assessment of detection efficacy of mycobacterium tuberculosis in sputum samples by real time pcr...
TRANSCRIPT
Assessment of Detection Efficacy of Mycobacterium tuberculosis in sputum samples
by Real Time PCR based method
BY: SURESH BANJARA
BASANTA K. DAHAL SARBESH D. DANGOL
SUNDAR HENGOJU KUL S. SHRESTHA
A project report submitted in the partial fulfillment of requirement for the degree of
Bachelors of Technology in Biotechnology
Department of Biotechnology School of Science
Kathmandu University
September 2011
2
Assessment of Detection Efficacy of Mycobacterium tuberculosis in sputum samples
by Real Time PCR based method
BY: SURESH BANJARA
BASANTA K. DAHAL SARBESH D. DANGOL
SUNDAR HENGOJU KUL S. SHRESTHA
SUPERVISOR: SUBODH KUMAR UPADHYAYA
Dr. SAMEER MANI DIXIT
A project report submitted in the partial fulfillment of requirement for the degree of
Bachelors of Technology in Biotechnology
Department of Biotechnology School of Science
Kathmandu University
September 2011
i
Letter of Recommendation
We certify that we have gone through all the segments of this dissertation and found
that the presentation and originality has been assured as per requirements. It contains
all the necessary contents and details satisfactory in scope and quality to denominate it
as a dissertation to be submitted at bachelor’s level.
The work presented herein is genuine work done originally by “Suresh Banjara,
Basanta K. Dahal, Sarbesh D. Dangol, Sundar Hengoju and Kul S. Shrestha” and has
not been published or submitted elsewhere for the requirement of a degree
programme. Any literature, data, or work done by others and cited within this report
has been given due acknowledgement and listed in the reference section.
_________________________ _________________________
Subodh Kumar Upadhyaya Dr. Sameer Mani Dixit
Assistant Professor Country Director/ Senior Scientist
Department of Biotechnology Center for Molecular Dynamics
School of Science Thapathali, Kathmandu
Kathmandu University
Dhulikhel, Kavre
ii
Board of Examiners
Recommended by: ---------------------------------
Subodh Kumar Upadhyaya
Assistant Professor
Department of Biotechnology
Kathmandu University
Project Supervisor
--------------------------------------
Dr. Sameer Mani Dixit
Country Director/ Senior Scientist
Center for Molecular Dynamics
Project Supervisor
Approved by:
--------------------------------------
Prof. Dr. Tika Bahadur Karki
Professor
Head of Department
Department of Biotechnology
Kathmandu University
Examined by: --------------------------------------
Rajani Malla
Associate Professor
Tribhuvan University
External Examiner
September 2011
iii
Declaration by the Students
The thesis entitled, “Assessment of Detection Efficacy of Mycobacterium tuberculosis
in sputum samples by Real Time PCR based method” is submitted in accordance with
the regulation of the Kathmandu University in partial fulfillment for the award of the
degree in Bachelors of Technology in Biotechnology. We, “Suresh Banjara, Basanta
K. Dahal Sarbesh D. Dangol, Sundar Hengoju and Kul S. Shrestha” declare that the
work presented herein is genuine and done under the supervision of Mr. Subodh K.
Upadhyaya and Dr. Sameer M. Dixit. The work presented here has not been published
or submitted elsewhere for requirement of a degree programme. Any literature, data,
or work done by others are cited within this report and has been listed in the reference
section.
---------------------------- ------------------------------ -------------------------------
Suresh Banjara Basanta K. Dahal Sarbesh D. Dangol
---------------------------- ----------------------------
Sundar Hengoju Kul S. Shrestha
Department of Biotechnology
School of Science
Kathmandu University
September 2011
iv
Acknowledgement
It is with immense pleasure we thank our supervisors Mr. Subodh K. Upadhyaya
(Assistant Professor, Department of Biotechnology, Kathmandu University) and Dr.
Sameer M. Dixit (Director R & D, Center for Molecular Dynamics Affiliated Intrepid
Nepal). Our deepest thanks to Prof. Dr. Tika Bahadur Karki (Head of Department,
Department of Biotechnology, Kathmandu University) for providing us with this
opportunity to perform this research project.
We are thankful to Department of Environmental Affairs, Kathmandu Metropolitan
City Office, Teku, Kathmandu for the financial support in this Research project. We
are also thankful to Ms. Sonu Shrestha (Center for Molecular Dynamics Affiliated
Intrepid Nepal) for her guidance and persistent encouragement for providing us timely
guidance and cooperative environment.
We appreciate the help provided by Ms. Jyoti Acharya (8th Level Lab Supervisor,
Shukra Raj Tropical and Infectious Disease Hospital, Teku, Kathmandu), Raunak M.
Shrestha (Center for Molecular Dynamics Affiliated Intrepid Nepal) and Mr. Deepak
Pokhrel (Shukra Raj Tropical and Infectious Disease Hospital, Teku, Kathmandu) for
providing the sputum samples from Shukra Raj Tropical and Infectious Disease
Hospital, Teku, Kathmandu, for AFB tests and culture tests.
v
Abstract
Assessment of Detection Efficacy of Mycobacterium
tuberculosis in sputum samples by Real Time PCR
based method
Suresh Banjara
Basanta K. Dahal
Sarbesh D. Dangol
Sundar Hengoju
Kul S. Shrestha
Department of Biotechnology
School of Science
Kathmandu University
Supervisor:
Mr. Subodh K. Upadhyaya
Dr. Sameer M. Dixit
vi
Abstract
A baseline study involving thirty (30) sputum samples from suspected pulmonary
tuberculosis (TB) patients is collected and performed Acid Fast Bacilli (AFB) tests,
culture till it shows growth (for six to eight weeks) and comparing these results with
those obtained using Real Time PCR detection.
