apoptosis loss and bcl-2 expression: key determinants of ... · ihc staining of deparaffinized...

Vol. 2, 1887-1894, November 1996 Clinical Cancer Research 1887

Apoptosis Loss and Bcl-2 Expression: Key Determinants of Lymph

Node Metastases in T, Breast Cancer’

Angels Sierra,2 Xavier Castellsagu#{233}, Silvia T#{243}rtola,

Agustmn Escobedo, Belen Lloveras,

Miguel A. Peinado, Abelardo Moreno, and

Angels Fabra

Departament Cancer i Metastasis, Institut de Recerca Oncol#{246}gica

[A. S.. S. T., M. A. P., A. F.], Servei d’Epidemiologia i Registre del

Cancer [X. Cl, and Servei d’Oncologia, Institut Catal#{224}d’Oncologia.

Hospital Duran i Reynals IA. El, and Servei d’Anatomia Patol#{244}gica

lB. L., A. M.], Ciutat Sanitaria i Universitaria de Bellvitge, Autoviade Castelldefels, km 2.7, 08907 L’Hospitalet de Llobregat, Barcelona,

Spain

ABSTRACT

The Bcl-2 proto-oncogene extends cell survival but does

not confer any proliferative advantage to cells that express

it. Thus, the loss of apoptosis may have a role in progression

allowing the acquisition of additional mutations. To deter-

mine whether apoptosis loss at diagnosis is associated with

the metastatic advantage of ductal breast carcinomas and to

examine the relationship between Bcl-2 expression, p53, and

tumor cell death status, we examined tumor samples from

116 patients diagnosed with T1 (2 cm or less) breast cancer

with (n = 49) or without (n 67) lymph node metastases.

Apoptosis loss in histological sections was considered when

< 1 % of tumor nuclei were stained with terminal de-

oxynucleotidyl transferase labeled with biotin. We studied

the expression of Bcl-2 and p53 by immunohistochemistry

and in 37 p53 mutations by single-strand conformational

polymorphism analysis and cycle sequencing. Multivariate

logistic regression modeling was used to estimate prevalence

odds ratios (pORs) for apoptosis loss and presence of lymph

node metastases. Patients with marked apoptosis loss in

their tumor cells were about 5 times more likely to present

lymph node metastases than those with no apoptosis loss in

their tumor cells (adjusted pOR, 4.7; 95% confidence inter-

val, 1.4-15.6; trend test, P 0.008). Bcl-2 expression was

strongly associated with both apoptosis loss (pOR, 6.9; trend

test, P < 0.0001) and presence of lymph node metastases

(pOR, 5.7; trend test, P 0.002). These associations were

more evident in histological grade I and II tumors than in

poorly differentiated histological grade III tumors and in

p53-negative tumors than in p53-positive tumors. This study

Received 3/5/96; revised 7/1/96; accepted 8/15/96.

, This study was supported by Grant FIS 94/1524 from the Ministerio de

Sanidad y Consumo Espa#{241}ol and Grant SAF 93/51 1 from Comision

Interministerial de Ciencia y Tecnologia.

2 To whom requests for reprints should be addressed, at DepartamentCancer i Metastasis, Institut de Recerca OncolOgica (I.R.O.), Hospital

Duran i Reynals, Ciutat Sanitaria i Universitaria de Bellvitge, Autoviade Castelldefels, km 2.7, 08907 L’Hospitalet de Llobregat, Barcelona,

Spain. Phone: 34-3-263-00-43: Fax: 34-3-263-22-51.

demonstrates for the first time that the lymphatic progres-

sion of T1 human breast cancer is strongly related to apop-

tosis loss.

INTRODUCTION

The identification of genetic lesions that lead to the devel-

opment and progression of early breast cancer is critical to

understanding the biological heterogeneity of breast carcinomas

and to distinguishing a population of patients who may benefit

from more aggressive therapies when the risk of metastasis is

elevated.

We recently reported that overexpression of Bcl-2 in-

creased the risk of lymph node metastases, particularly in HG3

I and II tumors and progesterone-positive T, (2 cm or less)

breast carcinomas ( 1 ). We showed that the overexpression of

Bcl-2 correlated with a reduction of the number of apoptotic

cells, suggesting that Bcl-2 is important in early progression

because it extends the survival of cells, which may eventually

accumulate or acquire other genetic changes. Similar findings

have been reported recently in colorectal epithelia and neopla-

sia, in which altered activation and expression of Bcl-2 resulted

in attenuated apoptosis (2). Furthermore, progressive inhibition

of apoptosis has been associated with the transformation of

colorectal epithelia to carcinomas (3).

An inverse correlation has been observed between Bcl-2

and p53 expression in advanced breast cancer (4, 5), as well as

in colorectal adenomas. This suggests a potential down-regula-

tion of Bcl-2 by mutant p513 during tumorigenesis (6), because

p53 and Bcl-2 may participate in a common pathway for the

control of cell survival (7). Furthermore, experimental studies

using breast cancer cell lines have demonstrated that the p53

mutant protein can effectively control the expression of Bcl-2,

probably by suppressing Bcl-2 transcription (8).

Apoptosis is thought to complement mitosis in regulating

cell number. Inhibition of apoptosis by the deregulation of

certain oncogenes and tumor suppressor genes may be associ-

ated with enhanced proliferation as well as decreased cell death

(9). The extended cell life span conferred by Bcl-2 presumably

permits the accumulation of the additional events needed for

tumor progression (10). Indeed, mechanisms of apoptotic cell

death must be closely linked to the function of Bcl-2 and p53 in

the homeostatic regulation of cell populations, and deregulation

of apoptosis may be a relevant event in the natural history of

breast cancer. We were interested in studying in breast carcino-

mas how these gene products correlate with both apoptosis and

tumor progression. Thus, the aim of this study is to assess

3 The abbreviations used are: HG, histological grade; ER, estrogenreceptor: IHC, immunohistochemical: PCNA, proliferating cell nuclear

antigen: pOR, prevalence odds ratio: PR, progesterone receptor; CI,

confidence interval.

