antigenic variation among foot-and-mouth disease virus type a field isolates of 1997–1999 from...

Short communication

Antigenic variation among foot-and-mouth disease

virus type A ®eld isolates of 1997±1999 from Iran

Otfried Marquardt*, Brigitte Freiberg

Bundesforschungsanstalt fuÈr Viruskrankheiten der Tiere, Paul-Ehrlich-Straûe 28,

D-72076 TuÈbingen, Germany

Received 3 December 1999; received in revised form 13 March 2000; accepted 14 March 2000

Abstract

The sequences of the antigenically relevant capsid proteins VP1-3 of 10 isolates obtained during

an epizootic of serotype A foot-and-mouth disease virus in Iran, and collected within two and a half

years, were found to be highly similar. However, each isolate differed by at least one amino acid

from all others. This prompted us to analyze the immunological reactivity of the isolates. To this

end, monoclonal antibodies (mAbs) against one isolate were generated and characterized with

regard to neutralizing activity and reactivity with trypsinized virus. These mAbs as well as others

raised against A22 virus were used for antigen pro®ling. This distinguished four antigenic

conditions among the isolates and 16 reactivities among the mAbs. These ®ndings, together with

the observed sequence differences indicated the location of several epitopes. Many mAbs

recognized the minor antigenic sites on VP2 and 3 and some the major site, the GH-loop of VP1.

One epitope was composed of residues of the capsid proteins VP1 and 2. # 2000 Elsevier Science

B.V. All rights reserved.

Keywords: FMDV type A Iran/1997±1999; Capsid protein sequences; Monoclonal antibody-pro®ling

The highly contagious foot-and-mouth disease (FMD) of cloven-hoofed animals is

caused by a picornavirus that exists as seven serotypes (A, C, O, Asia1 and SAT1-3).

FMD is dif®cult to control and still endemic in large parts of Africa and Asia where it

causes some 1000 outbreaks annually (Kitching, 1998). Continuing circulation of foot-

and-mouth disease virus (FMDV) in the ®eld coincided with the emergence of numerous

antigenic variants. Therefore, FMDV is de®ned as a quasispecies (for a review, see

Domingo et al., 1992).

Veterinary Microbiology 74 (2000) 377±386

* Corresponding author. Tel.: �49-7071-9670; fax: �49-7071-967-105.

E-mail address: [email protected] (O. Marquardt)

0378-1135/00/$ ± see front matter # 2000 Elsevier Science B.V. All rights reserved.

PII: S 0 3 7 8 - 1 1 3 5 ( 0 0 ) 0 0 1 9 4 - 2

The antigenic variation of FMDV is owing to spontaneous mutations, which occur

during replication of the single-stranded RNA genome of positive polarity (Domingo

et al., 1992). They allow some progeny virus to escape neutralizing antibodies induced

after infection (Krebs et al., 1993; Mateu et al., 1994). As observed with experimental

neutralization escape mutants, FMDV exhibits a major antigenic site composed of several

parts of capsid protein VP1, and some minor sites composed of parts of the capsid

proteins VP2 and 3 (for reviews, see Brown, 1995; Mateu, 1995). The GH-loop of VP1

and its C-terminus, both contributing to the major antigenic site and protruding from the

virus surface (Acharya et al., 1989; Logan et al., 1993), are removable by trypsin (Wild

et al., 1969; Strohmaier et al., 1982).

The experimental ®ndings should be compared with the situation in the ®eld, for

instance by analyzing to what extent different isolates of an epizootic vary in antigenicity.

A FMDV type A variant, distinct in antigenicity from currently used vaccine strains

(Kitching, 1998), was chosen for that purpose. It was ®rst observed in vaccinated cattle in

the North West of Iran early in 1996, and subsequently spread throughout the country,

causing serious morbidity and mortality in calves and lambs. In December 1997, the

variant was ®rst observed in Turkey, where it spread to nine provinces since then.

Moreover, the variant was transmitted to Caucasian countries (Garland, 1998) and

retransmitted in 1999.

Ten isolates of this FMDV type A variant, collected between 12 January and 28

February 1997, in January and December 1998, and in May 1999 all over Iran, were

available from the WHO FMD reference center at Pirbright, United Kingdom. They were

received as supernatants of lysed primary calf thyroid (BTY) cells, mixed with equal

volumes of glycerol. Some isolates were passaged on baby hamster kidney (BHK) cells

as previously described (Marquardt and Adam, 1988).