AFB tests were carried out on 30 samples at the Sukraraj Tropical and Infectious
Disease Hospital, Teku, Kathmandu, Nepal; Real time PCR (QPCR) methodolgy at
Center for Molecular Dynamics Nepal (CMDN) affiliated Intrepid Nepal (IN),
Kathmandu, Nepal and Culture at Kathmandu University, Dhulikhel, Kavre, Nepal.
The microbiological assessments applied were as per WHO guidelines (Ziehl-Neelsen
staining or AFB staining) and culture was used as a Gold standard for the sensitivity
and specificity assessment. The QPCR assay used targeted IS6110, a 12.7 Kb
fragment of M. tuberculosis not found in other Mycobacterium sub-species. Thirteen
samples (43%) were found to be AFB positive and Seventeen (57%) samples were
AFB negative. Fourteen of the samples (47%) were PCR positive and Sixteen (53%)
were PCR Negative. Three of AFB negative samples were found to be PCR positive.
Two AFB positive samples were found to be PCR negative. Thirteen samples (43%)
were found to be Culture Positive and Seventeen samples (57%) were found to be
Culture Negative. One Culture Negative samples was found to be PCR positive. Two
Culture Negative samples were found to be AFB positive and two culture positive
samples were found to be AFB Negative. The sensitivity with respect to gold standard
(culture) for AFB was calculated to be 84.61% while for Q-PCR it was calculated to
be 100%; specificity for AFB 88.24% while for Q-PCR 94.11%; Positive predictive
value for AFB was found to be 84.61% while for Q-PCR, it was calculated to be
92.86% ; Negative predictive value was found to be 88.24%, while for Q-PCR, it was
calculated to be 100%. These statistics clearly show that Q-PCR is highly efficient for
the diagnosis of TB compared to AFB.
The findings from this study demonstrates the need to deploy highly specific and
sensitive genomic based method of detection of M. tuberculosis in conjunction with
traditional AFB, X-ray, Tuberculin test, Fluorescein test, culture tests etc done for TB
detection to come up with rapid, reliable and accurate detection of M. Tuberculosis in
Nepal. Since QPCR will help this issue in the context of Nepal, the technology of
vii
Universal Sample Processing (USP) by combining AFB, culture and QPCR must be
developed in Nepal and the diagnosis must be started based on it and overcome the
barriers offset by economic partiality in Nepal.
Keywords: Mycobacterium tuberculosis, Real time PCR, AFB Staining, Culture
viii
Table of Contents Letter of Recommendation ............................................................................................. i
Board of Examiners ....................................................................................................... ii
Declaration by the Students .......................................................................................... iii
Acknowledgement ........................................................................................................ iv
Abstract .......................................................................................................................... v
Table of Contents ........................................................................................................ viii
List of tables .................................................................................................................. xi
List of figures ............................................................................................................... xii
List of Abbreviations .................................................................................................. xiii
CHAPTER I: INTRODUCTION ................................................................................... 1
1.1 Purpose of our Research Project: ......................................................................... 2
1.2 Introduction to Tuberculosis (TB): ...................................................................... 2
1.3 History of Tuberculosis ....................................................................................... 3
1.4 WHO figure in TB ............................................................................................... 8
1.5 TB figure in Nepal ............................................................................................. 11
1.6 History of TB in Nepal ...................................................................................... 13
1.7 TB infection and disease.................................................................................... 13
1.8 Structure of MTB .............................................................................................. 16
1.9 Cell Wall composition ....................................................................................... 18
1.10 Causes and factors of MTB ............................................................................. 19
1.10.1 Causes of MTB ........................................................................................ 19
1.10.2 Factors in acquiring TB infection and TB disease ................................... 19
1.11 Stages of Tuberculosis ..................................................................................... 21
1.12 Nature of MTB ................................................................................................ 24
1.13 Genome of MTB .............................................................................................. 25
1.14 Immune system roles in MTB ......................................................................... 25
ix
1.15 Binding of M. tuberculosis to Monocytes and Macrophages .......................... 25
1.16 Overview of T-cell Function and cytokine production .................................... 26
1.17!Diagnosis of Tuberculosis .............................................................................. 27
1.17.1. Medical history ........................................................................................ 28
1.17.2. Physical examination .............................................................................. 28
1.17.3. Acid Fast Staining/ Ziehl-Neelsen staining(AFB TEST) ........................ 29
1.17.4. Tuberculin skin test (TST)/ PPD skin test ............................................... 29
1.17.5. CULTURE: ............................................................................................. 30
1.17.6. Nucleic Acid Amplification Test(NAAT) ............................................... 31
1.17.7. Amplified Mycobacterium tuberculosis direct test (AMDT) .................. 32
1.18 Treatment of TB .............................................................................................. 33
1.18.1 First line Treatment: ................................................................................. 33
1.18.2 Second line Treatment .............................................................................. 33
1.18.3 Third line Treatment ................................................................................ 34
1.19 DOTS THERAPY ........................................................................................... 34
1.20 Drug Resistant Tuberculosis ............................................................................ 34
Chapter II: LITERATURE REVIEW .......................................................................... 36
2.1 The Mycobacterium tuberculosis Genome Analysis of H37Rv strain .............. 37
2.2 IS6110 gene ....................................................................................................... 38
2.3 IS6110 mediated deletion mechanism in H37Rv strain of Mycobacterium
tuberculosis.............................................................................................................. 42
2.4 IS6110 sequence of various Mycobacterium tuberculosis strains ..................... 43
