrosylation of BVR is crucial for protective

effects of BV-BVR [28]. S-nitrosylation is one form of cysteine modification

(posttranslational modification), and modulates the function of various inflammatory

proteins including NF-B and TLR-4 [270,271].

Biliverdin reductase also influences cell-signalling pathways. Maines and

colleagues [33,258] showed that BVR is a theronine/serine/tyrosine phosphoprotein and

requires phosphorylation to reduce BV to UCB. In addition, the tyrosine198

-

methionine199

-lysine200

-methionine201

(YMKM) motif in BVR acts as a substrate for

insulin receptor tyrosine kinase (IRK) as well as phosphorylation of insulin receptor

substrate (IRS-1/2) proteins, regulating glucose uptake and insulin signalling [255].

Furthermore, BVR is a modulator of protein kinase C, which links the two arms of

insulin /insulin growth factor (IGF)-1 signalling: the MAPK and PI3K pathways (Figure

2.14). These kinases together play a crucial role in regulating proliferation, cell death

and survival, modulation of ion channels tumour development, mRNA stability and

translation of pro-inflammatory cytokines genes within leukocytes [104,255,272].

Recently, Wegiel et al. [21] showed that BVR is induced on the cell surface (referred as

BVRsurf) of macrophages in response to LPS stimulation. Cell surface BVR mediates

55

BV induced anti-inflammatory effects via activation of the PI3K pathway [21]. Wegiel

et al. [21] also suggested that the tyrosine198

motif of BVR present on cytosolic domain

resembles the binding motif of platelet derived growth factor for the receptor for the

p85 sub-unit of PI3K. Therefore, BV/BVRsurf cross phosphorylates within YMKM

motif, which enables BVRsurf to interact with PI3K-P85 to drive Akt phosphorylation

[21].

In conclusion, BVR has emerged as a remarkable molecule, playing an

important role in preventing oxidative stress and inflammation, in addition to

influencing transcription and cell signalling pathways. This molecule may, therefore,

provide a new target for therapeutic development.

56

Figure 2.14: Signalling cascade initiated by BVR in response to extracellular

stimuli and their role in induction of gene expression. BVR is a modulator of protein

kinase C and in response to oxidative stress it modulates two main branches of

insulin/insulin growth factor (IGF-1): MAPK (ERK1/2, JNK and p38) and PI3K

(PDK1/2, mTOR, PKB). Both MAPK and PI3K are crucial for stress-induced

transcription factor activation (c-Jun, c-Fos, ATF-2 and NF-κB).

57

2.10 Phosphatidylinositol 3-kinase and inflammation

Phosphatidylinositol 3-kinase is a crucial component of intracellular signalling

and is activated in response to TLR-ligands [273], G-protein coupled receptor

activation, including C5a and C5aR and growth factor coupled tyrosine kinases [274].

The PI3K family consists of three classes of kinases: I, II and III and is highly

conserved from yeast to mammals [275,276]. The class I PI3Ks are divided into two

subclasses: class IA and class IB PI3Ks. The IA class is composed of three isoforms;

PI3K, PI3K and PI3K whereas class IB PI3K has one isoform: PI3K [277]. PI3Ks

transmit signals via tyrosine kinase-coupled receptors and consist of a p110 catalytic

subunit associated with p85, p85, p55, p55 and p50 regulatory subunits.

However, class IB PI3K does not have a p85 subunit [275]. Class I PI3K plays an

important role in regulating many cellular functions, including cell proliferation, cell

survival, apoptosis, adhesion, cell migration and inflammatory responses [275]. All the

three isoforms (PI3K, PI3K and PI3K) are ubiquitously expressed by leukocytes, T-

cells, B-cells and mast cells among others [276]. However, the PI3K isoform is mainly

expressed by leukocytes [277,278]. To date, three mammalian isoforms, PI3KC,

PI3KC and PI3KC of the class II family have been identified. It is suggested that

PI3KC and PI3KC function downstream of receptor tyrosine kinases, cytokine

receptors and integrin receptor and are involved in cell signalling [279,280]. However, a

precise cellular function for PI3KC has not yet been discovered [275]. The class III of

PI3K has one catalytic subunit called vascular-protein-sorting protein (Vsp34p), which

appears to play a role in lysosomal membrane trafficking [281,282].

The PI3Ks catalyse the phosphorylation of phosphatidylinositol-4,5-

bisphosphate (Ptdlns (4,5) P2) to phosphatidylinositol-(3,4,5)-trisphosphate (Ptdlns

(3,4,5)P3), which recruits downstream kinase, Akt (Figure 2.15) [276,283]. Both PI3K

and Akt are key players in leukocytes (e.g neutrophils and macrophages) signalling and

are involved in cell survival, cell migration and chemotaxis [276]. In addition, PI3K

also negatively or positively regulates the production of both pro- and anti-

inflammatory cytokines [284]. For example, ablation/inhibition of PI3K decreases

production of IL-10 and augments production of pro-inflammatory cytokines IL-1 and

IL-12 in monocytes and dendritic cells [284,285,286]. Additionally, inhibition of PI3K

decreases survival time in CLP-induced polymicrobial sepsis [287]. Mice lacking PI3K

activity also possessed elevated serum levels of IL-1, TNF-α, IL-6, IL-10, IL-12 in a

58

model of experimental sepsis [287]. Mice deficient in PI3Kγ or inhibition of PI3Kγ

reduces recruitment of neutrophils and macrophages towards peritonitis (induced by

bacterial injection), in addition to decreasing chemokine RANTES expression

[288,289]. In addition, C5a has been shown to activate phosphorylation of Akt in

murine macrophages [122]. Inhibition of PI3K with wortmannin or 2-(4-morpholinyl)-

8-phenyl-chromone (LY294002) inhibits macrophage chemotactic migration towards

C5a [122]. Moreover, inhibitors of PI3K have emerged as promising therapeutic targets

and have also entered clinical trials [274]. Several studies show that pharmacological

inhibition of PI3K prevents the progression of inflammatory and autoimmune disorders,

including rheumatoid arthritis, systemic lupus erythematosus and atherosclerosis

[274,276].

A number of signalling pathway also exist downstream of PI3K/Akt. For

example, mammalian target of rapamycin (mTOR) (Figure 2.15), a serine/threonine

kinase downstream of PI3K and is a central regulator of protein synthesis and cell

proliferation [290]. mTOR was identified and cloned after the findings of two genes:

TOR1 and TOR2 in the budding yeast Saccharomyces cerevisiae during a resistance

screen to rapamycin (immunosuppressant drug) [291]. mTOR initiates translation of

mRNA via activation of p70S6 kinase (p70S6K) and inhibition of initiation factor 4E-

binding protein 1 (4E-BP1) (Figure 2.15) [290,292]. p70S6 kinase then phosphorylates

the S6 protein of the 40S ribosomal subunit and initiates protein synthesis [293]. mTOR

and its downstream signalling molecules are activated by LPS whereas rapamycin

abolished their phosphorylation [290]. Studies by Weichhart et al. [290] showed that

inhibition of mTOR with rapamycin suppressed production of IL-10 and increased IL-

12 secretion in human peripheral blood mononuclear cells (PBMCs) in response to LPS

exposure, suggesting immuno-modulatory effects of mTOR. Rapamycin blocked the

LPS-mediated production of chemokine MCP-1 in monocytes [290], suggesting that the

mTOR pathway is also important for cell migration. Furthermore, mice treated with

rapamycin are protected against Listeria monocytogenes infection and these mice also

exhibit reduction in granulomatous lesions of the liver [290]. Rapamycin is a potent

immunosuppressant with both in vitro and in vivo studies showing that rapamycin

inhibits B- and T-cell proliferation in response to cytokines, alloantigen and mitogen

exposure [294,295]. Rapamycin also improves survival rates and reduces acute graft

rejection in animal and clinical studies [295,296], suggesting rapamycin maybe an

effective therapeutic target in organ transplantation.

59

In conclusion, PI3K and the associated downstream kinase mTOR are crucial

molecules that regulate inflammatory processes and associated inflammatory disorders.

60

Figure 2.15: PI3K and downstream kinases. GPCRs and TLRs present on immune

cells activate PI3K, which then phosphorylates phosphatidylinositol-4,5-bisphosphate

(Ptdlns (4,5) P2) to phosphatidylinositol-(3,4,5)-trisphosphate (Ptdlns (3,4,5)P3), leading

activation of Akt. Akt activates mTOR, which regulates protein synthesis by

phosphorylating p70S6 kinase to S6 and inhibits initiation factor 4EBP-1.

2.11 Sepsis and inflammation

Sepsis is a disease caused by systemic infection and is characterised by exacerbated

inflammation [297]. Sepsis contributes to 1.5 % of deaths per year and is the 10th

most

common cause of mortality in the United States [298]. Sepsis can be caused by infection

of the lung, abdomen or genitourinary system that spreads to the blood stream and

61

contributes to ~80% of cases of sepsis [42]. Infection with gram-positive bacteria and

polymicrobial infections account for 30-50% and 25% of cases of sepsis, respectively

[299,300,301]. Patients with sepsis show delayed hypersensitivity, inability to clear

infection and increased levels of numerous pro-inflammatory cytokines in

serum/plasma, leading to the generation of a ‘cytokine storm’ and organ dysfunction

[42,302]. The uncontrolled inflammation and bacterial expansion in sepsis cause

injuries to host tissues by promoting the migration of leukocytes from blood stream to

inflamed tissues (e.g. lung), resulting in increased expression/production of TLRs and

complement receptors, cytokines, chemokines and their receptors [42,297]. This

inflammatory reaction is commonly associated with profound hypotension, which

threatens organ perfusion and is a leading cause of mortality in septic patients

[298,303]. in the later phase of sepsis plays a crucial role in sepsis-induced mortality.

The pathogenesis of sepsis involves several factors that interact in a chain of events

from pathogen recognition to overwhelming host response. Several studies show the

involvement of TLRs in sepsis and patients/animal with sepsis show increased

expression of TLR-2 and TLR-4 [304]. For example, CLP-induced experimental

peritonitis increases the expression of TLR-2 and TLR-4 in lung, liver and splenic

macrophages as compared to sham-operated mice [305,306]. In addition, TLR-4

expression in mouse alveolar ECs promotes neutrophil recruitment into the lungs after

LPS administration, leading to tissue injury [307]. Furthermore, TLRs promote sepsis

via inducing the production of pro IL-1, which is then activated by caspase-1 to its

active extracellular form IL-1 [297]. Caspases are crucial for apoptosis, cellular

regulation and inflammation and mice deficient in caspase-1 show protection against

sepsis [297], suggesting IL-1 activation via caspase-1 is critical for aggravating

inflammation in sepsis.

Toll like receptors also interact with the complement system, with complement

activation augmenting TLR ligand-mediated cytokines production [308], triggering

further inflammation in sepsis. The activation of TLRs leads to elevated expression of

both C3aR and C5aR [309]. Additionally, the engagement of complement in sepsis

increases the plasma and serum levels of C3a, C5a and C5b-C9 [310]. The excessive

generation of C5a in sepsis induces a number of effects on different immune cells. For

example, C5a paralyses neutrophils and increases the host’s susceptibility to infection

[32]. In the case of macrophages, C5a increases the secretion of pro-inflammatory

62

cytokines including TNF-α and IL-6 by macrophages, followed by increased production

of IL-8 and tissue factor by ECs [32,311]. Furthermore, C5a induces apoptosis of

thymocytes, resulting in deficiency of B-cells and CD4+ T-cells in septic patients [113].

C5a also promotes adverse effects in sepsis via binding to its receptor C5aR, the

expression of which is remarkably increased in several organs [114,118].

Accumulating evidence shows that increased expression of TLR-2, TLR-4 and

cytokines activates rapid movement of NF-B p50:p65 dimers to the nucleus, which

further increases production of pro-inflammatory cytokines and leads to multiple organ

failure in sepsis [93]. In addition, animals exposed to LPS or bacteria via

intraperitoneal, inhaled or intravenous routes show activation of NF-B in lung tissue,

which results in increased expression of iNOS and systemic hypotension [312,313].

Furthermore, increased activation of NF-κB and increased levels of NF-B dependent

cytokines (TNF-α, IL-1 and IL-8) have also been reported in patients with sepsis or

sepsis-mediated acute lung injury [314].

Following systemic inflammation, compensatory anti-inflammatory response

(CARS) occurs, which leads to dysfunction of immune cells in sepsis [315,316].

Current studies provide compelling evidence of sepsis-mediated immunosuppression

and changes in immune cell profiles [317], particularly during the later periods of sepsis

(72 h after diagnosis of sepsis) [318]. For example, splenocytes from septic patients

show decreased cytokine production compared to those from healthy controls after in

vitro stimulation with LPS or anti-CD3/anti-CD28 [319]. Furthermore, depletion of

CD4, CD8 T-cells and monocytes, and an increased percentage of Treg cells have been

reported in splenocytes and in cells isolated from the lungs of septic patients [319].

These studies indicate that patients who survive hyper-inflammatory phase of sepsis

undergo profound immunosuppression, which reduces the ability to combat invading

pathogens and promotes the development of secondary infections [320]. Accumulating

evidence suggests that nearly two-thirds of deaths from sepsis occur due to secondary

infections [315]. Therefore, immunosuppression occurring in the later phase of sepsis

plays a crucial role in sepsis-induced mortality.

Summarising, inflammation and immunosuppression are central to the pathologic

sequelae of sepsis and associated organ dysfunction, leading to the activation/release of

63

a myriad of inflammatory molecules and compounds. We hypothesise that BV/BVR

may inhibit the activation of many of these inflammatory molecules and therefore could

represent a promising therapeutic agent against sepsis.

64

This chapter has been published by Biochemical and Biophysical Research

Communications as an original investigation. The abbreviations, formatting and

referencing of this document have been changed slightly to more closely reflect the

formatting of other chapters in this thesis.

Bisht K., Wegiel B., Tampe J., Neubauer O., Wagner K-H., Otterbein L. E., Bulmer A.

C. Biliverdin modulates the expression of C5aR in response to endotoxin in part via

mTOR signaling. Biochemical and Biophysical Research Communications. 449: 94-99

(2014).

Chapter 3 Biliverdin modulates the expression of C5aR in response to

endotoxin in part via mTOR signalling

65

3.1 Abstract

Macrophages play a crucial role in the maintenance and resolution of

inflammation and express a number of pro- and anti-inflammatory molecules in

response to stressors. Among them, the complement receptor 5a (C5aR) plays an

integral role in the development of inflammatory disorders. Biliverdin and bilirubin,

products of haem catabolism, exert anti-inflammatory effects and inhibit complement

activation. Here, we define the effects of biliverdin on C5aR expression in macrophages

and the roles of Akt and mammalian target of rapamycin (mTOR) in these responses.

Biliverdin administration inhibited lipopolysaccharide (LPS)-induced C5aR expression

(without altering basal expression), an effect partially blocked by rapamycin, an

inhibitor of mTOR signalling. Biliverdin also reduced LPS-dependent expression of the

pro-inflammatory cytokines TNF- and IL-6. Collectively, these data indicate that

biliverdin regulates LPS-mediated expression of C5aR via the mTOR pathway,

revealing an additional mechanism underlying biliverdin’s anti-inflammatory effects.

Key words: Macrophage, inflammation, mTOR

66

3.2 Introduction

Biliverdin (BV), a molecule with tetrapyrrole structure, is derived from haem

catabolism via haem oxygenase (HO) activity and is rapidly reduced to bilirubin (BR)

by biliverdin reductase (BVR) [21,198]. Both BV and BR are antioxidants [215],

though, have been regarded previously as waste products. Recent findings, however,

have begun to elucidate diverse protective roles for these molecules [34,233]. Biliverdin

shows strong cytoprotective activities in various in vitro and in vivo models of vascular

injury, ischemia-reperfusion injury and organ transplantation, demonstrating its

therapeutic potential [217,219]. We recently reported that BV reduces the expression of

toll like receptor-4 (TLR-4) in murine macrophages via nitric oxide-dependent

activation of BVR [28]. TLRs transmit signals to induce pro-inflammatory cytokine

expression via NF-B [321] and synergise with C5aR (CD88) to aggravate

inflammatory responses to endotoxin [322]. TLR-ligands are dependent on complement

activation and C5aR regulates TLR-4 signalling, supporting the importance of C5aR in

promoting inflammation [308].

Complement is a major component of innate and adaptive immunity. Similar to

TLRs, complement is also activated by pathogen associated molecular patterns,

including LPS, among many other mechanisms involved in classical, lectin and

alternative activation pathways [107,112]. Complement activation induces pathogen

opsonisation and generation of the anaphylatoxins: C3a and C5a, which stimulate

inflammatory responses by binding to respective C3aR and C5aR receptors [107].

Excessive inflammation mediated by complement activation contributes to various

diseases, including sepsis, asthma, Alzheimer’s disease and atherosclerosis

[29,107,112]. Therefore, it is important to identify molecules that regulate or attenuate

complement-mediated inflammation. Both BV and BR ameliorate complement-

mediated haemolysis by inhibiting the classical pathway of complement activation at

the C1 step via physically interacting with complement proteins [245,247]. However,

BV’s effect on the expression of complement receptors and mechanisms underlying this

regulation remains unknown.

The present study thus assessed the effects of BV and the PI3K/mTOR pathways

on C5aR expression in primary and immortalised macrophages. Data reveal that BV

inhibits LPS-dependent C5aR expression, in part via mTOR signalling.

67

3.3 Material and methods

3.3.1 Cell Culture and Treatment

RAW 264.7 mouse macrophage cell line was purchased from ATCC (USA). RAW

cells were cultured (<15 passages) in RPMI-1640 medium supplemented with 10% fetal

bovine serum, 100 U/mL penicillin and 100 µg/mL streptomycin (Life Technologies,

Grand Island, NY, USA; complete medium). Cells (1.5 X 105 cells/mL) were seeded on

60 mm Sterilin tissue culture plates or 6 well plates (Thermo Scientific, Logan, UT,

USA) in 3 mL of complete medium and incubated at 37 °C (5% CO2) for 24 h prior to

experimentation. Cells were then untreated or challenged with 100 ng/mL of LPS for 24

h in the absence or presence of freshly prepared biliverdin hydrochloride (10 or 50 µM;

Frontier Scientific, Logan UTA, USA) in 0.01 % DMSO as previously described [21].

Re595 LPS from Salmonella Minnesota (Sigma-Aldrich, St. Louis, MO, USA) was

dissolved in DPBS (Life Technologies) and used at a final concentration of 100 ng/mL.

Rapamycin (Sigma-Aldrich) was used as selective inhibitor of mTOR [291] and was

applied to sub-sets of cells (10 nM in 0.01 % DMSO final concentration) 1 h prior to

LPS or BV treatment. Biliverdin and related tetrapyrroles are photo sensitive, therefore,

all BV containing solutions were protected from light. Appropriate vehicle control

experiments were also completed.

For PI3K inhibiton, RAW 264.7 cells were pre-treated with LY294002 (LY, PI3K

inhibitor; Sigma Aldrich, USA) for 30 min. LY294002 was dissolved in DMSO at 10

µM in 0.01% DMSO final concentration. Samples were treated for 30 min with BV or

LPS after LY treatment for pAkt and for 24 h for C5aR expression.

3.3.2 Isolation of Bone Marrow-Derived Macrophages

7-8 week old C57BL/6 mice were purchased from Jackson Laboratories

(Jackson Laboratories, Bar Harbour, Maine, USA). All animals were held under

pathogen free conditions. Prior to completion, experiments were approved by the Beth

Israel Deaconess Medical Centre (BIDMC) Animal Care and Use Committee. Bone

marrow-derived macrophages (BMDMs) were isolated as previously described [21].

Macrophages were harvested after 5 days and were then cultured for 24 h in RPMI

medium supplemented with 10 % FBS and 5 % Antibiotic-Antimycotic (Life

68

Technologies) prior to experimentation. Cells were then treated with 50 M BV and

100 ng/mL LPS for 24 or 48 h.

3.3.3 RNA Extraction and qRT-PCR

Total RNA was isolated from cultured cells using RNeasy®

Plus Mini Kits

(Qiagen, Chadstone, VIC, Australia) according to manufacturer’s instructions. One

microgram of RNA was reverse transcribed into cDNA using a first strand cDNA

synthesis kit (Thermo Scientific). HPRT and GAPDH were used as reference genes

based on their stability of expression determined by geNorm analysis as described

below. Primers for mouse GAPDH, HPRT, C5aR, TNF-α, and IL-6 were designed

using Primer Quest Software (Table 3.1, Sigma-Aldrich). qRT-PCR was performed with

Applied Biosystems SteponeTM

and Stepone PlusTM

Real-Time PCR Systems (Life

Technologies). Each sample was run in triplicate and cycle threshold (CT) values were

imported into Microsoft Excel for geNorm analysis.

Gene

target

Forward sequence Reverse sequence Amplicon

size (bp)

GAPDH TCAACAGCAACTCCCACTCTTCCA ACCCTGTTGCTGTAGCCGTATTCA 115

HPRT AGGAGTCCTGTTGATGTTGCCAGT GGGACGCAGCAACTGACATTTCTA 134

C5aR TCATCCTGCTCAACATGTACGCCA TCTGACACCAGATGGGCTTGAACA 93

TNF-α TCTCATGCACCACCATCAAGGACT ACCACTCTCCCTTTGCAGAACTCA 92

IL-6 ATCCAGTTGCCTTCTTGGGACTGA TAAGCCTCCGACTTGTGAAGTGGT 134

Table 3.1. Primer sequences and amplicon sizes of housekeeping (GAPDH and HPRT)

and target genes (C5aR, TNF-α and IL-6) expressed in RAW 264.7 cells.

3.3.4 qRT-PCR Calculation using Genorm Analysis

qRT-PCR data was normalised by the use of geNorm algorithm as described by

Vandesompele et al. [323]. Briefly, the geNorm application determines the most stably

expressed and thus most accurate reference genes for the normalisation of qRT-PCR

data. The geometric mean of ∆CT expression for GAPDH and HPRT was calculated to

obtain the normalisation factor for each sample. The expression of each candidate gene

69

for each sample was normalised to the combined reference genes. The ∆CT (difference

between cycle threshold values) expression was then calculated for each gene in each

sample. The relative expression for each candidate gene was calculated by dividing the

∆CT of target gene for each sample by the normalisation factor of GAPDH and HPRT

within the same sample.

3.3.5 Sources of Antibodies

The following antibodies were used for western blotting analyses where

indicated: rabbit anti-phospho-Akt (Ser473), rabbit anti-Akt, rabbit anti-phospho-S6

Kinase (Ser235/236), anti-rabbit IgG and anti-mouse IgG (Cell Signalling, Beverly,

MA, USA) and mouse anti--actin (Sigma-Aldrich). For flow cytometry experiments,

PE-conjugated anti-mouse CD88 antibody (C5aR) and PE-labeled anti-rat IgG

(Biolegend, San Diego, CA, USA) were used.

3.3.6 Flow Cytometry

After harvesting and washing RAW 264.7 or BMDM cells with DPBS, cells

were stained with anti-mouse CD88 antibody or anti-rat IgG at 1 µg/106 cells for 30 min

at 4 °C. Cells were immediately analysed using a FACS Caliber flow cytometer (Becton

and Dickinson, San Jose, CA, USA) using the FL-2 channel. Mean fluorescence

intensity (MFI) was calculated using CellQuest ProTM

software (Becton and Dickinson).

3.3.7 Western Blot

Cell lysates were prepared in ice-cold RIPA buffer (50 mM Tris-HCl, [pH 7.4],

50 mM sodium fluoride, 150 mM NaCl, 1% Nonident P40, 0.5 M EDTA [pH 8.0]) and

the protease inhibitor cocktail Complete Mini (Roche, Indianapolis, IN, USA). Samples

were centrifuged at 14,000 g at 4 °C for 20 min and supernatants were collected. Protein

concentrations of supernatants were measured using a BCA protein assay kit (Thermo

Scientific). Forty micrograms of each protein sample was then electrophoresed on

NuPAGE 4-12% Bis-Tris Gel (Life Technologies) in NuPAGE MES SDS running

buffer (Life Technologies) for 90 min at 100 V. The membranes were blocked with 5%

non-fat dry milk in 1 x Tris buffered saline buffer (TBS; Boston Bio Products, Ashland,

MA, USA) for 1 h and then probed with appropriate primary antibodies (diluted at

1:1000 in 1 x TBS with 5 % non-fat milk) overnight at 4°C. Membranes were then

washed in 1 x TBS buffer and thereafter membranes were incubated with horseradish

70

peroxidase (HRP)-conjugated secondary antibodies at a dilution of 1:5000 in 1 x TBS

with 5 % non-fat milk for 1 h at room temperature. Membranes were visualised using

Super Signal West Pico chemiluminescent substrate (Thermo Scientific) or Femto

Maximum Sensitivity Substrate (Thermo Scientific), followed by exposure to

autobioradiography film (BioExpress, Kaysville, UT, USA). Precision Plus ProteinTM

KaleidoscopeTM

protein standard (Bio Rad, Hercules, CA, USA) was used to confirm

the molecular size of target proteins.

3.3.8 ELISA Analysis

The concentrations of cytokines were measured in cell culture media using

commercially available ELISA kits from eBioscience (Kensington, SA, Australia) for

IL-6 and R&D Systems (Gymea, NSW, Australia) for TNF- as per manufacturer’s

instructions.

3.3.9 Statistical Analysis

All data are reported as mean ± S.E. Statistical analysis was performed using

one-way repeated measures ANOVA (posthoc Tukey test; Sigmastat, Ver. 11.0). If the

data set lacked either normal distribution or equal variance, data were log10 transformed

to obtain normally distributed data. P < 0.05 was considered significant.

71

3.4 Results

3.4.1 Biliverdin inhibits the expression of C5aR in murine macrophages

qRT-PCR analysis showed that neither 10 or 50 µM BV modified basal expression

of C5aR in RAW 264.7 cells (Figure 3.1A and Figure 3.2A). However, the LPS-

dependent increase in C5aR gene expression at 24 h was significantly decreased by 50

M BV (Figure 3.2A; P < 0.05). Treatment with 10 µM BV at the time of LPS

stimulation failed to significantly block C5aR gene expression at 24 h (Figure 3.1A),

indicating a concentration-dependent inhibition of LPS induced C5aR expression by

BV.

Next, we tested whether BV inhibited C5aR protein expression. RAW 264.7 cells

were treated with 10 or 50 µM BV 100 ng/mL LPS for 24 h and cell surface

expression of C5aR was analysed. Biliverdin at 10 µM did not significantly affect LPS-

dependent C5aR gene and cell surface expression (Figure 3.1A and B), however, BV at

50 µM significantly inhibited LPS-induced C5aR expression (Figure 3.2B, P < 0.05).

These data are in agreement with other published reports showing that 50 µM BV is

necessary to induce anti-inflammatory effects [21,28]. Therefore, a concentration of 50

µM was chosen for investigating BV’s effect on cell signalling and LPS-mediated

inflammation. To confirm BV’s effects in primary macrophages, BMDMs from mice

were also incubated with 50 µM BV and 100 ng/mL LPS for 24 and 48 h. LPS

significantly increased C5aR expression by ~40 % at 48 h compared to control and BV

abrogated this effect (Figure 3.2C, P < 0.05). In summary, BV consistently decreased

both C5aR gene (24 h) and protein expression (24-48 h) in primary and immortalised

macrophages.

One mechanism by which BV exerts effects in macrophages is via PI3K/Akt

signalling [21]. We, therefore, next tested whether the inhibitory effect of BV on C5aR

expression was PI3K-dependent. To block PI3K signalling, cells were pre-incubated

with LY294002 (LY, 10 μM) for 30 min prior to 50 µM BV or LPS stimulation. To

confirm that LY inhibits downstream targets of PI3K, pAkt expression was determined

in RAW 264.7 cells treated with 50 µM BV or LPS for 30 min. As shown in Figure

3.1C and D, BV/LPS-induced phosphorylation of Akt was blocked by LY. To assess the

effects of LY on C5aR expression, experiments were performed over 24 h due to strong

effects of BV at this time point (Figure 3.2A and B). However, LY blocked the LPS-

dependent induction of C5aR gene and protein (Figure 3.1E and F), indicating PI3K

72

may play an integral role in mediating C5aR expression in response to LPS. The role of

PI3K on BV-mediated changes on C5aR gene and protein expression in the presence of

LPS could thus not be determined (Figure 3.1E and F; P = 0.286 and P = 0.083,

respectively).

Figure 3.1: Biliverdin reduces C5aR expression and the effects were independent

of PI3K/Akt signaling. (A) Gene expression and (B) cell surface expression of C5aR in

RAW 264.7 cells, treated with BV (10 μM) ± LPS (100 ng/mL) for 24 h. (C and D)

Protein expression of pAkt and Akt in RAW 264.7 cells, pre-incubated with or without

LY prior to BV (50 μM) and LPS treatment. (E) Gene and (F) protein expression of

C5aR in RAW 264.7 cells, pre-incubated with LY and thereafter treated with LPS or

BV (50 μM) for 24 h. The data are representative of two independent experiments.

