“Standardisation of meningococcal

epidemiology – diagnostics”

SJ Gray,

Meningococcal Reference Unit (MRU),

(part of RSID),

Health Protection Agency,

Manchester Medical Microbiology Partnership

Manchester Royal Infirmary,

Manchester, UK.

SoGAT, NIBSC June 2008

Meningococcal Reference Unit (MRU)

(part of HPA RSID), Manchester

Free reference services (England & Wales)

••Confirm identity of case isolates (since 1984)Confirm identity of case isolates (since 1984)

serological phenotypic characterisation & sensitivities

serogroup & epidemiological markers

••NonNon--culture (PCRculture (PCR--based) confirmation of based) confirmation of meningococcal disease from clinical material (since meningococcal disease from clinical material (since 1996)1996)

serogroup determination: B, C, Y, W135 or A

Lab confirmed cases of Meningococcal

Disease (E & W) – epi-year

2006-07: PCR Total tested = 1313013130, positives = 9%

PCR only = 51% of all casesaverage 50 meningo PCR samples / day

can reach 100+ samples / day 20% of mol dept workload

Cultures 2006-07 = 1284 (563 cases) total

Neisseria meningitidis - characterisation

Serogroup(A,B,C,Y,W135,X,Z,29E)Polysaccharide capsule porA class 1 OMP

porBclass 2 or3 OMP

DNADNA

PCR detectionPCR detection::

ctrA, crgActrA, crgA

SerogroupSerogroup::

siaDsiaD (B, C, Y , (B, C, Y ,

W135)W135)

mynBmynB (A)(A)

Molecular Molecular

Epidemiology:Epidemiology:

MLSTMLST,,

porA,porA, fetAfetA

Sero-subtype

Serotype

VR1, VR2, VR3

eg.phenotype

B:NT:NT/P1.4/NT

MRU PCR-based assays for cultures and

non-culture material (direct clinical samples)

Detection assays: ABI TaqmanDetection assays: ABI Taqman™™

•ctrA detection of meningococcal DNA (capsulated organisms)

•siaD serogroup determination (sialylated capsules): B, C, Y or W135

•mynB serogroup A

Molecular Epidemiology Molecular Epidemiology –– DNA sequencing assaysDNA sequencing assays

•porA determination of sero-subtype (3 variable regions; VR1, VR2 & VR3)

•MLST (Multi-locus Sequence Typing) genetic relatedness between strains - clones

porA sequencing

Organism DNA

extract (heated)

porA PCR 1

Non-culture DNA extract

PCR positive

porA PCR 1

Nested PCR

porA PCR 2PCR sequencing

reactions

VR1 & VR2-(VR3)

DNA Sequence

VR1 & VR2-(VR3)

Compare translated AA sequences

to porA library via ww.neisseria.org

(http://www.mlst.net) to designate

VR1, VR2 & VR3

MLST (Multi-Locus Sequence Typing)

•sequence 7 loci ( within constituitve genes) to determine sequence type (ST)

By comparison with MLST database via www.neisseria.org (at http://www.mlst.net)

•If 4/7 loci agree between organisms may assign Clonal Complex

•Most European meningococcal disease described by 4 Clonal Complexes

•CC ST-11 has CFR 14% others around 5%

•Not under immune selective pressure like porA

MLST - considerations

The 7 loci – genes may require specific PCR

conditions for Non-culture material

Use of nested PCR assays for non-culture material

Clonal Complex designation provides

epidemiologically useful information even though

incomplete MLST results

A single base change in any of the 7 loci will

designate a new ST

EUIBIS EQA distributions 2005-2007

SJ Gray1, AJ Fox1, MA Regan1, LS Newbold1, N Patel2

and V James2.

1Meningococcal Reference Unit (MRU), Health Protection Agency (HPA), Manchester Royal Infirmary, Manchester, UK.

2External Quality Assurance Department (eQAD), UKNEQAS, Centre for Infections, Colindale, London, UK.

Design: Include all EU member and accession states

(eg. 3rd distribution, 2007: Austria, Belgium, Czech Republic, Denmark,

Estonia, England, Finland, France, Germany, Greece, Hungary, Iceland,

Ireland, Italy, Netherlands, Norway, Poland, Portugal, Scotland, Slovak

Republic, Slovenia, Spain and Sweden).