2.5 Efficiency of PCR over conventional methods for detectection of TB and
Universal Sample Processing (USP) Methodology ................................................. 44
2.6 Real Time PCR .................................................................................................. 46
2.7 The Taqman Principle of Real Time PCR based method .................................. 47
2.8 Real Time PCR Data Analysis .......................................................................... 50
CHAPTER III: MATERIALS & METHODOLOGY ................................................. 54
x
3.1 Pulmonary sputum samples collection, transportation and storage ................... 55
3.2 AFB (Acid Fast Bacilli test) staining/ smear Microscopy ................................ 55
3.2.1 Materials used for AFB (Acid Fast Bacilli test) staining/ smear
Microscopy: ........................................................................................................ 55
3.2.2 Procedure for AFB (Acid Fast Bacilli test) staining/ smear Microscopy: .. 56
3.3 Real Time PCR (Q-PCR) .................................................................................. 56
3.3.1 Materials Required for DNA Extraction and Q-PCR: ................................ 56
3.3.3 Procedure for Real Time PCR for detection of Mycobacterium tuberculosis
from human sputum samples .............................................................................. 58
3.4 Culture ............................................................................................................... 59
3.4.1 Materials Required for Culture: ................................................................. 59
3.4.2 Procedure for Culture ................................................................................. 59
3.5 Statistical Analysis: ........................................................................................... 60
CHAPTER IV: RESULT ............................................................................................. 62
4.1 Result of AFB, QPCR and culture: ................................................................... 63
4.2 Standard Curve for the Real Time PCR tests .................................................... 65
4.3 Validity measurement for QPCR. ...................................................................... 66
4.4 Validity measurement for AFB ......................................................................... 67
CHAPTER V: DISCUSSION ...................................................................................... 69
CHAPTER VI: CONCLUSION & RECOMMENDATION ....................................... 74
References: ................................................................................................................... 76
Appendix ...................................................................................................................... 84
xi
List of tables
Table 1 : Estimated TB incidence, prevalence and mortality, 2009 (Source:WHO) ..... 9
Table 2: List of new test study vs. reference standard ................................................. 61
Table 3: Result of AFB, QPCR and Culture ................................................................ 63
Table 4: Summary of Result ........................................................................................ 64
Table 5: True Positive and True Negative calculation between QPCR and Gold
standard (culture). ........................................................................................................ 66
Table 6: True Positive and True Negative calculation between AFB test and Gold
standard (culture). ........................................................................................................ 67
xii
List of figures
Fig 1: Tuberculosis country profile for Nepal ......................................................................... 10
Fig 2: Case Finding and Treatment outcome for TB in Nepal. ................................................ 12
Fig 3: Phylogenetic Position of the tuberculosis within the Genus Mycobacterium: .............. 15
Fig 4: M. tuberculosis in EM ................................................................................................... 17
Fig 5: Colonies in Lowenstein-Jansen medium ....................................................................... 17
Fig 6: Acid-fast stain ................................................................................................................ 17
Fig 7: The structure of the Mycobacterium tuberculosis cell wall. .......................................... 19
Fig 8: Transmission of TB from Diseased to a healthy Individual .......................................... 22
Fig 9: Infection of Tuberculosis and role of immune cells ...................................................... 24
Fig 10: Overview of macrophage-lymphocyte interactions in tuberculosis. .......................... 26
Fig 11: Inflammatory response of phagocytic cells. ................................................................ 27
Fig 12: Circular map of M. tuberculosis H37Rv strain ............................................................ 38
Fig 13: Schematic representation of the 12.7 kb fragment. ..................................................... 40
Fig 14: IS6110 based deletion mechanism in RvD2 region of Mycobacterium
tuberculosis .............................................................................................................................. 43
Fig 15: Taqman Principle chemistry ........................................................................................ 48
Fig 16: Visualization of PCR ................................................................................................... 49
Fig 17: Log plot of amplification curves ................................................................................. 51
Fig 18: Melting curve analysis. ................................................................................................ 53
Fig 19: Standard Curve of QPCR ............................................................................................ 65
xiii
List of Abbreviations
ACTB : Actin Beta
AFB : Acid Fast Bacilli
AMDT : Amplified Mycobacterium tuberculosis direct test
BACTEC : Becton Dickinson
BLAST : Basic Local Alignment Search Tool
CCC : Central Chest Clinic
CD : Cluster of Differentiation
CIP : Ciprofloxacin
CLR : Clarithromycin
CMDN : Center for Molecular Dynamics Nepal
CMI : Cell-mediated immunity
CNS : Central nervous system
Ct : Threshold Cycle
DOTS : Directly Observed Treatment Short Course
DR : Direct Repeat
dsDNA : Doublestranded Deoxy-Ribo Nucleic Acid
DVR : Direct Variable Repeat
EMB : Ethambutol
FAM : 6-carboxyfluorescein
FAS : Fatty acid synthase
FNAC : Fine Needle Aspiration Cytology
FRET : Fluorescence resonance energy transfer
GM-CSF : Granulocyte-macrophage-colony stimulating factor
HIV : Human Immunodeficiency Virus
HLA : Human Leukocyte Antigen
xiv
IFN : Interferon
IL : Interleukin
IN : Intrepid Nepal
IS : Insertion Sequence
KU : Kathmandu University
LZD : Linezolid
MBSS : Mycobacterium bovis Specific Sequence
MHC : Major Histocompatibility Complex
MMR : Miniature Mass Radiography
MTB : Mycobacterium tuberculosis
MXF : Moxifloxacin
NAAT : Nucleic Acid Amplification Test
NADH : Nicotinamide Adenine Dinucleotide
NALC : N-acetyl L-cysteine
NATA : Nepal Anti-TB Association
NCBI : National Center for Biotechnology Information
NPV : Negative predictive value
NTC : National Tuberculosis Centre
NTC : Nepal Tuberculosis Center
PAS : p-aminosalicylic acid
PCR : Polymerase Chain Reaction
PPD : Purified Protein Derivative
PPV : Positive Predictive Value
QPCR : Quantitative Real Time Polymerase Chain Reaction
RIF : Rifampicin
RNA : Ribo Nucleic Acid
SLD : Second-line drugs
xv
SM : Streptomycin
ssDNA : Single-stranded DNA
SYBR : Synergy Brands, Inc.