Research. on September 10, 2020. © 1996 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

http://clincancerres.aacrjournals.org/

1888 Apoptosis Loss in Ductal Breast Carcinoma

whether loss of apoptosis is associated with the presence of

lymph node metastases at diagnosis, and to investigate the

relationship between Bcl-2 expression, altered p53, and tumor

cell death status in patients with T, (�2 cm) breast tumors.

MATERIALS AND METHODS

Tissue Samples and Patients

We studied a series of 1 16 patients with T, (�2 cm)

invasive ductal breast carcinomas obtained from two pathology

departments (Ciutat Sanitaria i Universitaria de Bellvitge and

Hospital del Mar, Barcelona, Spain) between 1988 and 1993.

All of the tissue blocks routinely embedded in paraffin were cut

in serial sections of 5 �i.m in our laboratory. Sixty-seven patients

did not have lymph node involvement (T,N0), and 49 had lymph

node involvement (T,N,). The two groups did not differ signif-

icantly with regard to clinical factors such as menopausal status

or patient age. The groups had a similar HG and tumor size

distribution. Neither of the two groups received any form of

treatment before surgery.

In Situ Nick-End Labeling of Apoptotic Nuclei

Apoptosis was detected histologically in paraffin embed-

ded sections by in situ labeling of nuclear DNA fragmentation

as described by Gavrieli (1 1). Deparaffinized sections were

incubated with 20 p.g/ml of proteinase K (Sigma Chemical Co.,

St. Louis, MO) for 15 mm before immersion in 0.3 enzyme

units/�.al terminal deoxynucleotidyl transferase and terminal de-

oxynucleotidyl transferase buffer (Boehringer Mannheim,

Mannheim, Germany) with biotinylated CIUTP at 1 :25 for 60

mm at 37#{176}C.Nuclei were visualized with avidin-biotin-peroxi-

dase complex followed by diaminobenzidine staining.

The quantitative measurement of positive cells was evalu-

ated as described elsewhere (1).

The degree of apoptosis was scored in three categories:

>3%, 1-3%, and < 1% stained tumor nuclei. We considered

that tumors had apoptosis loss when less than 1 % of cell nuclei

were stained.

PS3, Bcl-2, PCNA, and Hormone Receptor Expression

Studies

IHC staining of deparaffinized sections was performed in

normal breast, in breast tumor, and in lymph node metastases

from each patient. Each case was analyzed independently by

two investigators, and the number of positive cells was meas-

ured in 20 fields of the tumor.

To determine Bcl-2 protein expression, the monoclonal

anti-Bcl-2 124 (Cambridge Research Biochemicals, Cheshire,

United Kingdom) was used at 1 :200 dilution. Tumors were

considered positive for Bcl-2 expression when more than 5% of

tumor cells showed cytoplasmic staining.

After microwave boiling in 10 mxi sodium citrate (pH 6.0),

the samples were incubated overnight with antihuman p53 an-

tibody diluted in PBS containing 2% BSA. We used two com-

mercially available antibodies: the monoclonal antibody to p53,

clone BP-53-12-l (Biogenex, San Ramon, CA), and monoclonal

antibody Ab-6, clone DO-l (Oncogene Science, Uniondale,

NY), which are known to have a very good performance (I 2-

15). Staining was revealed with biotin-streptavidin-peroxidase

conjugate (Link-Label kit, Biogenex). Specimens showing more

than 25% stained cell nuclei were considered positive for p53

overexpression. Cytoplasmic staining was not considered to

determine positivity.We also studied tumor proliferation and expression of

hormone receptors, detecting expression of PCNA (anti-PCNA,

Santa Cruz Biotechnology, Inc., Santa Cruz, CA), ERs (DAKO,

Copenhagen, Denmark), and PRs (Novocastra Laboratories,

Newcastle, United Kingdom). Tumors with less than 10% of the

cells with nuclear staining were considered negative for the

expression of hormone receptors or of low proliferation.

Bound antibody was visualized with biotinylated goat an-

timouse IgG (Vector Laboratories, Burlingame, CA). Vectastain

Elite detection kit (Vector) was used to amplify signal by

avidin-peroxidase, following visualization with diaminobenzi-

dine and counterstaining with methyl green or hematoxylin.

p53 Gene Mutation Detection

Amplification of the p53 Gene. A fragment of the p53

gene including exons 5-9 was amplified in a first step by PCR.

Fifty ng of genomic DNA were added to a tube containing 1 unit

of Taq polymerase (Boehringer Mannheim), 0.4 p.M of each

primer, 125 JiM of each dNTP, and PCR buffer (10 mrvt Tris-HC1

pH 7.8, 50 mM KC1, 1.5 mtvi MgC12, 0.01% gelatin) in a final

volume of 25 �il. The reaction was carried out for 25 cycles in

a thermal cycler (Mi Research) at 94#{176}Cfor 30 s, 63#{176}Cfor 30 s,

and 72#{176}Cfor 1 mm. Second nested PCRs were performed to

amplify two fragments including exons 5-6 and 7-8, which

comprise most of the point mutations detected in human tumors

(16). Second PCRs were performed with 0.1-0.5 p.1 of the first

reaction in the same conditions with the following differences:

the primers were 2 p.M each and the PCR consisted of 35 cycles

in the same conditions as the previous one.

The primers used were as follows. First PCR: 12979U,

GCTGCCGTG1TCCAGTTGCT; l4875D, AGGCATCACT-

GCCCCCTGAT. Exons 5-6: 1 3054U, TACTCCCCTGCCCT-

CAACAAG; 13463D, CTCCTCCCAGAGACCCCAGT. Exons

7-8: 13966U, CTGGCCTCATCTTGGGCCTG; 14587D,

CTCGCTFAGTGCTCCCTGGG.

Single-Strand Conformational Polymorphism Analysis.

For analysis of p53 mutations, we used the single-strand con-

formational polymorphism method (17). The nested PCRs were

carried out as described above in the presence of a radioactive

nucleotide ([a-32P]dCTP, 2 �i.Ci/PCR tube). Five p.1 of the

radioactive PCR product were digested with HpaII. Samples

were diluted 20-fold in formamide-dye loading buffer (18) and

incubated for 3 mm at 95#{176}C.Tubes were cooled on ice and 2 p.1

were loaded on a 6% polyacrylamide/l0% glycerol nondenatur-

ing sequencing gel. Electrophoresis was carried out at room

temperature at 30 W for 12 mm and 6 W for 14 h. The gels were

dried under vacuum at 85#{176}Cand exposed to a X-ray film at

room temperature without intensifier screen.