The capsid protein genes were sequenced by use of a VP4-speci®c sense primer

(CAGTACCAGAAACTTCCATGGAC) and 2AB- (GAAGGGCCCAGGGTTGGACTC)

and VP1-speci®c (CGTGGCAGCACGCAGGAGAGC) antisense primers. Experimental

details of the extraction of RNA from cell culture supernatants, performance of RT±PCR,

product puri®cation, ¯uorescent dye deoxy-terminator cycle sequencing (Smith et al.,

1986; Reeve and Fuller, 1995) have been described previously (Marquardt and Adam,

1990; Freiberg et al., 1999; Marquardt et al., 2000).

The observed nucleotide sequence differences are summarized in Table 1. All Iranian

isolates were found to be closely related, because the sequence differences to the isolate

1/97 were 1±3% for most of the capsid protein genes. Most of the mutations were silent.

Isolate 3/97 exhibited ca. 10% sequence difference in the genes for VP4 and VP2. This

was, however, frequently owing to ambiguous signals, with one nucleotide being the

same as with other isolates. Such a sequence ambiguity has to be expected for ®eld virus

which occurs as a quasispecies. Co-existence of mutants in ®eld samples has previously

been observed (Rowlands et al., 1983; Sobrino et al., 1986; Leister et al., 1993). To a

lesser extent, the other ®eld isolates caused also ambiguous sequence signals, which did

not disappear completely after serial passage. Occasionally, the ambiguity caused codon

changes, notably of codons 98 of VP2 and 149, 150 and 152 of VP3 of several isolates

(Fig. 1). Many isolates are therefore mixtures of antigenic isotypes. In summary, virus

isolated early in 1997, ca. 1 year after the ®rst detection, differed frequently by 1±1.5%

378 O. Marquardt, B. Freiberg / Veterinary Microbiology 74 (2000) 377±386

and once by 4.6% in sequence. Additional circulation for one, two and two and a half

years coincided with an increase in sequence difference to 2.6, 2.9 and 3.0%, respectively.

Isolates 1 and 2/97 came from the same holding and were possibly therefore most similar

in sequence.

The amino acid sequences of the antigenically relevant capsid proteins were aligned to

each other (Fig. 1) and to those of FMDVA22 Iraq/1964, variant Pirbright (Bolwell et al.,

1989). This variant did not differ with regard to VP1 from the variant TuÈbingen

(Marquardt and Haas, 1998) and both variants reacted similarly with a panel of mAbs

(Table 2). It is concluded that the variants Pirbright and TuÈbingen of FMDV A22 are

highly similar in the sequences of VP2 and 3. Consistent with 1 year of circulation in

Iran, the isolates of 1997 exhibited amino acid changes concerning the neutralization sites

1a±c on VP1, 2 on VP2, and the BC- and HI-loops of VP3 that were found involved in

neutralization epitopes of FMDV A10 (Thomas et al., 1988). Isolates 19/98 and 28/99,

which circulated two and two and a half further years, deviated the strongest from the

consensus sequence. Some substitutions are shared with the isolates 3 and 17/97, and nine

deviations with A22.

MAbs were raised against A Iran 2/97, second passage on BHK cells, as previously

described (Freiberg et al., 1999). Only hybridomas whose mAbs did not react with

FMDV A22 were expanded. As a consequence, the panel was expected not to contain

mAbs directed against the antigenic sites 1c, the bEaB-loop of VP2 and the G2H-loop of

VP3 (Fig. 1), where A22 and A Iran 2/97 are of same sequence. The mAbs were analyzed

for neutralizing activity in the plaque reduction assay as described previously (Krebs

et al., 1993). Non-neutralizing, ef®ciently and poorly neutralizing mAbs were

distinguished. The latter neutralized at high antibody titers only. It was further

Table 1

Nucleotide sequence differences among the FMDV type A samples from Iran

VP4 gene VP2 gene VP3 gene VP1 gene Total (%)