TAMRA : Tetramethylrhodamine
TB : Tuberculosis
TBCP : Tuberculosis Control Programme
TC : Cytotoxic T cells
TH : T helper cells
TL : Tuberculous Lymphadenophathy
TMA : Transcription-mediated amplification
TNF : Tumor Necrosis Factor
TST : Tuberculin Skin Test
USP : Universal Smear Microscopy
ZN : Zeihl-Neelsen
CHAPTER I
INTRODUCTION
2
1.1 Purpose of our Research Project:
Our Research project on “Assessment of detection efficacy of Mycobacterium
tuberculosis in sputum samples by real time PCR based method” at Center for
Molecular Dynamics affiliated Intrepid Nepal Biotechnology laboratory, Thapathali,
Kathmandu was a bid to conduct earliest end-point detection of Mycobacterium
tuberculosis and to study the feasibility of this test to be conducted at hospitals and
laboratories of Nepal and of its sensitivity, speed, simplicity and barriers offset by
economic partiality for the first time in Nepal. During this study, we compared the
results obtained from Acid Fast Bacilli (AFB) test obtained from ShukraRaj Tropical
and Infectious Disease Hospital, Teku, Kathmandu, Nepal and the culture which is
regarded as gold standard by WHO at Kathmandu University, Department of
BioTechnology, Dhulikhel, Kavre, Nepal.
1.2 Introduction to Tuberculosis (TB):
Tuberculosis (TB), one of the oldest recorded human afflictions, is still one of the
biggest killers among the infectious diseases, despite the worldwide use of a live
attenuated vaccine and several antibiotics. Tuberculosis, MTB or TB (short
for tubercle bacillus) is a common and in many cases lethal infectious disease caused
by various strains of mycobacteria, usually Mycobacterium tuberculosis (Robbins
Basic Pathology ; 8th ed.). Tuberculosis usually attacks the lungs but can also affect
other parts of the body. It is spread through the air when people who have an active
MTB infection cough, sneeze, or otherwise transmit their saliva through the air
(Konstantinos A; 2010) Most infections in humans result in an asymptomatic, latent
infection, and about one in ten latent infections eventually progresses to active disease,
which, if left untreated, kills more than 50% of its victims.
The classic symptoms are a chronic cough with blood-tinged sputum, fever, night
sweats, and weight loss (the last giving rise to the formerly prevalent colloquial term
"consumption"). Infection of other organs causes a wide range of
symptoms. Diagnosis relies on radiology (commonly chest X-rays), a tuberculin skin
test, blood tests, as well as microscopic examination and microbiological culture of
bodily fluids. Treatment is difficult and requires long courses of multiple antibiotics.
Social contacts are also screened and treated if necessary. Antibiotic resistance is a
3
growing problem in (extensively) multi-drug-resistant tuberculosis. Prevention relies
on screening programs and vaccination, usually with Bacillus Calmette-
Guérin vaccine.
Overall, one-third of the world's population is currently infected with the TB bacillus.
5-10% of people who are infected with TB bacilli (but who are not infected with HIV)
become sick or infectious at some time during their life. People with HIV and TB
infection are much more likely to develop TB (World Health Organization; 2009).
1.3 History of Tuberculosis
TB can be present in various forms, including one that attacks bone and causes skeletal
deformities. Hard tissues like bone can be preserved for thousands of years, allowing
the almost certain identification of individuals with bone TB who died more than
4,000 years ago. The frequency of unearthed skeletons with apparent tubercular
deformities in ancient Egypt suggests that the disease was common among
that population. The discovery of similarly deformed bones in various Neolithic sites
in Italy, Denmark, and countries in the Middle East also indicates that TB was found
throughout the world up to 4,000 years ago. The origin of M. tuberculosis, the
causative agent of TB, has been the subject of much recent investigation, and it is
thought that the bacteria in the genus Mycobacterium, like other actimomycetes, were
initially found in soil and that some species evolved to live in mammals. The
domestication of cattle, thought to have occurred between 10,000 and 25,000
years ago, would have allowed the passage of a mycobacterial pathogen from
domesticated livestock to humans, and in this adaptation to a new host, the bacterium
would have evolved to the closely related M. tuberculosis. Specifically, it has been
hypothesized that M. bovis, which causes a TB-like disease in cattle, was the
hypothetical evolutionary precursor of M. tuberculosis (Stead, W. W. 1997). This
hypothesis is now considered doubtful in the light of new data, since it was formulated
before the genomes in the M. tuberculosis complex, including the human and animal
pathogens M. africanum, M. microti, and M. canetti, as well as M.
tuberculosis and M. bovis, were characterized by DNA sequencing and related
methods. These studies have shown a greater than 99.9% similarity of DNA sequence
among the members of the M. tuberculosis complex (Brosch et al; 2002), but the
existence of rare synonymous single-nucleotide polymorphisms (sSNP) allows
4
discrimination between these closely related bacteria. sSNP analyses suggest that M.
bovis evolved at the same time as M. tuberculosis (Sreevatsan et al; 1997), and a study
of the distribution of deletions and insertions in the genomes of the M.
tuberculosis complex provides strong evidence for the independent evolution of
both M. tuberculosis and M. bovis from another precursor species, possibly related
to M. canetti (Stead; 1997).