Cycle Sequencing of the p53 Gene. One-half p.1 of the

nested PCR product was used as a template for sequencing.

Reactions were performed using a commercial cycle sequencing

kit (Perkin-Elmer Cetus) and [a-33P}dATP. One of the primers

used for PCR was added (final concentration, 1 p.M) to the

reaction tube. The other reagents (included in the kit) were used

as suggested by the manufacturer. Sequencing reaction was



Clinical Cancer Research 1889

performed for 30 cycles under the same conditions as the

corresponding PCR amplification. The final product was diluted

3-fold in formamide-dye loading buffer. Samples were dena-

tured for 3 mm at 95#{176}C,and 2 p.1 of each were analyzed in a

denaturing 6% polyacrylamide/8 M urea sequencing gel for 2 or

5 h at 55 W. The gels were dried under vacuum at 85#{176}Cand

exposed to an X-ray film at room temperature without intensi-

fier screen.

The presence of the mutation was confirmed by sequencing

of the other DNA strand and, when possible, by digestion with

a restriction enzyme (when the mutation created or destroyed a

restriction site).

Statistical Analysis

To compare the distributions across groups of a given

variable, the uncorrected x2 test and, when appropriate, the

Fisher’s exact test were performed. Comparisons between pro-

portions as well as tests for linear trends were done by using the

STATCALC module of the Epi Info program (Centers for

Disease Control; Ref. 19).

To estimate the magnitude of the association of each din-

ical and immunohistochemical variable with apoptosis loss or

lymph node metastases, pORs were calculated using uncondi-

tional logistic regression (20). This measure of association es-

timates the excess odds for loss of apoptosis or metastases for

each category with regard to an arbitrary reference category of

a given variable. Values above 1 indicate an excess odds for

apoptosis loss or metastases, values close to 1 indicate no

association, and values below I indicate a reduction in the odds

for that category with regard to the reference category. pORs

estimated through logistic regression modeling have the advan-

tage of allowing for multivariate analyses in which the effects of

several variables can be taken into account simultaneously. Uni-

and multivariate analyses are therefore presented. All logistic

regression models were fitted by means of the maximum like-

lihood estimation of parameters (20) using the statistical pack-

age GLIM (21). For all analyses, an a value of 0.05 was

established to determine statistical significance and, accord-

ingly, 95% CIs around pORs are reported.

RESULTS

Apoptosis Loss, Bcl-2 Expression, and p53 Expression

in T1 Breast Tumors. Table 1 presents the distributions of

apoptosis loss, Bcl-2 expression, and p53 expression (p53-IHC)

according to selected clinical and pathological variables in our

series of I 16 T, breast cancer patients.

Apoptosis loss, as defined by the detection of less than I %

of stained cell nuclei, was observed more frequently in low-

grade tumors (HG I and II) than in poorly differentiated tumors

(HG III; trend test, P < 0.0001) and in estrogen-positive tumors

than in estrogen-negative tumors (x2test, P = 0.02).

Apoptosis loss and Bcl-2 expression were highly corre-

lated. The proportion of tumors with apoptosis loss increased

with increasing values of Bcl-2 expression in tumor cells (trend

test, P < 0.0001). In contrast, the proportion of tumors with

apoptosis loss was significantly larger in p53-negative tumors

than in p53-positive tumors, showing an inverse association

(40.3 versus 16.7%, respectively; P = 0.02).

As with apoptosis loss, Bcl-2 expression was associated

with the expression ofERs (P < 0.0001) and, inversely, with the

HG of the tumor (trend test, P = 0.02). Furthermore, Bcl-2 was

expressed more frequently in tumors expressing PRs (P = 0.02).

No significant associations were observed between Bcl-2 ex-

pression and age, hormonal status, or PCNA (Table 1).

p53 expression was strongly and linearly related to HG but

in the opposite direction of Bcl-2 and apoptosis loss. Thus, p53

was found to be expressed more frequently in HG III tumors

than in HG I and II tumors (trend test, P < 0.000]) and in

estrogen-negative tumors than in estrogen-positive tumors (P <

0.0001).

Immunohistochemical Correlates of Apoptosis Loss.

Table 2 summarizes the results of the uni- and multivariate

analyses for the relationship between apoptosis loss and expres-

sion of pS3, Bcl-2, hormone receptors, and HG. The crude

analysis showed that ERs, Bcl-2, and, inversely, HG and p53-

IHC were the main variables significantly associated with ap-

optosis loss. However, after correcting for the effects of HG and

Bcl-2, the magnitude of the associations found with p53 and

ERs was markedly reduced and no longer significant. In the

multivariate analysis, HG and Bcl-2 expression remained the

two variables most strongly and significantly associated with

apoptosis loss. Furthermore, these associations showed a strong

dose-response relationship but in opposite directions. Whereas

the likelihood of apoptosis loss decreased with increasing HG

(trend test, P = 0.0009), the likelihood of apoptosis loss in-

creased with increasing levels ofBcl-2 expression (P < 0.0001).

Of note are (a) the statistically significant 7-fold increased

likelihood of apoptosis loss for tumors with high Bcl-2 expres-

sion (>50% ofcells) as compared to Bcl-2-negative tumors; and

(b) the fact that even moderate levels of Bcl-2 expression

(between S and 50% of cells) were associated with a significant

4-fold increased likelihood of apoptosis loss.

Fig. 1A shows that the percentage of tumors with loss of

apoptosis was significantly larger in Bcl-2-positive tumors than

in Bcl-2-negative tumors (50.0 versus 14.9%, respectively: P <

0.0001), and in p53-negative tumors than in p53-positive tumors

(40.3 versus 16.7%, respectively; P 0.02). Fig. lB shows that

the association between Bcl-2 and apoptosis loss is only signif-

icant in p53-negative tumors (P = 0.004); in p53-positive tu-

mors, the association is markedly reduced and not statistically

significant (P 0.1).