Value represents mean ± S.E., n=3/group. *P < 0.05 versus non LPS control (0.01%

DMSO), &P < 0.05 versus LPS control and #P < 0.05 versus no LY LPS control.

73

Figure 3.2: Biliverdin inhibits C5aR expression. RAW M were treated BV (50 M)

± LPS for 24 h. (A) Gene and (B) cell surface expression of C5aR in RAW M. (C)

74

Cell surface expression of C5aR in BMDM M treated with BV and LPS for 24 and 48

h. Data are representatives of three independent experiments. Value represents mean ±

S.E. n=3/group, *P < 0.05 vs. non LPS control (0.01 % DMSO) at 24 h and 48 h and &

P

< 0.05 vs. LPS control at 24 and 48 h.

3.4.2 Biliverdin induces the phosphorylation of Akt and S6 and inhibits C5aR

expression in macrophages in part via mTOR signalling

Having established that BV activates the PI3K-Akt signalling axis [21], we next

evaluated the activation of pAkt and pS6 (downstream of mTOR) in response to BV in

RAW 264.7 macrophages. As shown in Figure 3.3A-D, both 50 M BV and 100 ng/mL

LPS increased Akt and S6 phosphorylation in a time-dependent manner.

75

Figure 3.3: Biliverdin enhances phosphorylation of Akt and S6. RAW 264.7 M

were treated with BV and LPS for different time points and protein expression of pAkt,

Akt (A and B) and pS6 (C and D) were analysed. Blots are representative of at least two

independent experiments.

Next, we sought to determine whether inhibition of the mTOR pathway with

rapamycin would modulate the effects of BV on C5aR expression. RAW 264.7 cells

were incubated with 10 nM rapamycin for 1 h prior to treatment with 50 μM BV or

LPS. As shown in Figure 3.4A, phosphorylation of S6 in response to BV and LPS was

blocked in the presence of rapamycin. Furthermore, rapamycin treatment increased the

basal expression of C5aR (Figure 3.4B), indicating the possibility that S6 negatively

regulates C5aR expression. LPS significantly increased C5aR expression and this effect

was not dependent on mTOR signalling (Figure 3.4B). However, BV decreased LPS-

induced C5aR expression in a rapamycin-dependent manner (Figure 3.4B), implicating

mTOR signalling in BV’s inhibitory effect. In summary, BV stimulates signalling

downstream of PI3K and mTOR. Although some similarities in LPS and BV signalling

exist, blocking mTOR signalling attenuates BV’s inhibitory effect on C5aR gene

expression.

76

Figure 3.4: Biliverdin modulates C5aR expression in part via mTOR signalling.

RAW 264.7 M were pre-incubated with rapamycin for 1 h and thereafter treated with

BV or LPS for 15 min or 24 h for pS6 and C5aR expression, respectively. (A) Protein

expression of pS6 and (B) cell surface expression of C5aR in RAW 264.7 cells. The

data are representative of three independent experiments. Value represents mean ± S.E.

n=3/group, #P < 0.05 vs. no rapamycin control (0.01 % DMSO), *P < 0.05 vs. no

rapamycin and no LPS control (0.01 % DMSO), &

P < 0.05 vs. no rapamycin and LPS

control and &#

P < 0.05 vs. no rapamycin BV + LPS group.

3.4.3 Biliverdin suppresses the release and expression of complement-

associated pro-inflammatory cytokines

We next evaluated the effects of BV on the expression of the pro-inflammatory

cytokines (TNF- and IL-6) in RAW 264.7 macrophages. LPS significantly increased

TNF- and IL-6 mRNA expression (~6- and ~200-fold, respectively) at 24 h, and these

responses were significantly inhibited by BV (Figure 3.5A and B, P < 0.05).

ELISA analysis of both cytokines showed that LPS significantly increased TNF-

and IL-6 concentrations in cell culture supernatants at 24 h (P < 0.05), while, BV only

reduced IL-6 levels in response to LPS (Figure 3.5D, P < 0.05).

77

Figure 3.5: Biliverdin attenuates complement associated pro-inflammatory

cytokines. mRNA expression of TNF- (A) and IL-6 (B) and protein concentration of

TNF- (C) and IL-6 (D) were analysed in RAW 264.7 macrophages, incubated with

BV±LPS for 24 h. The data are representative of two independent experiments. Value

represents mean ± S.E. n=3/group, *P < 0.05 vs. no LPS control (0.01 % DMSO) and

&P < 0.05 vs. LPS control.

78

3.5 Discussion

The present study provides novel insights into the anti-inflammatory effects of BV,

demonstrating that BV consistently decreases LPS-mediated C5aR gene and protein

expression in RAW 264.7 cells and BMDMs. This inhibitory effect of BV was partially

mediated via the mTOR pathway and was accompanied by decreased expression of

complement associated pro-inflammatory cytokines.

PI3K/Akt negatively regulates LPS signalling and inhibition of the PI3K pathway

augments LPS-induced responses, including the activation of NF-κB and TNF- gene

expression [324]. A novel and unexpected finding of this report is that pharmacological

inhibition of PI3K with LY attenuated LPS-induced increases in C5aR expression,

suggesting that PI3K signalling may be necessary for C5aR expression. Two studies

show that inhibition of PI3K with LY inhibits C5a induced chemotactic migration of

macrophages [122,325], which may be related to inhibition of C5aR expression as

reported here. However, LY’s inhibitory effects exist beyond PI3K signalling [326].

Therefore, it is also possible that LY blocked C5aR expression via a PI3K-independent

mechanism. Since LY’s effects are rather non-specific, we chose a more specific

downstream inhibitor of PI3K signalling [290,291], rapamycin, to determine whether

BV’s effect on C5aR was PI3K/mTOR dependent.

Rapamycin pre-treatment blocked BV and LPS-mediated phosphorylation of S6 (a

downstream signalling molecule of mTOR, which plays an important role in protein

synthesis) [290]. However, inhibition of mTOR signalling did not influence LPS-

induced C5aR expression, indicating that LPS likely regulates C5aR through a different

signalling pathway, such as NF-κB signalling [89]. On the other hand, BV inhibition of

LPS-induced C5aR was partially mitigated in the presence of rapamycin, suggesting

that BV inhibits C5aR in part via activation of the mTOR pathway.

The C5a-C5aR axis cross-talks with TLR-4 [308] and C5a via C5aR

concentration-dependently increases LPS-induced secretion of pro-inflammatory

cytokines, including IL-6 and TNF- in human monocytes [327]. Therefore, the effects

of BV on TNF- and IL-6 were also explored. While BV significantly downregulated

LPS-induced mRNA expression of both cytokines at 24 h, only IL-6 and not TNF-

protein levels were reduced by BV. TNF- gene expression and synthesis/release are

79

regulated via different pathways [328]. Activation of macrophages with LPS leads to

rapid cytosolic accumulation of TNF- mRNA via activation of the NF-κB pathway

[329]. However, TNF- is initially expressed as pro-TNF- and release of mature

TNF- from leukocytes relies on matrix metalloproteinase (MMP) activation, which

promotes cleavage of mature TNF- from pro-TNF- [127]. Furthermore, TNF-

mRNA is short-lived (~46 min) and does not contribute to rapid increases in TNF-

release by RAW macrophages upon LPS activation [328]. Therefore, it is likely that BV

inhibits TNF- transcription, via inhibition of NF-κB [212,217], yet does not prevent

activation of MMP-induced cleavage and release of TNF-. These data and conclusions

are consistent with reported in vivo findings, which show that BV only decreases

mRNA expression of TNF- and does not influence serum levels of TNF- in

endotoxin/transplantation challenged animals [217,219]. However, BV significantly

decreased IL-6 expression and secretion. We suggest that BV may decrease IL-6 by

inhibiting activation of C5aR since C5aR antagonists reportedly decrease LPS-mediated

release of cytokines including IL-6 by monocytes, macrophages and thymocytes

[327,330].

Both LPS and BV induce BVR, which rapidly converts BV to BR [21]. Both in

vitro and in vivo studies show rapid conversion of BV to BR over time [21,217].

Furthermore, in vivo studies suggest that BV may inhibit LPS-induced responses via BR

generation [217]. Furthermore, our group has previously shown that BR concentration

increases by 33% of the BV concentration after exogenous administration in rats [198].

Therefore, if future studies were to increase blood BV concentration to 50 M, blood

BR levels would likely increase ~ 15 M, approximating the range seen in Gilbert’s

syndrome (≤17 μM) [22]. Such an increase in BR may be associated with

immunomodulation, including reduced IL-6 and increased IL-1β expression [25,239].

However, whether BV’s anti-inflammatory effects are influenced by BR are still debated

and require further investigation. In this study, 50 µM BV consistently inhibited effects

of LPS on C5aR gene expression after 24 h of incubation, with effects of 50 µM BV

statistically significant. These effects are consistent with inhibition of C5aR protein

expression at 24 and 48 h. We speculate that the lower 10 µM concentration of BV is

more rapidly reduced to BR [21], reducing BV availability for BVR activity/signalling.

At the higher 50 µM concentration, BV induces prolonged S6 phosphorylation and

modulation of C5aR expression. These data suggest a threshold concentration of BV of

80

50 µM is necessary to activate kinase signalling and evoke changes in protein synthesis

[21,331].

Furthermore, several in vitro studies have shown that LPS increases expression of

C5aR in different cells, including rat alveolar epithelial cells [332], mouse endothelial

cells [333] and RAW264.7 macrophages [334], supporting the in vitro findings

presented in this chapter. Importantly, in vivo studies reported increase in C5 and C5a

levels in BAL and plasma, respectively after LPS infusion [335,336], suggesting that

LPS activates complement proteins. However, heating of serum inactivates complement

proteins, including C5a [337]. Therefore, any C5a generated in vitro must have been

derived from LPS-activated leukocytes. C5a via C5aR can then stimulate expression

and release of cytokines by leukocytes [309,327]. Therefore, future studies are required

to investigate the effect of co-incubation of BV and C5aR antagonists on LPS-induced

cytokine expression and release, to determine whether BV inhibits cytokine expression

and release via reducing C5aR expression. Although in vivo studies have shown

increased plasma levels of C5a after LPS administration future studies are required to

measure C5a concentrations in heat inactivated serum, to determine the importance of

leukocytes C5a release in supporting the inflammatory effect of LPS in vitro.

In conclusion, this is the first report to show that BV significantly inhibits LPS-

induced C5aR expression in primary and immortalized macrophage cell lines, an effect

that is partially mediated via mTOR signalling. Biliverdin also reduced pro-

inflammatory cytokine expression, which may be related to C5aR inhibition. We

propose that inhibition of C5aR by BV provides a previously unknown anti-

inflammatory mechanism, supporting BV’s role as an endogenous anti-inflammatory

molecule that serves to re-establish homeostasis and protect against transplant rejection

and endotoxic shock. Taken together, we propose that BV may offer unique therapeutic

avenues for treating sepsis and shock.

81

The work in this chapter is presented in an international conference in the form of an

oral presentation (please see below). This chapter is currently in the process of

submission.

Bisht K., Li M., Bulmer A.C., Nemeth Z., Csizmadia E., Otterbein L.E., Wegiel B.

Conditional deletion of biliverdin reductase in myeloid cells promotes chemotaxis by

C5a dependent mechanism. 43rd

Annual Scientific Meeting, Australasian Society for

Immunology, Wellington, New Zealand, from 2nd

to 5th

December 2013.

Chapter 4 Conditional deletion of biliverdin reductase in myeloid cells

promotes chemotaxis by C5a dependent mechanism

82

4.1 Abstract

Biliverdin reductase (BVR) is a pleotropic enzyme, which has cytoprotective

and immunomodulatory effects in various cell types. In this study, we investigated the

role of BVR in regulating macrophage phenotype and function by assessing expression

of complement receptor 5a (C5aR), inducible nitric oxide synthase (iNOS) and TNF-

as well as chemotaxis in response to complement 5a (C5a). Bone marrow derived

macrophages (BMDMs) from BVRfl/fl

and CreLyz:BVRfl/fl

mice (conditional deletion of

BVR in myeloid cells) that were treated with endotoxin and IFN-γ or IL-4 in the

presence or absence of neutralising antibody against C5aR were studied.

Expression of C5aR was measured by flow cytometry and real-time PCR.

Macrophages isolated from CreLyz:BVRfl/fl

mice expressed higher cell surface and gene

expression of C5aR (P < 0.05) compared to BMDM from BVRfl/fl

(P < 0.05). In

addition, conditional deletion of BVR resulted in enhanced chemotaxis towards C5a.

Furthermore, endotoxin and IFN--induced macrophage polarisation towards the

classical phenotype (M1) was significantly increased in BMDM from CreLyz:BVRfl/fl

mice (P < 0.05) These effects were blocked in the presence of neutralising antibody

against C5aR, indicating an important role of C5aR in mediating the effects of BVR.

In summary, BVR deletion regulates macrophage chemotaxis in response to C5a

via the modulation of C5aR expression. In addition, macrophages lacking BVR express

an M1 phenotype with elevated gene and protein expression of iNOS and TNF-

release that depends, in part, on C5aR signalling.

Key words: Macrophage activation, C5aR, chemotaxis, and iNOS.

83

4.2 Introduction

Biliverdin reductase (BVR) is a multifunctional enzyme, which mediates the reduction

of biliverdin (BV) to bilirubin (BR) [9,33]. The conversion of BV to BR occurs in many

cellular compartments; however the majority of this reactivity is detected in the ER and

cell membrane [258]. Recently, we showed that BVR present on the surface of

macrophages is critical for mediating anti-inflammatory effects of BV through Akt-IL-

10 signalling [21]. Biliverdin and BVR induce cytoprotective effects in various cells

and in vivo models [28,266]. For example, deletion of BVR by RNA interference

promotes cell death and oxidative stress in response to 2’, 7’-dichlorodihydrofluorescein

diacetate in HeLa and SH-SY5Y cells [263,266]. Lack of BVR also leads to the

development of a pro-inflammatory phenotype in macrophages, characterised by

elevated production of TNF- due to increased basal expression of TLR-4 [28].

Complement is an important constituent of innate and adaptive immunity [108].

The main function of complement is to eliminate pathogens by opsonisation and

permeabilisation of foreign particles and is also involved in the clearance of apoptotic

and necrotic cells [109,110]. Activation of complement by one of the four pathways:

classical, lectin, alternative and protease generate anaphylatoxins (C3a and C5a) and

activate their receptors (C3aR, C5aR and C5L2) [114]. Among them, the C5a-C5aR

axis is important during inflammation-associated pathologies such as ischaemia

reperfusion injury (IRI), neurodegenerative disorders, atherosclerosis, rheumatoid

arthritis and sepsis [29,30,32]. Therefore, therapeutics that can regulate the activation of

C5a and its receptor could represent promising treatments against complement-

associated disorders. Biliverdin has shown cytoprotective effects in animal models of

IRI and sepsis [27,176,217]. It has been suggested that BV imparts anti-inflammatory

effects via BVR-mediated activation of IL-10 via phosphatidylinositol 3-kinase (PI3K)-

dependent mechanism [21]. We have recently shown that BV inhibits the expression of

C5aR in RAW 264.7 macrophages in part via mTOR [338]. Whether BV-BVR axis can

regulate functional activation of C5aR remains unknown.

Macrophages, first identified as phagocytic cells, are now well recognised as

regulators of both innate and adaptive immunity as well as crucial mediators of

haematopoiesis, apoptosis, malignancy, vasculogenesis and reproduction [339].

Macrophages can be polarised into two different phenotypes in response to LPS and

84

cytokines in vitro [340]. Stimulation of macrophages with LPS and IFN-γ results in

their polarisation towards the M1, classically activated, phenotype. Whereas, IL-4

drives macrophage polarisation towards the M2 phenotype [45,55,73,341]. M1

macrophages express high levels of iNOS and are associated with acute responses to

pathogen presentation and inflammation [342], while M2 macrophages are associated

with the wound healing process and chornic inflammation [341].

In the present study, we isolated the bone marrow derived macrophages

(BMDMs) from BVRfl/fl

and CreLyz:BVRfl/fl

mice and evaluated the expression of C5aR

and macrophage chemotaxis towards C5a. Furthermore, we investigated the effect of

BVR deletion on macrophage phenotype in response to M1 and M2 stimuli and whether

C5aR was critical for their phenotypic switch dictated by BVR. We show that

conditional deletion of BVR resulted in increased expression of C5aR and accelerated

chemotaxis towards C5a. Moreover, macrophages lacking BVR expressed an M1

phenotype, which induction was partially dependent C5aR activation. In summary, we

show that BVR and C5aR are crucial for regulating macrophage chemotaxis and

polarisation in response to inflammatory stimuli.

85


4.3.1 Generation of BVRfl/fl

mice

BVRfl/fl

mice were generated (Wegiel et al., recently presented in abstract form)

in the laboratory of Dr. Wegeil and Dr. Otterbein at BIDMC, Harvard Medical School,

Boston. Briefly, a targeting construct was designed based on a PGK Neo FRT/loxp

vector. A targeted sequence of exons IV and V of the mouse BVR gene was inserted

into the SacII site, which is located upstream of the neomycin resistance gene and that

are flanked by two loxp sites. The fragment of 3’ (part of intron IV) arm and 5’ (exon

V) arm of homology were inserted outside the loxp sites between Hpa-I and Sal-I sites,

respectively. The blunt-end cloning was applied for all of the inserts. The construct was

linearised with Not-I and electroporated into embryonic stem (ES) cells (Children’s

Hospital Core Facility, Harvard Medical School, Boston, MA). Six colonies were

determined to be positive (out of 192) for homologous recombination by southern blot

and PCR. Homozygote BVRfl/fl

mice were crossed with Cre-Lyz mice to generate a

myeloid linage with specific knockout of BVR. Deletion of BVR was confirmed by

qPCR and western blot. The primers sequeces for BVR are provided in Table 4.1 and

rabbit anti-BVR antibody was used for western blot.

4.3.2 Stable transfection of RAW 264.7 cells with mir-bvr shRNA

RAW 264.7 cells were stably transfected as described previously [28]. Briefly,

microRNA adapted short hairpin RNA (shRNA) against BVR was generated from a

pSM2 vector (Open Biosystems, USA). shRNA BVR was subcloned to MSCV-

LTRmir30-PIG (LMP) vector (Open Biosystems, USA) with XhoI and EcoRI

restriction enzymes (Life Technologies). Cloning was verified by restriction site

analysis and sequencing. For production of retrovirus, HEK293T cells were transiently

transfected with shRNA BVR-1-LMP, VSVG, and Gag-Pol plasmids by using

Lipofectamine 2000 (Life Technologies, USA). Medium with viruses were collected at

12 h and the supernatants were used for transduction of RAW 264.7 cells. After 14 h

incubation with viruses, RAW cells were selected with 5 g/ml of puromycin (Sigma-

Aldrich) for one week and the knockdown of BVR was tested by Western blot and

qPCR.

86

4.3.3 Isolation of bone marrow-derived macrophages

C57BL/6 (Jackson Laboratories, Bar Harbour, Maine, USA), BVRfl/fl

controls

and CreLyz: BVRfl/fl

(conditional deletion of BVR in myeloid cells) mice were used at 7-

8 weeks of age. All animals were held under specific pathogen free conditions and the

experiments were approved by the BIDMC Animal Care and Use Committee. BMDMs

were isolated as previously described [21]. Briefly, BMDMs were isolated from the

femur by cutting and washing the bones with RPMI medium (Thermo Scientific, Logan,

UT, USA) supplemented with 5% Antibiotic-Antimycotic (Anti-Anti; wash medium;

Life Technologies, Grand Island, NY, USA). Isolated cells were differentiated with

mouse recombinant M-CSF (ProSpec, East Brunswick, NJ, USA) at a final

concentration of 20 ng/mL in RPMI medium supplemented with 15 % FCS and

antibiotic and antifungal solution (Anti-Anti) for five days (M-CSF medium). The

medium was changed to fresh M-CSF medium on the third day of culture. Macrophages

were harvested after five days and were then cultured for 24 h in RPMI medium

supplemented with 10 % fetal calf serum (FCS; Atlanta Biologicals, Flowery Branch,

GA, USA) and 1 x Anti-Anti prior to experimentation. For macrophage polarisation

experiments, cells (1.5 x 105 cells/mL) were treated with LPS (100 ng/mL; E. Coli

Serotype 0127:B8, Sigma Aldrich, St. Louis, MO, USA) and IFN-γ (20 ng/mL;

Peprotech Inc. Rocky Hill, NJ, USA) for M1 polarisation or IL-4 (100 ng/mL;

Peprotech Inc.) for M2 polarisation for 24 or 72 h.

For blocking experiments with anti-mouse CD88 (C5aR); cells were pre-

incubated with LEAFTM

anti-mouse CD88 (1 g/mL; clone 20/70, Biolegend, San

Diego, CA, USA) or anti-mouse IgG (Cell Signalling, Beverly, MA, USA) for 30 min

and followed by treatment with M1 or M2 stimuli.

4.3.4 Source of antibodies

The following antibodies were used for western blot, rabbit anti-BVR (#OSA-

450, Stressgen, Victoria, BC, Canada), mouse anti--actin (Sigma-Aldrich), rabbit anti-

iNOS (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-mouse IgG (Cell

Signalling) or anti-rabbit IgG (Cell Signalling). For flow cytometry, PE anti-mouse

CD88 and PE rat IgG2a (Biolegend) were used. For immunohistochemistry, rat anti-

mouse CD88/C5aR antibody (clone 10/92, LifeSpan Biosciences, Seattle, WA, USA)

87

and biotinylated anti-rat IgG (Vector Laboratories. Burlingame, CA, USA) were

applied.

4.3.5 Animal treatment

BVRfl/fl

controls and CreLyz: BVRfl/fl

mice

were administrated LPS (5 mg/kg,

intraperitoneal) and were monitored for 24 h. Cell surface expression of C5aR and

influx of immune cells into the peritoneum was assessed. Peritoneal cells were isolated

by flushing the mouse peritoneum with 1 mL of PBS after euthanisation. Cells were

stained with anti-mouse CD88-PE or were immediately analysed for granulocyte and

monocyte cell count by FACS Caliber flow cytometer (Becton and Dickinson, San Jose,

CA, USA).

4.3.5 RNA extraction and reverse transcriptase quantitative PCR

Total RNA was isolated from cultured cells using RNeasy®

Plus Mini Kits

(Qiagen, Valencia, CA, USA) and qPCR was performed as previously described [28].

Primers BVR, C5aR and iNOS were purchased from Life Technologies (Table 4.1). -

actin was used a housekeeping gene. Briefly, RNA was reverse transcribed using

iScriptTM

cDNA synthesis kits (BioRad, Hercules, CA, USA) and qPCR was performed

with an Mx3000P QPCR system (Agilent Technologies, Santa Clara CA, USA). The

expression levels of BVR were quantified by using SYBR® Select Master Mix (Life

Technologies). The relative quantification of gene expression was analysed using the ∆

CT method, normalised to housekeeping gene and expressed as 2- ∆∆ CT

.

Gene

target


size (bp)

-actin CCACAGGATTCCATACCCAAGA TAGACTTCGAGCAGGAGATGG 157

BVR ATTCTGCCACCATGGAAA CTCCAAGGACCCAGATTTGA 161

C5aR CATTGCTCCTCACCATTCCA CACCACTTTGAGCGTCTTGG 245

iNOS CAGCTGGGCTGTACAAACCTT CATTGGAAGTGAAGCGGTTCG 95

Table: 4.1 Primer sequences and amplicon sizes of housekeeping (β-actin) and target

genes (C5aR, BVR and iNOS) expressed in mouse BMDM cells.

88

4.3.6 Flow cytometry analysis of CD88

After harvesting and washing BMDM cells with DPBS, cells were stained with

PE labeled anti-mouse CD88 antibody or IgG (1 µg/106 cells) for 30 min at room

temperature. Cells were immediately analysed using a flow cytometer using the FL-2

channel. The percentage of gated cells was derived and analysed using CellQuest

ProTM software (Becton and Dickinson).

4.3.7 Immunohistochemistry

Liver, lung and spleen tissue samples were formalin-fixed followed by paraffin

embedding and immunostaining of 5 m sections as previously described [178]. Mouse

antibody against CD88 (C5aR) was used at the concentration of 5 g/mL. Secondary

antibody (biotin-labeled anti-rat IgG) was used as negative control. Briefly, sections

were processed for antigen retrieval using high pressure cooker in 10 mM citrate buffer

for 1 h. Sections were then incubated for 30 min in a blocking buffer containing 7%

horse serum (Vector Laboratories) in PBS. Primary antibody against CD88 was then

applied to the sections overnight at 4C. Sections were then incubated with biotin-

labeled secondary antibody (1.5 g/mL in PBS) for 1 hour at room temperature,

followed by application a Vectastain Elite ABC kit (1:1 of ratio of reagent A and B) and

detection with ImmPact DAB (Vector Laboratories) as previously described [178].

Images were captured using a Nikon Eclipse E600 microscope and camera (Nikon

Instruments, Melville, NY, USA).

4.3.8 Cell migration assay

Chemotaxis was evaluated in cells maintained in 12-well Transwell plates

(Corning Inc. Corning, NY, USA) using polycarbonate membranes (8 m pore size).

BMDMs from BVRfl/fl

and CreLyz:BVRfl/fl

were suspended in serum free RPMI medium

at 1 x 106 cells/mL. 100 L of the cell suspension was added to the upper chamber and

500 L of serum free RPMI medium containing recombinant mouse C5a (100 nM; R &

D Systems, Minneapolis, MN, USA) was added to the lower wells of the chamber.

Cells were incubated for 24 h. Thereafter, the cells from the upper chamber were

removed and cells on the lower side of the chamber stained with Crystal Violet (Sigma

Aldrich) for 10 min, followed by extensive washing with water. Cells were dried and

those affixed to the bottom of the wells were visualised at 40X magnification. The

stained cells were then dissolved in 10 % acetic acid and absorbance was measured at

89

562 nm on a spectrophotometric plate reader. For blocking experiments with anti-mouse

CD88, cells were pre-incubated with LEAFTM

anti-mouse CD88 or anti-mouse IgG for

30 min, prior treatement with C5a.

4.3.9 Immunoblotting

Cell lysates were prepared in ice-cold RIPA buffer (50 mM Tris-HCl, [pH 7.4],

50 mM sodium fluoride, 150 mM NaCl, 1% Nonident P40, 0.5 M EDTA [pH 8.0]) and

the protease inhibitor cocktail Complete Mini (Roche, Indianapolis, IN, USA). Samples

were centrifuged at 14,000 g at 4 °C for 20 min and supernatants were collected. Protein

concentrations of supernatants were measured using a bicinchoninic acid protein assay

kit (BCA; Thermo Scientific). Forty µg of each protein sample was then

electrophoresed on NuPAGE 4-12% Bis-Tris Gel (Life Technologies) in NuPAGE

MES SDS running buffer (Life Technologies) for 90 min at 100 Volts. Membranes

were blocked with 5% non-fat dry milk in 1 x Tris buffered saline buffer (TBS; Boston

Bio Products, Ashland, MA, USA) for 1 hour and then probed with appropriate primary

antibodies (diluted at 1:1000 in 1 x TBS with 5 % non-fat milk) overnight at 4°C.

Membranes were then washed in 1 x TBS buffer and thereafter incubated with

horseradish peroxidase (HRP)-conjugated secondary antibodies at a dilution of 1:5000

in 1 x TBS with 5 % non-fat milk for 1 h at room temperature. The membranes were

visualised using Super Signal West Pico chemiluminescent substrate (Thermo

Scientific) or Femto Maximum Sensitivity Substrate (Thermo Scientific), followed by

exposure to autobioradiography film (BioExpress, Kaysville, UT, USA).

4.3.10 ELISA analysis

TNF-α cytokine was measured in cell culture medium using Quantikine

Immunoassays (R & D Systems) according to the manufacturer’s protocol.

4.3.11 Statistical analysis

All data are reported as mean ± standard error (S.E; n=3). Statistical analysis was

performed using student t-tests or one-way analysis of variance (ANOVA; Posthoc

Tukey test; Graph pad Prism).

90

4.4 Results

4.4.1 BVR deletion in CreLyZ:BVRfl/fl

mice

Investigating the effects of conditional deletion of specific genes within specific

cell types is crucial to understanding gene function [343]. Cre recombinase under

lysosome (Lyz) promoter control is constitutively expressed in myeloid cells [344].

The BVR gene was deleted by crossing the BVRfl/fl

mice to CreLyz mice to generate

myeloid specific deletion of BVR (recently presented in abstract form by Wegiel et al.).