23 countries - Results returned from 21

Aim: Optimise and standardise European meningococcal

reference laboratory meningococcal strain

characterisation and detection to ensure accurate

surveillance Funded by

(European Invasive Bacterial Infections Surveillance Network)

EQA Aim and Design

•To assess phenotypic and genotypic characterisation (porA

sequence type and MLST) of culturescultures

•Use of simulated clinical non-culture samples to assess

DNA extraction, detection (PCR-based) and genotypic

characterisation (species DNA, serogroup, porA sequence

type and MLST)

•Utilising expert support of eQAD, CfI, UK

X3 EQA panels distributed in 2005, 2006 and 2007

Participants to receive their individual anonymous

reports compared to the consensus results

EQA Design continued

Culture and non-culture material

•Representative of the major disease causing lineages in

Europe

•Consideration of phenotypic and molecular

characteristics (porA sequence type and MLST)

A few unusual examples

Non-culture material was also selected to challenge

detection limits (sensitivity) of assays

All material was freeze-dried and distributed

internationally by eQAD

Preparation of simulated septicaemic

samples

MRU: Saline suspension of

N.meningitidis & estimated

viable count inin MSC*MSC*

Heat killed (100oC, 5

mins)

= Stock Suspension

Dilutions of Stock Suspension

in defibrinated horse blood

ABI Taqman to assess

dilutions for typical clinical

samples

Frozen Stock Suspension

transported to eQAD,CfI

eQAD: Specified dilutions

in horse blood, freeze

dried, safe international

distribution, documentation

Reconstituted on receipt,

tested to local abilities -

Results returned anonymouslyanonymously

to eQAD

Results reviewed by eQAD & MRUto produce individual lab result

compared to consensus

Individual labs assess own resultsIndividual labs assess own results

X3 EQA distributions - composition

EQA culture non-culture

panel (simulated septicaemia)

1st B (5), C (1), W135 (1), B (2), C (2), Neg (1)

Y (1), NG (1)

2nd A (1), B (1), Y (1) A (1), B (3)1, C (3)2, W135 (1),Neg (1), Str.pneumoniae (1)

3rd A (1), B (1), C (1), X (1) A (1)3, B (1)4, C (1)5, Neg (1)

Non-culture sensitivity design: 1, 2dilution series ( +++, ++ and + ), 3+++. 4+ and 5++

Example of culture consensus results

(2nd distribution)

No. phenotype1 porA MLST

VR1 VR2 VR3 ST CC

8318 A:21:P1.10 5-2 10 37-1 75 1

8319 C:2a:NT 5-12 10-8 36-2 11 11

8320 Y:14:P1.5 5-1 10-4 36-2 23 23

8321 C:2a:NT del3 del3 del3 11 11

8322 B:4:P1.3,6 18-1 3 38 41 41/44

1Phenotype dependent on reagent availability.

2stop codon in porA VR1. 3porA deletion

Culture EQA Results 1

Phenotypes: good agreement but lack of some reagents

locally. Clerical & notation issues.

Genotypes: PorA was successful where available: porA VR1

& VR2 assigned by 11/11, 6/6 and 15/15 over x3 distributions

(with fewer reporting VR3)

Two C isolates (2nd distribution) demonstrated the limitations

of phenotype characterisation but interesting porA. One had a

porA deletion problematic for some labs and one a point

mutation generating a stop codon (3-base TAG insertion) in

VR1.

•MLST: ST results were in good agreement for the cultures

with very few different to the consensus

•anomalies:

Labs able to compare their results with the consensus

The base changes could be due to technical, scientific or

clerical issues.

Culture EQA Results 2

Allelic profile

Consensus abcz adk aroE fumC gdh pdhC pgm

ST-275 CC ST-269 4 10 2 5 38 11 9

Non – consensus

ST-1881 CC ST-NA1 4 10 2 5 38 11 74

ST-352 CC ST-269 4 10 2 5 8 11 9

1NA = CC not assigned

An example of culture MLST anomalies –

comparison of consensus ST-275 to

ST-1881 and ST-352

ST-275 gdh 38 CGCGGCGAGTTTTATGACATTACCGGCG

ST-325 gdh 8 CGCGGCGAGTTTTACGACATTACCGGCG

gdh allele 38 and gdh allele 8 differ by 1 base change at nucleotide position 93

ST-275 pgm 9 GTAGTTACCAAAGAC

ST-1881 pgm 74 GTGGTTACCAAAGAC

pgm allele 9 and pgm allele 74 differ by 1 base change at nucleotide position 3

Consensus results of simulated

septicaemia samples (1st distribution)

No. concentration1 Genotype Lab

(orgs/mL) Group porA MLST Results2

VR1 VR2 VR3 ST

7863 4 x106 B 7 16 35 32 12/12

7864 0 Negative control - - - - 7/7

7865 2 x106 C 5-1 10-8 36-2 11 9/11

7866 9 x105 B 7-2 4 37 41 10/12

1estimated number of viable organisms / mL (MRU)

2Proportion of labs with serogroup consensus result

Consensus results for simulated

septicaemia samples (2nd distribution)