In recorded history, Assyrian clay tablets describe patients coughing blood in the
seventh century B.C., and Hippocrates (fifth century B.C.) writes of patients with
consumption (the Greek term is phthisis), i.e., wasting away associated with chest pain
and coughing, frequently with blood in the sputum. By this time, the frequency of
descriptions of patients with TB-like symptoms indicates that the disease was already
well entrenched. It is thought that TB may have been introduced into these regions by
the migration of Indo-European cattle herders who were carrying it by virtue of their
exposure to cattle infected with the tubercle bacillus. Analysis of various human
phenotypic traits, like lactose tolerance, that are associated with the raising of cattle
and selection for the ability to utilize milk, as well as the resulting exposure to M.
tuberculosis, has also suggested that Indo-Europeans spread the disease to Europe
and Asia during their migrations into these regions (Haas and Haas. 1996).
Europe, with its population explosion in the second millennium A.D. and the growth
of large urban centers, become the epicenter for many TB epidemics starting in the
16th and 17th centuries. This disease peaked in Europe in the first half of the
19th century, and it is estimated that one-quarter Europeans died of TB. In one study in
a Paris hospital at that time, 250 of 696 cadavers examined showed that the individuals
had died of this disease (Dubos and Dubos. 1952). In the last half of the 19th century,
mortality due to TB decreased, largely due to improved sanitation and housing, of
which the best-known example is the urban renewal of Paris in the 1850s, initiated and
directed by Baron Georges Haussmann. Of course, the motivation for this massive
project was not only public health concerns but also political considerations, since the
wide, straight boulevards of the rebuilt Right Bank allowed better control of the
increasingly radicalized working class by Louis Bonaparte's troops (Chaudun,
N. 2000). It has also been postulated that natural selection of humans resistant to TB
may have played a major role in the 19th-century decrease in the incidence of this
5
disease, but the decline has been too rapid to be explained by these changes (Lipsitch
and Sousa. 2002).
European immigrants to the New World brought the disease with them, and while the
mortality rate never reached the levels found in Europe, large urban centers like
Boston and New York had TB death rates of 6 to 7 per 1,000 in 1800, declining to 4
per 1,000 in 1860 to 1870 (Daniel et al; 1994. ). Presumably public health
measures also played a role in these declining mortality rates.
TB morbidity and mortality rates due to TB steadily dropped during the 20th century
in the developed world, aided by better public health practices and widespread use of
the M. bovis BCG vaccine (discussed below), as well as the development of
antibiotics in the 1950s. This downward trend ended and the numbers of new cases
started increasing in the mid-1980s. The major causes of this were increased
homelessness and poverty in the developed world and the emergence of AIDS, with its
destruction of the cell-mediated immune response in coinfected persons. Only
by massive expenditures of funds and human resources, mainly by directly monitored
antibiotic delivery, has this "mini epidemic" of new TB cases been reversed in Europe
and the United States (Frieden et al; 1995).
However, the underdeveloped world is still suffering from TB, as shown by the
following statistics. The incidence of TB ranges from less than 10 per 100,000 in
North America to 100 to 300 per 100,000 in Asia and Western Russia to over 300 per
100,000 in Southern and Central Africa. There is one death from TB every 15 s (over
two million per year), and eight million people develop TB every year. Without
treatment, up to 60% of people with the disease will die (Kaye and Frieden. 1996).
Essentially all these cases are in the Third World (Wong et al; 1999), reflecting the
poverty and the lack of healthy living conditions and adequate medical care
(Waaler; 2002). This global crisis is compounded by the emergence of multidrug
resistance in countries like the former Soviet Union, South Africa, and India, where
some antibiotics are available but are of inferior quality or are not used for a sufficient
time to control the disease according to recommended regimens (Iseman; 1994,
O'Brien; 2001.).
6
Throughout the centuries, doctors and scientists have described TB in its many forms
and sought to understand the origins of the disease, in order to use this information for
better diagnoses, prevention, and cures. Hippocrates thought the disease was largely
inherited, while Aristotle (4th century B.C.) stressed its contagious nature, as did
Galen, greatest of Roman physicians, in the 2nd century A.D. This opposing view of
the origins of TB reemerged in the second half of 17th century, where Italian
physicians, continuing Galen's ideas and influencing countries in the
Mediterranean basin, still maintained that TB was contagious. Conversely, doctors and
savants in Northern countries favored constitutional or hereditary causes of this
disease. Reflecting the empiricism of medical authorities of the time like Paracelsus of
Switzerland, it was believed that the Southern theory of contagion was not rigorously
proven scientifically and did not explain why some people in urban settings did not get
TB even where there was a high incidence of the disease (Haas and Haas. 1996). This
philosophic difference, which can be paraphrased as the well-known nature-versus-
nurture conundrum, came to its high point in the 19th century. In 1865, Jean-Antoine
Villemin, a French military physician, reported that he had been able to give TB to
laboratory rabbits by inoculating them with tuberculous tissue from a cadaver. This
report was immediately assailed by the French medical establishment, notably Herman
Pidoux, who strongly maintained that there had to be more "modern" and more social
solutions to the problem of TB, which he and others felt arose in the poorer (working)
classes from external causes like malnutrition, poor sanitation, and overwork. The
report by Robert Koch 17 years later (Koch; 1882), which conclusively showed that
TB was indeed caused by a bacterium discredited many of Pidoux's arguments.
However, belief in the societal causes of TB still continued into the early 20th
century as the revolutionary syndicalist movement in France, in their struggle for an 8-
h working day, used TB as an example of a disease that was caused by overwork and
malnutrition. Contemporary exponents of this view tried to discredit Koch's
conclusive experiments, using arguments similar to those of Northern
European doctors of the 17th century and Pidoux and his colleagues (Barnes; 2000).
Starting with Edward Trudeau's work in the late 19th and the early 20th centuries, the
apparent dichotomy in explaining the etiology of tuberculosis was resolved. In a
classic experiment, which by today's standards might be considered
statistically limited, he showed that TB could be induced in rabbits with a purified
culture of virulent M. tuberculosis but that the environmental conditions in which the
7
animals were maintained greatly influenced the course of the disease (Trudeau; 1887).