Apoptosis Loss, Bcl-2, p53, and Likelihood of Lymph

Node Metastases. Table 3 summarizes estimated crude and

adjusted pORs for lymph node involvement in relation to degree

of apoptosis loss and expression of Bcl-2 and p53. The main

finding of these analyses was that both apoptosis loss and Bcl-2

expression were significantly and strongly associated with the

presence of lymph node metastases. Patients with tumors with

very little apoptotic activity (< I % of apoptotic cells) were

about S times as likely to present lymph node metastases as

patients with tumors with a clear apoptotic activity (>3% of

apoptotic cells). Similarly, patients with evident Bcl-2 expres-

sion (>50% of cells) were almost 6 times as likely to have their

lymph nodes affected as patients with tumors with virtually no

Bcl-2 expression. Furthermore, the magnitude of these associ-

ations showed a highly significant dose-response relationship.

Thus, the likelihood of presenting lymph node metastases in-



Table I Distribution of apoptosis loss, Bcl-2 expression, and p53 expression according to main clinicalpatients with 1, breast tumors

and pathological characteristics in

Apoptosis loss Bcl-2 p53-IHC

No. No. No.

Variable tested % positive tested % positive tested % positive

Numberofpatients n = Ill n = 116 ii = 110

P = 0.95

58.342.6I 2.5

P < 0.0001

P = 0.33

75.059.6

45.0

P - 0.02

P = 0.65

P = 0.02

8.320.850.0

P < 0.0001

Age

<50 30 36.7 30 43.3 29 31.0

51-60 27 25.9 29 69.0 27 25.9>60 39 41.0 42 64.3 40 22.5Unknown 15 15 14Trend test P = 0.65 P = 0.10 P = 0.43

Hormonal status

Premenopausal 40 35.0 40 52.5 39 28.2Postmenopausal 61 34.4 66 62.1 62 24.2Unknown 10 10 9

x2 testHistological Grade

I 24 24 24II 47 52 48III 40 40 38Trend test

ER

Negative (<10%) 19 10.5 19 10.5 19 68.4Positive (�lO%) 73 38.4 78 69.2 74 24.3Unknown 19 19 17,<2 test

PRNegative (<10%) 62 65 61Positive (�l0%) 42 44 43

Unknown 7 7 6

x2 testPCNA

Negative (< 10%) 58 36.2 60 63.3 56 28.6

Positive (�l0%) 48 35.4 48 54.2 47 27.7

Unknown 5 8 7

x2 test P = 0.93 P = 0.34 P = 0.92

Bcl-2

Negative (�5%) 47 14.9 48 35.4

6-50% 39 43.6 37 24.3>50% 25 60.0 25 20.0Trend test P < 0.0001 P = 0.17

p53-JHC

Negative (<25%) 77 40.3 79 60.8Positive (�25%) 30 16.7 31 45.2Unknown 4 6

x2 test P = 0.02 P = 0.14

33.9

35.7

P = 0.85

P < 0.000147.7

70.5

P = 0.02

P < 0.0001

29.530.2

P = 0.94


creased with increasing number of tumors cells showing apop-

tosis loss or Bcl-2 expression. Further stratified analyses by HG

showed that these associations were only observed in HG I and

II tumors (data not shown).

As shown in Table 3, patients with tumors showing both

apoptosis loss and Bcl-2 expression had an almost 8-fold increased

likelihood of presenting lymph node metastases. The magnitude of

this association was even larger among patients with HG I and II

tumors (adjusted pOR, 12.7; 95% CI, 2.6-62.4).

Table 4 further shows that the association between Bcl-2/

apoptosis loss and presence of lymph node metastases was

restricted and even larger in patients with p53-negative tumors.

The effect of Bcl-2 and apoptosis loss among patients with

p53-positive tumors was weak and not statistically significant.

HG and tumor size were not associated with the presence

of lymph node metastases (data not shown).

p53 Expression and Mutations in Breast Tumors. Nu-

clear p53 staining of primary tumors assessed by IHC staining

was present in 28.2% (31 of I 10) of the specimens. We could

study p53 mutations in 37 specimens (33.6%). The correlation

between p53 mutations and p53 expression by IHC staining was

indeed extremely high (x2 test, P = 0.00001).

All tumors having p53 mutations (n = 12) were correctly

classified by IHC staining. From 25 tumors with no p53 gene

mutation, 19 (76%) were correctly classified by IHC staining.

Most of the p53 mutations characterized in this study have

been previously described either in breast or other tumors. It is

noteworthy that in two cases we found a single base substitution

resulting in a stop signal at codon 192. This change should result

in a truncated protein. This prediction was confirmed by the fact

that in both cases, antibody PAb24O (which recognizes a region

comprising amino acid residues 156-214) failed to detect over-



Table 2 Crude and adjusted pORs for apoptosis loss (< 1% of tumor

cells) according to hormonal and IHC variables in patients with T,A

, 32/64

psO.02

31177

“ Adjusted by HG and Bcl-2 expression.

p53 +TOTAL �53

Bcl-2 +p53+ Bcl-2 -

Bcl-2 +PS3-

Bcl-2 -

0 10 20 30 40 50 60

% of tumors with apoptosis loss

Fig. I Percentage of tumors with apoptosis loss (< I % of dead cells)according to Bcl-2 expression (>6% of tumor cells stained) and p53

expression (>25% of tumor nuclei). A. percentages according to overallBcl-2 status and overall p53 status; B, percentages according to differentcombinations of p53 and Bcl-2 status.


breast tumors

Variables

Apoptosis loss, pOR (95% CI)

Crude Adjusted”

Histological Grade

I 1.00 (reference) 1.00 (reference)II 0.53 (0.20-1.43) 0.63 (0.22-1.82)

III 0.10 (0.03-0.35) 0.13 (0.04-0.47)Trend test P = 0.0001 P = 0.0009

ERNegative (< 10%) 1.00 (reference) 1.00 (reference)Positive (� 10%) 5.29 ( I .15-24.42) 1. 18 (0.20-7.1)

PRNegative (< 10%) 1 .00 (reference) 1 .00 (reference)

Positive (�l0%) 1.08 (0.48-2.47) 0.67 (0.25-1.76)Bcl-2

Negative (�5%) 1.00 (reference) I .00 (reference)6-50% 4.42 (1.59-12.27) 3.85(1.31-11.35)>50% 8.57 (2.76-26.63) 6.94 (2.12-22.68)

Trend test P < 0.0001 P < 0.0001p53-IHC

Negative (<25%) 1.00 (reference) 1.00 (reference)Positive (�25%) 0.30(0.10-0.86) 0.57 (0.17-1.91)

expression, whereas positivity was clearly demonstrated with

the other antibody (Ab-6), which binds to residues 37-45.