No. concentration1 Genotype Lab

(orgs/mL) Group porA MLST Results2

VR1 VR2 VR3 ST CC

83233 3 x105 C 5-1 10-4 36-2 50 11 16/18

83243 2 x104 C 5-1 10-4 36-2 50 11 14/18

83253 3 x103 C 5-1 10-4 36-2 50 11 12/17

8326 1 x106 W135 5 2 36-2 11 11 12/17

8327 1 x106 A 5-2 10 37-1 75 1 12/19

83284 1 x106 B 17 16-3 36 136 41/44 18/20

83294 1 x104 B 17 16-3 36 136 41/44 15/20

83304 3 x103 B 17 16-3 36 136 41/44 8/17

8331 3 x105 Negative N.meningitidis, POSITIVE Str. pneumoniae

8332 - Negative Control

1estimated number of viable organisms / mL (MRU).

2Proportion of labs with PCR-based serogroup consensus result.

38323, 8324 & 8325 were all dilutions of the same organism. 48328, 8329 & 8330 were all dilutions of the same organism.

Non-culture serogroup, MLST and

porA results

•The more dilute the sample the fewer the number of labs achieving the consensus

Suggest x103 organisms/mL may be the practical limit of PCR-based confirmation and characterisation

Inconsistency in reporting Negative results (assays attempted)

Assay availability (Y, W135 & A)

•Analysis and review of non-consensus sequencing results results

Lab30: Mis-priming in initial gdh loci

amplification resulted in “new” allele

designation – possible new ST?

Sample 8330, (x103 orgs/mL reported

as ?new gdh. Allele A>G at base 153.

Closest to allele 9 . No other alleles in

PubMLST database have A at this

position – evidence of mis-priming in

early PCR rounds

Sample 8329 gdh allele 9. Base G at

position 153

Samples 8329 & 8330 are the same

organism

Repeated sequencing of the products confirmed the same result. It was resolved post-EQA by repeating the initial amplification and re-sequencing the new products to obtain the consensus ST result.

Non-culture MLST 8768 (weak B) 3rd

distribution – only 2 lab reports

abcZ adk aroE fumC gdh pdhc pgm

ST 41 3 6 9 5 9 6 9

ST 2288 25 6 9 9 9 6 9

Nucleotide differences between abcZ-3 and abcZ-25

Identity: 99.08 % Differences: 4

nt 144: C → T nt 423: T → C

nt 429: T → C nt 432: C → T

Nucleotide differences between fumC-5 and fumC-9

Identity: 99.57 % Differences: 2

nt 9: G → A nt 441: A → G

6.78 x 103 distributed dilution

No consensus ST for 8768

But expected ST- 41

Non-culture porA 8768 - Weak

serogroup B (3rd distribution)

One lab reported different results to VR1 7-8 consensus

VR1 7-8 AQAANGGAGASGQVKVTKVTKVTKA

VR1 7-15 AQAANGGAGASGQVKVTKVTKV

6.78 x 103 distributed dilution

Conclusions 1

•x3 safe distributions of mixed culture and simulated

septicaemia (non-culture) material - with observed

improvement by the 3rd distribution

•Consensus reports allowed individual labs to review

Evidence of EQA for accreditation bodies

•Phenotypic characterisation: good - but limited access to

reagents, differences in notation and reporting were

observed

•PCR-based detection, confirmation and characterisation

was generally successful but some potential limitations

were observed

Improved surveillance - wider usage of serogroup A

assays

Reporting of clonal complexes is epidemiologically

useful (even if incomplete ST designation)

••Some evidence of detection and characterisation assay Some evidence of detection and characterisation assay

sensitivity limit (x10sensitivity limit (x1033 org/mL)org/mL)

••Evidence that gelEvidence that gel--based detection matched realbased detection matched real--time time

assays except for weak nonassays except for weak non--culture samplesculture samples

Conclusions 2

Feedback from participants: EU-IBIS meeting, Rome,

May 2007 (- used to design 3rd distribution October 2007)

•Too many samples?

•Expensive to carry out all assays – order of priority to

be given?

•Discussion of the validity of consensus results? What

if a lab is superior to the consensus?

•Possible scoring of EQA results for local quality

manager reports

More detailed analysis required of: PCR targets,

primers and DNA extraction methods

The Future

•Development of assay controls - DNA or organism

standards in collaboration with NIBSC?

For DNA extraction (protein matrix) & assay control

large freeze-dried batches (quantified?)

dilutions for sensitivity and EQA panels

applicable to surveillance targets

•Recent successful ECDC bid (co-ordinated by EMGM)

includes a further meningococcal EQA distribution and

training workshop