We showed that basal BVR gene expression as well as protein levels were significantly

decreased in BMDMs from CreLyz:BVRfl/fl

mice as compared to BMDMs from control

mice (Figure 4.1B and C, P < 0.05).

91

Figure 4.1: Deletion of BVR in BMDM from CreLyz:BVRfl/fl

. A) Plan of crossing of

BVRfl/fl

mice to CreLyz mice. The deletion of BVR in BMDMs was confirmed by qPCR

(B) and western blot (C). Results represent mean ± S.E. of three independent

experiments (n=3-5/group). *P < 0.05 CreLyz:BVRfl/fl

vs BVRfl/fl

.

4.4.2 Conditional deletion of BVR in BMDM promotes C5aR expression both

in vitro and in vivo

We first tested whether knocking down of BVR in vitro using stable transfection

would affect C5aR expression. RAW cells tranfected with shRNA-BVR (mir BVR)

[28] showed significantly higher surface and gene expression of C5aR as compared to

control cells (mir C; Figure 4.2C-D, P < 0.05).

92

Figure 4.2: Lack of BVR augments C5aR expression. RAW 264.7 cells were stably

transfected with shRNA against BVR (mir BVR) or shRNA control (mir C). Gene (A)

and protein expression (B) of BVR were analysed using qPCR and western blot,

respectively. Results are expressed as mean ± S.E. of three independent experiments (n

= 3/group (A)) *P < 0.05 vs mir C. Blots are representative of two independent

experiments (B). Gene expression (C) and cell surface expression (D) of C5aR (CD88)

were measured by qPCR and flow cytometry, respectively. The data are representative

of three independent experiments (n = 3/group). *P < 0.05 vs mir C.

93

To confirm our findings in a primary cell line, we next tested whether the deletion

of BVR in primary myeloid cells using Cre recombinase under Lyz promoter control

would increase the expression of C5aR. Bone marrow derived macrophages were

isolated from C57BL/6, BVRfl/fl

and CreLyz:BVRfl/fl

mice. First, we assessed the effects

of M-CSF stimulation on C5aR expression in BMDMs from C57BL/6 mice, which

significantly increased C5aR surface expression over time (Figure 4.3A). BMDMs from

CreLyz:BVRfl/fl

mice showed significant increase on C5aR gene and protein expression

as compared to control BMDMs (Figure 4.3B and C, P < 0.05). To confirm our

observation from in vitro culture, we also evaluated C5aR protein expression in vivo in

various organs. Immunohistochemistry showed that CreLyz:BVRfl/fl

mice had enhanced

expression of C5aR as compared to control mice in liver, lung and spleen; however the

relative intensity of staining reached significance only in the spleen (Figure 4..4A and

B, P < 0.05).

94

Figure 4.3: Increased gene and cell surface expression of C5aR in mice lacking

BVR in myeloid cells. A) C5aR (CD88) cell surface expression in differentiated

95

BMDMs at day 0-5 from C57BL/6 mice was measured by flow cytometry. Gene

expression of C5aR was analysed using qPCR (B) and the surface expression was

assessed by flow cytometry (C) in BMDMs from BVRfl/fl

and CreLyz:BVRfl/fl

. Results are

representative of three independent experiments (n=3/group). *P < 0.05 CreLyz:BVRfl/fl

vs BVRfl/fl

.

96

Figure 4.4: Increased protein expression of C5aR in organs isolated from mice

lacking BVR in myeloid cells. Liver, lung and spleen were harvested from BVRfl/fl

and

CreLyz:BVRfl/fl

mice and CD88 expression was analysed by immunohistochemistry.

Representative images are shown in A. Images were taken at 100X magnification and

quantitative analysis for CD88 positive cells in multiple fields of view is shown in B.

Results represent mean ± S.E. of four mice per group. *P < 0.05 CreLyz:BVRfl/fl

vs

BVRfl/fl

.

97

4.4.3 Deletion of BVR induces migration of BMDMs towards C5a in part via

C5aR

Complement component C5a is a strong chemoattractant and acts on C5aR,

which mediates C5a-induced chemotaxis [345]. Therefore, we next tested the effects of

BVR deletion on BMDM migration towards C5a and the role of C5aR on BVR-

regulated chemotaxis. BMDMs isolated from mice lacking BVR showed significantly

increased migration towards C5a at 24h (Figure 4.5A and B, P < 0.05) as compared to

control cells. To evaluate the role of C5aR in this effect, BMDMs were pre-incubated

with neutralising antibody against C5aR. We confirmed blockage of C5aR by flow

cytometry (Figure 4.5C). Induction of chemotaxis in CreLyz:BVRfl/fl

BMDMs towards

C5a was significantly inhibited by incubation with neutralising antibody against C5aR

(Figure 4.6A and B, P < 0.05), suggesting a functional role of increased expression of

the receptor in CreLyz:BVRfl/fl

BMDMs.

98

Figure 4.5: BMDM from CreLyz:BVRfl/fl

are characterisd by increased chemotaxis

towards C5a. Representative images (A) and absorbance at 562 nM of BMDM

99

supernatant (B) from BVRfl/fl

and CreLyz:BVRfl/fl

mice that migrated through to the lower

chamber of transwell chambers in response to C5a after 24 h of culture in serum free

media. Results are presented as mean ± S.E. of three independent experiments (n =

3/group). *P < 0.05 CreLyz:BVRfl/fl

vs BVRfl/fl

. C) BMDM from BVRfl/fl

and

CreLyz:BVRfl/fl

mice incubated with anti-mouse IgG or C5aR for 30 min and cell

surface expression of C5aR was analysed by flow cytometry. Results are representative

of three independent experiments (n = 3/group). *P < 0.05 CreLyz:BVRfl/fl

vs BVRfl/fl

.

100

Figure 4.6: C5a mediated chemotaxis in CreLyz:BVRfl/fl

BMDMs is mediated by

C5aR. Representative images (A) and absorbance of BMDM supernatant (B) from

BVRfl/fl

and CreLyz:BVRfl/fl

mice that migrated through to the lower chamber of the

transwell chamber in response to C5a after 24 h incubation in the presence or absence of

anti-mouse IgG or anti-mouse C5aR. Data are expressed mean ± S.E. of three

101

independent experiments (n = 3/group). *P < 0.05 CreLyz:BVRfl/fl

vs BVRfl/fl

and #P <



anti-mouse IgG.

4.4.4 Peritoneal cells from CreLyz:BVRfl/fl

show increase expression of C5aR

and influx of monocytes after in vivo LPS administration

We next evaluated the effects of intraperitoneal LPS administration on C5aR

expression and immune cell infiltration in BVRfl/fl

and CreLyz:BVRfl/fl

mice. C5aR

expression was significantly greater in peritoneal cells isolated from CreLyz:BVRf/lfl

compared to BVRfl/fl

mice (Figure 4.7A, P < 0.05). Furthermore, LPS injection resulted

in significant increase in influx of monocytes into the peritoneum of CreLyz:BVRfl/fl

mice compared to BVRfl/fl

mice (Figure 4.7B, P < 0.05).

102

Figure 4.7: Lack of BVR promotes C5aR expression and peritoneal monocyte

infiltration in CreLyz:BVRfl/fl

in response to LPS. Perionteal cells were isolated from

LPS injected BVRfl/fl

and CreLyz:BVRfl/fl

mice. Cell surface expression of C5aR (A) and

influx of granulocytes and monocytes (B) were analysed by flow cytometry. Results are

expressed as mean ± S.E. of three mice in each group. *P < 0.05 CreLyz:BVRfl/fl

vs

BVRfl/fl

.

4.4.5 BMDM from CreLyz:BVRfl/fl

mice show M1 phenotype

Having shown that BMDMs from CreLyz:BVRfl/fl

mice have increased

expression of C5aR and chemotaxis, we next assessed the phenotype of BMDMs

isolated from BVRfl/fl

and CreLyz:BVRfl/fl

mice and whether the phenotype was dictated

by complement signalling. No difference in arginase expression (M2 marker) [341] in

BMDM from BVRfl/fl

and CreLyz:BVRfl/fl

mice existed after incubation with IL-4 (data

not shown). However, stimulation of BMDMs with LPS and IFN-γ lead to an increase

in iNOS gene and protein expression, a marker of M1 macrophages [342]. iNOS was

significantly increased in BMDMs from CreLyz:BVRfl/fl

mice compared to BMDM from

BVRfl/fl

mice (Figure 4.8A, P < 0.05). Furthermore, BMDMs from CreLyz:BVRfl/fl

mice

had significantly increasd protein expression of iNOS in M1 polarized macrophages

(Figure 4.8B). Finally, to confirm the role of C5aR in BVR-mediated modulation of

iNOS expression, we blocked C5aR expression in BMDMs with neutralising antibody

against C5aR. LPS and IFN-γ-induced iNOS expression in BMDM from BVRfl/fl

and

103

CreLyz:BVRfl/fl

was blunted after treatment with neutralising antibody against C5aR

(Figure 4.8C and D).

Figure 4.8: Induction of iNOS expression in M1 polarised BMDMs from

CreLyz:BVRfl/fl

is partially mediated by C5aR. BMDMs were incubated in the

presence or absence of LPS/IFN-γ for 24 and 72 h. Gene expression (A) was assessed at

24 h and protein expression (B) was analysed at 72 h. Data are representative of three

independent experiments (n = 3/group (A)). *P < 0.05 CreLyz:BVRfl/fl

vs BVRfl/fl

. Blots

are representative of at least two independent experiments (B). BMDMs were incubated

with anti-mouse IgG or anti-mouse C5aR prior to LPS/IFN-γ stimulation, and gene

expression (C) and protein expression (D) were assessed after 24 and 72 h, respectively.

Results represent mean ± S.E. of three independent experiments (n = 3/group (C)). *P <

104


vs BVRfl/fl


anti-mouse C5aR vs

CreLyz:BVRfl/fl

anti-mouse IgG. Blots are representative of at least two independent

experiments (D).

Next, we tested the role of BVR deletion on TNF-α expression, which is another

marker of M1 macrophage phenotype [342]. M1 polarisation of BMDMs was induced

with LPS/IFN-γ and cytokine concentration of TNF-α in media was measured.

Treatment with LPS and IFN-γ elevated the levels of TNF-α, which was further induced

in BMDMs from CreLyz:BVRfl/fl

mice as compared to BMDM from BVRfl/fl

mice

(Figure 4.9A, P < 0.05). We next evaluated the effects of neutralising antibody against

C5aR on BVR-modulated TNF-α expression. Addition of anti-mouse C5aR prior M1

polarisation significantly suppressed the LPS/IFN-γ induced TNF-α release in BMDM

from BVRfl/fl

and CreLyz:BVRfl/fl

(Figure 4.9B, P < 0.05).

105

Figure 4.9: Macrophages lacking BVR express increased levels of TNF-α. A)

ELISA was applied to measure TNF-α levels in the supernatant of cultured BMDMs

from BVRfl/fl

and CreLyz:BVRfl/fl

mice incubated with ± LPS/IFN-γ for 24 h. Data are


CreLyz:BVRfl/fl

vs BVRfl/fl

. B) TNF-α levels in supernatant from BMDMs pre-incubated

with anti-mouse IgG or anti-mouse C5aR prior to M1 polarisation for 24 h were

measured by ELISA. Data are representative of three independent experiments (n =

3/group. *P < 0.05 CreLyz:BVRfl/fl

vs BVRfl/fl


anti-mouse

C5aR vs CreLyz:BVRfl/fl

anti-mouse IgG.

106

4.5 Discussion

In the present study, we describe a novel finding showing that BVR maybe

important in mediating macrophage chemotaxis towards C5a and this occurs partially

via a C5aR-dependent manner. Conditional deletion of BVR increased expression of

C5aR in primary macrophages, which led to increased chemotaxis towards C5a. We

also demonstrate that lack of BVR promotes macrophage polarisation towards the M1

phenotype by amplifying the expression of LPS-induced iNOS and TNF-α, which was

regulated in part via C5aR. We suggest that the remarkable effects of BVR on

complement activation and macrophage polarisation are crucial in regulation of innate

immune responses, as demonstrated by increased peritoneal leukocyte influx after LPS

administration in mice lacking BVR.

BVR is a leucine zipper protein [268] and interacts with activator protein (AP)-1

sites in the promoter regions of haem oxygenase (HO)-1 and activated transcription

factor-2 (ATF-2) [269]. We have previously shown that BV inhibits TLR-4 expression

in part via BVR binding to AP-1 sites [28]. BVR is a modulator of cell signalling

pathways and is described as a theronine/serine/tyrosine kinase in the mitogen activated

kinase/insulin/insulin growth factor-1 signalling cascade [20]. Furthermore, silencing of

surface BVR with RNA interference abrogated BV-induced Akt (protein kinase B)

phosphorylation and IL-10 expression [21], suggesting that BVR also interacts with

Akt. Moreover, BVR is S-nitrosylated in response to BV and LPS through endothelial

nitric oxide synthase (eNOS) derived nitric oxide (NO), leading nuclear translocation of

BVR and binding to TLR-4 promoter and repression of TLR-4 expression [28].

Although, these studies support the cell signalling and immuno-modulatory capabilities

of BVR in in vitro models, the role of BVR in modulating inflammation in in vivo

models has not been well described. Recently, we discovered that conditional deletion

of BVR in murine myeloid cells increases resistance to acetaminophen (300mg/kg, i.p.)

injury and results in reduced inflammatory responses to TLR-9 ligands (CpG rich

region) both in vitro and in vivo (Wegiel et al., recently presented in abstract form).

However, the effects of BVR deletion on complement receptor and macrophage

phenotype were not tested. We hypothesised that lack of BVR promotes the

development of a pro-inflammatory macrophage phenotype, which drives acute

inflammation via increased in macrophage chemotaxis and induction of C5aR.

107

Increased expression of C5a and its receptor C5aR are strongly associated with

acute and chronic inflammation and inflammatory disorders [29,311]. The anti-

inflammatory effects of BV in models of sepsis [179,218], transplantation and IRI

[212,219] have previously been published. Moreover, BV induces inhibitory effects on

C5aR in vitro via mTOR signalling [338]; however, the role of BVR on C5aR

signalling remains unknown. C5aR is a G-protein coupled receptor and is expressed in

both myeloid and non-myeloid cells and increased expression of C5aR has been

observed in the inflamed tissues [29,30,116].

We first investigated the effect of BVR deletion on C5aR expression in

macrophages. Silencing of BVR with shRNA resulted in increased basal expression of

C5aR in RAW macrophages. Furthermore, BMDMs from CreLyz:BVRfl/fl

mice

(conditional deletion of BVR in myeloid cells) also showed enhanced gene and protein

expression of C5aR. Our in vitro findings are supported by in vivo studies, in which,

we reported higher C5aR expression in spleens isolated from CreLyz:BVRfl/fl

mice.

Increased expression of C5aR promotes recruitment of neutrophils and macrophages at

sites of infection, trauma and inflammation [346]. Studies by Soruri et al. showed that

blockage of C5aR by neutralising antibody against C5aR (clone 20/70) completely

inhibited the migration of rat basophilic leukemia RBL-2H3 cells towards C5a [345].

We discovered that BVR is an important molecule for regulating macrophage

chemotaxis towards C5a and deletion of BVR in macrophages promotes chemotaxis

towards C5a. We reported that the increased cell migration of BMDMs towards C5a in

CreLyz:BVRfl/fl

mice was suppressed after treatment with C5aR neutralising antibody,

implicating a role of C5aR on BVR-mediated modulation of chemtoaxis. However, we

only chose 24 hour time point to investigate the effect of C5a on chemotaxis and future

studies are required to investigate the effect of C5a on cell migration at different time-

points. Nevertheless, our in vitro findings are translated in vivo, where we observed that

peritoneal cells from LPS treated CreLyz:BVRfl/fl

mice expressed more C5aR compared

to BVRfl/fl

mice and are characterised by increased influx of monocytes after LPS

treatment, suggesting a potential role of BVR as a regulator of monocyte infiltration

towards endotoxin.

BVR is well described for modulating BV-mediated inflammatory responses,

including production of IL-10 in response to endotoxin [21] and NO generation [28] by

108

macrophages. However, the effects of BVR on macrophage polarisation have not been

elucidated. We reported that incubation of macrophages with LPS and IFN-γ stimulate

macrophage polarisation towards the M1 phenotype, which was characterised by

increased expression of iNOS and TNF-α in macrophages. Interestingly, macrophages

from CreLyz:BVRfl/fl

mice express higher levels of iNOS and TNF-α compared to

BVRfl/fl

mice after LPS/IFN-γ activation. Together, these data suggest that BVR is a

crucial molecule that modulates macrophage polarisation in response to inflammatory

stimuli.

Further, we investigated the effects of C5aR blocking on BVR-modulated iNOS

expression and TNF- α release. We reported significant reduction in LPS and IFN-

induced expression iNOS and TNF-α release after neutralising antibody against C5aR in

BMDMs from CreLyz:BVRfl/fl

and BVRfl/fl

mice. Although, it has been shown that C5aR

regulates the LPS-induced production of pro-inflammatory cytokines: IL-6 and IL-12

[308] the effects of C5aR on M1 markers were not previously described. Both TNF-α

and iNOS are key players in inflammation and upregulated expression of iNOS and

TNF-α have been observed in number of diseases, including sepsis [94] and

atherosclerosis [78,126]. C5aR also plays a key role in disrupting blood brain barrier

integrity via regulating mRNA expression of iNOS on brain endothelial cells [347]. Our

data suggest that C5aR is a crucial molecule in regulating BVR-modulated iNOS and

TNF expression on macrophages.

In summary, we show that BVR crosstalks with C5a complement signalling.

Deletion of BVR in myeloid cells induces complement activation by increasing C5aR

expression and leading to elevated chemotaxis towards C5a. BVR has known cell

signalling [33] and cytoprotective effects [263,266] and deletion of BVR promotes

inflammation [21]. The data in the present study further support for the role of BVR in

modulation of innate immune responses, by a previously unknown mechanism. We also

demonstrate that macrophages lacking BVR display an M1 phenotype with increased

expression of iNOS and TNF-. Moreover, increased expression of C5aR, macrophage

chemotaxis and polarisation towards M1 state were partially mediated by C5aR.

Collectively, we identified BVR as a target for regulating complement activation

and demonstrate that BVR modulates macrophage polarisation. We suggest that BVR-

109

mediated modulation of macrophage responses towards C5a, LPS and IFN-γ is

regulated in part by C5aR.

110

This chapter has been published by Journal of Clinical and Cellular Immunology as an

original investigation. The abbreviations, formatting and referencing of this document

have been changed slightly to more closely reflect the formatting of other chapters in

this thesis.

Bisht K., Tampe J., Shing C., Bakrania B., Winearls J., Fraser J., Wagner K-H., Bulmer

A. C. Endogenous tetrapyrroles influence leukocyte responses to lipopolysaccharide in

human blood: pre-clinical evidence demonstrating the anti-inflammatory potential of

biliverdin. Journal of Clinical and Cellular Immunology. 5: 1000218 (2014).

Chapter 5 Endogenous tetrapyrroles influence leukocyte responses to

lipopolysaccharide in human blood: pre-clinical evidence demonstrating the

anti-inflammatory potential of biliverdin

111

5.1 Abstract

Sepsis is associated with abnormal host immune function in response to pathogen

exposure, including endotoxin (lipopolysaccharide; LPS). Cytokines play crucial roles

in the induction and resolution of inflammation in sepsis. Therefore, the primary aim of

this study was to investigate the effects of endogenous tetrapyrroles, including

biliverdin (BV) and unconjugated bilirubin (UCB) on LPS-induced cytokines in human

blood. Biliverdin and UCB are by products of haem catabolism and have strong

cytoprotective, antioxidant and anti-inflammatory effects. In the present study, whole

human blood supplemented with BV and without was incubated in the presence or

absence of LPS for 4 and 8 h. Thereafter, whole blood was analysed for gene and

protein expression of cytokines, including IL-1β, IL-6, TNF-, IFN-γ, IL-1Ra and IL-8.

Biliverdin (50 M) significantly decreased the LPS-mediated gene expression of IL-1β,

IL-6, IFN-γ, IL-1Ra and IL-8 (P < 0.05). Furthermore, BV significantly decreased LPS-

induced secretion of IL-1 and IL-8 (P < 0.05). Serum samples from human subjects

and, wild type and hyperbilirubinaemic Gunn rats were also used to assess the

relationship between circulating bilirubin and cytokine expression/production.

Significant positive correlations between baseline UCB concentrations in human blood

and LPS-mediated gene expression of IL-1 (R = 0.929), IFN- (R = 0.809), IL-1Ra (R

= 0.786) and IL-8 (R = 0.857) were observed in blood samples (all P < 0.05). These

data were supported by increased baseline IL-1 concentrations in hyperbilirubinaemic

Gunn rats (P < 0.05). Blood samples were also investigated for complement receptor-5

(C5aR) expression. Stimulation of blood with LPS decreased gene expression of C5aR

(P < 0.05). Treatment of blood with BV alone and in the presence of LPS tended to

decrease C5aR expression (P = 0.08). These data indicate that supplemented BV

inhibits the ex vivo response of human blood to LPS. Surprisingly, however, baseline

UCB was associated with heighted inflammatory response to LPS. This is the first study

to explore the effects of BV in a pre-clinical human model of inflammation and

suggests that BV could represent an anti-inflammatory target for the prevention of LPS

mediated inflammation in vivo.

Key words: Cytokine, inflammation, tetrapyrroles, lipopolysaccharide.

112

5.2 Introduction

Sepsis, caused by systemic microbial infection, is a potentially life-threatening

condition and characterised by uncontrolled inflammation [297]. The pathogenesis of

sepsis involves several factors that interact in a chain of events from pathogen

recognition to an overwhelming host response [42]. Among the molecules involved, toll

like receptor (TLR) and complement receptor 5a (C5aR) are major contributors leading

to septic shock, coagulation abnormalities, tissue hypoperfusion and organ failure

[118,304]. Activation of TLRs and C5aR promote the production of pro- and anti-

inflammatory cytokines by immune cells, contributing to the ‘cytokine storm’ of acute

inflammation [297,303]. Several studies implicate the involvement of both pro- and

anti-inflammatory cytokines in initiation and aggravation of infectious and

inflammatory disorders, including sepsis, arthritis, and atherosclerosis [124,348]. Septic

patients and animals often experience increased circulating concentrations of tumour

necrosis factor (TNF)-, interleukin (IL)-1β, IL-6 and interferon (IFN)-, resulting in

exacerbated inflammation and, ultimately, organ dysfunction [124,349].

Discovery of new treatments for sepsis and the application of such treatments to

patients presenting with sepsis poses significant challenges to both researchers and

clinicians. Despite many years of exhaustive research and clinical trials the

pathophysiology of sepsis remains incompletely understood and specific anti-

inflammatory and immuno-modulatory therapies have not been translated into improved

patient outcomes [350]. A number of therapies (activated protein C (aPC), steroids and

cytokine blockade) have been investigated in both preclinical and clinical trials to target

the host response factors thought to play a significant role in the inflammatory response

to sepsis. None of these therapeutic approaches have translated into improved patient

outcomes despite promising early results [350]. Activated protein C has antithrombotic,

anticoagulant, anti-inflammatory and antifibrinolytic effects. Initial data suggested a

significant mortality benefit associated with the use of aPC in severe sepsis and septic

shock [351]. However, in a recent Cochrane Review the use of aPC found no evidence

to support the use of aPC in severe sepsis and in fact showed a trend to significant

haemorrhagic complications [351]. A number of trials investigating therapeutic targets

against TNF- and IL-1 showed promise in experimental models of sepsis, but again

these effects were not translated into beneficial outcomes for patients in clinical trials

[352,353,354]. The use of systemic steroids in severe sepsis and septic shock remains

controversial despite almost 50 years of research into the area. Again there is strong

113

biological rationale to support the use of steroids in severe sepsis but this has yet to be

translated into improved patient outcomes [355]. Therefore, the discovery of new and

effective anti-inflammatory therapeutics to reduce morbidity and mortality due to sepsis

and septic shock are necessary.

Endogenous tetrapyrroles, including biliverdin (BV) and unconjugated bilirubin

(UCB) are haem catabolites and are formed by the sequential action of haem oxygenase

and biliverdin reductase (BVR) forming BV and UCB, respectively, within cells of the

reticulo-endothelial system [198,356]. Unconjugated bilirubin is water insoluble and

must be conjugated by uridine diphosphate glucuronosyltransferase (UGT1A1) in

hepatocytes forming bilirubin mono and diglucuronides, which are then excreted into

the bile [194,356]. Several in vivo and in vitro studies report strong cytoprotective

effects of these compounds in various animal models of ischaemia-reperfusion injury

(IRI), transplantation, sepsis and endotoxic shock [21,26,27,228]. It is suggested that

these compounds induce cytoprotection via attenuation of inflammation and free radical

induced macromolecule oxidation [192,197].

Biliverdin inhibits the expression of TLR-4 and C5aR in vitro [28,338]. Our

groups and others have also shown that BV and UCB modulate the expression and

production of TNF-α, IL-6 and IL-1 in cell culture and animal models

[208,217,236,338]. However, whether anti-inflammatory effects of BV/UCB exist in

human models, remains unknown. Therefore, the primary aim of this study was to

investigate the effects of supplemented BV and baseline UCB on cytokine expression

and release after lipopolysaccharide (LPS) activation of whole human blood. Similar ex

vivo models have been applied to investigate the efficacy of lead anti-inflammatory

compounds with this system providing some advantages over in vitro assays, including

culture of isolated peripheral blood mononuclear cells (PBMCs) [349,357]. To reveal

whether UCB accumulation influences baseline cytokine production, we also obtained

baseline serum samples from Gunn rats (an animal model of hyperbilirubinaemia due to

autosomal recessive deficiency of UGT1A1) and control rats. We hypothesised that

BV/UCB would demonstrate anti-inflammatory effects by mitigating LPS-mediated

cytokine expression and release into whole blood.

114


5.3.1 Human blood sample collection and ex vivo incubation with LPS and BV

To assess the effects of BV on ex vivo cytokine expression, fasting blood was

collected from healthy male volunteers (25-52 years). Exclusion criteria for the subjects

included current smoking, recent (within two weeks) bacterial infection and/or

consumption of antioxidant supplements, consumption of >8 standard alcoholic

drinks/week, elevated glucose or serum liver enzyme activities or presence of

hyperlipidaemia. We also excluded subjects who showed less than a 10-fold increase in

IL-1β expression in response to LPS to ensure the homogeneity of responder phenotype

in participating subjects. The study was approved by the Human Ethics Research

Committee of Griffith University (MSC/02/10/HREC).

Whole blood was drawn from each subject into ethylenediaminetetra-acetic acid

(EDTA) (Becton and Dickinson, Australia; total 50 mL). Two millilitres of EDTA

blood was centrifuged at 1500 g for 15 min at 4 °C using a benchtop centrifuge

(Beckman Coulter, Australia) to obtain plasma for the measurement of UCB

concentration. The remaining EDTA blood samples were kept in the dark and were

prepared for ex vivo incubation with LPS and BV/control within one hour.

Two millilitres of EDTA blood was supplemented with BV (10 and 50 µM;

Frontier Scientific, Logan UTA, USA) dissolved in DMSO (solvent control), in the

presence or absence (control) of LPS (3 µg/mL) from Escherichia coli (K235, Sigma-

Aldrich, Australia). Lipopolysacchraide was chosen as a stimulant because it is a

specific TLR-4 ligand and stimulates cytokine release from immune cells [358]. Blood

samples were then incubated in closed eppendorff tubes, in a water bath at 37 °C for 4

and 8 h, with hourly mixing. Samples were continuously protected from light using

aluminium foil. Samples were collected for RNA extraction at 4 h from EDTA blood

samples, which is an appropriate time point for cytokine expression analysis within

whole blood [359]. Gene/mRNA expression was assessed using quantitative real-time

quantitative polymerase chain reaction (qRT-PCR) using cytokine primers as reported

in Table 1. Thereafter, blood was centrifuged at 4 and 8 h as previously described.

Plasma samples were then stored at -80 °C until the analysis of cytokine concentrations.

115

5.3.2 Animal experiments

Breeding pairs of heterozygote Gunn rats were imported from the Rat Research

and Resource Centre (Columbia, MO, USA) and non-jaundiced Wistar rats were used

as wild type controls. Animals were housed at Griffith University Animal Facility (12 h

light:dark cycle, constant temperature (22 °C) and humidity (60%)). All the animals had

continuous access to standard laboratory food pellets (Speciality Feeds, Glen Forest,

Australia) and fresh water. Male homozygous Gunn rats (jaundiced) were sourced from

an internal colony by breeding male homozygote Gunn rats with heterozygote females

(non-jaundiced) after weaning. Concentrations of UCB were measured in blood

collected from the tail tip of pups at the age of 21 days to confirm the presence of

jaundice. The pups were kept under brief isofluorane anaesthesia (3 % in O2; 1-2 L/min)

until blood collection was complete. Serum UCB was analysed using HPLC (see

below). For the present study, male rats were used (10 wild type controls and 17 Gunn

rats). Animals at 12 months of age were anaesthetised using an intraperitoneal injection

of thiobutabarbital sodium (concentration 60 mg/mL; 1 mL/kg). A mid-line laparotomy

was performed and ~ 5 mL of blood was collected from thoracic cavity as previously

described [233]. Serum samples were stored at -80 °C. All the animal experiments were

conducted after approval by Griffith University Animal Ethics Research Committee

(MSC/06/12).