Another case presenting the same discordance between the two

antibodies had a mutation in codon 257. This change

(CTG-*CAG, Leu-Gln) might affect the protein conforma-

tion and render unavailable the PAb24O antibody epitope.

On the other hand, 3 of 37 cases showed microsatellite

instability when analyzed by PCR amplification of a CA repeat-

containing sequence (data not shown).

Proliferation of Breast Tumors and Apoptosis. PCNA

staining was not associated with apoptosis loss, Bcl-2, or p53

(Table 1). However, further analyses stratified by p53 tumor

status (Fig. 2) showed that in p53-positive tumors, PCNA stain-

ing was more frequently observed in Bcl-2-negative tumors than

in Bcl-2-positive tumors (62.5 versus 23.15, respectively; P

0.03). This inverse association, however, was not observed in

p53-negative tumors (P = 0.68). PCNA staining was markedly

expressed in poorly differentiated HG III tumors (61 .5%) as

compared to low-grade tumors (31.8% in HG I tumors and

36.2% in HG II tumors). This association was significant and

showed a dose-response relationship indicating that the percent-

age of tumors expressing PCNA increased with increasing de-

grees of undifferentiation (i.e., HG; trend test, P - 0.01). No

association was found between p53 and PCNA or between p53

and nodal involvement in either low-grade or high-grade tu-

mors.

DISCUSSION

This is, to our knowledge, the first study demonstrating in

a large, homogenous series of patients with T, breast tumors that

apoptosis loss is directly and strongly associated with the pres-

ence of lymph node metastases. Our study indicates that breast

cancer patients with tumors with both apoptosis loss and Bcl-2

TOTAL �

0 10 20 30 40 50 60

% oftumors with apopto�is loss

B

overexpression show large excess odds for lymph node metas-

tases (pOR, 7.6). This association is larger in HG I and II tumors

(pOR, 12.7) and in p53-negative tumors (pOR, 14.6). We also

show that the main variables associated with apoptosis loss are

Bcl-2 expression and, inversely, the HG of the tumor.

The associations reported here are large, statistically sig-

nificant, and independent of other variables and showed a clear

dose-response relationship. The statistical robustness of our

findings, coupled with the well-defined inclusion criteria that

restricted the analysis to patients with tumors no larger than 2

cm, rules out both an important role of selection bias and the

possibility that the observed associations might be due to chance

or to the masked effect of other parameters included in the study

(i.e. , age, menopausal status, HG, tumor size, and expression of

hormone receptors).

Our results are in agreement with previous reports showing

that Bcl-2 expression was particularly common in carcinomas

with HG I or II and strongly correlated with ER and PR

expression (4-5, 14, 22-24). Furthermore, our findings are not

in conflict with those reported by others showing an inverse

relationship between abnormal p53 protein expression and Bcl-2

protein expression, which in turn is associated with increased

cell proliferation and poor prognosis in breast cancer patients (4,




Table 3 Crude an d adjusted pORs for lymph node invo lvement according t o apoptosis loss, Bc 1-2, and p5 3 expression

Variable ,,

T,N,

% n

T,N(,

%

Crude

pOR

Adjusted”

pOR 95% CI

Apoptosis loss

>3% of apoptosis I I 22.4 22 35.5 1 .00 1 .00 Reference

1-3% of apoptosis 15 30.6 24 38.7 1.25 1.48 0.52-4.24

<1% of apoptosis 23 46.9 16 25.8 2.87 4.70 1.41-15.65

Unknown 0 5Trend test P = 0.03 P = 0.008

Bcl-2

Negative (�5%) 14 28.6 35 52.2 1.00 1.00 Reference6-50% 17 34.7 23 34.3 1.85 2.25 0.82-6.13

>50% 18 36.7 9 13.4 5.00 5.71 1.80-18.14

Trend test P = 0.001 P = 0.002p53-IHC

Negative (<25%) 35 71.4 44 65.7 1.00 1.00 ReferencePositive (�25%) I I 22.4 20 29.9 0.69 0.50 0.17-1.43Unknown 3 3

x2 test P = 0.40 P = 0.190Bcl-2 (apoptosis loss)

�5% (�l%) 13 26.5 27 43.5 1.00 1.00 Reference�5%(<l%)>5% (�l%)

1

13

2.0

26.5

6

19

9.7]

30.6 1 1.16 1.20 0.42-3.44>5% (<1%) 22 44.9 10 16.1 4.57 7.59 2.06-27.89

Unknown 0 5Trend test P = 0.003 P = 0.002

“ Adjusted by HG, ER expression, and p53-IHC. Effect of p53 further adjusted by Bcl-2.

Table 4 Adjusted p ORs for lymph nod e involvement according to Bcl-2 overexpre ssion and a popt osis loss stratified by p53 expression

Variable

p53-negative tumors p53-positive tumors

n

T,N,

% n

T,N0 Adjusted” T,N,

n % n

T,N0 Adjusted”

% pOR 95% CI% pOR 95% CI

Bcl-2

Negative �s5%) 9 25.7 22 50.0 1.00 Reference S 45.5 12 60.0 1.00 Reference6-50% 13 37.1 15 34.1 4.76 1.27-17.88 3 27.3 6 30.0 0.75 0.07-7.87

>50% 13 37.1 7 15.9 8.10 1.97-33.24 3 27.3 2 10.0 1.83 0.13-26.72

Trend test P = 0.0019 P = 0.7 13

Bcl-2 (apoptosis loss):s5% (�l%) 8 22.9 16 38.1 1.00 Reference S 45.5 1 1 57.9 1.00 Reference:s;5% (<1%)

>5% (�l%)

1

9

2.9

25.7

5

13

11.9 0.28 0.02-4.96

31.9 2.41 0.59-9.83

0 0.0

3 27.3

1

6

5.3�

31.61 0.32 0.02-5.05

>5% (<1%) 17 48.6 8 19.0 14.62 2.96-72.23 3 27.3 1 5.3 5.73 0.19-177.49

Unknown 0 2 0 1Trend test P = 0.0005 P = 0.58

“ Adjusted by HG and ER expression.