135 nta 654 nt 663 nt 639 nt 2091 nt

1/97:2/97 2 6 2 4 0.67

1/97:3/97 11 62 15 8 4.59

1/97:6/97 2 8 9 3 1.05

1/97:8/97 2 16 6 5 1.39

1/97:9/97 4 15 6 6 1.48

1/97:9/97 p 9 1 9 2b 4 0.84c

1/97:17/97 2 8 9 5 1.15

1/97:7/98 n.d. 10d 10e 16 2.61f

1/97:19/98 3 21 19 18 2.91

1/97:28/99 n.d. n.d. n.d. 20 3.13

1/97:A22 Pir 21 94 67 105 13.72

a nt, nucleotides; numbers, differences to isolate 1/97 observed in each gene.b 483 nt only of 9/97p 9 were determined.c 1911 nt can be compared.d 456 nt.e 283 nt only of 7/98 were determined.f 1378 nt can be compared.

O. Marquardt, B. Freiberg / Veterinary Microbiology 74 (2000) 377±386 379

Fig. 1. (A±C) The amino acid sequence of the capsid proteins VP1-3 of the FMDV isolate A Iran 1/97 is shown

in the top lane in the one letter code. Aligned to it are sequences of other Iranian isolates, either contained in

lysed primary calf tyroid cells (BTY) or in baby hamster kidney cell passages (p), and of the FMDVA22 variants

Pirbright (Bolwell et al., 1989) and TuÈbingen (Marquardt and Haas, 1998). Sequence deviations are indicated, in

case of an isotypic state by two letters at one position. Dots represent identical sequence, blanks unresolved

sequence. The structural elements (Acharya et al., 1989) are underlined in the bottom line, and the antigenic

sites 1±4 are marked. *, positions on VP2 and 3 found to be changed with type A neutralization escape mutants

(Thomas et al., 1988). The receptor binding site is given in italics. Trypsin cleavage sites on VP1 and 2 are

marked by dashes above the residues. Antigenic sites relevant in this study are shadowed.


determined whether the epitopes of the mAbs were sensitive or resistant to trypsin

(Table 2).

The virus isolates were subjected to pro®ling by the panels of mAbs raised against A

Iran 2/97 and A22 (Freiberg et al., 1999). The results of ELISA performed according to

Kitching et al. (1988) are presented as log10 of the dilution at which the antigen caused an

OD value of 0.5 (Table 2), because this correlates the reactivity of each mAb with each

Fig. 1. (Continued).


antigen. The isolates A Iran 1, 6, 8, 9 and 17/97 reacted like isolate 2/97 with all mAbs.

Different values indicate varying antigen concentrations. Amino acid differences at some

antigenic sites possibly distinguish the isolates in their antigenic properties, but this could

not be measured by the available mAbs. The isolates A Iran 3/97 and 19/98 as well as the

9th passage of the isolate 9/97, however, exhibited individual reaction patterns. Note that

Fig. 1. (Continued).


isolate 19/98 reacted with three mAbs only of the Iranian panel. The different reaction

patterns together with the reaction of the epitopes on trypsin-treatment and the

neutralizing potency of the mAbs distinguished 16 reactivities.

A correlation of the properties of the mAbs and their epitopes with the sequence

differences allows to suggest the location of several epitopes. The neutralizing mAb 10F3

of the Iranian panel binds to a trypsin-sensitive epitope present on all Iranian isolates, but

Table 2

Reactivity of type A FMDV isolates with monoclonal antibodies

Mab

raised

against

NTa TRb Type A FMDV antigens Suggested

epitope

locationIran Iran Iran Iran Iran Iran Iran Iran Iran 22 22

2/97c 8/97 17/97 6/97 1/97 9/97 3/97 9/97 p 19/98 TuÈb. Pir.

A Iran

10F3 � ÿ 2.40d 2.48 2.21 1.85 1.64 1.68 2.00 2.00 2.35 0e 0 1f GH

17D12 � ÿ 2.18 1.88 0.82 1.23 1.05 0.95 1.10 <0.1 1.35 0 0 1GH�2C

2E10 � � 1.94 1.99 1.41 1.10 0.91 0.84 0 0 0 0 0 2 or 3BC

2A10 (�) � 2.03 2.10 1.57 1.28 1.20 1.10 1.36 1.44 0 0 0

3G4 (�) � 2.24 2.33 1.57 1.58 1.42 1.41 1.54 1.23 0 0 0 n.d.g

6H10 (�) � 2.28 2.28 1.54 1.58 1.43 1.41 1.55 1.29 0 0 0

9H9 (�) � 2.22 2.24 1.30 1.59 1.46 1.40 1.57 0.79 0 0 0

10H2 (�) � 2.28 2.25 1.41 1.57 1.42 1.40 1.53 0.70 0 0 0 2CaA?