5.3.3 RNA extraction and qRT-PCR

Total RNA was isolated from whole blood using QIAamp®

RNA Blood Mini Kit

(Qiagen, Australia) and qRT-PCR was performed as previously described [338].

Primers for human HPRT-1, IL-6, IL-1, TNF-α, IFN-γ, IL-1Ra IL-10, IL-8 and C5aR

were designed using Primer Quest Software (Table 1; Integrated DNA technologies,

Australia). Quantitative real time PCR was performed with Applied Biosystems

SteponeTM

and Stepone PlusTM

Real-Time PCR Systems (AB Applied Biosystem, USA)

using EvaGreen master mix (Integrated Biosciences, Australia). The relative

quantification of gene expression was analysed using 2- ∆∆ C

T method [360], normalised

to the housekeeping gene (HPRT) and expressed as fold expression.

116

Table 5.1: Primer sequences and amplicon sizes of housekeeping (HPRT) and target genes (IL-1β, IL-6, TNF-,

IFN-γ, IL-1Ra IL-10, and C5aR) expressed in humans.

Gene

target


size (bp)

HPRT TGGAGTCCTATTGACATCGCCAGT AGTGCCTCTTTGCTGCTTTCACAC 197

IL-1β AACAGGCTGCTCTGGGATTCTCTT ATTTCACTGGCGAGCTCAGGTACT 92

IL-6 AAATTCGGTACATCCTCGACGGCA AGTGCCTCTTTGCTGCTTTCACAC 88

TNF- TGGGCAGGTCTACTTTGGGATCAT TTTGAGCCAGAAGAGGTTGAGGGT 128

IFN-γ ACTAGGCAGCCAACCTAAGCAAGA CATCAGGGTCACCTGACACATTCA 184

IL-1Ra AATCCATGGAGGGAAGATGTGCCT TGTCCTGCTTTCTGTTCTCGCTCA 110

IL-10 TCCTTGCTGGAGGACTTTAAGGGT TGTCTGGGTCTTGGTTCTCAGCTT 109

IL-8 CTTGGCAGCCTTCCTGATTT GGGTGGAAAGGTTTGGAGTATG 111

C5aR AGACATCCTGGCCTTGGTCATCTT TACCGCCAAGTTGAGGAACCAGAT 133

117

5.3.4 Cytokine analysis

Cytokines in plasma samples were analysed using a Milliplex Human

Cytokine Magnetic Panel kit for IL-6, IL-1, TNF-α, IFN-, IL-10 and IL-1Ra and Rat

Cytokine Magnetic Panel kit for IL-6, IL-1 and TNF-α (Abacus, Australia) according

to manufacturer’s instructions. The plasma concentration of each cytokine was detected

and quantified using a Bio-plex Multiplex system (BioRad, USA). Human IL-8

concentration was measured using a high sensitivity ELISA kit (R & D Systems,

Australia).

5.3.5 Cell count, haem and bilirubin analysis

Total blood cell counts were performed in fresh human EDTA blood samples

using a Beckman Coulter Counter (Beckman Coulter Inc. USA). Plasma UCB and haem

concentrations were quantified using HPLC and a photodiode array detector (Waters,

Australia) as previously described [198]. A C18 reverse-phase HPLC guard and

analytical column (4.6 x 150 mm, 3 µM; Phenomenex, Australia) was perfused at 0.7

mL/min using methanolic 0.1 M di-n-octylamine acetate (methanol:H2O 95:5 v/v)

mobile phase. The extracted samples were injected with a run time of 18 min and were

analysed in duplicate. Haem (max 400 nm) and UCB (max 450 nm) eluted at 8 and

13 mins, respectively. Haemin and UCB (Frontier Scientific, Logan UTA, USA) at a

concentration of 0-100 µM were used for external standards.

5.3.6 Statistical analysis

To detect any effect that varying BV concentrations (0, 10 and 50 µM) had on

LPS induced cytokine gene and protein expression, one way of analysis of variance

(ANOVA; post-hoc Tukey; Sigmastat, Ver. 11.0) was used. A repeated measures

ANOVA (post-hoc Bonferronni t-test) was used to determine the effects of incubation

time and BV treatment on haem and UCB concentrations. The relationship between

baseline UCB and cytokine expression was analysed using Pearson correlation

coefficient, or Spearman’s rank correlation coefficient in data sets lacking normal

distribution. Furthermore, un-paired t-tests were performed to detect differences in UCB

concentration, body weight and IL-1 concentration between Gunn and wild type

animals. When data was non-normally distributed, a Mann Whitney U-test was used. A

P-value of < 0.05 was considered significant. Data is expressed as either mean ± S.E. or

median (25-75% interquartile range), as appropriate.

118

5.4 Results

5.4.1 Clinical parameters, haem and UCB concentration

Healthy male subjects were recruited (37.1 ± 8.5 years old) for this study. All

total blood cell counts were within the normal range (Table 5.2). Haem and UCB

concentrations at both baseline and after 4 and 8 h of incubation were assessed in all

conditions. All samples underwent minor haemolysis after 4 and 8 h of incubation

(Table 3). The average UCB concentration of the subjects was 5.23 ± 1.41 mol/L at

baseline and significantly increased after 4 and 8 h of incubation with 50 µM BV only

(Table 3, P < 0.05). Furthermore, control samples showed a non-significant increase in

baseline UCB concentration after 4 and 8 h of incubation (Table 5.3).

Variable Result

Age (years) 37.1 ± 8.5

BMI (kg/m2) 24.7 ± 3.42

HGB (g/L) 148 ± 6.51

RBC (1012

/L) 5.14 ± 0.18

WBC (109/L) 6.01 ± 1.27

NE (109/L) 2.51 ± 0.78

LYM (109/L) 2.28 ± 0.51

MO (109/L) 0.86 ± 0.28

EO (109/L) 0.30 ± 0.11

BA (109/L) 0.05 ± 0.03

Table 5.2: Clinical characteristics of recruited subjects at baseline (n=7)

Note: BMI (bone marrow index), WBC (white blood cell), RBC (red blood cell), HGB

(total haemoglobin), NE (neutrophil), LYM (lymphocyte), MO (monocytes), EO

(eosinophil), BA (basophil).

119

Haem (baseline;

µM)

Treatment Haem (µM)

4 h 8 h

4.80 ± 0.63

Control 14.65 ± 0.90* 30.18 ± 3.89*#

BV (10 µM) 16.88 ± 1.59*

27.01 ± 1.94*#

BV (50 µM) 15.41 ± 1.38* 32.24 ± 3.43 *#

LPS 16.69 ± 1.82* 36.25 ± 2.93*#

LPS+BV (10 µM) 17.30 ± 2.77* 28.00 ± 3.34*

LPS+BV (50 µM) 16.14 ± 1.62* 33.86 ± 4.84*#

UCB (baseline; µM)

Treatment

UCB (µM)

4 h 8 h

5.23 ± 1.41

Control 11.32 ± 2.03 9.69± 2.32

BV (10 µM) 11.68 ± 1.98 12.85 ± 2.70*

BV (50 µM) 14.40 ± 2.93*

2.93*

15.56 ± 3.02*

LPS 10.14 ± 3.36 9.50 ± 1.73

LPS+BV (10 µM) 12.42 ± 4.11* 13.31 ± 4.30*

LPS+BV (50 µM) 12.56 ± 2.35* 13.72 ± 2.90*

Table 5.3: Unconjugated bilirubin (UCB) and haem concentrations in subjects after 0

(baseline), 4 and 8 h incubation with BV ± LPS (N=7/group).

Note: The effect of BV and haemolysis on haem and UCB concentration was performed

by repeated measures ANOVA. *P < 0.05 vs. baseline UCB or haem concentrations and

#P <0.05 vs. haem concentrations at 4 h.

5.4.2 Biliverdin and cytokine expression

The mRNA expression of pro- and anti-inflammatory cytokines from blood

samples incubated with BV ± LPS were assessed. Individual subjects’ response to LPS-

mediated cytokine expression can be found in Figures 5.1. Biliverdin treatment alone

had no effect on cytokine mRNA abundance (Figure 5.2). However, a dose dependent

decrease in the mRNA expression of IL-1, IL-6, IFN- and IL-1Ra occurred when

blood was stimulated with LPS and BV. Fifty micromolar BV was required to

significantly reduce the expression of these cytokines (Figure 5.3A, B, D and E, P <

0.05). Biliverdin had no effect on the expression of TNF- in the presence of LPS

(Figure 5.3C).

121

Figure 5.1: Cytokine expression in each individual in response to LPS. The whole

blood of each subject was incubated with LPS (3 g/mL) for 4 h. The fold change of

each cytokine (A-F) was analysed using 2- ∆∆ C

T method. Data are presented as mean ±

S.E.

123

Figure 5.2: Cytokine gene expression in response to BV. The whole blood was

incubated with BV at different concentrations for 4 h and the mRNA expression was

assessed. The fold change of each cytokine (A-F) was analysed using 2- ∆∆ C

T method.

Data are presented as mean ± S.E. n=7, P < 0.05 vs sample treated with control only (0

µM BV).

125

Figure 5.3: Cytokine gene expression in response to LPS and BV. The whole blood

was incubated with BV and LPS for 4 h and the mRNA expression was assessed. The

relative fold change of each cytokine (A-F) was analysed using 2- ∆∆ C

T method. Data are

presented as mean ± S.E. n=7, P < 0.05 vs sample treated with LPS only (0 µM).

126

Plasma cytokine concentrations were measured 8 h after LPS incubation in accordance

with previous studies, which show a robust increase in IL-1β at this time point

[348,361]. Similar to the gene response, subjects showed variation in their response to

cytokine protein expression after LPS exposure (Figure 5.4). Therefore, inhibition of

cytokine release by BV is presented relative to each individual’s LPS response (Figure

5.6). Biliverdin alone did not affect cytokine release into plasma (Figure 5.5). However,

BV dose dependently and significantly decreased IL-1 plasma concentration in the

presence of LPS (Figure 5.6A, P < 0.05). Biliverdin did not significantly affect LPS-

induced IL-6, TNF-, IFN-, IL-1Ra and IL-10 cytokine release into plasma (Figure

5.6B-F).

128

Figure 5.4: Cytokine protein concentration in each individual in response to LPS.

The whole blood of each subject was incubated with LPS (3 g/mL) for 8 h.

Concentration of each cytokine (A-F) was analysed using Milliplex human cytokine kit.

Data are presented as mean ± S.E (0 µM).

130

Figure 5.5: Cytokine protein concentration in response to BV. The whole blood was

incubated with BV at different concentrations for 8 h. Concentration of each cytokine

(A-F) was analysed using Milliplex human cytokine kit. Data are presented as mean ±

S.E. n=7, P < 0.05 vs sample treated with control only (0 µM BV).

132

Figure 5.6: Cytokine concentration in response to LPS and BV. The whole blood

was incubated with BV and LPS for 8 h and cytokine concentration was measured using

a Milliplex human cytokine kit. The relative change in each cytokine (A-F)

concentration is presented. Data are presented as mean ± S.E. n=7, P < 0.05 vs sample

treated with LPS only (0 µM).

133

5.4.3 Association between baseline UCB concentration and cytokine expression

We have previously shown that increasing concentrations of UCB in vivo are associated

with increased circulating IL-1β concentrations [25]. Therefore, we sought to investigate

whether baseline UCB concentration in our cohort study impacted upon the gene and protein

expression of cytokines in response to LPS (i.e. in solvent control samples not treated with BV).

A significant positive correlation between UCB and LPS-mediated IL-1β (R = 0.929; P <

0.001), IFN-γ (R = 0.809; P = 0.027) and IL-1Ra (R = 0.786; P = 0.025) gene expression

(Figure 5.7A, D and E) existed. However, no significant correlation between baseline UCB

concentration and gene expression of IL-6 and IL-10 after LPS exposure occurred (Figure 5.7B

and F). Furthermore, there were no significant correlations between baseline UCB

concentrations and LPS-mediated cytokine (IL-1β, IL-6, IFN-γ, IL-1Ra and IL-10) release into

plasma (Figure 5.8). Interestingly, increasing concentration of UCB tended to be associated

with increases gene and protein expression of TNF- (Figure 5.7C and Figure 5.8C, P < 0.1)

135

Figure 5.7: UCB concentration and cytokine gene expression in response to LPS.

Whole blood was incubated with BV and LPS for 4 h and mRNA expression was

assessed. Figure shows the scatter plots and the correlation between baseline UCB

concentration and cytokine gene expression (A-F), n = 7.

137

Figure 5.8: UCB concentration and cytokine concentration in response to LPS.

Whole blood was incubated with BV and LPS for 8 h and plasma cytokine

concentration was measured using a Milliplex human cytokine kit. Figure shows scatter

plots and the correlation between baseline UCB concentration and plasma cytokine

concentrations (A-F), n=7.

138

To confirm a possible effect of physiologically, severely elevated UCB (beyond that

seen in our human subjects) on physiological IL-1β concentrations in blood; serum

samples were collected from wild type and hyperbilirubinaemic Gunn rats. Gunn rats

had significantly reduced body mass compared to control animals (Figure 5.9A, P <

0.001) and had significantly increased UCB concentrations compared to their wild type

counterparts (Figure 5.9B, P < 0.05), as reported previously [233]. Gunn rats also had a

significantly elevated plasma IL-1 concentration compared to wild type controls

(Figure 5.9C, P < 0.001). Furthermore, a significant and positive relationship existed

between UCB and IL-1 concentrations (Figure 5.9D, R = 0.488 and P = 0.01).

139

Figure 5.9: IL-1β concentration in blood samples of wild type control and Gunn

rats. A. Graph showing the body weight of Wistar (n=10) and Gunn rats (n=17). Data

are presented as mean ± S.E; P <0.05 vs control (non-jaundiced Wister rats). Box plot

showing the serum UCB concentration (B) and IL-1β concentration in Wistar and Gunn

rats (C). Data are presented as median (25-75% interquartile range); n=10 for Wister

and n =17 for Gunn rats and P <0.05 vs control (non-jaundiced Wister rats). D. Scatter

plot and the correlation between baseline UCB concentration and IL-1β concentration;

n=10 for Wister and n =17 for Gunn rats.

140

5.4.4 Unconjugated bilirubin, biliverdin and chemokine IL-8 expression

Interleukin-8, the most abundant chemokine secreted by neutrophils, promotes

the migration of neutrophils towards the site of inflammation, encouraging the acute

phase of tissue damage/pathogen destruction [362,363]. Blood samples incubated with

BV ± LPS were analysed for IL-8 gene and protein expression. Biliverdin alone

significantly decreased IL-8 gene expression (Figure 5.10A). When BV was co-

incubated with LPS, IL-8 gene and protein expression also were decreased in a dose

dependent manner, with 50 µM BV being most effective (Figure 5.11A-B; P < 0.05).

We also analysed whether baseline UCB concentration affected IL-8 expression

in leukocytes after LPS activation. A positive correlation existed between UCB and IL-

8 gene expression (R = 0.857, P = 0.006; Figure 5.11C); however, no significant

relationship existed between UCB and IL-8 release (Figure 5.11D).

141

Figure 5.10: IL-8 gene and protein expression in response to BV. IL-8 gene (A) and

protein (B) expression was analysed using 2- ∆∆ C

T method and ELISA kit, respectively.

Data are presented as mean ± S.E. n=7, P < 0.05 vs sample treated with control only (0

µM BV).

142

Figure 5.11: IL-8 concentration in response to LPS and BV. IL-8 gene and protein

concentration was analysed using qPCR and high sensitivity ELISA kit, respectively in

blood samples incubated with BV and LPS for 4 or 8 h. IL-8 gene (A) and protein (B)

expression in response to BV + LPS. Data are presented as mean ± S.E. n=7 and P <

0.05 vs sample treated with LPS only (0 µM). Scatter plot showing the correlation

between baseline UCB concentration and IL-8 gene (C) and protein expression (D) in

response to LPS, n=7.

143

5.4.5 Biliverdin and C5aR expression

We have recently shown that stimulation using LPS induces C5aR expression in

RAW 264.7 and bone marrow derived macrophages after 24 and 48 h incubation [338].

Biliverdin at 50 µM significantly reduced the LPS-mediated increase in C5aR in both

primary and immortalised macrophages [338]. Therefore, we investigated whether

incubation of whole blood with LPS would induce C5aR and whether BV would

mitigate this increase. Stimulation of whole blood with LPS significantly decreased

C5aR gene expression (P < 0.05; Figure 5.12A). However, BV + LPS failed to show

any additional significant reduction in C5aR expression (Figure 5.12A). The effect of

BV treatment alone on C5aR expression was also assessed. Biliverdin treatment tended

to decrease C5aR expression (ANOVA effect; P = 0.08; Figure 5.12B).

144

Figure 5.12: C5aR gene expression in response to BV±LPS. Gene expression of

C5aR was analysed using 2- ∆∆ C

T method (A and B). Data are presented as median (25-

75% interquartile range). n=7, *P < 0.05 vs control (C).

145

5.5 Discussion

The present study shows novel immuno-modulatory effects of supplemented BV

and physiological UCB concentrations on both pro- and anti-inflammatory cytokine

gene and protein expression in human blood, in response to whole blood LPS exposure.

Biliverdin, the precursor of UCB, mitigated ex vivo LPS-induced expression of IL-1β,

IL-6, IFN-γ and IL-1Ra at the transcriptional level. Biliverdin also attenuated LPS-

mediated IL-1 and IL-8 release into plasma. Increasing baseline concentrations of

UCB in human samples were associated with increased IL-1β, IFN-γ, IL-1Ra and IL-8

gene expression. Furthermore, increased baseline IL-1β concentrations in severely

hyperbilirubinaemic rat blood samples were positively correlated with bilirubin

concentrations.

Biliverdin and cytokine response: A significant body of evidence shows the anti-

inflammatory potential of BV in cell culture and in animal models of organ

transplantation and sepsis. For example, investigations in cardiac, lung, liver

transplantation and sepsis models show that BV treatment improves tissue graft

survival, function and tissue injury by inhibiting pro-inflammatory cytokine expression

[210,212,216,217,218]. Furthermore, a recent study in a rat model of haemorrhagic

shock and resuscitation reported that pre-treatment with BV attenuated lung injury via

decreased expression of IL-6, TNF- and iNOS in lung tissue [219]. Although these

studies show great promise, they have all been conducted in animal models, which have

limitations when predicting human responses. For example, Seok et al. [364] recently

demonstrated that mouse models of inflammation poorly correlate with human

inflammatory responses. Therefore, we conducted the first in human ex vivo assay to

assess the effect of exogenous BV on leukocyte responses to LPS exposure. We adopted

the whole blood ex vivo model of LPS stimulation without any culture media as used in

other studies [357,365]. Whole blood retains all blood components and provides a

normal working environment for cell to cell interactions [357].

The data presented here further strengthens the argument for an anti-inflammatory

role of BV, as reported in animal studies, by showing inhibitory effects of BV (50 µM)

on LPS-mediated mRNA abundance of IL-1 and IL-6. However, when cytokines were

analysed in plasma, BV only decreased LPS-mediated IL-1 release. The enhanced

146

production of cytokines, particularly IL-1β during acute inflammation is important for

resolution of inflammation/infectious diseases, including sepsis [303]. Furthermore,

animal studies show that the beneficial effects of anti-IL-1β neutralising antibody

(XOMA 052) in several acute and chronic inflammatory diseases, including type 2

diabetes, gout and ischaemia [366,367]. XOMA 052 antibody blocked the IL-1β

induced expression of IL-6 and IL-8 in human lung fibroblast cell line, suggesting the

importance of IL-1β in inflammation [366]. Therefore, BV’s inhibitory effect on IL-β

appears to be a very important finding and provides preliminary evidence in support of

BV’s anti-inflammatory potential in humans. These data are in agreement with BV’s

effects in experimental and in vitro studies [210,212,216,217,218]. Moreover,

experiments performed in animal models of transplantation and sepsis investigated

BV’s effects on pro-inflammatory cytokine gene expression only and reported that BV

consistently reduced the expression of pro-inflammatory cytokines. For example, BV

treatment prior to endotoxin shock or caecal ligation and puncture (CLP) or organ

transplantation significantly decreased the mRNA expression of pro-inflammatory

cytokines, including IL-1β, IL-6, TNF- and monocyte chemoattractant protein (MCP)-

1 [208,217,218] in injured tissues. In contrast to this, BV decreased both the gene and

protein expression of IL-6 in LPS-stimulated RAW macrophages; however, protein

expression of TNF- remained unchanged [217,338]. We also report here suppression

of LPS-induced IFN-γ and IL-1Ra gene expression. Biliverdin at a higher concentration

(100 µM) also suppresses IFN-γ release in anti-CD3 stimulated mice splenocytes [212].

The mechanism to explain the differential effects of BV on pro-inflammatory cytokine

expression remains unknown. However, the data presented here are valuable, in that

they document 1) inhibitory effects of BV on gene expression in human leukocytes and

2) confirm that some of these responses are accompanied by reductions in cytokine

release, which is rarely documented in cell culture and animal studies.

We suggest that BV’s inconsistent capacity to decrease the release of cytokines into

plasma may be mediated by the variations in human cytokine kinetics and release after

LPS stimulation. For example, the maximum mRNA levels for TNF- and IL-6 in

whole blood are reported between 2-4 h after LPS exposure and protein levels were

rapidly increased at 4-6 h after LPS stimulation and, thereafter, start to decrease

[361,368]. In contrast to this, IL-1β gene expression decreases slowly and protein levels

147

peak after 8 h after whole blood LPS stimulation [361]. Unfortunately, it was beyond

the scope of this manuscript to measure each cytokine at each of their optimal time

points, however, the data do provide very interesting and novel evidence to suggest that

BV can reduce IL-1β and IL-8 expression and their release in a human blood ex vivo

LPS model of inflammation.

In the present study, total cell counts showed that neutrophils represented the major

cell population of white blood cells in blood. Therefore, we also investigated BV’s

effects on IL-8. We reported a significant decrease in LPS-induced IL-8 gene and

protein expression by BV (50 M). This is the first study to show an effect of BV on

IL-8. Supportive data presented by Andria et al. [27] recently showed that BV treatment

prevented IRI-induced cell death and reduced infiltration of neutrophils by >50 % in the

pig livers [27]. In addition, rats pre-treated with BV showed reduced neutrophil

recruitment into bronchoalveolar lavage fluid and intestine after LPS and CLP

exposure, respectively [217,218], suggesting that BV might reduce the severity of sepsis

in various organs via inhibition of IL-8 mediated neutrophil infiltration. We suggest that

BV exerts these effects by suppressing leukocyte IL-8 expression and release, as

documented here.

Unconjugated bilirubin and cytokine response: A surprising finding of this study was

that in humans, higher baseline UCB concentrations were significantly associated with

greater LPS-mediated cytokine gene expression. Furthermore, serum samples from

hyperbilirubinaemic Gunn rats had increased baseline IL-1β concentrations. A previous

report indicates that baseline IL-1β concentration is elevated in hyperbilirubinaemic

humans [25]. We sought to determine whether elevated IL-1β in humans and rats might

be caused by increased IL-1β gene expression in whole blood. A positive correlation

between UCB concentration and expression of IL-1 in addition to IFN-, IL-1Ra and

IL-8 was found after LPS exposure; however, no significant correlation between UCB

concentration and LPS-induced IL-6, TNF- and IL-10 gene expression occurred.

Furthermore, when cytokines were measured in plasma samples, no significant

correlation existed between UCB concentrations and LPS-induced cytokine release.

Similar observations were reported in Gunn rats and RAW macrophages, in which,

UCB showed no effect on IL-6, TNF- and IL-10 concentrations after LPS exposure;

148

however UCB decreased the expression of LPS-mediated inducible nitric oxide

synthase (iNOS) [238]. These findings are supported by an in vivo study by Dorresteijn

et al. (recently presented in abstract form), showing no change in LPS-induced pro-

inflammatory cytokine concentrations in subjects receiving atazanavir (300 mg twice

daily for four days). Atazanavir induces hyperbilirubinaemia by inhibiting the enzyme

UGT1A1 [369]. However, in the same study, Dorresteijn et al. showed that atazanavir

significantly decreased LPS-mediated IL-10 concentration, suggesting immuno-

modulatory activities of UCB in humans.

Although studies have shown that individuals with mildly elevated

concentration of UCB in Gilbert’s Syndrome (GS) have low prevalence of

cardiovascular disease [221,222], excessive accumulation of UCB (> 200 µM) in

newborn infants causes jaundice [370,371]. Elevated UCB concentrations are clearly

toxic to neuronal tissues, promoting apoptosis in astrocytes and in brain endothelial

cells via induction of pro-inflammatory cytokines (IL-1, IL-6 and TNF-) [372,373].

Our human ex vivo and in vivo data from rat serum samples both support a hypothesis

that UCB increases IL-1β expression in leukocytes, which then excrete IL-1β into

plasma. IL-1β is synthesised as pro IL-1β and requires activation by caspase-1.

Caspase-1 together with caspase-3 and -9 induce apoptosis and DNA fragmentation

[297]. Studies show that UCB increases caspase-3 and caspase-9 activities in

hepatocytes and cardiomyocytes [374,375]. However, UCB’s effect on caspase-1

(which is strongly associated with septic responses) [297] remains unknown, clearly

warrants future investigation and represents a potentially very exciting area of future

research.

Unconjugated bilirubin’s effects on cytokine expression, reported here, are

interesting because Gunn rats and mice treated with UCB (8.5 µmol/kg) show improved

survival of cardiac and islets grafts, respectively via attenuation of mRNA expression of

TNF-, IL-6, MCP-1, iNOS and cyclooxygenase (COX)-2 [228,229]. However, none of

the above studies showed a relationship between baseline UCB concentrations and pro-

inflammatory cytokine expression. This suggests that UCB may have dichotomous

effects in rodents and humans. Importantly, the data presented here show that increasing

concentration of UCB is positively correlated with IL-1β expression and are in

149

agreement with a previous study that showed elevated circulating IL1β concentrations

in hyperbilirubinaemic humans [25]. We suggest that UCB concentration plays an

important role in modulating inflammatory responses with very low (<5 M) and

mildly elevated UCB (>17 M) concentrations associated with increased IL-1β

concentrations [25]. Furthermore, in support of our findings, human neutrophils treated

with UCB alone (10-300 µM) for 24 h showed increased IL-1β and IL-8 concentration

in media [239], implying that UCB at elevated concentrations may heighten

inflammation. However, no studies have thus far reported effects of UCB on LPS-

mediated cytokine gene and protein expression. We reported significant, positive

correlations between increasing baseline UCB concentration (up to 12 M) and LPS-

driven gene expression of IL-1, IFN-, IL-1Ra and IL-8. However, the baseline UCB

concentrations were not associated with the release of cytokines into plasma. These data

are in agreement with an in vitro study showing that UCB concentration (10-300 µM)

did not influence IL-1β and IL-8 release into media after LPS activation of human

neutrophils [239]. We suggest that a higher concentration (compared to 12 µM studied

here) of UCB is required to increase synthesis and release of baseline IL-1β [25,239],

which was confirmed in our hyperbilirubinaemic Gunn animals (UCB ~ 100 M).

It is possible that BV could be infused into Gunn rats and IL-1β concentrations

assessed. It should be noted, however, that BV is rapidly reduced to UCB [21,198],

which will result in further increase in the UCB concentration in Gunn rats and may

promote inflammation. However, a recent study by Kosaka et al. [219] have shown that

Sprague–Dawley rats administrated various doses of BV (0-100 mg/kg) were protected

haemorrhagic shock induced lung injury, further supporting the cytoprotective potential

of BV.