5, 14, 22). Indeed, these observations strengthen our hypothesis

that different pathways of progression are involved in low- or

high-grade breast tumors. We suggest that in low-grade tumors,

the overexpression of Bcl-2 protein is triggering the progression

in the absence of p53 mutations. This effect may be mediated by

the ability of Bcl-2 to extend cell survival with no direct influ-

ence on cellular proliferation. The lengthening of the life span of

the cells may favor the accumulation of genetic alterations or

simply the occurrence of other secondary changes, such as an

activation of other oncogenes, such as c-myc, or even the ac-

quisition of major genetic alterations, such as loss or mutation of

the p53 gene.

Our findings are different from the results from other

reports, in which no relationship was demonstrated betweenBcl-2 immunoreactivity and nodal status, presence of metasta-

ses, or disease-free survival (5, 25). This may be due to the strict

selection criteria used in our study. The other series included

heterogeneous groups of patients with small and large tumors

(T,-T4), often with high proliferation rates, which may reveal

different mechanisms of progression as compared to those op-

erating in Bcl-2-positive tumors with low proliferating activity

(15).

Tumor size has been considered one of the clinical factors

associated with axillary lymph nodal status (26). However, the

interest in additional prognostic indicators in breast cancer is

increasing, especially the interest in predicting whether a patient



+ - #{247}

p53+ p53-


%oftumors 70

PCNA +

BcI-2

60

50

40

30

20

10

0

Fig. 2 Percentage of tumors that express PCNA according to p53 andBcl-2 status. Tumors expressing PCNA in more than 10% ofcells were

considered positive (see “Materials and Methods” for details).

with T1 breast cancer will develop lymph node metastases. Our

findings contribute to this aim by providing an alternative mech-

anism of lymph node involvement for small and low-grade

tumors. However, long-term follow-up studies designed to de-

termine the effect of apoptosis loss and Bcl-2 overexpression on

prognosis in T1 breast cancer patients are needed to confirm this

fact.

The relationship between p53, Bcl-2, and apoptosis is still

under active investigation. In this regard, Bcl-2 can abrogate the

p53-dependent cell death triggered by wild-type p53 (27, 28).

Once p53 mutations occur, the deregulation of cell number by

an apoptotic mechanism may not be required because the mu-

tated p53 protein assures cell proliferation. Bcl-2 and p53 gene

products have been linked to a common apoptotic pathway (29).

Moreover, there is an overlap between Bcl-2 and either wild-

type or mutant p53 functions, which could participate in the

control of cell death. We and others (4, 5) have found an inverserelationship between Bcl-2 expression and the presence of p53

mutations, suggesting a possible negative regulatory effect of

Bcl-2 transcription by mutated p53 protein as it has been shown

in human breast cancer cell lines (8).

In our series, higher proliferation rates were found in

p53-mutated tumors in which the Bcl-2 protein was absent, as

has been reported by others (30, 3 1). We measured cell prolif-

eration as the overexpression of the PCNA protein, which has

been demonstrated to be up-regulated by mutated p53 in human

cancer cell lines (32); our data of increased PCNA expression in

a subset of p53-mutated tumors are concordant with this. The

loss of p53-dependent checkpoint may serve to rapidly fix

stochastic mutations that are involved with angiogenesis, inva-

siveness, or metastatic potential (33). Indeed, our results further

suggest that p53 overexpression is far more common in HG III

tumors. Tumors with p53 mutations have an aggressive pheno-

type; this finding is in agreement with previous reports, which

have associated mutated p53 with a high proliferative activity

(34), a high HG (35), and the absence of ERs and PRs (36). The

mutated p53 protein may provide an enhanced proliferation and

the acquisition of properties for a more aggressive phenotype.

On the other hand, because p.53 wild-type gene inactivation

occurs in over one-half of human cancers, it is also possible that

loss of p53-mediated down-regulation of Bcl-2 gene expression

might account for the overproduction of Bcl-2 seen in tumors.

Bcl-2 is a member of a family of genes that can control the

apoptotic threshold of a cell. The dysfunction of other Bcl-2

family members like Bax, Bdl-xL, Bdl-x5, or Bad (37-39) may

be also involved in this mechanism, and they are now under

investigation. The protein product of the bay gene can form

heterodimers with Bcl-2 and abrogate its ability to suppress

apoptosis (40), which could be attributed to reductions of the

levels of these proteins. Experiments in vitro demonstrate that a

temperature-sensitive p53 cDNA transfected in a murine leuke-

mia cell line regulates the expression of Bcl-2 and Bax (41).

Thus, the ratio of Bcl-2 and Bax proteins contributes to apop-

totic cell death control in several tissues (42, 43), and it might be

relevant in breast tumors (44).

In conclusion, the overexpression of Bcl-2 with apoptosis

loss in low-grade T1 tumors identifies a population of breast

cancer patients who can benefit from more aggressive therapies

because these patients may have up to I 3-fold excess odds of

presenting lymph node metastases.

The knowledge of the genes involved in cell death control

could provide important targets for therapeutic intervention and

might allow effective vectors for gene therapy targeted to in-

ducing selective apoptosis in cells.

ACKNOWLEDGMENTS

We gratefully acknowledge G. Aiza, 1. CoIl, S. Ma#{241}as,and L.

Moreno for their skillful technical assistance. We thank the Comit#{233}de

Cancer de Mama from Ciutat Sanitaria i Universitaria de Bellvitge for

their valuable advice in the clinical selection of patients. We are also

grateful to Dr. R. Colomer (Servicio de Oncologia, Hospital La Paz,

Madrid, Spain) for helpful suggestions and critical reading of the manu-

script.