In this study, five M. tuberculosis-infected rabbits were kept in a crowded, dark cage
with minimal food. Of these, four died of TB within 3 months, and one became
severely ill with the disease. When five similarly infected animals were allowed to live
outdoors on a small island with additional food, one rabbit died within a month of
infection but the other four were still alive after 6 months, with no sign of the disease.
The control series, i.e., five uninfected rabbits confined to a dark, crowded cage
with little food, became malnourished and clearly unhappy but did not get TB
(Trudeau; 1887). This simple experiment gave scientific validity to the treatment of
TB (fresh air and ample food) that was the basis of the TB sanitarium movement
started by European physicians in the mid-1800s and that was also used by Trudeau in
his Saranac Lake TB treatment center that opened in 1884. The history of research and
treatment of TB at the Trudeau Institute has been described in a fascinating and
informative review (Collins; 1998).
Thus, TB is caused by a bacterium, but environmental factors play a major role, an
idea that Rene Dubos clearly rearticulated 50 years ago (Dubos and Dubos; 1952). To
Dubos, purely medical solutions alone would not work to cure and prevent TB.
Unfortunately, the events of the last half of the 20th century have shown how
prescient he was. The antibiotic era, begun by the discovery of streptomycin by Schatz
and Waksman in the 1940s and its use to treat TB and followed by the introduction of
many other antibiotics like isoniazid, rifampin, and pyrazinamide that are useful
against TB, has not eliminated the disease (Ryan; 1992). Likewise, the widespread use
of BCG, an attenuated vaccine strain produced by the sequential passage of a
virulent M. bovis strain by Calmette and Guerin in Paris in the 1920s, has not lowered
the incidence of TB in recent years ( Andersen; 2002), and there is more TB today
than ever before (Waaler; 2002). Clearly, new vaccines and drugs are needed for TB
control, and approaches discussed in this review are designed to help in this search.
However, it is always important to remember Dubos' cautionary words, which stressed
the social nature of TB.
One third of the world's population is thought to be infected with M. tuberculosis,(
Dolin et al; 1994) and new infections occur at a rate of about one per second (World
Health Organization. November 2010). The proportion of people who become sick
with tuberculosis each year is stable or falling worldwide but, because of population
8
growth, the absolute number of new cases is still increasing (World Health
Organization. November 2010). In 2007 there were an estimated 13.7 million chronic
active cases, 9.3 million new cases, and 1.8 million deaths, mostly in developing
countries (World Health Organization. November 2009). In addition, more people in
the developed world contract tuberculosis because their immune systems are more
likely to be compromised due to higher exposure to immunosuppressive
drugs, substance abuse, or AIDS. The distribution of tuberculosis is not uniform across
the globe; about 80% of the population in many Asian and African countries test
positive in tuberculin tests, while only 5–10% of the US population test positive
(Robbins Basic Pathology ; 8th ed.).
1.4 WHO figure in TB
WHO estimates that the largest number of new TB cases in 2008 occurred in the
South-East Asia Region, which accounted for 35% of incident cases globally.
However, the estimated incidence rate in sub-Saharan Africa is nearly twice that of the
South-East Asia Region with over 350 cases per 100 000 population.An estimated 1.7
million people died from TB in 2009. The highest number of deaths was in the Africa
Region.
In 2008, the estimated per capita TB incidence was stable or falling in all six WHO
regions. However, the slow decline in incidence rates per capita is offset by population
growth. Consequently, the number of new cases arising each year is still increasing
globally in the WHO regions of Africa, the Eastern Mediterranean and South-East
Asia.
9
Table 1 : Estimated TB incidence, prevalence and mortality, 2009
(Source:WHO)
Incidence1 Prevalence 2 Mortality(excl. HIV)
WHO region
No. in
thousands
%
of global
total
Rate per
100 000
pop3
No. in
thousands
Rate per
100 000
pop3
No. in
thousands
Rate per
100 000
pop3
Africa 2 800 30% 340 3 900 450 430 50
The Americas 270 2.9% 29 350 37 20 2.1
Eastern
Mediterranean 660 7.1% 110 1 000 180 99 18
Europe 420 4.5% 47 560 63 62 7
South-East
Asia 3 300 35% 180 4 900 280 480 27
Western
Pacific 1 900 21% 110 2 900 160 240 13
Global total 9 400 100% 140 14 000 164 1 300 19
1 Incidence is the number of new cases arising during a defined period. 2 Prevalence is the number of cases (new and previously occurring) that exists at a given point
in time. 3 Pop indicates population.
(Sour
Fig
rce: WHO) (h
1: Tubercul
http://www.w
10
losis country
who.int/tb/cou
y profile for N
untry/data/pro
Nepal
files/en/indexx.html)
11
1.5 TB figure in Nepal
More than 90% of the global tuberculosis cases and deaths occur in the developing
world (World Health Organisation; 2007). One third of the global burden of
tuberculosis is from South East Asian Region where approximately 40% of total
population has been infected with tuberculosis (World Health Organization; 2006.).
Nepal is a landlocked country between India and China with 31% of the total
population of 26 million under the poverty line (Nepal National Planning
Commission; 2004.) and with 86% living in the rural area (Nepal Central Bureau of
Statistics; 2001.). Tuberculosis is a major public health problem in Nepal and ranks as
one of the most prevalent communicable disease throughout the country.
The NTP introduced Direct Observed Treatment Short course (DOTS) strategy in
1996 and the number of deaths from tuberculosis is reduced since then, but still 5,000
to 7,000 patients die due to tuberculosis in Nepal every year (National tuberculosis
programme: NTP Annual Report 2005/2006). There is clear political commitment
to control tuberculosis these days, which has led to a low case detection rate of sputum
smear positive pulmonary tuberculosis and enormous treatment success.