19B11 (�) � 2.40 2.36 1.53 1.75 1.55 1.55 1.60 0.89 0 0 0

5A4 (�) � 1.78 1.78 0.69 0.98 0.80 0.69 0.94 0 0 0 0 n.d.

9C2 ÿ � 2.29 2.29 1.98 1.61 1.45 1.41 1.25 0 1.60 0 0 n.d.

10A12 ÿ � 2.44 2.46 2.12 1.86 1.57 1.61 1.44 0.23 0 0 0 2CaA?

10C3 ÿ � 2.43 2.47 2.10 1.82 1.56 1.61 1.49 0.12 0 0 0

5G4 ÿ � 2.30 2.45 2.02 1.71 1.54 1.57 0 0.80 0 0 0

6D11 ÿ � 1.84 1.81 0.54 1.04 0.90 0.74 0 0 0 0 0 n.d.

7A9 ÿ � 2.14 2.17 1.79 1.42 1.24 1.25 0 <0.1 0 0 0

8G9 ÿ � 2.41 2.34 1.91 1.72 1.55 1.54 0 1.14 0 0 0

10G10 ÿ � 2.45 2.47 2.06 1.86 1.57 1.70 0 1.24 0 0 0 3HI

8B2 ÿ � 2.11 1.99 1.88 1.51 1.30 1.25 1.69 1.65 0 0 0 n.d.

A22 TuÈb.

2B1 � ÿ 0 0 0 0 0 0 0 0 0 2.99 2.73 1GH

14B9 � � 1.74 1.93 1.50 1.02 0.67 0.67 1.39 0 2.35 2.99 2.89 2EaB

9B4 ÿ ÿ 2.12 2.32 2.00 1.75 1.50 1.53 1.81 1.75 2.04 2.47 2.23 2N

18G11 ÿ � 2.34 2.55 2.04 2.07 1.80 1.84 2.11 2.26 2.50 2.82 2.62 n.d.

1B4 ÿ (�) 2.09 2.33 1.96 1.83 1.52 1.54 1.91 1.98 2.31 2.72 2.44 n.d.

a Neutralizing activity: �, yes; (�), yes, but only with highly concentrated mAb; ÿ no.b Trypsin-resistance: �, yes (slight reduction of OD after incubation of 4 mg virus for 15 min/378C with

400 mg trypsin); (�), yes, but not completely (considerable reduction of OD); ÿ, no (OD reduced to

background); bold, homologous reactions.c Immunization antigen.d Antigen dilution that results in an OD value of 0.5.e Values in italics denote no reactivity, poor reactivity.f Number and structural elements of capsid proteins.g No correlation done.


not on A22. This suggests its epitope to involve residues 143±149 of VP1, as only here all

residues removable by trypsin are identical. The neutralizing mAb 2B1 of the A22 panel

binds to a trypsin-sensitive epitope present on A22, but not on Iranian isolates. This

indicates the epitope also to reside at the GH-loop of VP1, as both viruses differ in

sequence at both sides of the receptor binding motif RGD (Fox et al., 1989). The third

neutralizing mAb that recognizes a trypsin-sensitive epitope, 17D12, reacted with all

Iranian isolates except isolate 9/97, 9th passage. As there is no change at the VP1 GH-

loop of this variant, the epitope for MAb 17D12 must include residues located elsewhere.

The experience gained with A22 (Bolwell et al., 1989) provides an explanation. Here, the

changed residues 82 and 88 on VP2 of a variant were found responsible for the

observation that mAbs did not bind to a trypsin-sensitive epitope. Both residues are

located at the surface of the virus with VP2 residue 82 lying adjacent to VP1 residue 135

(Acharya et al., 1989). Isolate 9/97, 9th passage, exhibits a change at position 79 on VP2.

Isolate 19/98 and A22 further de®ne the VP2-speci®c portion of the non-linear epitope.

19/98 is recognized by mAb 17D12, despite of substitutions at positions 77 and 86 on

VP2, whereas A22, exhibiting the same substitutions as 19/98 is not, because it differs in

the VP1 GH-loop portion of this epitope. Consistent with some distance of VP2 residue

79 to the crucial residue 82, binding of mAb 17D12 to isolate 9/97, 9th passage, was not

completely blocked.