REFERENCES

1. Sierra, A., Lloveras, B., Castellsagu#{233}, X., Moreno, L., GarcIa-

Ramirez, M., and Fabra, A. Bcl-2 expression is associated with lymph

node metastasis in human ductal breast carcinoma. Int. J. Cancer, 60:

54-60, 1995.

2. Merritt, A. J., Potten, C. S., Watson, A. J. M., Loh, D. Y., Nakayama,

K., Nakayama, K., and Hickman, J. A. Differential expression of bcl-2

in intestinal epithelia. Correlation with attenuation of apoptosis in co-Ionic crypts and the incidence of colonic neoplasia. J. Cell Sci., 108:

2261-2271, 1995.

3. Bedi, A., Pasricha, P. J., Akhtar, A. J., Barber, J. P., Bedi, G. C.,

Giardiello, F. M., Zehnbauer, B. A., Hamilton, S. R., and Jones, R. J. In-hibition of apoptosis during development of colorectal cancer. Cancer

Res., 55: 1811-1816, 1995.

4. Leek, R. D., Kaklamanis, L., Pezzella, F., Gatter, K. C., and Harris,

A. L. bcl-2 in normal human breast and carcinoma, association with

oestrogen receptor-positive, epidermal growth factor receptor-negativetumours and in situ cancer. Br. J. Cancer, 69: 135-139, 1994.

5. Silvestrini, R., Veneroni, S., Daidone, M. G., Benini, E., Boracchi,

P., Mezzetti, M., Di Fronzo, G., Rilke, F.. and Veronesi, U. The Bcl-2protein, a prognostic indicator strongly related to p53 protein in lymph-node-negative breast cancer patients. J. NatI. Cancer Inst., 86: 499-504,1994.

6. Sinicrope, F. A., Ruan, S. B., Cleary, K. R., Stephens, L. C., Lee,

J. J., and Levin, B. bcl-2 and p53 oncoprotein expression during cob-

rectal tumorigenesis. Cancer Res., 55: 237-241, 1995.

7. Strasser, A., Harris, A. W., Jacks, T., and Cory, S. DNA damage can

induce apoptosis in proliferating lymphoid cells via p53-independent

mechanisms inhibitable by Bcl-2. Cell, 79: 329-339, 1994.




8. Haldar, S., Negrini, M., Monne, M., Sabbioni, S., and Croce, C. M.

Down-regulation of bcl-2 by p53 in breast cancer cells. Cancer Res., 54:

2095-2097, 1994.

9. McDonnell, T. J. Cell division s’ersus cell death: a functional modelof multistep neoplasia. Mol. Carcinog., 8: 209-213, 1993.

10. Hockenbery, D. M. bcl-2 in cancer, development and apoptosis. J.Cell Sci., 18: 51-55, 1994.

1 1. Gavrieli, Y., Sherman, Y., and Ben-Sasson, S. A. Identification ofprogrammed cell death in situ via specific labeling of nuclear DNA

fragmentation. J. Cell Biol., 119: 493-501, 1992.

12. Bartkova, J., Bartek, J., Vojtesek, B., Lukas, J., Rejthar, A., Ko-

yank, j., Millis, R. R., Lane, D. P., and Barnes, D. M. Immunochemical

analysis of the p53 oncoprotein in matched primary and metastatic

human tumours. Eur. J. Cancer, 29A: 881-886, 1993.

13. Cunningham, J. M., Ingle, J. N., Jung, S. H., Cha, S. S., Wold, L. E.,Farr, G., Witzig, 1. E., Krook, J. E., Wieand, H. S., and Kovach, J. S.p53 gene expression in node-positive breast cancer: relationship to DNA

ploidy and prognosis. J. Natl. Cancer Inst., 86: 1871-1873, 1994.

14. Joensuu, H., Pylkkanen, L., and Toikkanen, S. Bcl-2 protein cx-pression and long-term survival in breast cancer. Am. J. Pathol., 145:

1191-1198, 1994.

15. Ceccarelli, C., Santini, D., Chieco, P., Taffurelli, M., Marrano, D.,and Mancini, A. M. Multiple expression patterns of biopathologicalmarkers in primary invasive breast carcinoma: a useful tool for eluci-dating its biological behaviour. Ann. Oncol., 6: 275-282, 1995.

16. Hollstein, M., Sidransky, D., and Volgelstein, B. p53 mutations inhuman cancers. Science (Washington DC), 253: 49-53, 1991.

17. Orita, M., Iwahana, H., Kanazawa, H., Hayashy, K., and Sekiya, T.Detection of polymorphisms of human DNA by gel electrophoresis assingle-strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA,

86: 2766-2770, 1989.

18. Sambrook, J., Fitsch, E. F., and Maniatis, T. Molecular Cloning: ALaboratory Manual, Ed. 2, p. 13.63. Cold Spring Harbor, New York:

Cold Spring Harbor Laboratory, 1989.

19. Dean, A. G., Dean, J. A., Coubombier, D., Brendel, K. A., Smith, D.C., Burton, A. H., Dicker, R. C., Sullivan, K., Fagan, R. F., and Arner,T. G. Epi Info, Version 6: a word processing, database, and statisticsprogram for epidemiology on microcomputers. Centers for DiseaseControl and Prevention, Atlanta. Georgia, U.S.A., 1994.

20. Breslow, N. E., and Day, N. E. Statistical Methods in Cancer

Research. I. The Analysis of Case-Control Studies. IARC ScientificPubI. No. 32. Lyon, France: IARC, 1980.

21. Baker, R. J., and Nelder, J. A. The GLIM system, Release 3.Generalized linear interactive modelling. Oxford, United Kingdom:Numerical Algorithms Group, 1978.

22. Doglioni, C., Dci los, A. P., Laurino, L., Chiarelli, C., Barbareschi,

M., and Viale, G. The prevalence of Bcl-2 immunoreactivity in breastcarcinomas and its clinicopathological correlates, with particular refer-

ence to oestrogen receptor status. Virchows Arch., 424: 47-5 1, 1994.