These data suggest that both BV and UCB induce differential effects on

inflammatory mediators expression after LPS exposure, which is interesting because

BV is rapidly reduced to UCB [21,198,217]. Our data confirms that leukocytes are

capable of such reduction, showing ~ a three-fold increase in UCB concentration after

addition of 50 µM BV. However, all the samples showed mild increase in haemolysis,

which resulted in a small increase in UCB concentrations in control samples. We

suggest that the BV (50 µM)-induced increase in UCB concentration is a consequence

150

of both haem and BV metabolism. This data is in agreement with in vivo data showing

that UCB increases by approximately 33 % of the exogenously administered circulating

BV concentration [198]. Cell culture and animal studies provide an insight into the

differential effects on BV and UCB. For example, BV inhibits the activation of nuclear

factor kappa B (NF-κB) in HEK293A cells and in animal models of sepsis and

transplantation [212,217,218,220]. On the contrary, UCB does not affect NF-κB

expression both in vivo and in vitro [242]. Therefore, we suggest that in humans, BV via

activation of transcription factor NF-κB may counter-regulate inflammation in the acute

phase (Figure 5.13). Accumulating evidence suggests that UCB is the potential activator

and ligand of transcription factor aryl hydrocarbon receptor (AhR) [197,376]. AhR was

first discovered as a mediator of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD; dioxin)

toxicity and over the last decade it has emerged as a potential regulator of immune

system [377]. We suggest that UCB, similar to AhR agonist TCDD [378], may increase

the gene expression of IL-1β in the presence/absence of LPS stimulation (Figure 5.13).

Therefore, it is likely that BV and UCB induce their effects on inflammatory mediators

via different mechanisms.

152

Figure 5.13: Possible mechanism of BV and UCB-triggered immune-modulatory

effects. Haem is catabolised into BV, iron (Fe++

) and carbon monoxide (CO) via the

action of haem oxygenase (HO). Biliverdin is rapidly reduced to UCB in the presence of

BVR. Pro-inflammatory mediators and endotoxin activate NF-B p60/p65 dimer and

promote its translocation to the nucleus, where it induces the transcription and

translation of pro-inflammatory genes. Biliverdin inhibits the expression of pro-

inflammatory mediators via inhibition of NF-B activation. However UCB, similar to

dioxins, may promote translocation of AhR from the cytoplasm and binding to

xenobiotics/dioxin responsive elements, which results in activation of AhR. Activated

form of AhR then leads to increase expression of cytokines (TNF- and IL-1).

153

Biliverdin and C5aR expression: Having established that BV decreases LPS-dependent

C5aR expression in primary and immortalised macrophages [338], we aimed to assess

whether LPS/BV would also modulate C5aR gene expression in human blood.

Lipopolysaccharide significantly inhibited C5aR expression at 4 h. Although, blood

leukocytes from patients with severe septic shock show a remarkable increase in C5aR

gene expression compared to healthy individuals [379], incubation of human monocytes

with LPS (6-12 h) significantly decreased C5aR mRNA expression [327,380],

suggesting counter-regulatory role of LPS on C5aR in human leukocytes. However, BV

+ LPS had no additional significant effect on C5aR expression vs. LPS control.

Biliverdin treatment alone tended to decrease C5aR expression (ANOVA effect; P =

0.08) in agreement with our previous published reports indicating that BV treatment of

macrophages decreases C5aR expression [338]. Assessment of C5aR expression in a

larger group of individuals may be necessary to reveal a statistically significant effect of

BV.

Limitations: Although we recruited a relatively small sample of volunteers, we

reduced between subject responses by investigating healthy individuals and limited

recruitment to male subjects, eliminating possible variation introduced by the oestrous

cycle in women [381]. By investigating human subjects who showed > 10 fold IL-1β

expression our findings are limited to those individuals with a strong host response to

LPS. In addition, all samples experienced mild haemolysis at 4 and 8 h, which

contributed to a non-significant increase in UCB in control samples. Haemolysis is

frequently observed in patients with sepsis after acute infection [382]. However,

haemolysis did not contribute to inflammation in the present study as indicated by low

levels of cytokines in non-LPS treated samples. It is also reported that LPS positively or

negatively regulates HO-1 expression in different cell lines and species [383,384,385].

For example, LPS induces HO-1 induction in leukemia cell lines; however, LPS does

not increase HO-1 expression in primary monocytes because they express a substantial

amount of HO-1 basally compared to immortalised monocytes [386]. Furthermore

during extensive haemolysis, free haemoglobin promotes release of free haem and

accumulation in the cell membrane [387]. Our ex vivo data showed ~ 4 and ~ 7-fold

increase in haem content in plasma after 4 and 8 h of incubation, respectively. In

addition, in vitro studies show that incubation with haem (10 μM) for 24 h promotes

HO-1 induction [388]. We suggest that haemolysis reported after 4 and 8 h incubation

154

may increase HO-1 expression, however, future studies are required to investigate the

effect of haemolysis on HO-1 induction and the effect of this within ex vivo models of

LPS stimulation. Only one time point was used to measure the release of cytokines in

this study (8 h) and it is possible that measurement at other time points (4-6 h)

[361,368] might reveal additional significant effects of BV and UCB. Despite this, the 8

h time point was appropriate for LPS-mediated IL-1 and IL-8 release into plasma,

which were decreased after BV treatment. Clearly, the kinetics of cytokine release

differs between targets and, therefore, this likely accounted partly for the lack of

congruence between gene and protein data. Although previous in vitro studies showed

suppressive effects of BV on both gene and protein expression of pro-inflammatory

cytokines (IL-6), these studies were performed using a single cell type. The present

study has benefit of studying inflammatory responses in a complex, yet appropriate

matrix composing of multiple cell lineages and, most importantly, these responses were

tested in human cells.

Summary: Collectively, these data show that BV inhibits whole human blood responses

to LPS, by reducing mRNA expression of IL-1, IL-6, IFN-, IL-1Ra and IL-8.

Biliverdin also attenuated the LPS-induced excretion of IL-1 and IL-8 into plasma.

Interestingly, UCB at increasing baseline concentrations was correlated with greater

transcription of cytokines in response to LPS, suggesting UCB has pro-inflammatory

potential. In summary, in this report we demonstrate that both BV and UCB are

immuno-modulatory compounds and that BV could represent potential therapeutic

target against inflammatory disorders, including sepsis, based upon its potent ability to

potently inhibit IL-1 and IL-8 transcription and release in leukocytes.

155

Chapter 6 Thesis Summary and Conclusion

156

6.1 Introduction

Despite extensive research on BV’s protective mechanisms against

transplantation-related pathology [27,176,209,211], vascular injury [26], endotoxic

shock [217], polymicrobial sepsis/caecal ligation puncture [218], the effects of BV on

C5aR, a major contributor to inflammatory pathology [29,30,31,32], is essentially

unknown.

Biliverdin reductase influences a diverse spectrum of functions, including cell

signalling and induces antioxidant cytoprotection [255,263]. For example, deletion of

BVR by RNA interference leads to the development of a pro-inflammatory phenotype

in macrophages, increasing TLR-4 gene expression [28]. The beneficial effects of

BV/BVR against inflammation-mediated injury prompted this thesis topic, which aimed

to investigate the potential impacts of exogenous BV and endogenous BVR on C5aR,

pro-inflammatory cytokine expression, macrophage chemotaxis and phenotype in cell

culture and animal models. In addition, the project also aimed to translate the effects of

exogenous BV observed in animal studieson on pro- and anti-inflammatory cytokine

gene expression in an ex vivo human model of LPS stimulation. These data might assist

in revealing the therapeutic potential of BV administration in sepsis and septic shock.

6.2 Project summary

The first study (Chapter 3) explored the anti-inflammatory effects of BV in

immortalised and primary macrophages. It was hypothesised that: i) BV would reduce

LPS-induced gene and protein expression of C5aR in both macrophage populations, ii)

effects of BV would be mediated via the PI3K/mTOR signalling pathway and iii) BV

would inhibit LPS-mediated gene expression and production of TNF-α and IL-6. The

hypotheses were partially supported in that BV at 50 µM inhibited the LPS (100

ng/mL)-dependent increase in C5aR gene and protein expression in RAW 264.7 and

bone marrow derived macrophages. Furthermore, BV and LPS increased the

phosphorylation of Akt (downstream of PI3K) and S6 (downstream of mTOR), which

was inhibited by treatment with LY294002 (LY) and rapamycin, respectively. However,

LY also blocked LPS-induced C5aR expression in addition to Akt phosphorylation.

Since LY may exert non-specific inhibitory effects beyond the PI3K pathway [326],

rapamycin was chosen (a specific inhibitor of pS6) [291] to specifically investigate

whether BV’s activation of mTOR signalling inhibits LPS-induced C5aR expression.

157

Interestingly, the mTOR inhibitor did not influence LPS-effects on C5aR, although,

BV’s inhibitory effect on LPS-induced C5aR was abrogated, suggesting that BV

mitigates LPS-mediated C5aR expression in part via mTOR signalling. Biliverdin also

significantly decreased gene expression of TNF-α and IL-6 after 24 h incubation with

LPS. However, when cytokine release was measured, BV only significantly decreased

LPS-triggered IL-6 release.

These data suggest that inhibition of C5aR expression by BV is an important

anti-inflammatory mechanism. Therefore, the next study of this project aimed to explore

the effect of BVR (which BV activates) deletion on C5aR, chemotaxis and macrophage

polarisation.

The second study (Chapter 4) of this project investigated the role of BVR on

C5aR expression, macrophage phenotype and function. Macrophages from BVRfl/fl

and

CreLyz: BVRfl/fl

mice (conditional deletion of BVR in myeloid cells) were employed and

treated with LPS (100 ng/mL) and IFN-γ (20 ng/mL) or control for 24 or 72 h ± a

neutralising antibody against C5aR. Stimulation with LPS and IFN-γ promoted

macrophage polarisation towards the M1 phenotype, resulting in increased iNOS

expression and TNF-α production [342]. Macrophages from CreLyz:BVRfl/fl

mice

showed a significant increase in C5aR gene and protein expression at baseline, and

exhibited increased chemotaxis in response to C5a (100 nM). Furthermore, the increase

in C5aR protein and chemotaxis in CreLyz:BVRfl/fl

was blocked by pre-incubation with

a C5aR neutralising antibody. Deletion of BVR in CreLyz:BVRfl/fl

mice promoted

macrophage polarisation towards the M1 phenotype, which was accompanied by a

significant increase in iNOS gene and protein expression and TNF-α production.

Interestingly, blocking C5aR with the neutralising antibody abrogated the LPS and IFN-

γ dependent increase in iNOS expression and TNF-α levels in CreLyz:BVRfl/fl

mice. In

conclusion, these data suggested that deletion of BVR in myeloid cells induces

complement activation by increased expression of C5aR and chemotaxis in response to

C5a. Furthermore, BVR regulates macrophage activation and phenotype, and deletion

of BVR results in increased expression of iNOS and TNF-α (M1 polarisation). The

increased expression of C5aR, chemotaxis and expression of M1 markers in

macrophages from CreLyz:BVRfl/fl

mice were abrogated by treatment with anti-mouse

158

C5aR, suggesting that C5aR plays a crucial role in regulating BVR’s mediated immune

responses.

The data from Chapter 3 and 4 suggest that both BV and BVR play an important

role in regulating inflammation by reducing the expression of C5aR, cytokine gene

expression, release and macrophage phenotype in cellular and murine models. These

data further support the possibility that BV/BVR mediates cytoprotection against

transplantation, endotoxic shock and sepsis-mediated inflammation in rodent models via

its anti-inflammatory mechanisms of action. However, the effect of BV

supplementation in a humanised model of inflammation remains unknown. Therefore,

the next study aimed to investigate the anti-inflammatory potential of BV after ex vivo

LPS activation of whole human blood.

The third and final study (Chapter 5) of this thesis investigated the effects of

exogenous BV and endogenous UCB on C5aR and cytokine gene expression and

release of pro-and anti-inflammatory cytokines in human blood after LPS stimulation.

Interestingly, stimulation of human blood with LPS significantly decreased C5aR gene

expression, therefore, BV’s effect on C5aR could not be verified in this ex vivo human

model. However, in vitro studies show that LPS increases C5aR expression in

epithelial, endothelial and mouse macrophage cell lines [332,334]. However, acute

incubation of human monocytes with LPS (6-12 h) reduced C5aR mRNA expression

[327,380], suggesting LPS induces counter-regulatory expression of C5aR in human

leukocytes. Recently, Dorrestejein et al. [389] reported no significant effect of LPS

administration on the complement cascade, including C1 esterase and C4 proteins in

humans. Furthermore, Furebring et al. [390] showed that ex vivo incubation of whole

blood with LPS (0.1-1000 ng/mL) decreased the C5aR protein expression in leukocytes,

agreeing with gene expression data presented in this thesis. In addition, reduced

expression of C5aR was reported in patients with sepsis [391] and in an animal model

of caecal ligation puncture [392]. However, an ~ 5-fold increase in serum

concentrations of C5a and ~ 2-fold increase in C5b-9 (membrane attack complex) were

reported in septic shock patients [392]. These studies indicate that a decrease in C5aR

during sepsis or after LPS exposure could be mediated via excessive activation of

complement proteins, including C5a. In contrast to this, Tschering et al. [393] showed

that in mice and rats, C5aR was exclusively expressed by infiltrated leukocytes but was

undetectable in parenchymal cells, including epithelial cells, smooth muscle cells and

159

endothelial cells after LPS-induced pneumonitis. However, in vitro that LPS induces

C5aR expression in cultured epithelial and endothelial cells [332,333], suggesting that

LPS increases C5aR expression in murine leukcoytes and cultured myeloid and non-

myeloid cells. These studies indicate that LPS positively or negatively regulates C5aR

expression, depending on cell types investigated, species studied and severity of

inflammation. Therefore, future studies are required to investigate the effect of ex vivo

LPS at different time-points in large animal (ovine and porcine) models. These

observations also suggest that another stimulus will be required to induce C5aR

expression in an ex vivo human model to study BV’s inhibitory effect.

Although BV had non-significant effects on C5aR expression, supplementation

of human blood with 50 µM BV significantly reduced LPS-induced gene expression of

IL-1β, IL-6, IFN-γ, IL-1Ra and IL-8. Furthermore, BV decreased leukocyte IL-1β and

IL-8 release in response to LPS. Surprisingly, increasing concentration of baseline

UCB (in the absence of BV) was positively associated with LPS-mediated gene

expression of IL-1β, IFN-γ, IL-1Ra and IL-8. In addition, hyperbilirubinaemic Gunn

rats showed an increase in baseline IL-1β concentrations compared to

normobilirubinaemic Wistar rats. These data indicate that supplemented BV inhibits

LPS-dependent cytokine gene expression and release in whole human blood, supporting

BV’s anti-inflammatory potential in humans. However, endogenous UCB at higher

concentrations appears to promote LPS-mediated cytokine gene expression, suggesting

UCB acts as an immuno-modulatory agent in humans.

6.3 Future research

Revealing the effects of BV and BVR on C5aR in cellular and murine models of LPS

stimulation will facilitate and inform further exploration of the efficacy of BV and BVR

as anti-inflammatory agents in larger animal models of complement associated

inflammatory pathology, including ovine and porcine models of inflammation. Large

animal models represent more appropriate models to translate the efficacy of anti-

inflammatory compounds to the human organism. It is acknowledged that significant

challenges will exist in the translation of BV as an anti-inflammatory drug for use in

humans suffering severe inflammatory disorders. This may exist because BV is rapidly

reduced to UCB [21,198,217], which is likely to induce acute jaundice within human

recipients. Furthermore, as indicated in this thesis, UCB appears to exert pro-

inflammatory effects, which may promote inflammatory responses after BV has been

160

metabolised/excreted. Therefore, future studies are clearly required to further

investigate the effects of BV supplementation in large animal and human ex vivo whole

blood culture models with additional inflammatory stimuli, including damage

associated molecules (e.g. mitochondrial DNA, heat shock protein, high mobility group

box1, burn and hypoxia) to determine the viability and utility of BV as a viable clinical

therapeutic.

Despite these limitations, the inhibitory effects of BV on C5aR suggest that BV

may reduce the severity of complement-associated disorders, including sepsis, arthritis

and possibly atherosclerosis. The data within this thesis also suggest that BV inhibits

IL-8 gene expression and release by leukocytes, supporting a hypothesis that BV may

reduce neutrophil infiltration after organ damage/transplantation, which is an important

finding. The beneficial effects of BV on neutrophils and on chemokine release,

including IL-8 and MCP-1 should also be tested in ovine and porcine models to

determine the viability of BV to improve clinical outcomes after transplant/trauma.

Several studies have documented BVR-mediated protective effects in hypoxia

[267], oxidative stress [263,266] and endotoxin-induced injuries [28] in cell culture and

murine models. The data documented here further support BVR’s anti-inflammatory

and cytoprotective potential using Cre:BVRfl/fl

mice. BVR is also available as a

recombinant protein and cytoprotective effects of exogenous BVR have been

demonstrated against experimental induced encephalomyelitis in rats [266]. Data from

Chapter 4 suggest that the lack of BVR or mutation in the BVR gene is likely to induce

sensitisation to inflammatory stimuli (i.e. C5a). BVR mutation is prevalent (although

very rare) [14], however, data exist to indicate that reduced haem turnover (which forms

BV) may fail to activate BVR sufficiently to mediate anti-inflammatory effects. Haem

catabolism decreases with age [394], consistent with reduced UCB levels in the elderly

[395] and suggests that BVR is less metabolically active in aged individuals. It is likely

that the reduction in haem catabolism and BVR activity with age may increase the risk

of chronic inflammation occurring, which overwhelms host responses in age-associated

diseases [394]. Furthermore, data from Chapter 5 also suggested that UCB at

concentrations above normal levels (>17.1 µM) [192,233] may activate inflammatory

responses by increasing the expression and production of IL-1β [25]. Although, we

speculated that UCB at mildly elevated concentrations may promote inflammation via

161

aryl hydrocarbon receptor activation, future studies are required to establish this mode

of action.

6.4 Concluding remarks

Recently, a growing body of research has demonstrated cytoprotective effects of

BV, suggesting that BV imparts protection via its combined anti-oxidant and anti-

inflammatory effects. The data in this thesis further support the importance of BV/BVR

in mediating protection against inflammation and suggest that BV/BVR may reduce the

severity of inflammation-associated pathologies in humans, by reducing C5aR and

cytokine expression. Reporting these beneficial effects of BV/BVR will hopefully

attract research funding agencies to support research on the therapeutic potential of

BV/BVR, which may benefit the health of general public.

162

Chapter 7 References

163

[1] L. Vitek, J.D. Ostrow, Bilirubin chemistry and metabolism; harmful and protective

aspects. (2009) Curr Pharm Des 15: 2869-2883.

[2] A.E. O'Connor, W.M. Gallagher, A.T. Byrne, Porphyrin and nonporphyrin

photosensitizers in oncology: preclinical and clinical advances in photodynamic

therapy. (2009) Photochem Photobiol 85: 1053-1074.

[3] H.L. Bonkovsky, J.T. Guo, W. Hou, T. Li, T. Narang, M. Thapar, Porphyrin and

heme metabolism and the porphyrias. (2013) Compr Physiol 3: 365-401.

[4] R.E. Blankenship, H. Hartman, The origin and evolution of oxygenic

photosynthesis. (1998) Trends Biochem Sci 23: 94-97.

[5] F.L. Sousa, L. Shavit-Grievink, J.F. Allen, W.F. Martin, Chlorophyll biosynthesis

gene evolution indicates photosystem gene duplication, not photosystem merger, at

the origin of oxygenic photosynthesis. (2013) Genome Biol Evol 5: 200-216.

[6] M.F. Hohmann-Marriott, R.E. Blankenship, Evolution of photosynthesis. (2011)

Annu Rev Plant Biol 62: 515-548.

[7] A.R. Battersby, Biosynthesis of the pigments of life. (1988) J Nat Prod 51: 629-642.

[8] D.C. Mauzerall, Evolution of porphyrins. (1998) Clin Dermatol 16: 195-201.

[9] A.F. McDonagh, Turning green to gold. (2001) Nat Struct Biol 8: 198-200.

[10] A. Wilks, Heme oxygenase: evolution, structure, and mechanism. (2002) Antioxid

Redox Signal 4: 603-614.

[11] C.A. Piantadosi, Biological chemistry of carbon monoxide. (2002) Antioxid Redox

Signal 4: 259-270.

[12] R. Zhao, G.Y. Xu, Z.Z. Liu, J.Y. Li, N. Yang, A study on eggshell pigmentation:

biliverdin in blue-shelled chickens. (2006) Poult Sci 85: 546-549.

[13] A.F. McDonagh, Controversies in bilirubin biochemistry and their clinical

relevance. (2010) Semin Fetal Neonatal Med 15: 141-147.

[14] M. Gafvels, P. Holmstrom, A. Somell, F. Sjovall, J.O. Svensson, L. Stahle, U.

Broome, P. Stal, A novel mutation in the biliverdin reductase-A gene combined

with liver cirrhosis results in hyperbiliverdinaemia (green jaundice). (2009) Liver Int

29: 1116-1124.

[15] J.W. Painter, Jaundice in the newborn. IV. The treatment of hyperbilirubinemia at

Mary Washington Hospital. (1959) Va Med Mon (1918) 86: 97-98.

[16] R.L. Watson, Hyperbilirubinemia. (2009) Crit Care Nurs Clin North Am 21: 97-

120, vii.

[17] H. Ihara, N. Hashizume, N. Shimizu, T. Aoki, Threshold concentration of unbound

bilirubin to induce neurological deficits in a patient with type I Crigler-Najjar

syndrome. (1999) Ann Clin Biochem 36 ( Pt 3): 347-352.

[18] S.W. Ryter, Bile pigments in pulmonary and vascular disease. (2012) Front

Pharmacol 3: 39.

[19] R. Stocker, Antioxidant activities of bile pigments. (2004) Antioxid Redox Signal

6: 841-849.

[20] N. Lerner-Marmarosh, J. Shen, M.D. Torno, A. Kravets, Z. Hu, M.D. Maines,

Human biliverdin reductase: a member of the insulin receptor substrate family

with serine/threonine/tyrosine kinase activity. (2005) Proc Natl Acad Sci U S A

102: 7109-7114.

[21] B. Wegiel, C.J. Baty, D. Gallo, E. Csizmadia, J.R. Scott, A. Akhavan, B.Y. Chin,

E. Kaczmarek, J. Alam, F.H. Bach, B.S. Zuckerbraun, L.E. Otterbein, Cell surface

biliverdin reductase mediates biliverdin-induced anti-inflammatory effects via

phosphatidylinositol 3-kinase and Akt. (2009) J Biol Chem 284: 21369-21378.

164

[22] L. Vitek, M. Jirsa, M. Brodanova, M. Kalab, Z. Marecek, V. Danzig, L. Novotny,

P. Kotal, Gilbert syndrome and ischemic heart disease: a protective effect of

elevated bilirubin levels. (2002) Atherosclerosis 160: 449-456.

[23] L.J. Horsfall, G. Rait, K. Walters, D.M. Swallow, S.P. Pereira, I. Nazareth, I.

Petersen, Serum bilirubin and risk of respiratory disease and death. (2011) JAMA

305: 691-697.

[24] L.J. Horsfall, I. Nazareth, S.P. Pereira, I. Petersen, Gilbert's syndrome and the risk

of death: a population-based cohort study. (2013) J Gastroenterol Hepatol.

[25] M. Wallner, A.C. Bulmer, C. Molzer, E. Mullner, R. Marculescu, D. Doberer, M.

Wolzt, O.F. Wagner, K.H. Wagner, Haem catabolism: a novel modulator of

inflammation in Gilbert's syndrome. (2013) Eur J Clin Invest 43: 912-919.

[26] A. Nakao, N. Murase, C. Ho, H. Toyokawa, T.R. Billiar, S. Kanno, Biliverdin

administration prevents the formation of intimal hyperplasia induced by vascular

injury. (2005) Circulation 112: 587-591.

[27] B. Andria, A. Bracco, C. Attanasio, S. Castaldo, M.G. Cerrito, S. Cozzolino, D. Di

Napoli, R. Giovannoni, A. Mancini, A. Musumeci, E. Mezza, M. Nasti, V.

Scuderi, S. Staibano, M. Lavitrano, L.E. Otterbein, F. Calise, Biliverdin protects

against liver ischemia reperfusion injury in swine. (2013) PLoS One 8: e69972.

[28] B. Wegiel, D. Gallo, E. Csizmadia, T. Roger, E. Kaczmarek, C. Harris, B.S.

Zuckerbraun, L.E. Otterbein, Biliverdin inhibits Toll-like receptor-4 (TLR4)

expression through nitric oxide-dependent nuclear translocation of biliverdin

reductase. (2011) Proc Natl Acad Sci U S A 108: 18849-18854.

[29] H.D. Manthey, A.C. Thomas, I.A. Shiels, A. Zernecke, T.M. Woodruff, B. Rolfe,

S.M. Taylor, Complement C5a inhibition reduces atherosclerosis in ApoE-/- mice.

(2011) FASEB J 25: 2447-2455.

[30] R. Oksjoki, P.T. Kovanen, S. Meri, M.O. Pentikainen, Function and regulation of

the complement system in cardiovascular diseases. (2007) Front Biosci 12: 4696-

4708.

[31] S. Khandhadia, V. Cipriani, J.R. Yates, A.J. Lotery, Age-related macular

degeneration and the complement system. (2012) Immunobiology 217: 127-146.

[32] P.A. Ward, Role of C5 activation products in sepsis. (2010) ScientificWorldJournal

10: 2395-2402.

[33] M.D. Maines, New insights into biliverdin reductase functions: linking heme

metabolism to cell signaling. (2005) Physiology (Bethesda) 20: 382-389.

[34] B. Wegiel, L.E. Otterbein, Go green: the anti-inflammatory effects of biliverdin

reductase. (2012) Front Pharmacol 3: 47.

[35] T.R. Kollmann, O. Levy, R.R. Montgomery, S. Goriely, Innate immune function

by Toll-like receptors: distinct responses in newborns and the elderly. (2012)

Immunity 37: 771-783.

[36] R.S. Goldszmid, G. Trinchieri, The price of immunity. (2012) Nat Immunol 13:

932-938.

[37] C.C. Santos, H. Zhang, M. Liu, A.S. Slutsky, Bench-to-bedside review: Biotrauma

and modulation of the innate immune response. (2005) Crit Care 9: 280-286.

[38] M. Cruvinel Wde, D. Mesquita, Jr., J.A. Araujo, T.T. Catelan, A.W. de Souza, N.P.

da Silva, L.E. Andrade, Immune system - part I. Fundamentals of innate immunity

with emphasis on molecular and cellular mechanisms of inflammatory response.

(2010) Rev Bras Reumatol 50: 434-461.

[39] P. Bourlioux, B. Koletzko, F. Guarner, V. Braesco, The intestine and its microflora

are partners for the protection of the host: report on the Danone Symposium "The

Intelligent Intestine," held in Paris, June 14, 2002. (2003) Am J Clin Nutr 78: 675-

683.

165

[40] A.M. Lundberg, G.K. Hansson, Innate immune signals in atherosclerosis. (2010)

Clin Immunol 134: 5-24.

[41] W.K. den Dekker, C. Cheng, G. Pasterkamp, H.J. Duckers, Toll like receptor 4 in

atherosclerosis and plaque destabilization. (2010) Atherosclerosis 209: 314-320.

[42] D. Annane, E. Bellissant, J.M. Cavaillon, Septic shock. (2005) Lancet 365: 63-78.

[43] E. Kolaczkowska, P. Kubes, Neutrophil recruitment and function in health and

inflammation. (2013) Nat Rev Immunol 13: 159-175.

[44] N. Fujiwara, K. Kobayashi, Macrophages in inflammation. (2005) Curr Drug

Targets Inflamm Allergy 4: 281-286.

[45] J.M. Cavaillon, M. Adib-Conquy, Monocytes/macrophages and sepsis. (2005) Crit

Care Med 33: S506-509.

[46] T.J. Kindt, Osborne, Barbara A., Goldsby, Richard A, Kuby Immunology (6th

edition). (2006).

[47] D. Mesquita Junior, J.A. Araujo, T.T. Catelan, A.W. Souza, M. Cruvinel Wde, L.E.

Andrade, N.P. Silva, Immune system - part II: basis of the immunological response

mediated by T and B lymphocytes. (2010) Rev Bras Reumatol 50: 552-580.

[48] J.A. Alberts B, Lewis J, Raff M, Roberts K, Walter P, Molecular Biology of the

Cell. 5th edition. (2007).

[49] A.W. de Souza, D. Mesquita Junior, J.A. Araujo, T.T. Catelan, M. Cruvinel Wde,

L.E. Andrade, N.P. da Silva, Immune system: part III. The delicate balance of the

immune system between tolerance and autoimmunity. (2010) Rev Bras Reumatol

50: 665-679.

[50] J. Parkin, B. Cohen, An overview of the immune system. (2001) Lancet 357: 1777-

1789.

[51] E.M. Shevach, CD4+ CD25+ suppressor T cells: more questions than answers.

(2002) Nat Rev Immunol 2: 389-400.

[52] L.P. Sousa, A.L. Alessandri, V. Pinho, M.M. Teixeira, Pharmacological strategies

to resolve acute inflammation. (2013) Curr Opin Pharmacol 13: 625-631.