The neutralizing mAb 2E10, the epitope of which is trypsin-resistant, did not bind to

the isolates 3/97, 9/97, 9th passage, 19/98 and A22. Neutralization sites where the

mentioned variants exhibit differences from the consensus sequence are the BC-loops of

VP2 and 3. Residence of the epitope remains unresolved. No mAb was directed against

the BB-knob, identi®ed as antigenic site 4 (for a review, see Mateu, 1995).

The neutralizing mAb 14B9 of the A22 panel bound to a trypsin-resistant epitope

present on all isolates except 9/97, 9th passage. It differs from all other isolates at position

131 on VP2. This exchange might account for the lack in binding to mAb 14B9, because

changes at positions 132 and 133 on VP2 were observed for neutralization escape mutants

of A10 (Thomas et al., 1988). Similar to the reaction pattern of mAb 14B9 is that of mAb

9C2 of the Iranian panel. However, the epitope of the latter is non-neutralizing and not present

on A22. It is, therefore, questionable whether the epitopes for both mAbs are related.

The non-neutralizing mAbs 8G9 and 10G10 bind to trypsin-resistant epitopes present

on all virus variants except 3/97, 19/98 and A22. This correlates with deviations from the

consensus sequence at the HI-loop of VP3, which is therefore suggested to be involved in

this epitope. The non-neutralizing mAb 9B4 of the A22 panel has previously been

described to bind to the N-terminus of VP2 (Freiberg et al., 1999).

In summary, the antigenic variation of FMDV type A in the course of an epizootic is

consistent with experimental ®ndings (Thomas et al., 1988; Baxt et al., 1989; Bolwell

et al., 1989; Parry et al., 1990). Within 2 years of circulation, amino acid substitutions

accumulated at the major and minor antigenic sites, which prevented most of the mAbs

raised against an earlier isolate of this epizootic from binding. While generating the

mAbs, the BC-loop of VP2 has apparently been an ef®cient antigenic site. Here reside

various epitopes for mAbs, by which virus can be neutralized ef®ciently, inef®ciently or

not at all, in dependence of whether or not trypsin-sensitive parts of the GH-loop of VP1

contribute to their formation.


References

Acharya, R., Fry, E., Stuart, D., Fox, G., Rowlands, D.J., Brown, F., 1989. The three-dimensional structure of

foot-and-mouth disease virus at 2.9. A resolution. Nature 337, 709±716.

Baxt, B., Vakharia, V., Moore, D.M., Franke, A.J., Morgan, D.O., 1989. Analysis of neutralizing antigenic sites

on the surface of type A12 foot-and-mouth disease virus. J. Virol. 63, 2143±2151.

Bolwell, C., Brown, A.L., Barnett, P.V., Campbell, R.O., Clarke, B.E., Parry, N-R., Ouldridge, E.J., Brown, F.,

Rowlands, D.J., 1989. Host cell selection of antigenic variants of foot-and-mouth disease virus. J. Gen. Virol.

70, 45±57.

Brown, F., 1995. Antibody recognition and neutralization of foot-and-mouth disease virus. Semin. Virol. 6,

243±248.

Domingo, E., Escarmis, C., MartõÂnez, M.A., MartõÂnez-Salas, E., Mateu, M.G., 1992. Foot-and-mouth disease

virus populations are quasispecies. Curr. Top. Micobiol. Immunol. 176, 33±47.

Freiberg, B., Rahman, M.M., Marquardt, O., 1999. Genetical and immunological analysis of recent Asian type A

and O foot-and-mouth disease virus isolates. Virus Genes 19, 167±182.

Fox, G., Parry, N.R., Barnett, P.V., McGinn, B., Rowlands, D., Brown, F., 1989. The cell attachment site on foot-

and-mouth disease virus includes the amino acid sequence RGD (arginine±glycine±aspartic acid). J. Gen.

Virol. 70, 625±637.

Garland, A.J.M., 1998. Report of the FAO mission to the Islamic Republic of Iran and the Republic of Turkey to

assess the control of foot-and-mouth disease. FAO, Rome.