23. Nathan, B., Gusterson, B., Jadayel, D., O’Hare, M., Anbazhagan,

R., Jayatilake, H., Ebbs, S., Micklem, K., Price, K., Gelber, R., Reed, R.,Senn, H-J., Goldhirsch, A., and Dyer, M. J. S. Expression of Bcl-2 inprimary breast cancer and its correlation with tumour phenotype. Ann.Oncol., 5: 409-414, 1994.

24. Lipponen, P., Pietil#{228}inen, T., Kosma, V-M., Aaltomaa, S., Eskeli-

nen, M., and Syrjanen, K. Apoptosis suppressing protein bcl-2 is cx-

pressed in well-differentiated breast carcinomas with favourable prog-nosis. J. Pathol., 177: 49-55, 1995.

25. Hellemans, P., van Dam, P. A., Weyler, J., van Oosterom, A. T.,Buytaert, P., and Van Marck, E. Prognostic value of bcl-2 expression ininvasive breast cancer. Br. J. Cancer, 72: 354-360, 1995.

26. Ravdin, P. M., Dc Laurentiis, M., Vendely, 1., and Clark, G. M.

Prediction of axillary lymph node status in breast cancer patients by useof prognostic indicators. J. Natl. Cancer Inst., 86: 1771-1774, 1994.

27. Chiou, S., Rao, L., and White, E. Bcl-2 blocks p53-dependent

apoptosis. Mol. Cell. Biol., 14: 2556-2563, 1994.

28. Wang, Y., Szekely, L., Okan, I., Klein, G., and Wiman, K. G.

Wild-type p53-triggered apoptosis is inhibited by bcl-2 in a v-mvc-

induced T-cell lymphoma line. Oncogene, 8: 3427-3431, 1993.

29. Mann, M. C., Hsu, B., Meyn, R. E., Donehower, L. A., El-Naggar,

A. K., and McDonnell, 1. J. Evidence that p53 and bcl-2 are regulatorsof a common cell death pathway important for in viva lymphomagen-esis. Oncogene, 9: 3107-3112, 1994.

30. Gorczyca, W., Markiewski, M., Kram, A., Tuziak, T., and Dama-gala, W. Immunohistochemical analysis of bcl-2 and p53 expression in

breast carcinomas: their correlation with Ki-67 growth fraction. Vir-chows Arch., 426: 229-233, 1995.

31. Hurlimann, J., Larrinaga, B., and Vala, D. L. M. bcl-2 protein in

invasive ductal breast carcinomas. Virchows Arch., 426: 163-168,1995.

32. Jackson, P., Ridgway, P., Rayner, J., Noble, J., and Braithwaite, A.

Transcriptional regulation of the PCNA promoter by p53. Biochem.

Biophys. Res. Commun., 203: 133-140, 1994.

33. Symonds, H., Krall, L., Remington, L., Saenz-Robles, M., Lowe, S.,

Jacks, T., and Van Dyke, 1. p53-dependent apoptosis suppresses tumorgrowth and progression in vivo. Cell, 78: 703-711, 1994.

34. Marchetti, A., Buttitta, F., Pellegrini, S., Campani, D., Diella, F.,Cecchetti, D., Callahan, R., and Bistocchi, M. p53 mutations and his-tological type of invasive breast carcinoma. Cancer Res., 53: 4665-4669, 1993.

35. Lipponen, P., Ji, H., Aaltomaa, S., Syrjanen, S., and Syrjanen, K.

p53 protein expression in breast cancer as related to histopathologicalcharacteristics and prognosis. Int. J. Cancer, 55: 51-56, 1993.

36. Jacquemier, J., Moles, J. P., Penault-Llorca, F., Adelaide, J., br-rente, M., Viens, P., Birnbaum, D., and Theillet, C. p53 immunohisto-chemical analysis in breast cancer with four monoclonal antibodies:comparison of staining and PCR-SSCP results. Br. J. Cancer, 69:

846-852, 1994.

37. Korsmeyer, S. J. Regulators of cell death. Trends in Genet., 11:

101-105, 1995.

38. Cory, S. Regulation of lymphocyte survival by the bcl-2 gene

family. Annu. Rev. Immunol., 13: 513-543, 1995.

39. Yang, E., Zha, J., Jockel, J., Boise, L. H., Thompson, C. B., andKorsmeyer, S. J. Bad, a heterodimeric partner for Bdl-xL and Bcl-2,displaces Bax and promotes cell death. Cell, 80: 285-291, 1995.

40. Oltvai, Z. N., Milliman, C. L., and Korsmeyer, S. J. Bcl-2 het-erodimerizes in vivo with a conserved homolog, Bax, that accelerates

programed cell death. Cell, 74: 609-619, 1993.

41. Miyashita, b., Harigai, M., Hanada, M., and Reed, J. C. Identifica-tion of a p53-dependent negative response element in the bcl-2 gene.Cancer Res., 54: 3131-3135, 1994.

42. Oltvai, Z. N., and Korsmeyer, S. J. Checkpoints of dueling dimers

foil death wishes. Cell, 79: 189-192, 1994.

43. Hoffman, B., and Liebermann, D. A. Molecular controls of apop-tosis: differentiation/growth arrest primary response genes, proto-onco-

genes, and tumor suppressor genes as positive and negative modulators.Oncogene, 9: 1807-1812, 1994.

44. Bargou, R. C., Daniel, P. T., Mapara, M. Y., Bommert, K., Wage-

ncr, C., Kallinich, B., Royer, H. D., and D#{246}rken,B. Expression of thebcl-2 gene family in normal and malignant breast tissue: low box-aexpression in tumor cells correlates with resistance towards apoptosis.Int. J. Cancer, 60: 854-859, 1995.



1996;2:1887-1894. Clin Cancer Res A Sierra, X Castellsagué, S Tórtola, et al. lymph node metastases in T1 breast cancer.Apoptosis loss and bcl-2 expression: key determinants of

Updated version

http://clincancerres.aacrjournals.org/content/2/11/1887

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/2/11/1887To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



apoptosis loss and bcl-2 expression: key determinants of ... · ihc staining of deparaffinized...

Documents