[53] P. Kubes, W.Z. Mehal, Sterile inflammation in the liver. (2012) Gastroenterology

143: 1158-1172.

[54] C.N. Serhan, S.D. Brain, C.D. Buckley, D.W. Gilroy, C. Haslett, L.A. O'Neill, M.

Perretti, A.G. Rossi, J.L. Wallace, Resolution of inflammation: state of the art,

definitions and terms. (2007) FASEB J 21: 325-332.

[55] A.L. Alessandri, L.P. Sousa, C.D. Lucas, A.G. Rossi, V. Pinho, M.M. Teixeira,

Resolution of inflammation: Mechanisms and opportunity for drug development.

(2013) Pharmacol Ther 139: 189-212.

[56] V. Kumar, A. Sharma, Neutrophils: Cinderella of innate immune system. (2010)

Int Immunopharmacol 10: 1325-1334.

[57] B. Amulic, C. Cazalet, G.L. Hayes, K.D. Metzler, A. Zychlinsky, Neutrophil

function: from mechanisms to disease. (2012) Annu Rev Immunol 30: 459-489.

[58] N. Borregaard, J.B. Cowland, Granules of the human neutrophilic

polymorphonuclear leukocyte. (1997) Blood 89: 3503-3521.

[59] C.D. Sadik, N.D. Kim, A.D. Luster, Neutrophils cascading their way to

inflammation. (2011) Trends Immunol 32: 452-460.

[60] J. Pillay, I. den Braber, N. Vrisekoop, L.M. Kwast, R.J. de Boer, J.A. Borghans, K.

Tesselaar, L. Koenderman, In vivo labeling with 2H2O reveals a human

neutrophil lifespan of 5.4 days. (2010) Blood 116: 625-627.

[61] P.S. Tofts, T. Chevassut, M. Cutajar, N.G. Dowell, A.M. Peters, Doubts

concerning the recently reported human neutrophil lifespan of 5.4 days. (2011)

Blood 117: 6050-6052; author reply 6053-6054.

166

[62] K.W. Li, S.M. Turner, C.L. Emson, M.K. Hellerstein, D.C. Dale, Deuterium and

neutrophil kinetics. (2011) Blood 117: 6052-6053; author reply 6053-6054.

[63] S. Caielli, J. Banchereau, V. Pascual, Neutrophils come of age in chronic

inflammation. (2012) Curr Opin Immunol 24: 671-677.

[64] C. Summers, S.M. Rankin, A.M. Condliffe, N. Singh, A.M. Peters, E.R. Chilvers,

Neutrophil kinetics in health and disease. (2010) Trends Immunol 31: 318-324.

[65] F. Walker, H.H. Zhang, V. Matthews, J. Weinstock, E.C. Nice, M. Ernst, S. Rose-

John, A.W. Burgess, IL6/sIL6R complex contributes to emergency granulopoietic

responses in G-CSF- and GM-CSF-deficient mice. (2008) Blood 111: 3978-3985.

[66] P. Lacy, The role of Rho GTPases and SNAREs in mediator release from

granulocytes. (2005) Pharmacol Ther 107: 358-376.

[67] C.S. Baker, R.J. Hall, T.J. Evans, A. Pomerance, J. Maclouf, C. Creminon, M.H.

Yacoub, J.M. Polak, Cyclooxygenase-2 is widely expressed in atherosclerotic

lesions affecting native and transplanted human coronary arteries and colocalizes

with inducible nitric oxide synthase and nitrotyrosine particularly in macrophages.

(1999) Arterioscler Thromb Vasc Biol 19: 646-655.

[68] C. Bogdan, M. Rollinghoff, A. Diefenbach, Reactive oxygen and reactive nitrogen

intermediates in innate and specific immunity. (2000) Curr Opin Immunol 12: 64-

76.

[69] D.I. Pattison, M.J. Davies, C.L. Hawkins, Reactions and reactivity of

myeloperoxidase-derived oxidants: differential biological effects of hypochlorous

and hypothiocyanous acids. (2012) Free Radic Res 46: 975-995.

[70] S. Gordon, P.R. Taylor, Monocyte and macrophage heterogeneity. (2005) Nat Rev

Immunol 5: 953-964.

[71] A. Parihar, T.D. Eubank, A.I. Doseff, Monocytes and macrophages regulate

immunity through dynamic networks of survival and cell death. (2010) J Innate

Immun 2: 204-215.

[72] C. Zhang, The role of inflammatory cytokines in endothelial dysfunction. (2008)

Basic Res Cardiol 103: 398-406.

[73] F.O. Martinez, L. Helming, S. Gordon, Alternative activation of macrophages: an

immunologic functional perspective. (2009) Annu Rev Immunol 27: 451-483.

[74] I. Tabas, Macrophage death and defective inflammation resolution in

atherosclerosis. (2010) Nat Rev Immunol 10: 36-46.

[75] M. Pate, V. Damarla, D.S. Chi, S. Negi, G. Krishnaswamy, Endothelial cell

biology: role in the inflammatory response. (2010) Adv Clin Chem 52: 109-130.

[76] P. Libby, Inflammation and cardiovascular disease mechanisms. (2006) Am J Clin

Nutr 83: 456S-460S.

[77] M. Toborek, S. Kaiser, Endothelial cell functions. Relationship to atherogenesis.

(1999) Basic Res Cardiol 94: 295-314.

[78] J. Davignon, P. Ganz, Role of endothelial dysfunction in atherosclerosis. (2004)

Circulation 109: III27-32.

[79] J.S. Pober, W.C. Sessa, Evolving functions of endothelial cells in inflammation.

(2007) Nat Rev Immunol 7: 803-815.

[80] G. Bazzoni, E. Dejana, Endothelial cell-to-cell junctions: molecular organization

and role in vascular homeostasis. (2004) Physiol Rev 84: 869-901.

[81] J.S. Pober, W. Min, J.R. Bradley, Mechanisms of endothelial dysfunction, injury,

and death. (2009) Annu Rev Pathol 4: 71-95.

[82] P. Kubes, The complexities of leukocyte recruitment. (2002) Semin Immunol 14:

65-72.

[83] B. Petri, M. Phillipson, P. Kubes, The physiology of leukocyte recruitment: an in

vivo perspective. (2008) J Immunol 180: 6439-6446.

167

[84] F. Sallusto, M. Baggiolini, Chemokines and leukocyte traffic. (2008) Nat Immunol

9: 949-952.

[85] M. Barkett, T.D. Gilmore, Control of apoptosis by Rel/NF-kappaB transcription

factors. (1999) Oncogene 18: 6910-6924.

[86] T.M. Baetu, H. Kwon, S. Sharma, N. Grandvaux, J. Hiscott, Disruption of NF-

kappaB signaling reveals a novel role for NF-kappaB in the regulation of TNF-

related apoptosis-inducing ligand expression. (2001) J Immunol 167: 3164-3173.

[87] R. Sen, D. Baltimore, Multiple nuclear factors interact with the immunoglobulin

enhancer sequences. (1986) Cell 46: 705-716.

[88] S. Ghosh, M.S. Hayden, New regulators of NF-kappaB in inflammation. (2008)

Nat Rev Immunol 8: 837-848.

[89] Z. Sun, R. Andersson, NF-kappaB activation and inhibition: a review. (2002)

Shock 18: 99-106.

[90] G. Bonizzi, M. Karin, The two NF-kappaB activation pathways and their role in

innate and adaptive immunity. (2004) Trends Immunol 25: 280-288.

[91] A.M. Mabb, S. Miyamoto, SUMO and NF-kappaB ties. (2007) Cell Mol Life Sci

64: 1979-1996.

[92] J. Dabek, A. Kulach, Z. Gasior, Nuclear factor kappa-light-chain-enhancer of

activated B cells (NF-kappaB): a new potential therapeutic target in

atherosclerosis? (2010) Pharmacol Rep 62: 778-783.

[93] E. Abraham, Nuclear factor-kappaB and its role in sepsis-associated organ failure.

(2003) J Infect Dis 187 Suppl 2: S364-369.

[94] U. Forstermann, W.C. Sessa, Nitric oxide synthases: regulation and function.

(2012) Eur Heart J 33: 829-837, 837a-837d.

[95] K. Bian, F. Murad, Diversity of endotoxin-induced nitrotyrosine formation in

macrophage-endothelium-rich organs. (2001) Free Radic Biol Med 31: 421-429.

[96] K. Bian, F. Ghassemi, A. Sotolongo, A. Siu, L. Shauger, A. Kots, F. Murad, NOS-

2 signaling and cancer therapy. (2012) IUBMB Life 64: 676-683.

[97] R.B. Mikkelsen, P. Wardman, Biological chemistry of reactive oxygen and

nitrogen and radiation-induced signal transduction mechanisms. (2003) Oncogene

22: 5734-5754.

[98] V.W. Liu, P.L. Huang, Cardiovascular roles of nitric oxide: a review of insights

from nitric oxide synthase gene disrupted mice. (2008) Cardiovasc Res 77: 19-29.

[99] L.A. Ridnour, D.D. Thomas, D. Mancardi, M.G. Espey, K.M. Miranda, N.

Paolocci, M. Feelisch, J. Fukuto, D.A. Wink, The chemistry of nitrosative stress

induced by nitric oxide and reactive nitrogen oxide species. Putting perspective on

stressful biological situations. (2004) Biol Chem 385: 1-10.

[100] G. Foldes, S. von Haehling, S.D. Anker, Toll-like receptor modulation in

cardiovascular disease: a target for intervention? (2006) Expert Opin Investig

Drugs 15: 857-871.

[101] H. Bjorkbacka, Multiple roles of Toll-like receptor signaling in atherosclerosis.

(2006) Curr Opin Lipidol 17: 527-533.

[102] M.F. Tsan, B. Gao, Endogenous ligands of Toll-like receptors. (2004) J Leukoc

Biol 76: 514-519.

[103] R.T. Figueiredo, P.L. Fernandez, D.S. Mourao-Sa, B.N. Porto, F.F. Dutra, L.S.

Alves, M.F. Oliveira, P.L. Oliveira, A.V. Graca-Souza, M.T. Bozza,

Characterization of heme as activator of Toll-like receptor 4. (2007) J Biol Chem

282: 20221-20229.

[104] L.C. Parker, L.R. Prince, I. Sabroe, Translational mini-review series on Toll-like

receptors: networks regulated by Toll-like receptors mediate innate and adaptive

immunity. (2007) Clin Exp Immunol 147: 199-207.

168

[105] R.P. Gomariz, A. Arranz, Y. Juarranz, I. Gutierrez-Canas, M. Garcia-Gomez, J.

Leceta, C. Martinez, Regulation of TLR expression, a new perspective for the role

of VIP in immunity. (2007) Peptides 28: 1825-1832.

[106] L.R. Prince, M.K. Whyte, I. Sabroe, L.C. Parker, The role of TLRs in neutrophil

activation. (2011) Curr Opin Pharmacol 11: 397-403.

[107] J.V. Sarma, P.A. Ward, The complement system. (2011) Cell Tissue Res 343:

227-235.

[108] M.C. Carroll, The complement system in regulation of adaptive immunity. (2004)

Nat Immunol 5: 981-986.

[109] U. Kishore, R.B. Sim, Factor H as a regulator of the classical pathway activation.

(2012) Immunobiology 217: 162-168.

[110] M.V. Carroll, R.B. Sim, Complement in health and disease. (2011) Adv Drug

Deliv Rev 63: 965-975.

[111] H.D. Manthey, T.M. Woodruff, S.M. Taylor, P.N. Monk, Complement

component 5a (C5a). (2009) Int J Biochem Cell Biol 41: 2114-2117.

[112] C. Ehrnthaller, A. Ignatius, F. Gebhard, M. Huber-Lang, New insights of an old

defense system: structure, function, and clinical relevance of the complement

system. (2011) Mol Med 17: 317-329.

[113] P.A. Ward, The dark side of C5a in sepsis. (2004) Nat Rev Immunol 4: 133-142.

[114] P.A. Ward, Functions of C5a receptors. (2009) J Mol Med (Berl) 87: 375-378.

[115] M. Huber-Lang, J.V. Sarma, F.S. Zetoune, D. Rittirsch, T.A. Neff, S.R. McGuire,

J.D. Lambris, R.L. Warner, M.A. Flierl, L.M. Hoesel, F. Gebhard, J.G. Younger,

S.M. Drouin, R.A. Wetsel, P.A. Ward, Generation of C5a in the absence of C3: a

new complement activation pathway. (2006) Nat Med 12: 682-687.

[116] W. Zhou, The new face of anaphylatoxins in immune regulation. (2012)

Immunobiology 217: 225-234.

[117] P.J. Haas, J. van Strijp, Anaphylatoxins: their role in bacterial infection and

inflammation. (2007) Immunol Res 37: 161-175.

[118] A. Klos, A.J. Tenner, K.O. Johswich, R.R. Ager, E.S. Reis, J. Kohl, The role of

the anaphylatoxins in health and disease. (2009) Mol Immunol 46: 2753-2766.

[119] K.E. Foreman, A.A. Vaporciyan, B.K. Bonish, M.L. Jones, K.J. Johnson, M.M.

Glovsky, S.M. Eddy, P.A. Ward, C5a-induced expression of P-selectin in

endothelial cells. (1994) J Clin Invest 94: 1147-1155.

[120] H. Lee, P.L. Whitfeld, C.R. Mackay, Receptors for complement C5a. The

importance of C5aR and the enigmatic role of C5L2. (2008) Immunol Cell Biol

86: 153-160.

[121] I.J. Laudes, J.C. Chu, S. Sikranth, M. Huber-Lang, R.F. Guo, N. Riedemann, J.V.

Sarma, A.H. Schmaier, P.A. Ward, Anti-c5a ameliorates coagulation/fibrinolytic

protein changes in a rat model of sepsis. (2002) Am J Pathol 160: 1867-1875.

[122] H.R. Tsai, L.M. Yang, W.J. Tsai, W.F. Chiou, Andrographolide acts through

inhibition of ERK1/2 and Akt phosphorylation to suppress chemotactic migration.

(2004) Eur J Pharmacol 498: 45-52.

[123] N.J. Chen, C. Mirtsos, D. Suh, Y.C. Lu, W.J. Lin, C. McKerlie, T. Lee, H.

Baribault, H. Tian, W.C. Yeh, C5L2 is critical for the biological activities of the

anaphylatoxins C5a and C3a. (2007) Nature 446: 203-207.

[124] H. Ait-Oufella, S. Taleb, Z. Mallat, A. Tedgui, Recent advances on the role of

cytokines in atherosclerosis. (2011) Arterioscler Thromb Vasc Biol 31: 969-979.

[125] A. Tedgui, Z. Mallat, Cytokines in atherosclerosis: pathogenic and regulatory

pathways. (2006) Physiol Rev 86: 515-581.

[126] N. Parameswaran, S. Patial, Tumor necrosis factor-alpha signaling in

macrophages. (2010) Crit Rev Eukaryot Gene Expr 20: 87-103.

169

[127] A.J. Gearing, P. Beckett, M. Christodoulou, M. Churchill, J. Clements, A.H.

Davidson, A.H. Drummond, W.A. Galloway, R. Gilbert, J.L. Gordon, et al.,

Processing of tumour necrosis factor-alpha precursor by metalloproteinases.

(1994) Nature 370: 555-557.

[128] C. Zhang, T.W. Hein, W. Wang, Y. Ren, R.D. Shipley, L. Kuo, Activation of

JNK and xanthine oxidase by TNF-alpha impairs nitric oxide-mediated dilation of

coronary arterioles. (2006) J Mol Cell Cardiol 40: 247-257.

[129] Y. Kamari, A. Shaish, S. Shemesh, E. Vax, I. Grosskopf, S. Dotan, M. White, E.

Voronov, C.A. Dinarello, R.N. Apte, D. Harats, Reduced atherosclerosis and

inflammatory cytokines in apolipoprotein-E-deficient mice lacking bone marrow-

derived interleukin-1alpha. (2011) Biochem Biophys Res Commun 405: 197-203.

[130] C.A. Dinarello, IL-1: discoveries, controversies and future directions. (2010) Eur

J Immunol 40: 599-606.

[131] C. Gabay, C. Lamacchia, G. Palmer, IL-1 pathways in inflammation and human

diseases. (2010) Nat Rev Rheumatol 6: 232-241.

[132] L.R. Leon, Invited review: cytokine regulation of fever: studies using gene

knockout mice. (2002) J Appl Physiol 92: 2648-2655.

[133] W.P. Arend, The balance between IL-1 and IL-1Ra in disease. (2002) Cytokine

Growth Factor Rev 13: 323-340.

[134] B.D. Freeman, T.G. Buchman, Interleukin-1 receptor antagonist as therapy for

inflammatory disorders. (2001) Expert Opin Biol Ther 1: 301-308.

[135] I. Aksentijevich, S.L. Masters, P.J. Ferguson, P. Dancey, J. Frenkel, A. van

Royen-Kerkhoff, R. Laxer, U. Tedgard, E.W. Cowen, T.H. Pham, M. Booty, J.D.

Estes, N.G. Sandler, N. Plass, D.L. Stone, M.L. Turner, S. Hill, J.A. Butman, R.

Schneider, P. Babyn, H.I. El-Shanti, E. Pope, K. Barron, X. Bing, A. Laurence, C.C.

Lee, D. Chapelle, G.I. Clarke, K. Ohson, M. Nicholson, M. Gadina, B. Yang, B.D.

Korman, P.K. Gregersen, P.M. van Hagen, A.E. Hak, M. Huizing, P. Rahman, D.C.

Douek, E.F. Remmers, D.L. Kastner, R. Goldbach-Mansky, An autoinflammatory

disease with deficiency of the interleukin-1-receptor antagonist. (2009) N Engl J

Med 360: 2426-2437.

[136] A.R. Brasier, The nuclear factor-kappaB-interleukin-6 signalling pathway

mediating vascular inflammation. (2010) Cardiovasc Res 86: 211-218.

[137] M. Madan, B. Bishayi, M. Hoge, S. Amar, Atheroprotective role of interleukin-6

in diet- and/or pathogen-associated atherosclerosis using an ApoE heterozygote

murine model. (2008) Atherosclerosis 197: 504-514.

[138] T. Tanaka, T. Kishimoto, Targeting interleukin-6: all the way to treat autoimmune

and inflammatory diseases. (2012) Int J Biol Sci 8: 1227-1236.

[139] C.A. Janeway, Jr., R. Medzhitov, Innate immune recognition. (2002) Annu Rev

Immunol 20: 197-216.

[140] P. Matzinger, The danger model: a renewed sense of self. (2002) Science 296:

301-305.

[141] K. Eder, N. Baffy, A. Falus, A.K. Fulop, The major inflammatory mediator

interleukin-6 and obesity. (2009) Inflamm Res 58: 727-736.

[142] D.M. Mosser, X. Zhang, Interleukin-10: new perspectives on an old cytokine.

(2008) Immunol Rev 226: 205-218.

[143] L.M. Williams, G. Ricchetti, U. Sarma, T. Smallie, B.M. Foxwell, Interleukin-10

suppression of myeloid cell activation--a continuing puzzle. (2004) Immunology

113: 281-292.

[144] J.K. Jenkins, M. Malyak, W.P. Arend, The effects of interleukin-10 on

interleukin-1 receptor antagonist and interleukin-1 beta production in human

monocytes and neutrophils. (1994) Lymphokine Cytokine Res 13: 47-54.

170

[145] J.B. Crawley, L.M. Williams, T. Mander, F.M. Brennan, B.M. Foxwell,

Interleukin-10 stimulation of phosphatidylinositol 3-kinase and p70 S6 kinase is

required for the proliferative but not the antiinflammatory effects of the cytokine.

(1996) J Biol Chem 271: 16357-16362.

[146] S.S. Iyer, G. Cheng, Role of interleukin 10 transcriptional regulation in

inflammation and autoimmune disease. (2012) Crit Rev Immunol 32: 23-63.

[147] P.R. Montellano, The mechanism of heme oxygenase. (2000) Curr Opin Chem

Biol 4: 221-227.

[148] A. Paine, B. Eiz-Vesper, R. Blasczyk, S. Immenschuh, Signaling to heme

oxygenase-1 and its anti-inflammatory therapeutic potential. (2010) Biochem

Pharmacol 80: 1895-1903.

[149] A. Grochot-Przeczek, J. Dulak, A. Jozkowicz, Haem oxygenase-1: non-canonical

roles in physiology and pathology. (2012) Clin Sci (Lond) 122: 93-103.

[150] R. Gozzelino, V. Jeney, M.P. Soares, Mechanisms of cell protection by heme

oxygenase-1. (2010) Annu Rev Pharmacol Toxicol 50: 323-354.

[151] C. Taille, A. Almolki, M. Benhamed, C. Zedda, J. Megret, P. Berger, G. Leseche,

E. Fadel, T. Yamaguchi, R. Marthan, M. Aubier, J. Boczkowski, Heme oxygenase

inhibits human airway smooth muscle proliferation via a bilirubin-dependent

modulation of ERK1/2 phosphorylation. (2003) J Biol Chem 278: 27160-27168.

[152] L. Malaguarnera, M.R. Pilastro, S. Quan, M.H. Ghattas, L. Yang, A.V.

Mezentsev, T. Kushida, N.G. Abraham, A. Kappas, Significance of heme

oxygenase in prolactin-mediated cell proliferation and angiogenesis in human

endothelial cells. (2002) Int J Mol Med 10: 433-440.

[153] G. Li Volti, L.F. Rodella, C. Di Giacomo, R. Rezzani, R. Bianchi, E. Borsani, D.

Gazzolo, R. Motterlini, Role of carbon monoxide and biliverdin in renal

ischemia/reperfusion injury. (2006) Nephron Exp Nephrol 104: e135-139.

[154] M.D. Maines, The heme oxygenase system: past, present, and future. (2004)

Antioxid Redox Signal 6: 797-801.

[155] S.W. Ryter, J. Alam, A.M. Choi, Heme oxygenase-1/carbon monoxide: from

basic science to therapeutic applications. (2006) Physiol Rev 86: 583-650.

[156] S. Koizumi, Human heme oxygenase-1 deficiency: a lesson on serendipity in the

discovery of the novel disease. (2007) Pediatr Int 49: 125-132.

[157] N. Radhakrishnan, S.P. Yadav, A. Sachdeva, P.K. Pruthi, S. Sawhney, T. Piplani,

T. Wada, A. Yachie, Human heme oxygenase-1 deficiency presenting with

hemolysis, nephritis, and asplenia. (2011) J Pediatr Hematol Oncol 33: 74-78.

[158] K.D. Poss, S. Tonegawa, Reduced stress defense in heme oxygenase 1-deficient

cells. (1997) Proc Natl Acad Sci U S A 94: 10925-10930.

[159] K.D. Poss, S. Tonegawa, Heme oxygenase 1 is required for mammalian iron

reutilization. (1997) Proc Natl Acad Sci U S A 94: 10919-10924.

[160] M.H. Kapturczak, C. Wasserfall, T. Brusko, M. Campbell-Thompson, T.M. Ellis,

M.A. Atkinson, A. Agarwal, Heme oxygenase-1 modulates early inflammatory

responses: evidence from the heme oxygenase-1-deficient mouse. (2004) Am J

Pathol 165: 1045-1053.

[161] M.P. Seldon, G. Silva, N. Pejanovic, R. Larsen, I.P. Gregoire, J. Filipe, J.

Anrather, M.P. Soares, Heme oxygenase-1 inhibits the expression of adhesion

molecules associated with endothelial cell activation via inhibition of NF-kappaB

RelA phosphorylation at serine 276. (2007) J Immunol 179: 7840-7851.

[162] K.A. Nath, G.M. Vercellotti, J.P. Grande, H. Miyoshi, C.V. Paya, J.C. Manivel,

J.J. Haggard, A.J. Croatt, W.D. Payne, J. Alam, Heme protein-induced chronic

renal inflammation: suppressive effect of induced heme oxygenase-1. (2001)

Kidney Int 59: 106-117.

171

[163] A. Yachie, Y. Niida, T. Wada, N. Igarashi, H. Kaneda, T. Toma, K. Ohta, Y.

Kasahara, S. Koizumi, Oxidative stress causes enhanced endothelial cell injury in

human heme oxygenase-1 deficiency. (1999) J Clin Invest 103: 129-135.

[164] Q. Gu, Q. Wu, M. Jin, Y. Xiao, J. Xu, C. Mao, F. Zhao, Y. Zhang, Y. Zhang,

Heme oxygenase-1 alleviates mouse hepatic failure through suppression of

adaptive immune responses. (2012) J Pharmacol Exp Ther 340: 2-10.

[165] K. Ishikawa, M. Navab, N. Leitinger, A.M. Fogelman, A.J. Lusis, Induction of

heme oxygenase-1 inhibits the monocyte transmigration induced by mildly

oxidized LDL. (1997) J Clin Invest 100: 1209-1216.

[166] K. Srisook, C. Kim, Y.N. Cha, Molecular mechanisms involved in enhancing

HO-1 expression: de-repression by heme and activation by Nrf2, the "one-two"

punch. (2005) Antioxid Redox Signal 7: 1674-1687.

[167] A.M. Choi, J. Alam, Heme oxygenase-1: function, regulation, and implication of

a novel stress-inducible protein in oxidant-induced lung injury. (1996) Am J

Respir Cell Mol Biol 15: 9-19.

[168] Y.C. Kim, Y. Yamaguchi, N. Kondo, H. Masutani, J. Yodoi, Thioredoxin-

dependent redox regulation of the antioxidant responsive element (ARE) in

electrophile response. (2003) Oncogene 22: 1860-1865.

[169] A.S. Pachori, A. Smith, P. McDonald, L. Zhang, V.J. Dzau, L.G. Melo, Heme-

oxygenase-1-induced protection against hypoxia/reoxygenation is dependent on

biliverdin reductase and its interaction with PI3K/Akt pathway. (2007) J Mol Cell

Cardiol 43: 580-592.

[170] L. Rochette, Y. Cottin, M. Zeller, C. Vergely, Carbon monoxide: mechanisms of

action and potential clinical implications. (2013) Pharmacol Ther 137: 133-152.

[171] M. Hayashi, T. Takahashi, H. Morimatsu, H. Fujii, N. Taga, S. Mizobuchi, M.

Matsumi, H. Katayama, M. Yokoyama, M. Taniguchi, K. Morita, Increased

carbon monoxide concentration in exhaled air after surgery and anesthesia. (2004)

Anesth Analg 99: 444-448, table of contents.

[172] L.E. Otterbein, M.P. Soares, K. Yamashita, F.H. Bach, Heme oxygenase-1:

unleashing the protective properties of heme. (2003) Trends Immunol 24: 449-

455.

[173] H. Morimatsu, T. Takahashi, K. Maeshima, K. Inoue, T. Kawakami, H. Shimizu,

M. Takeuchi, M. Yokoyama, H. Katayama, K. Morita, Increased heme catabolism

in critically ill patients: correlation among exhaled carbon monoxide, arterial

carboxyhemoglobin, and serum bilirubin IXalpha concentrations. (2006) Am J

Physiol Lung Cell Mol Physiol 290: L114-119.

[174] M.J. Dorresteijn, P. Pickkers, Carboxyhemoglobin levels during human

inflammation. (2012) Crit Care 16: 24.

[175] H. Morimatsu, T. Takahashi, T. Matsusaki, M. Hayashi, J. Matsumi, H. Shimizu,

M. Matsumi, K. Morita, An increase in exhaled CO concentration in systemic

inflammation/sepsis. (2010) J Breath Res 4: 047103.

[176] A. Nakao, J.S. Neto, S. Kanno, D.B. Stolz, K. Kimizuka, F. Liu, F.H. Bach, T.R.

Billiar, A.M. Choi, L.E. Otterbein, N. Murase, Protection against

ischemia/reperfusion injury in cardiac and renal transplantation with carbon

monoxide, biliverdin and both. (2005) Am J Transplant 5: 282-291.

[177] Y. Akamatsu, M. Haga, S. Tyagi, K. Yamashita, A.V. Graca-Souza, R. Ollinger,

E. Czismadia, G.A. May, E. Ifedigbo, L.E. Otterbein, F.H. Bach, M.P. Soares,

Heme oxygenase-1-derived carbon monoxide protects hearts from transplant

associated ischemia reperfusion injury. (2004) FASEB J 18: 771-772.

[178] B. Wegiel, D. Gallo, E. Csizmadia, C. Harris, J. Belcher, G.M. Vercellotti, N.

Penacho, P. Seth, V. Sukhatme, A. Ahmed, P.P. Pandolfi, L. Helczynski, A.

172

Bjartell, J.L. Persson, L.E. Otterbein, Carbon monoxide expedites metabolic

exhaustion to inhibit tumor growth. (2013) Cancer Res 73: 7009-7021.