In Nepal 45% of total population are infected with TB and 40,000 people get TB every
year. 20,000 new sputum positive cases are seen every year and 5000-7000 people die
each year from TB. Delay in the diagnosis and treatment of tuberculosis cases spreads
the infection in the community, increases severity of the disease and is associated with
higher risk of mortality ( Toman K: World Health Organisation; 1979).
Nepal is a rural country, and the majority of its citizens are illiterate. There is
widespread belief in these rural communities that TB is a disease sent from God, and
only cursed or bad people get it. This causes many people who are infected with
tuberculosis to hide the disease and to deny immediate, if any, treatment. Taking such
things into consideration, the National Tuberculosis Centre (NTC) of Nepal has
envisaged the concept of community control of tuberculosis. Under this program, the
community is educated about symptoms of TB patients, and parents are made aware of
when their child needs to receive medical help. Additionally, active contact tracing of
children who are members of a household with infectious adults is especially
important under this program. With the help of many international organizations, NTC
has been w
other hand
diagnosed
treatment
In Nepal,
deadly dis
tubercular
often said
would be
exposed d
(Sou
working stron
d, NTC recom
d case. Now
success rate o
TB is preval
sease. The mo
r meningitis,
d that tubercu
exposed to t
do not necessa
Fig 2: Case
urce: Nationa
ngly to raise t
mmends the u
DOTS has b
of DOTS in N
ent in people
ost common T
tuberculoma
ular infection
tuberculosis d
arily develop
Finding and
l Tuberculosi
12
the BCG vac
use of DOTS
been started a
Nepal is nearly
e of all ages.
TB in children
a, TB nephrit
n is so comm
during his ch
this disease.
d Treatment
is Control Pro
(2009/2010)
ccination cove
therapy for th
all over the c
y 90%.
Children as w
n are are tube
tis, TB abdom
mon in Nepal
hildhood, thou
outcome for
ogramme Nep
)
erage in child
he manageme
country, and
well are besie
rcular lympha
men and TB
that almost
ugh all childr
TB in Nepal
pal) ; FY 2066
dren. On the
ent of every
the present
eged by this
adenopathy,
bone. It is
every child
ren who are
l.
6/67 –
13
1.6 History of TB in Nepal
To cope up with this problem, Tuberculosis Control Programme (TBCP) was launched
by GON of Nepal almost about four decades back. The first step taken for TB Control
was in 1937 with the establishment of ‘Tokha Sanatorium' situated on the north of
Kathmandu city. Secondly, the Central Chest Clinic (CCC) came into existence in
1951 with the facility of Diagnosis and Treatment services for the TB patients on
domiciliary basis.
Simultaneously, Nepal Anti-TB Association (NATA) was established in 1953 and
initiated its TB Control services with opening of outpatient Clinic in 1955 and
established a Chest Hospital in 1970.
Similarly, in 1965, TBCP was systematically organized with tripartite agreement
between GON of Nepal, WHO and UNICEF, and since then TBCP started a
nationwide TB control service programme adopting preventive measures like: BCG
vaccination, active case-findings and distribution of drugs in different integrated
Health Posts. In the meantime, various National and International experts
recommended that both CCC and TBCP should be amalgamated into one centre as
National Tuberculosis Centre (NTC) with a view that all TB Control activities should
be conducted under the leadership of National Tuberculosis Control Programme
(NTP).
As a result the National Tuberculosis Centre in Thimi, Bhaktapur at the central level
and Regional Tuberculosis Centre (RTC) at the regional level in Pokhara were
established in 1989 with the cooperation of Japan International Cooperation Agency
(JICA) in order to strengthen the activities of NTP.
1.7 TB infection and disease
It is not necessary that all the individuals who are infected with the TB must develop
TB disease. In case of TB infection the immune system keeps the bacteria under
control so that it cannot progress to develop disease. Host immune system does so by
generating macrophages that surrounds the tubercle baccilli. Hence, the immune
system is highly effective in containing the pathogen, but fails to eradicate it. Disease
typically develops through reactivation once the immune system is weakened. Eg. in
14
people with weakened immune systems, including those with HIV, TB organisms can
easily overcome the body's defenses, multiply, and cause an active disease. 10 % of all
HIV patients develop MTB in their lifetime.
MTB is present inside body in both cases. The differences between the TB infection
and TB disease are listed in a table as follows:
TB infection TB disease
This occurs when a person has the TB
bacteria in his/her body, but does not
have symptoms of the disease.
This occurs when a person exhibits
symptoms of an active infection. e.g.
fever, cough, etc.
This person would have a positive skin
test but a normal chest x-ray.
The person would have a positive skin
test and a positive chest x-ray.
No illness. Might be ill.
The person is not infectious. The person is infectious unless the
treatment is started.
Also called “Dormant TB” and can’t be
defined as a clear case of TB.
Also called “Active TB” and can be
defined as clear case of TB.
Negative sputum smears and cultures. Positive sputum smears and cultures.
Scientific classification of Mycobacterium tuberculosis:
Kingdom Bacteria
Phylum Actinobacteria
Class Actinobacteria
Subclass Actinobacteridae
Order Actinomycetales
Suborder Corynebacterineae
Family Mycobacteriaceae
Genus Mycobacterium
Species tuberculosis
15
Fig 3: Phylogenetic Position of the tuberculosis within the Genus Mycobacterium:
The blue triangle corresponds to tubercle bacilli sequences that are identical or
differing by a single nucleotide
It has different other common names such as "Bacillus tuberculosis" (Zopf 1883)
Klein 1884, "Bacterium tuberculosis" Zopf 1883, "Mycobacterium tuberculosis typus
humanus" Lehmann and Neumann 1907, "Mycobacterium tuberculosis var. hominis"
Bergey et al. 1934, Bacillus tuberculosis, Bacterium tuberculosis, Mycobacterium
tuberculosis (Zopf 1883) Lehmann and Neumann 1896, Mycobacterium tuberculosis
typus humanus, Mycobacterium tuberculosis var. hominis etc.