Kitching, R.P., Rendle, R., Ferris, N.P., 1988. Rapid correlation between ®eld isolates and vaccine strains of

foot-and-mouth disease virus. Vaccine 6, 403±408.

Kitching, R.P., 1998. A recent history of foot-and-mouth disease virus. J. Comparative Pathol. 118, 89±108.

Krebs, O., Ahl, R., Straub, O.C., Marquardt, O., 1993. Amino acid changes outside the G±H loop of capsid

protein VP1 of type O foot-and-mouth disease virus confer resistance to neutralization by antipeptide G±H

serum. Vaccine 11, 359±362.

Leister, D., Adam, K-H., Marquardt, O., 1993. Co-replication of several isotypes of foot-and-mouth disease

virus. J. Gen. Virol. 74, 2753±2757.

Logan, D., Abu-Ghazaleh, R., Blakemore, W., Curry, S., Jackson, T., King, A., Lea, S., Lewis, R., Newman, J.,

Parry, N., Rowlands, D., Stuart, D., Fry, E., 1993. Structure of a major immunogenic site on foot-and-mouth

disease virus. Nature 362, 566±568.

Marquardt, O., Adam, K.-H., 1988. Sequences of capsid protein VP1 of two type A foot-and-mouth disease

viruses. Virus Genes 2, 283±291.

Marquardt, O., Adam, K.-H., 1990. Foot-and-mouth disease virus subtyping by sequencing VP1 genes. Vet.

Microbiol. 23, 175±183.

Marquardt, O., Haas, B., 1998. VP1-coding sequences of recent isolates of foot-and-mouth disease virus types

A, O and Asia1. Virus Genes 16, 185±193.

Marquardt, O., Rahman, M.M., Freiberg, B., 2000. Genetic and antigenic variance of foot-and-mouth disease

virus type Asia1. Arch. Virol. 145, 149±157.

Mateu, M.G., HernaÂndez, J., MartõÂnez, M.A., Feigelstock, D., Lea, S., Perez, S.S., Giralt, E., Stuart, D., Palma,

E.L., Domingo, E., 1994. Antigenic heterogeneity of a foot-and-mouth disease virus serotype in the ®eld is

mediated by very limited sequence variation at several antigenic sites. J. Virol. 68, 1407±1417.

Mateu, M.G., 1995. Antibody recognition of picornaviruses and escape from neutralization: a structural view.

Virus Res. 38, 1±24.

Parry, N., Fox, G., Rowlands, D., Brown, F., Fry, E., Acharya, R., Logan, D., Stuart, D., 1990. Structural and

serological evidence for a novel mechanism of antigenic variation in foot-and-mouth disease virus. Nature

347, 569±572.

Reeve, M.A., Fuller, C.W., 1995. A novel thermostable polymerase for DNA sequencing. Nature 376,

796±797.

Rowlands, D.J., Clarke, B.E., Carroll, A.R., Brown, F., Nicholson, B.H., Bittle, J.L., Houghten, R.A., Lerner,

R.A., 1983. Chemical basis of antigenic variation in foot-and-mouth disease virus. Nature 306, 694±697.

Smith, L.M., Sanders, J.Z., Kaiser, R.J., Hughes, P., Dodd, C., Connell, C.R., Heiner, C., Kent, S.B.H., Hood,

L.E., 1986. Fluorescence detection in automated DNA sequence analysis. Nature 321, 674±679.


Sobrino, F., Palma, E.L., Beck, E., DaÂvila, M., de la Torre, J.C., Negro, P., Villanueva, N., OrtõÂn, J., Domingo, E.,

1986. Fixation of mutants in the viral genome during an outbreak of foot-and-mouth disease: heterogeneity

and rate variation. Gene 50, 149±159.

Strohmaier, K., Franze, R., Adam, K.-H., 1982. Location and characterization of the antigenic portion of the

FMDV immunizing protein. J. Gen. Virol. 59, 295±306.

Thomas, A.A.M., Woortmeijer, R.J., Puijk, W., Barteling, S.J., 1988. Antigenic sites on foot-and-mouth disease

virus type A10. J. Virol. 62, 2782±2789.

Wild, T.F., Burroughs, J.N., Brown, F., 1969. Surface structure of foot-and-mouth disease virus. J. Gen. Virol. 4,

313±320.


antigenic variation among foot-and-mouth disease virus type a field isolates of 1997–1999 from...

Documents