[179] J.K. Sarady, S.L. Otterbein, F. Liu, L.E. Otterbein, A.M. Choi, Carbon monoxide

modulates endotoxin-induced production of granulocyte macrophage colony-

stimulating factor in macrophages. (2002) Am J Respir Cell Mol Biol 27: 739-745.

[180] H.O. Pae, G.S. Oh, B.M. Choi, S.C. Chae, Y.M. Kim, K.R. Chung, H.T. Chung,

Carbon monoxide produced by heme oxygenase-1 suppresses T cell proliferation

via inhibition of IL-2 production. (2004) J Immunol 172: 4744-4751.

[181] S.W. Ryter, L.E. Otterbein, Carbon monoxide in biology and medicine. (2004)

Bioessays 26: 270-280.

[182] R.F. Coburn, L.B. Mayers, Myoglobin O2 tension determined from measurement

of carboxymyoglobin in skeletal muscle. (1971) Am J Physiol 220: 66-74.

[183] T.H. Stevenson, A.F. Gutierrez, W.K. Alderton, L. Lian, N.S. Scrutton, Kinetics

of CO binding to the haem domain of murine inducible nitric oxide synthase:

differential effects of haem domain ligands. (2001) Biochem J 358: 201-208.

[184] C.A. Piantadosi, Carbon monoxide, reactive oxygen signaling, and oxidative

stress. (2008) Free Radic Biol Med 45: 562-569.

[185] N. Christodoulides, W. Durante, M.H. Kroll, A.I. Schafer, Vascular smooth

muscle cell heme oxygenases generate guanylyl cyclase-stimulatory carbon

monoxide. (1995) Circulation 91: 2306-2309.

[186] H.L. Vieira, C.S. Queiroga, P.M. Alves, Pre-conditioning induced by carbon

monoxide provides neuronal protection against apoptosis. (2008) J Neurochem

107: 375-384.

[187] C.S. Queiroga, A.S. Almeida, C. Martel, C. Brenner, P.M. Alves, H.L. Vieira,

Glutathionylation of adenine nucleotide translocase induced by carbon monoxide

prevents mitochondrial membrane permeabilization and apoptosis. (2010) J Biol

Chem 285: 17077-17088.

[188] U. Dirnagl, A. Meisel, Endogenous neuroprotection: mitochondria as gateways to

cerebral preconditioning? (2008) Neuropharmacology 55: 334-344.

[189] C.A. Piantadosi, M.S. Carraway, H.B. Suliman, Carbon monoxide, oxidative

stress, and mitochondrial permeability pore transition. (2006) Free Radic Biol

Med 40: 1332-1339.

[190] C.S. Queiroga, A.S. Almeida, P.M. Alves, C. Brenner, H.L. Vieira, Carbon

monoxide prevents hepatic mitochondrial membrane permeabilization. (2011)

BMC Cell Biol 12: 10.

[191] A.C. Bulmer, J.T. Blanchfield, J.S. Coombes, I. Toth, In vitro permeability and

metabolic stability of bile pigments and the effects of hydrophilic and lipophilic

modification of biliverdin. (2008) Bioorg Med Chem 16: 3616-3625.

[192] A.C. Bulmer, J.T. Blanchfield, I. Toth, R.G. Fassett, J.S. Coombes, Improved

resistance to serum oxidation in Gilbert's syndrome: a mechanism for

cardiovascular protection. (2008) Atherosclerosis 199: 390-396.

[193] K.A. Kirkby, C.A. Adin, Products of heme oxygenase and their potential

therapeutic applications. (2006) Am J Physiol Renal Physiol 290: F563-571.

[194] J. Fevery, Bilirubin in clinical practice: a review. (2008) Liver Int 28: 592-605.

[195] S. Wang, J.R. Chowdhury, N.R. Chowdhury, Bilirubin metabolism: Applied

physiology. (2006) Current Paediatrics 16: 70-74.

[196] A.F. McDonagh, L.A. Palma, Preparation and properties of crystalline biliverdin

IX alpha. Simple methods for preparing isomerically homogeneous biliverdin and

[14C[biliverdin by using 2,3-dichloro-5,6-dicyanobenzoquinone. (1980) Biochem J

189: 193-208.

173

[197] S. Jangi, L. Otterbein, S. Robson, The molecular basis for the immunomodulatory

activities of unconjugated bilirubin. (2013) Int J Biochem Cell Biol 45: 2843-2851.

[198] A.C. Bulmer, J.S. Coombes, J.T. Blanchfield, I. Toth, R.G. Fassett, S.M. Taylor,

Bile pigment pharmacokinetics and absorption in the rat: therapeutic potential for

enteral administration. (2011) Br J Pharmacol 164: 1857-1870.

[199] Z. Zhu, A.T. Wilson, B.A. Luxon, K.E. Brown, M.M. Mathahs, S.

Bandyopadhyay, A.P. McCaffrey, W.N. Schmidt, Biliverdin inhibits hepatitis C

virus nonstructural 3/4A protease activity: mechanism for the antiviral effects of

heme oxygenase? (2010) Hepatology 52: 1897-1905.

[200] J. Kapitulnik, Bilirubin: an endogenous product of heme degradation with both

cytotoxic and cytoprotective properties. (2004) Mol Pharmacol 66: 773-779.

[201] S.W. Ryter, D. Morse, A.M. Choi, Carbon monoxide and bilirubin: potential

therapies for pulmonary/vascular injury and disease. (2007) Am J Respir Cell Mol

Biol 36: 175-182.

[202] R. Stocker, A.N. Glazer, B.N. Ames, Antioxidant activity of albumin-bound

bilirubin. (1987) Proc Natl Acad Sci U S A 84: 5918-5922.

[203] R. Ollinger, K. Yamashita, M. Bilban, A. Erat, P. Kogler, M. Thomas, E.

Csizmadia, A. Usheva, R. Margreiter, F.H. Bach, Bilirubin and biliverdin

treatment of atherosclerotic diseases. (2007) Cell Cycle 6: 39-43.

[204] R. Ollinger, M. Bilban, A. Erat, A. Froio, J. McDaid, S. Tyagi, E. Csizmadia,

A.V. Graca-Souza, A. Liloia, M.P. Soares, L.E. Otterbein, A. Usheva, K.

Yamashita, F.H. Bach, Bilirubin: a natural inhibitor of vascular smooth muscle

cell proliferation. (2005) Circulation 112: 1030-1039.

[205] M. Mishra, J.F. Ndisang, A critical and comprehensive insight on heme

oxygenase and related products including carbon monoxide, bilirubin, biliverdin

and ferritin in type-1 and type-2 diabetes. (2014) Curr Pharm Des 20: 1370-1391.

[206] L. Rodella, B.D. Lamon, R. Rezzani, B. Sangras, A.I. Goodman, J.R. Falck, N.G.

Abraham, Carbon monoxide and biliverdin prevent endothelial cell sloughing in

rats with type I diabetes. (2006) Free Radic Biol Med 40: 2198-2205.

[207] N. Ikeda, T. Inoguchi, N. Sonoda, M. Fujii, R. Takei, E. Hirata, H. Yokomizo, J.

Zheng, Y. Maeda, K. Kobayashi, R. Takayanagi, Biliverdin protects against the

deterioration of glucose tolerance in db/db mice. (2011) Diabetologia 54: 2183-

2191.

[208] A. Nakao, L.E. Otterbein, M. Overhaus, J.K. Sarady, A. Tsung, K. Kimizuka,

M.A. Nalesnik, T. Kaizu, T. Uchiyama, F. Liu, N. Murase, A.J. Bauer, F.H. Bach,

Biliverdin protects the functional integrity of a transplanted syngeneic small

bowel. (2004) Gastroenterology 127: 595-606.

[209] C. Fondevila, M. Katori, C. Lassman, I. Carmody, R.W. Busuttil, F.H. Bach, J.W.

Kupiec-Weglinski, Biliverdin protects rat livers from ischemia/reperfusion injury.

(2003) Transplant Proc 35: 1798-1799.

[210] C. Fondevila, X.D. Shen, S. Tsuchiyashi, K. Yamashita, E. Csizmadia, C.

Lassman, R.W. Busuttil, J.W. Kupiec-Weglinski, F.H. Bach, Biliverdin therapy

protects rat livers from ischemia and reperfusion injury. (2004) Hepatology 40:

1333-1341.

[211] L.M. Tang, Y.P. Wang, K. Wang, L.Y. Pu, F. Zhang, X.C. Li, L.B. Kong, B.C.

Sun, G.Q. Li, X.H. Wang, Exogenous biliverdin ameliorates ischemia-reperfusion

injury in small-for-size rat liver grafts. (2007) Transplant Proc 39: 1338-1344.

[212] K. Yamashita, J. McDaid, R. Ollinger, T.Y. Tsui, P.O. Berberat, A. Usheva, E.

Csizmadia, R.N. Smith, M.P. Soares, F.H. Bach, Biliverdin, a natural product of

heme catabolism, induces tolerance to cardiac allografts. (2004) Faseb Journal 18:

765-767.

174

[213] H. Kaur, M.N. Hughes, C.J. Green, P. Naughton, R. Foresti, R. Motterlini,

Interaction of bilirubin and biliverdin with reactive nitrogen species. (2003) Febs

Letters 543: 113-119.

[214] T. Jansen, M. Hortmann, M. Oelze, B. Opitz, S. Steven, R. Schell, M. Knorr, S.

Karbach, S. Schuhmacher, P. Wenzel, T. Munzel, A. Daiber, Conversion of

biliverdin to bilirubin by biliverdin reductase contributes to endothelial cell

protection by heme oxygenase-1-evidence for direct and indirect antioxidant

actions of bilirubin. (2010) J Mol Cell Cardiol 49: 186-195.

[215] C. Molzer, H. Huber, A. Steyrer, G. Ziesel, A. Ertl, A. Plavotic, M. Wallner, A.C.

Bulmer, K.H. Wagner, In vitro antioxidant capacity and antigenotoxic properties

of protoporphyrin and structurally related tetrapyrroles. (2012) Free Radic Res 46:

1369-1377.

[216] J. Wang, H.C. Zhou, P. Pan, N. Zhang, W.Z. Li, Exogenous biliverdin improves

the function of lung grafts from brain dead donors in rats. (2010) Transplant Proc

42: 1602-1609.

[217] J.K. Sarady-Andrews, F. Liu, D. Gallo, A. Nakao, M. Overhaus, R. Ollinger,

A.M. Choi, L.E. Otterbein, Biliverdin administration protects against endotoxin-

induced acute lung injury in rats. (2005) Am J Physiol Lung Cell Mol Physiol 289:

L1131-1137.

[218] M. Overhaus, B.A. Moore, J.E. Barbato, F.F. Behrendt, J.G. Doering, A.J. Bauer,

Biliverdin protects against polymicrobial sepsis by modulating inflammatory

mediators. (2006) Am J Physiol Gastrointest Liver Physiol 290: G695-703.

[219] J. Kosaka, H. Morimatsu, T. Takahashi, H. Shimizu, S. Kawanishi, E. Omori, Y.

Endo, N. Tamaki, M. Morita, K. Morita, Effects of biliverdin administration on

acute lung injury induced by hemorrhagic shock and resuscitation in rats. (2013)

PLoS One 8: e63606.

[220] P.E. Gibbs, M.D. Maines, Biliverdin inhibits activation of NF-kappaB: reversal of

inhibition by human biliverdin reductase. (2007) Int J Cancer 121: 2567-2574.

[221] L. Novotny, L. Vitek, Inverse relationship between serum bilirubin and

atherosclerosis in men: a meta-analysis of published studies. (2003) Exp Biol Med

(Maywood) 228: 568-571.

[222] J.P. Lin, C.J. O'Donnell, J.P. Schwaiger, L.A. Cupples, A. Lingenhel, S.C. Hunt,

S. Yang, F. Kronenberg, Association between the UGT1A1*28 allele, bilirubin

levels, and coronary heart disease in the Framingham Heart Study. (2006)

Circulation 114: 1476-1481.

[223] L. Vitek, The role of bilirubin in diabetes, metabolic syndrome, and

cardiovascular diseases. (2012) Front Pharmacol 3: 55.

[224] C.A. Adin, B.P. Croker, A. Agarwal, Protective effects of exogenous bilirubin on

ischemia-reperfusion injury in the isolated, perfused rat kidney. (2005) Am J

Physiol Renal Physiol 288: F778-784.

[225] J.E. Clark, R. Foresti, P. Sarathchandra, H. Kaur, C.J. Green, R. Motterlini, Heme

oxygenase-1-derived bilirubin ameliorates postischemic myocardial dysfunction.

(2000) Am J Physiol Heart Circ Physiol 278: H643-651.

[226] Y.Y. Fu, K.J. Kang, J.M. Ahn, H.R. Kim, K.Y. Na, D.W. Chae, S. Kim, H.J.

Chin, Hyperbilirubinemia reduces the streptozotocin-induced pancreatic damage

through attenuating the oxidative stress in the Gunn rat. (2010) Tohoku J Exp Med

222: 265-273.

[227] P. Cheriyath, V.S. Gorrepati, I. Peters, V. Nookala, M.E. Murphy, N. Srouji, D.

Fischman, High Total Bilirubin as a Protective Factor for Diabetes Mellitus: An

Analysis of NHANES Data From 1999 - 2006. (2010) J Clin Med Res 2: 201-206.

175

[228] H.J. Wang, S.S. Lee, C. Dell'Agnello, V. Tchipashvili, J. D'Avilla, E. Czismadia,

B.Y. Chin, F.H. Bach, Bilirubin can induce tolerance to islet allografts (vol 147,

pg 762, 2006). (2006) Endocrinology 147: 4842-4842.

[229] S. Lee, T. Yamada, T. Osako, D.B. Stolz, M. Abe, K.R. McCurry, N. Murase, J.

Kotani, A. Nakao, Recipient hyperbilirubinaemia protects cardiac graft in rat

heterotopic heart transplantation. (2013) Eur J Cardiothorac Surg.

[230] M.L. Tomaro, A.M. Batlle, Bilirubin: its role in cytoprotection against oxidative

stress. (2002) Int J Biochem Cell Biol 34: 216-220.

[231] R. Stocker, B.N. Ames, Potential role of conjugated bilirubin and copper in the

metabolism of lipid peroxides in bile. (1987) Proc Natl Acad Sci U S A 84: 8130-

8134.

[232] M. Minetti, C. Mallozzi, A.M. Di Stasi, D. Pietraforte, Bilirubin is an effective

antioxidant of peroxynitrite-mediated protein oxidation in human blood plasma.

(1998) Arch Biochem Biophys 352: 165-174.

[233] A.C. Boon, C.L. Hawkins, K. Bisht, J.S. Coombes, B. Bakrania, K.H. Wagner,

A.C. Bulmer, Reduced circulating oxidized LDL is associated with

hypocholesterolemia and enhanced thiol status in Gilbert syndrome. (2012) Free

Radic Biol Med 52: 2120-2127.

[234] P.A. Dennery, A.F. McDonagh, D.R. Spitz, P.A. Rodgers, D.K. Stevenson,

Hyperbilirubinemia results in reduced oxidative injury in neonatal Gunn rats

exposed to hyperoxia. (1995) Free Radic Biol Med 19: 395-404.

[235] S.S. Lee, W. Gao, S. Mazzola, M.N. Thomas, E. Csizmadia, L.E. Otterbein, F.H.

Bach, H. Wang, Heme oxygenase-1, carbon monoxide, and bilirubin induce

tolerance in recipients toward islet allografts by modulating T regulatory cells.

(2007) FASEB J 21: 3450-3457.

[236] A. Kadl, J. Pontiller, M. Exner, N. Leitinger, Single bolus injection of bilirubin

improves the clinical outcome in a mouse model of endotoxemia. (2007) Shock

28: 582-588.

[237] Y. Liu, P. Li, J. Lu, W. Xiong, J. Oger, W. Tetzlaff, M. Cynader, Bilirubin

possesses powerful immunomodulatory activity and suppresses experimental

autoimmune encephalomyelitis. (2008) J Immunol 181: 1887-1897.

[238] S. Lanone, S. Bloc, R. Foresti, A. Almolki, C. Taille, J. Callebert, M. Conti, D.

Goven, M. Aubier, B. Dureuil, J. El-Benna, R. Motterlini, J. Boczkowski,

Bilirubin decreases NOS2 expression via inhibition of NAD(P)H oxidase:

implications for protection against endotoxic shock in rats. (2005) Faseb Journal

19: 1890-+.

[239] B. Weinberger, F.E. Archer, S. Kathiravan, D.S. Hirsch, A.M. Kleinfeld, A.M.

Vetrano, T. Hegyi, Effects of bilirubin on neutrophil responses in newborn infants.

(2013) Neonatology 103: 105-111.

[240] I. Miler, P. Sima, V. Vetvicka, M. Indrova, M. Slavikova, The potential

immunosuppressive effect of bilirubin. (1988) Allerg Immunol (Leipz) 34: 177-

184.

[241] P. Sima, J. Mala, I. Miler, R. Hodr, E. Truxova, The suppressive effect of

continuous infusion of bilirubin on the immune response in mice. (1980) Folia

Microbiol (Praha) 25: 483-490.

[242] W.Z.W. Wang, D.L.H. Smith, S.D. Zucker, Bilirubin inhibits iNOS expression

and NO production in response to endotoxin in rats. (2004) Hepatology 40: 424-

433.

[243] G.L. Mazzone, I. Rigato, C. Tiribelli, Unconjugated bilirubin modulates nitric

oxide production via iNOS regulation. (2010) Biosci Trends 4: 244-248.

176

[244] H.L. Liu, C.H. Chen, M. Chen, Q. Wu, M.J. Li, [Effect of bilirubin on expression

of toll-like receptor 4 in cord blood monocytes]. (2011) Zhongguo Dang Dai Er

Ke Za Zhi 13: 153-156.

[245] C.L. Basiglio, S.M. Arriaga, F. Pelusa, A.M. Almara, J. Kapitulnik, A.D. Mottino,

Complement activation and disease: protective effects of hyperbilirubinaemia.

(2010) Clinical Science 118: 99-113.

[246] S. Arriaga, A. Almara, A. Mottino, In vivo anti-complement effect of bilirubin-

IXalpha. (2002) Biochem Pharmacol 64: 741-744.

[247] A.R. Kinderlerer, I. Pombo Gregoire, S.S. Hamdulay, F. Ali, R. Steinberg, G.

Silva, N. Ali, B. Wang, D.O. Haskard, M.P. Soares, J.C. Mason, Heme

oxygenase-1 expression enhances vascular endothelial resistance to complement-

mediated injury through induction of decay-accelerating factor: a role for

increased bilirubin and ferritin. (2009) Blood 113: 1598-1607.

[248] W.C. Song, Complement regulatory proteins and autoimmunity. (2006)

Autoimmunity 39: 403-410.

[249] W.H. Koppenol, The Haber-Weiss cycle--70 years later. (2001) Redox Rep 6:

229-234.

[250] R. Evstatiev, C. Gasche, Iron sensing and signalling. (2012) Gut 61: 933-952.

[251] P.O. Berberat, M. Katori, E. Kaczmarek, D. Anselmo, C. Lassman, B. Ke, X.

Shen, R.W. Busuttil, K. Yamashita, E. Csizmadia, S. Tyagi, L.E. Otterbein, S.

Brouard, E. Tobiasch, F.H. Bach, J.W. Kupiec-Weglinski, M.P. Soares, Heavy

chain ferritin acts as an antiapoptotic gene that protects livers from ischemia

reperfusion injury. (2003) FASEB J 17: 1724-1726.

[252] K.J. Hintze, E.C. Theil, Cellular regulation and molecular interactions of the

ferritins. (2006) Cell Mol Life Sci 63: 591-600.

[253] G. Balla, H.S. Jacob, J. Balla, M. Rosenberg, K. Nath, F. Apple, J.W. Eaton,

G.M. Vercellotti, Ferritin: a cytoprotective antioxidant strategem of endothelium.

(1992) J Biol Chem 267: 18148-18153.

[254] J.L. Taylor, M.S. Carraway, C.A. Piantadosi, Lung-specific induction of heme

oxygenase-1 and hyperoxic lung injury. (1998) Am J Physiol 274: L582-590.

[255] J. Kapitulnik, M.D. Maines, Pleiotropic functions of biliverdin reductase: cellular

signaling and generation of cytoprotective and cytotoxic bilirubin. (2009) Trends

Pharmacol Sci 30: 129-137.

[256] M.D. Maines, J.F. Ewing, T.J. Huang, N. Panahian, Nuclear localization of

biliverdin reductase in the rat kidney: response to nephrotoxins that induce heme

oxygenase-1. (2001) J Pharmacol Exp Ther 296: 1091-1097.

[257] D.P. Converso, C. Taille, M.C. Carreras, A. Jaitovich, J.J. Poderoso, J.

Boczkowski, HO-1 is located in liver mitochondria and modulates mitochondrial

heme content and metabolism. (2006) FASEB J 20: 1236-1238.

[258] M. Salim, B.A. Brown-Kipphut, M.D. Maines, Human biliverdin reductase is

autophosphorylated, and phosphorylation is required for bilirubin formation.

(2001) J Biol Chem 276: 10929-10934.

[259] C. Molzer, H. Huber, K. Diem, M. Wallner, A.C. Bulmer, K.H. Wagner,

Extracellular and intracellular anti-mutagenic effects of bile pigments in the

Salmonella typhimurium reverse mutation assay. (2013) Toxicol In Vitro 27: 433-

437.

[260] A. Kikuchi, S.Y. Park, H. Miyatake, D. Sun, M. Sato, T. Yoshida, Y. Shiro,

Crystal structure of rat biliverdin reductase. (2001) Nat Struct Biol 8: 221-225.

[261] U.M. Florczyk, A. Jozkowicz, J. Dulak, Biliverdin reductase: new features of an

old enzyme and its potential therapeutic significance. (2008) Pharmacol Rep 60: 38-

48.

177

[262] P.E. Gibbs, C. Tudor, M.D. Maines, Biliverdin reductase: more than a namesake -

the reductase, its Peptide fragments, and biliverdin regulate activity of the three

classes of protein kinase C. (2012) Front Pharmacol 3: 31.

[263] D.E. Baranano, M. Rao, C.D. Ferris, S.H. Snyder, Biliverdin reductase: a major

physiologic cytoprotectant. (2002) Proc Natl Acad Sci U S A 99: 16093-16098.

[264] T.W. Sedlak, S.H. Snyder, Bilirubin benefits: cellular protection by a biliverdin

reductase antioxidant cycle. (2004) Pediatrics 113: 1776-1782.

[265] A.F. McDonagh, The biliverdin-bilirubin antioxidant cycle of cellular protection:

Missing a wheel? (2010) Free Radic Biol Med 49: 814-820.

[266] Y. Liu, J. Liu, W. Tetzlaff, D.W. Paty, M.S. Cynader, Biliverdin reductase, a

major physiologic cytoprotectant, suppresses experimental autoimmune

encephalomyelitis. (2006) Free Radic Biol Med 40: 960-967.

[267] S. Song, S. Wang, J. Ma, L. Yao, H. Xing, L. Zhang, L. Liao, D. Zhu, Biliverdin

reductase/bilirubin mediates the anti-apoptotic effect of hypoxia in pulmonary

arterial smooth muscle cells through ERK1/2 pathway. (2013) Exp Cell Res 319:

1973-1987.

[268] Z. Ahmad, M. Salim, M.D. Maines, Human biliverdin reductase is a leucine

zipper-like DNA-binding protein and functions in transcriptional activation of

heme oxygenase-1 by oxidative stress. (2002) J Biol Chem 277: 9226-9232.

[269] P.J. Lee, S.L. Camhi, B.Y. Chin, J. Alam, A.M. Choi, AP-1 and STAT mediate

hyperoxia-induced gene transcription of heme oxygenase-1. (2000) Am J Physiol

Lung Cell Mol Physiol 279: L175-182.

[270] J. Sun, C. Steenbergen, E. Murphy, S-nitrosylation: NO-related redox signaling to

protect against oxidative stress. (2006) Antioxid Redox Signal 8: 1693-1705.

[271] T. Into, M. Inomata, M. Nakashima, K. Shibata, H. Hacker, K. Matsushita,

Regulation of MyD88-dependent signaling events by S nitrosylation retards toll-

like receptor signal transduction and initiation of acute-phase immune responses.

(2008) Mol Cell Biol 28: 1338-1347.

[272] P.E. Gibbs, T. Miralem, N. Lerner-Marmarosh, C. Tudor, M.D. Maines,

Formation of ternary complex of human biliverdin reductase-protein kinase

Cdelta-ERK2 protein is essential for ERK2-mediated activation of Elk1 protein,

nuclear factor-kappaB, and inducible nitric-oxidase synthase (iNOS). (2012) J

Biol Chem 287: 1066-1079.

[273] H. Fan, J.A. Cook, Molecular mechanisms of endotoxin tolerance. (2004) J

Endotoxin Res 10: 71-84.

[274] A. Fougerat, S. Gayral, N. Malet, F. Briand-Mesange, M. Breton-Douillon, M.

Laffargue, Phosphoinositide 3-kinases and their role in inflammation: potential

clinical targets in atherosclerosis? (2009) Clin Sci (Lond) 116: 791-804.

[275] R. Katso, K. Okkenhaug, K. Ahmadi, S. White, J. Timms, M.D. Waterfield,

Cellular function of phosphoinositide 3-kinases: implications for development,

homeostasis, and cancer. (2001) Annu Rev Cell Dev Biol 17: 615-675.

[276] C. Rommel, M. Camps, H. Ji, PI3K delta and PI3K gamma: partners in crime in

inflammation in rheumatoid arthritis and beyond? (2007) Nat Rev Immunol 7:

191-201.

[277] B. Vanhaesebroeck, S.J. Leevers, K. Ahmadi, J. Timms, R. Katso, P.C. Driscoll,

R. Woscholski, P.J. Parker, M.D. Waterfield, Synthesis and function of 3-

phosphorylated inositol lipids. (2001) Annu Rev Biochem 70: 535-602.

[278] D.A. Fruman, L.C. Cantley, Phosphoinositide 3-kinase in immunological systems.

(2002) Semin Immunol 14: 7-18.

178

[279] A. Arcaro, M.J. Zvelebil, C. Wallasch, A. Ullrich, M.D. Waterfield, J. Domin,

Class II phosphoinositide 3-kinases are downstream targets of activated

polypeptide growth factor receptors. (2000) Mol Cell Biol 20: 3817-3830.

[280] R.A. Brown, J. Domin, A. Arcaro, M.D. Waterfield, P.R. Shepherd, Insulin

activates the alpha isoform of class II phosphoinositide 3-kinase. (1999) J Biol

Chem 274: 14529-14532.

[281] P.V. Schu, K. Takegawa, M.J. Fry, J.H. Stack, M.D. Waterfield, S.D. Emr,

Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene essential for protein

sorting. (1993) Science 260: 88-91.

[282] A.E. Wurmser, J.D. Gary, S.D. Emr, Phosphoinositide 3-kinases and their FYVE

domain-containing effectors as regulators of vacuolar/lysosomal membrane

trafficking pathways. (1999) J Biol Chem 274: 9129-9132.

[283] P. Gunzl, K. Bauer, E. Hainzl, U. Matt, B. Dillinger, B. Mahr, S. Knapp, B.R.

Binder, G. Schabbauer, Anti-inflammatory properties of the PI3K pathway are

mediated by IL-10/DUSP regulation. (2010) J Leukoc Biol 88: 1259-1269.

[284] N. Molnarfi, L. Gruaz, J.M. Dayer, D. Burger, Opposite regulation of IL-1beta

and secreted IL-1 receptor antagonist production by phosphatidylinositide-3

kinases in human monocytes activated by lipopolysaccharides or contact with T

cells. (2007) J Immunol 178: 446-454.

[285] T. Fukao, S. Koyasu, PI3K and negative regulation of TLR signaling. (2003)

Trends Immunol 24: 358-363.

[286] T.T. Antoniv, L.B. Ivashkiv, Interleukin-10-induced gene expression and

suppressive function are selectively modulated by the PI3K-Akt-GSK3 pathway.

(2011) Immunology 132: 567-577.

[287] D.L. Williams, C. Li, T. Ha, T. Ozment-Skelton, J.H. Kalbfleisch, J. Preiszner, L.

Brooks, K. Breuel, J.B. Schweitzer, Modulation of the phosphoinositide 3-kinase

pathway alters innate resistance to polymicrobial sepsis. (2004) J Immunol 172:

449-456.

[288] E. Hirsch, V.L. Katanaev, C. Garlanda, O. Azzolino, L. Pirola, L. Silengo, S.

Sozzani, A. Mantovani, F. Altruda, M.P. Wymann, Central role for G protein-

coupled phosphoinositide 3-kinase gamma in inflammation. (2000) Science 287:

1049-1053.

[289] C. Ferrandi, V. Ardissone, P. Ferro, T. Ruckle, P. Zaratin, E. Ammannati, E.

Hauben, C. Rommel, R. Cirillo, Phosphoinositide 3-kinase gamma inhibition

plays a crucial role in early steps of inflammation by blocking neutrophil

recruitment. (2007) J Pharmacol Exp Ther 322: 923-930.

[290] T. Weichhart, G. Costantino, M. Poglitsch, M. Rosner, M. Zeyda, K.M.

Stuhlmeier, T. Kolbe, T.M. Stulnig, W.H. Horl, M. Hengstschlager, M. Muller,

M.D. Saemann, The TSC-mTOR signaling pathway regulates the innate

inflammatory response. (2008) Immunity 29: 565-577.

[291] N. Hay, N. Sonenberg, Upstream and downstream of mTOR. (2004) Genes Dev

18: 1926-1945.

[292] L.S. Steelman, W.H. Chappell, S.L. Abrams, R.C. Kempf, J. Long, P. Laidler, S.

Mijatovic, D. Maksimovic-Ivanic, F. Stivala, M.C. Mazzarino, M. Donia, P.

Fagone, G. Malaponte, F. Nicoletti, M. Libra, M. Milella, A. Tafuri, A. Bonati, J.

Basecke, L. Cocco, C. Evangelisti, A.M. Martelli, G. Montalto, M. Cervello, J.A.

McCubrey, Roles of the Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR pathways in

controlling growth and sensitivity to therapy-implications for cancer and aging.

(2011) Aging (Albany NY) 3: 192-222.

179

[293] O.H. Iwenofu, R.D. Lackman, A.P. Staddon, D.G. Goodwin, H.M. Haupt, J.S.

Brooks, Phospho-S6 ribosomal protein: a potential new predictive sarcoma marker

for targeted mTOR therapy. (2008) Mod Pathol 21: 231-237.

[294] M.M. Bertagnolli, L. Yang, S.H. Herrmann, R.L. Kirkman, Evidence that

rapamycin inhibits interleukin-12-induced proliferation of activated T

lymphocytes. (1994) Transplantation 58: 1091-1096.

[295] R.N. Saunders, M.S. Metcalfe, M.L. Nicholson, Rapamycin in transplantation: a

review of the evidence. (2001) Kidney Int 59: 3-16.

[296] D.S. Collier, R.Y. Calne, S.G. Pollard, P.J. Friend, S. Thiru, Rapamycin in

experimental renal allografts in primates. (1991) Transplant Proc 23: 2246-2247.

[297] I. Cinel, S.M. Opal, Molecular biology of inflammation and sepsis: a primer.

(2009) Crit Care Med 37: 291-304.

[298] M.W. Merx, C. Weber, Sepsis and the heart. (2007) Circulation 116: 793-802.

[299] G.S. Martin, D.M. Mannino, S. Eaton, M. Moss, The epidemiology of sepsis in

the United States from 1979 through 2000. (2003) N Engl J Med 348: 1546-1554.

[300] D. Annane, P. Aegerter, M.C. Jars-Guincestre, B. Guidet, Current epidemiology

of septic shock: the CUB-Rea Network. (2003) Am J Respir Crit Care Med 168:

165-172.

[301] C. Alberti, C. Brun-Buisson, H. Burchardi, C. Martin, S. Goodman, A. Artigas, A.

Sicignano, M. Palazzo, R. Moreno, R. Boulme, E. Lepage, R. Le Gall,

Epidemiology of sepsis and infection in ICU patients from an international

multicentre cohort study. (2002) Intensive Care Med 28: 108-121.

[302] R.S. Hotchkiss, I.E. Karl, The pathophysiology and treatment of sepsis. (2003) N

Engl J Med 348: 138-150.

[303] P.A. Ward, New approaches to the study of sepsis. (2012) EMBO Mol Med 4:

1234-1243.

[304] H. Tsujimoto, S. Ono, P.A. Efron, P.O. Scumpia, L.L. Moldawer, H. Mochizuki,

Role of Toll-like receptors in the development of sepsis. (2008) Shock 29: 315-321.

[305] H. Tsujimoto, S. Ono, T. Majima, N. Kawarabayashi, E. Takayama, M.

Kinoshita, S. Seki, H. Hiraide, L.L. Moldawer, H. Mochizuki, Neutrophil elastase,

MIP-2, and TLR-4 expression during human and experimental sepsis. (2005) Shock

23: 39-44.

[306] D.L. Williams, T. Ha, C. Li, J.H. Kalbfleisch, J. Schweitzer, W. Vogt, I.W.

Browder, Modulation of tissue Toll-like receptor 2 and 4 during the early phases

of polymicrobial sepsis correlates with mortality. (2003) Crit Care Med 31: 1808-

1818.

[307] G. Andonegui, C.S. Bonder, F. Green, S.C. Mullaly, L. Zbytnuik, E. Raharjo, P.

Kubes, Endothelium-derived Toll-like receptor-4 is the key molecule in LPS-

induced neutrophil sequestration into lungs. (2003) J Clin Invest 111: 1011-1020.

[308] X. Zhang, Y. Kimura, C. Fang, L. Zhou, G. Sfyroera, J.D. Lambris, R.A. Wetsel,

T. Miwa, W.C. Song, Regulation of Toll-like receptor-mediated inflammatory

response by complement in vivo. (2007) Blood 110: 228-236.

[309] N.C. Riedemann, R.F. Guo, P.A. Ward, A key role of C5a/C5aR activation for the

development of sepsis. (2003) J Leukoc Biol 74: 966-970.

[310] C. Yan, H. Gao, New insights for C5a and C5a receptors in sepsis. (2012) Front

Immunol 3: 368.

[311] P.A. Ward, The harmful role of c5a on innate immunity in sepsis. (2010) J Innate

Immun 2: 439-445.

[312] S.F. Liu, X. Ye, A.B. Malik, In vivo inhibition of nuclear factor-kappa B

activation prevents inducible nitric oxide synthase expression and systemic

hypotension in a rat model of septic shock. (1997) J Immunol 159: 3976-3983.

180

[313] T.S. Blackwell, T.R. Blackwell, E.P. Holden, B.W. Christman, J.W. Christman,

In vivo antioxidant treatment suppresses nuclear factor-kappa B activation and

neutrophilic lung inflammation. (1996) J Immunol 157: 1630-1637.

[314] M.D. Schwartz, E.E. Moore, F.A. Moore, R. Shenkar, P. Moine, J.B. Haenel, E.

Abraham, Nuclear factor-kappa B is activated in alveolar macrophages from

patients with acute respiratory distress syndrome. (1996) Crit Care Med 24: 1285-

1292.

[315] K.M. Sundar, M. Sires, Sepsis induced immunosuppression: Implications for

secondary infections and complications. (2013) Indian J Crit Care Med 17: 162-

169.

[316] R.S. Hotchkiss, G. Monneret, D. Payen, Immunosuppression in sepsis: a novel

understanding of the disorder and a new therapeutic approach. (2013) Lancet

Infect Dis 13: 260-268.

[317] P.A. Ward, Immunosuppression in sepsis. (2011) JAMA 306: 2618-2619.

[318] M.K. Brunialti, P.S. Martins, H. Barbosa de Carvalho, F.R. Machado, L.M.

Barbosa, R. Salomao, TLR2, TLR4, CD14, CD11B, and CD11C expressions on

monocytes surface and cytokine production in patients with sepsis, severe sepsis,

and septic shock. (2006) Shock 25: 351-357.

[319] J.S. Boomer, K. To, K.C. Chang, O. Takasu, D.F. Osborne, A.H. Walton, T.L.

Bricker, S.D. Jarman, 2nd, D. Kreisel, A.S. Krupnick, A. Srivastava, P.E.

Swanson, J.M. Green, R.S. Hotchkiss, Immunosuppression in patients who die of

sepsis and multiple organ failure. (2011) JAMA 306: 2594-2605.

[320] N.A. Hutchins, J. Unsinger, R.S. Hotchkiss, A. Ayala, The new normal:

immunomodulatory agents against sepsis immune suppression. (2014) Trends Mol

Med 20: 224-233.

[321] A. Vink, D.P. de Kleijn, G. Pasterkamp, Functional role for toll-like receptors in

atherosclerosis and arterial remodeling. (2004) Curr Opin Lipidol 15: 515-521.

[322] B. Holst, A.C. Raby, J.E. Hall, M.O. Labeta, Complement takes its Toll: an

inflammatory crosstalk between Toll-like receptors and the receptors for the

complement anaphylatoxin C5a. (2012) Anaesthesia 67: 60-64.

[323] J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, F.

Speleman, Accurate normalization of real-time quantitative RT-PCR data by

geometric averaging of multiple internal control genes. (2002) Genome Biol 3:

RESEARCH0034.

[324] M. Guha, N. Mackman, The phosphatidylinositol 3-kinase-Akt pathway limits

lipopolysaccharide activation of signaling pathways and expression of inflammatory

mediators in human monocytic cells. (2002) J Biol Chem 277: 32124-32132.

[325] M.C. Perianayagam, V.S. Balakrishnan, A.J. King, B.J. Pereira, B.L. Jaber, C5a

delays apoptosis of human neutrophils by a phosphatidylinositol 3-kinase-

signaling pathway. (2002) Kidney Int 61: 456-463.

[326] S.I. Gharbi, M.J. Zvelebil, S.J. Shuttleworth, T. Hancox, N. Saghir, J.F. Timms,

M.D. Waterfield, Exploring the specificity of the PI3K family inhibitor

LY294002. (2007) Biochem J 404: 15-21.

[327] V. Seow, J. Lim, A. Iyer, J.Y. Suen, J.K. Ariffin, D.M. Hohenhaus, M.J. Sweet,

D.P. Fairlie, Inflammatory responses induced by lipopolysaccharide are amplified

in primary human monocytes but suppressed in macrophages by complement

protein C5a. (2013) J Immunol 191: 4308-4316.

[328] T. Mijatovic, L. Houzet, P. Defrance, L. Droogmans, G. Huez, V. Kruys, Tumor

necrosis factor-alpha mRNA remains unstable and hypoadenylated upon stimulation

of macrophages by lipopolysaccharides. (2000) Eur J Biochem 267: 6004-6012.

181

[329] A.N. Shakhov, M.A. Collart, P. Vassalli, S.A. Nedospasov, C.V. Jongeneel,

Kappa B-type enhancers are involved in lipopolysaccharide-mediated transcriptional

activation of the tumor necrosis factor alpha gene in primary macrophages. (1990) J

Exp Med 171: 35-47.

[330] N.C. Riedemann, R.F. Guo, I.J. Laudes, K. Keller, V.J. Sarma, V. Padgaonkar,

F.S. Zetoune, P.A. Ward, C5a receptor and thymocyte apoptosis in sepsis. (2002)

FASEB J 16: 887-888.

[331] M.D. Maines, Potential application of biliverdin reductase and its fragments to

modulate insulin/IGF-1/MAPK/PI3-K signaling pathways in therapeutic settings.

(2010) Curr Drug Targets 11: 1586-1594.

[332] N.C. Riedemann, R.F. Guo, V.J. Sarma, I.J. Laudes, M. Huber-Lang, R.L.

Warner, E.A. Albrecht, C.L. Speyer, P.A. Ward, Expression and function of the

C5a receptor in rat alveolar epithelial cells. (2002) J Immunol 168: 1919-1925.

[333] I.J. Laudes, J.C. Chu, M. Huber-Lang, R.F. Guo, N.C. Riedemann, J.V. Sarma, F.

Mahdi, H.S. Murphy, C. Speyer, K.T. Lu, J.D. Lambris, F.S. Zetoune, P.A. Ward,

Expression and function of C5a receptor in mouse microvascular endothelial cells.

(2002) J Immunol 169: 5962-5970.

[334] J.R. Hunt, C.B. Martin, B.K. Martin, Transcriptional regulation of the murine C5a

receptor gene: NF-Y is required for basal and LPS induced expression in

macrophages and endothelial cells. (2005) Mol Immunol 42: 1405-1415.

[335] M.S. Bolger, D.S. Ross, H. Jiang, M.M. Frank, A.J. Ghio, D.A. Schwartz, J.R.

Wright, Complement levels and activity in the normal and LPS-injured lung.

(2007) Am J Physiol Lung Cell Mol Physiol 292: L748-759.

[336] G. Smedegard, L.X. Cui, T.E. Hugli, Endotoxin-induced shock in the rat. A role

for C5a. (1989) Am J Pathol 135: 489-497.

[337] R.D. Soltis, D. Hasz, M.J. Morris, I.D. Wilson, The effect of heat inactivation of

serum on aggregation of immunoglobulins. (1979) Immunology 36: 37-45.

[338] K. Bisht, B. Wegiel, J. Tampe, O. Neubauer, K.H. Wagner, L.E. Otterbein, A.C.

Bulmer, Biliverdin modulates the expression of C5aR in response to endotoxin in

part via mTOR signaling. (2014) Biochem Biophys Res Commun 449: 94-99.

[339] D. Tugal, X. Liao, M.K. Jain, Transcriptional control of macrophage polarization.

(2013) Arterioscler Thromb Vasc Biol 33: 1135-1144.

[340] P.J. Murray, T.A. Wynn, Protective and pathogenic functions of macrophage

subsets. (2011) Nat Rev Immunol 11: 723-737.

[341] F.Y. McWhorter, T. Wang, P. Nguyen, T. Chung, W.F. Liu, Modulation of

macrophage phenotype by cell shape. (2013) Proc Natl Acad Sci U S A 110:

17253-17258.

[342] M.J. Davis, T.M. Tsang, Y. Qiu, J.K. Dayrit, J.B. Freij, G.B. Huffnagle, M.A.

Olszewski, Macrophage M1/M2 polarization dynamically adapts to changes in

cytokine microenvironments in Cryptococcus neoformans infection. (2013) MBio

4: e00264-00213.

[343] R. Kuhn, F. Schwenk, M. Aguet, K. Rajewsky, Inducible gene targeting in mice.

(1995) Science 269: 1427-1429.

[344] I. Goren, N. Allmann, N. Yogev, C. Schurmann, A. Linke, M. Holdener, A.

Waisman, J. Pfeilschifter, S. Frank, A transgenic mouse model of inducible

macrophage depletion: effects of diphtheria toxin-driven lysozyme M-specific cell

lineage ablation on wound inflammatory, angiogenic, and contractive processes.

(2009) Am J Pathol 175: 132-147.

[345] A. Soruri, S. Kim, Z. Kiafard, J. Zwirner, Characterization of C5aR expression on

murine myeloid and lymphoid cells by the use of a novel monoclonal antibody.

(2003) Immunol Lett 88: 47-52.

182

[346] J. Godau, T. Heller, H. Hawlisch, M. Trappe, E. Howells, J. Best, J. Zwirner, J.S.

Verbeek, P.M. Hogarth, C. Gerard, N. Van Rooijen, A. Klos, J.E. Gessner, J.

Kohl, C5a initiates the inflammatory cascade in immune complex peritonitis.

(2004) J Immunol 173: 3437-3445.

[347] A. Jacob, B. Hack, E. Chiang, J.G. Garcia, R.J. Quigg, J.J. Alexander, C5a alters

blood-brain barrier integrity in experimental lupus. (2010) FASEB J 24: 1682-

1688.

[348] J.E. Wang, R. Solberg, C. Okkenhaug, P.F. Jorgensen, C.D. Krohn, A.O. Aasen,

Cytokine modulation in experimental endotoxemia: characterization of an ex vivo

whole blood model. (2000) Eur Surg Res 32: 65-73.

[349] M.J. Dorresteijn, A. Draisma, J.G. van der Hoeven, P. Pickkers,

Lipopolysaccharide-stimulated whole blood cytokine production does not predict

the inflammatory response in human endotoxemia. (2010) Innate Immun 16: 248-

253.

[350] M. Aziz, A. Jacob, W.L. Yang, A. Matsuda, P. Wang, Current trends in

inflammatory and immunomodulatory mediators in sepsis. (2013) J Leukoc Biol 93:

329-342.

[351] A.J. Marti-Carvajal, I. Sola, C. Gluud, D. Lathyris, A.F. Cardona, Human

recombinant protein C for severe sepsis and septic shock in adult and paediatric

patients. (2012) Cochrane Database Syst Rev 12: CD004388.

[352] C.J. Fisher, Jr., S.M. Opal, J.F. Dhainaut, S. Stephens, J.L. Zimmerman, P.

Nightingale, S.J. Harris, R.M. Schein, E.A. Panacek, J.L. Vincent, et al., Influence

of an anti-tumor necrosis factor monoclonal antibody on cytokine levels in

patients with sepsis. The CB0006 Sepsis Syndrome Study Group. (1993) Crit

Care Med 21: 318-327.

[353] F. Zeni, B. Freeman, C. Natanson, Anti-inflammatory therapies to treat sepsis and

septic shock: a reassessment. (1997) Crit Care Med 25: 1095-1100.

[354] J. Cohen, J. Carlet, INTERSEPT: an international, multicenter, placebo-controlled

trial of monoclonal antibody to human tumor necrosis factor-alpha in patients with

sepsis. International Sepsis Trial Study Group. (1996) Crit Care Med 24: 1431-

1440.

[355] A. National Health and Medical Research Council, A.a.N.Z.I.C.S.C.T. Group,

ADjunctive coRticosteroid trEatment iN criticAlly ilL Patients With Septic Shock.

(2012) ClinicalTrials.gov.identifier.

[356] A.C. Bulmer, H.J. Verkade, K.H. Wagner, Bilirubin and beyond: a review of lipid

status in Gilbert's syndrome and its relevance to cardiovascular disease protection.

(2013) Prog Lipid Res 52: 193-205.

[357] P. Myrianthefs, S. Karatzas, K. Venetsanou, E. Grouzi, P. Evagelopoulou, E.

Boutzouka, G. Fildissis, I. Spiliotopoulou, G. Baltopoulos, Seasonal variation in

whole blood cytokine production after LPS stimulation in normal individuals.

(2003) Cytokine 24: 286-292.

[358] H. Shiratsuch, M.D. Basson, Differential regulation of monocyte/macrophage

cytokine production by pressure. (2005) Am J Surg 190: 757-762.

[359] L. Rainen, U. Oelmueller, S. Jurgensen, R. Wyrich, C. Ballas, J. Schram, C.

Herdman, D. Bankaitis-Davis, N. Nicholls, D. Trollinger, V. Tryon, Stabilization

of mRNA expression in whole blood samples. (2002) Clin Chem 48: 1883-1890.

[360] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-

time quantitative PCR and the 2(-Delta Delta C(T)) Method. (2001) Methods 25:

402-408.

[361] M.G. Netea, J.P. Drenth, N. De Bont, A. Hijmans, M. Keuter, E. Dharmana, P.N.

Demacker, J.W. van der Meer, A semi-quantitative reverse transcriptase

183

polymerase chain reaction method for measurement of MRNA for TNF-alpha and

IL-1 beta in whole blood cultures: its application in typhoid fever and exentric

exercise. (1996) Cytokine 8: 739-744.

[362] D.G. Remick, Interleukin-8. (2005) Crit Care Med 33: S466-467.

[363] O. Neubauer, S. Sabapathy, K.J. Ashton, B. Desbrow, J.M. Peake, R. Lazarus, B.

Wessner, D. Cameron-Smith, K.H. Wagner, L.J. Haseler, A.C. Bulmer, Time

course-dependent changes in the transcriptome of human skeletal muscle during

recovery from endurance exercise: from inflammation to adaptive remodeling.

(2014) J Appl Physiol (1985) 116: 274-287.

[364] J. Seok, H.S. Warren, A.G. Cuenca, M.N. Mindrinos, H.V. Baker, W. Xu, D.R.

Richards, G.P. McDonald-Smith, H. Gao, L. Hennessy, C.C. Finnerty, C.M.

Lopez, S. Honari, E.E. Moore, J.P. Minei, J. Cuschieri, P.E. Bankey, J.L. Johnson,

J. Sperry, A.B. Nathens, T.R. Billiar, M.A. West, M.G. Jeschke, M.B. Klein, R.L.

Gamelli, N.S. Gibran, B.H. Brownstein, C. Miller-Graziano, S.E. Calvano, P.H.

Mason, J.P. Cobb, L.G. Rahme, S.F. Lowry, R.V. Maier, L.L. Moldawer, D.N.

Herndon, R.W. Davis, W. Xiao, R.G. Tompkins, Genomic responses in mouse

models poorly mimic human inflammatory diseases. (2013) Proc Natl Acad Sci U

S A 110: 3507-3512.

[365] C. Marie, C. Fitting, J. Muret, D. Payen, J.M. Cavaillon, Interleukin 8 production

in whole blood assays: Is interleukin 10 responsible for the downregulation

observed in sepsis? (2000) Cytokine 12: 55-61.

[366] A.M. Owyang, H. Issafras, J. Corbin, K. Ahluwalia, P. Larsen, E. Pongo, M.

Handa, A.H. Horwitz, M.K. Roell, M. Haak-Frendscho, L. Masat, XOMA 052, a

potent, high-affinity monoclonal antibody for the treatment of IL-1beta-mediated

diseases. (2011) MAbs 3: 49-60.

[367] C.A. Dinarello, Interleukin-1 in the pathogenesis and treatment of inflammatory

diseases. (2011) Blood 117: 3720-3732.

[368] L.E. DeForge, D.G. Remick, Kinetics of TNF, IL-6, and IL-8 gene expression in

LPS-stimulated human whole blood. (1991) Biochem Biophys Res Commun 174:

18-24.

[369] S. Rodriguez-Novoa, L. Martin-Carbonero, P. Barreiro, G. Gonzalez-Pardo, I.

Jimenez-Nacher, J. Gonzalez-Lahoz, V. Soriano, Genetic factors influencing

atazanavir plasma concentrations and the risk of severe hyperbilirubinemia. (2007)

AIDS 21: 41-46.

[370] P.A. Dennery, D.S. Seidman, D.K. Stevenson, Neonatal hyperbilirubinemia.

(2001) N Engl J Med 344: 581-590.

[371] J.F. Watchko, Neonatal hyperbilirubinemia--what are the risks? (2006) N Engl J

Med 354: 1947-1949.

[372] A. Fernandes, A.S. Falcao, R.F. Silva, A.C. Gordo, M.J. Gama, M.A. Brito, D.

Brites, Inflammatory signalling pathways involved in astroglial activation by

unconjugated bilirubin. (2006) J Neurochem 96: 1667-1679.

[373] E. Akin, B. Clower, R. Tibbs, J. Tang, J. Zhang, Bilirubin produces apoptosis in

cultured bovine brain endothelial cells. (2002) Brain Res 931: 168-175.

[374] J.M. Seubert, A.J. Darmon, A.O. El-Kadi, S.J. D'Souza, J.R. Bend, Apoptosis in

murine hepatoma hepa 1c1c7 wild-type, C12, and C4 cells mediated by bilirubin.

(2002) Mol Pharmacol 62: 257-264.

[375] D.S. Kim, S.W. Chae, H.R. Kim, H.J. Chae, CO and bilirubin inhibit

doxorubicin-induced cardiac cell death. (2009) Immunopharmacol Immunotoxicol

31: 64-70.

184

[376] K.W. Bock, C. Kohle, Contributions of the Ah receptor to bilirubin homeostasis

and its antioxidative and atheroprotective functions. (2010) Biol Chem 391: 645-

653.

[377] C.A. Beamer, D.M. Shepherd, Role of the aryl hydrocarbon receptor (AhR) in

lung inflammation. (2013) Semin Immunopathol 35: 693-704.

[378] P.S. Wong, C.F. Vogel, K. Kokosinski, F. Matsumura, Arylhydrocarbon receptor

activation in NCI-H441 cells and C57BL/6 mice: possible mechanisms for lung

dysfunction. (2010) Am J Respir Cell Mol Biol 42: 210-217.

[379] M. Kalkoff, R.T. Cursons, J.W. Sleigh, G.M. Jacobson, The use of real time

rtPCR to quantify inflammatory mediator expression in leukocytes from patients

with severe sepsis. (2004) Anaesth Intensive Care 32: 746-755.

[380] A.C. Raby, B. Holst, J. Davies, C. Colmont, Y. Laumonnier, B. Coles, S. Shah, J.

Hall, N. Topley, J. Kohl, B.P. Morgan, M.O. Labeta, TLR activation enhances

C5a-induced pro-inflammatory responses by negatively modulating the second

C5a receptor, C5L2. (2011) Eur J Immunol 41: 2741-2752.

[381] J. Evans, L.A. Salamonsen, Inflammation, leukocytes and menstruation. (2012)

Rev Endocr Metab Disord 13: 277-288.

[382] R.E. Goyette, N.S. Key, E.W. Ely, Hematologic changes in sepsis and their

therapeutic implications. (2004) Semin Respir Crit Care Med 25: 645-659.

[383] S.A. Rushworth, X.L. Chen, N. Mackman, R.M. Ogborne, M.A. O'Connell,

Lipopolysaccharide-induced heme oxygenase-1 expression in human monocytic

cells is mediated via Nrf2 and protein kinase C. (2005) J Immunol 175: 4408-

4415.

[384] N. Wijayanti, S. Huber, A. Samoylenko, T. Kietzmann, S. Immenschuh, Role of

NF-kappaB and p38 MAP kinase signaling pathways in the lipopolysaccharide-

dependent activation of heme oxygenase-1 gene expression. (2004) Antioxid

Redox Signal 6: 802-810.

[385] G.A. Ricchetti, L.M. Williams, B.M. Foxwell, Heme oxygenase 1 expression

induced by IL-10 requires STAT-3 and phosphoinositol-3 kinase and is inhibited

by lipopolysaccharide. (2004) J Leukoc Biol 76: 719-726.

[386] T. Miyazaki, Y. Kirino, M. Takeno, S. Samukawa, M. Hama, M. Tanaka, S.

Yamaji, A. Ueda, N. Tomita, H. Fujita, Y. Ishigatsubo, Expression of heme

oxygenase-1 in human leukemic cells and its regulation by transcriptional

repressor Bach1. (2010) Cancer Sci 101: 1409-1416.

[387] Y.M. Kim, H.O. Pae, J.E. Park, Y.C. Lee, J.M. Woo, N.H. Kim, Y.K. Choi, B.S.

Lee, S.R. Kim, H.T. Chung, Heme oxygenase in the regulation of vascular biology:

from molecular mechanisms to therapeutic opportunities. (2011) Antioxid Redox

Signal 14: 137-167.

[388] J.A. Moraes, P. Barcellos-de-Souza, G. Rodrigues, V. Nascimento-Silva, S.V.

Silva, J. Assreuy, M.A. Arruda, C. Barja-Fidalgo, Heme modulates smooth

muscle cell proliferation and migration via NADPH oxidase: a counter-regulatory

role for heme oxygenase system. (2012) Atherosclerosis 224: 394-400.

[389] M.J. Dorresteijn, T. Visser, L.A. Cox, M.P. Bouw, J. Pillay, A.H. Koenderman,

P.F. Strengers, L.P. Leenen, J.G. van der Hoeven, L. Koenderman, P. Pickkers,

C1-esterase inhibitor attenuates the inflammatory response during human

endotoxemia. (2010) Crit Care Med 38: 2139-2145.

[390] M. Furebring, L. Hakansson, P. Venge, J. Sjolin, Differential expression of the

C5a receptor and complement receptors 1 and 3 after LPS stimulation of

neutrophils and monocytes. (2004) Scand J Immunol 60: 494-499.

185

[391] M. Furebring, L.D. Hakansson, P. Venge, B. Nilsson, J. Sjolin, Expression of the

C5a receptor (CD88) on granulocytes and monocytes in patients with severe

sepsis. (2002) Crit Care 6: 363-370.

[392] H. Unnewehr, D. Rittirsch, J.V. Sarma, F. Zetoune, M.A. Flierl, M. Perl, S. Denk,

M. Weiss, M.E. Schneider, P.N. Monk, T. Neff, M. Mihlan, H. Barth, F. Gebhard,

P.A. Ward, M. Huber-Lang, Changes and regulation of the C5a receptor on

neutrophils during septic shock in humans. (2013) J Immunol 190: 4215-4225.

[393] T. Tschernig, Z. Kiafard, C. Dibbert, D. Neumann, J. Zwirner, Use of monoclonal

antibodies to assess expression of anaphylatoxin receptors in rat and murine

models of lung inflammation. (2007) Exp Toxicol Pathol 58: 419-425.

[394] H. Atamna, Heme, iron, and the mitochondrial decay of ageing. (2004) Ageing

Res Rev 3: 303-318.

[395] M. Greabu, R. Olinescu, F.A. Kummerow, D.O. Crocnan, The levels of bilirubin

may be related to an inflammatory condition in patients with coronary heart

disease. (2001) Acta Pol Pharm 58: 225-231.

anti-inflammatory and cell signalling effects of · kavita bisht,msc. anti-inflammatory and cell...

Documents