Bacteria (singular: bacterium) are ubiquitous in every habitat on Earth, growing in
soil, acidic hot springs, radioactive waste (Fredrickson et al. 2004) water, and deep in
the Earth's crust, as well as in organic matter and the live bodies of plants and animals.
There are approximately ten times as many bacterial cells in the human flora as there
are human cells in the body, with large numbers of bacteria on the skin and as gut
flora (Sears; 2005. "A dynamic partnership: celebrating our gut flora"). A few species
of bacteria are pathogenic and cause infectious diseases. The most common fatal
bacterial diseases are respiratory infections like tuberculosis.
16
Actinobacteria is one of the dominant phyla of the bacteria. They are a group of Gram-
positive bacteria with high guanine and cytosine content. They can be terrestrial or
aquatic.
Actinomycetales is an order of Actinobacteria. They are Gram positive, however
several species have complex cell wall structures that makes the gram
staining unsuitable like Mycobacteriaceae. Corynebacterineae is a suborder of
the Actinomycetales, and includes most of the acid-fast bacteria. It is a high G+C
gram positive bacteria.
Mycobacterium is a genus of Actinobacteria, given its own family, the
Mycobacteriaceae. The genus includes pathogens known to cause serious diseases in
mammals, including Mycobacterium tuberculosis ( Ryan and Ray; Sherris Medical
Microbiology. 2004). Latin prefix "myco—" means both fungus and wax; its use here
reflects the "waxy" compounds that compose parts of the cell wall.
1.8 Structure of MTB
MTB is a single-celled, prokaryotic microorganism. It has a shape of rod so it is also
called as bacillus. The rods are 2-4 micron long and have width of 0.2-0.5 microns. It
obligate aerobe so is mostly found in the well aerated upper parts of the lungs. It is
rarely pleomorphic so they generally don’t elongate into filaments and branch into
chains when observed in clinical specimens of cultures. It has slow generation time of
15-20 hours, that plays an important role in its virulence. When numerous and actively
multiplying, it is strongly acid fast and shows distinct tendency to form hydrophobic
bundles.
17
Fig 4: M. tuberculosis in EM
Fig 5: Colonies in Lowenstein-Jansen medium
Fig 6: Acid-fast stain
18
1.9 Cell Wall composition
Mycobacterium tuberculosis is an aerobic and non motile that are
characteristically acid-alcohol fast (Ryan and Ray; Sherris Medical Microbiology;
2004). It does not contain endospores or capsules and are usually considered as Gram-
positive. As it does not retain the crystal violet stain well it can’t be categorized as
Gram-positive strain and is classified as an acid-fast Gram-positive bacterium due to
their lack of an outer cell membrane. The cell wall consists of the hydrophobic
mycolate layer and a peptidoglycan layer held together by a
polysaccharide, arabinogalactan. The cell wall makes a substantial contribution to the
hardiness of this bacteria. The biosynthetic pathways of cell wall components are
potential targets for new drugs for tuberculosis( Bhamidi; 2009. Mycobacterial Cell
Wall Arabinogalactan).
The cell wall structure of Mycobacterium tuberculosis is unique among prokaryotes
which determines virulence for the bacterium. The cell wall complex
contains peptidoglycan and lipids. Over 60% of the mycobacterial cell wall is lipid. It
shares a characteristic cell wall, thicker than in many other bacteria, which
is hydrophobic, waxy, and rich in mycolic acids. Mycolic acids are unique alpha-
branched lipids found in cell walls of Mycobacterium. They make up 50% of the dry
weight of the mycobacterial cell envelope. They are strong hydrophobic molecules
which form a lipid shell around the organism and affect the cell surface permeability
properties. They also help to determine the virulence in MTB and prevent attack by
cationic proteins, lysozyme, and oxygen radicals in the phagocytic granule. They also
protect extracellular mycobacteria from complement deposition in serum (Todar;
Todar’s Online Textbook of Bacteriology. 2011).
The high concentration of lipids have different properties such as:
Impermeability to stains and dyes; Resistance to many antibiocs and acidic or alkaline
compounds; Resistance to osmotic lysis via complement deposition ; Resistance to
lethal oxidations and survival inside of macrophages.
19
Fig 7: The structure of the Mycobacterium tuberculosis cell wall.
This figure shows a schematic representation of the major components of the cell wall
and their distributions. The inner layer is composted of peptidoglycan which is
covalently linked to arabinogalactan layer. The outer membrane contains mycolic
acids, glycolipids like (mannose-capped) lipomannan, and mannoglycoproteins
(Kleinnijenhuis; 2011)
1.10 Causes and factors of MTB
1.10.1 Causes of MTB
Tuberculosis is an infection caused by the rod-shaped, non–spore-forming, aerobic
bacterium Mycobacterium tuberculosis. It is spread by small airborne droplets, called
droplet nuclei, generated by the coughing, sneezing, talking, or singing of a person
with pulmonary or laryngeal tuberculosis. These minuscule droplets can remain
airborne for minutes to hours after expectoration (Lee et al; 2005).
1.10.2 Factors in acquiring TB infection and TB disease
The number of bacilli in the inoculum and the relative virulence of the organism are
the major factors in determining transmission of the disease. TB is transmitted by
20
inhaling the tubercle bacilli so seen more in people who are living with someone who
has active TB (Braun et al; 1989).
Persons who have received anti-TB drugs are much less infectious than those who
have not received any treatment. Risk factors for acquiring TB are usually exogenous
to the patient, so the chance of infection depends on the environment. Environmental
factors mainly contribute to the likelihood of acquiring infection. Currently, TB is the
leading cause of mortality among infectious diseases worldwide, and 95% of TB cases
and 98% of deaths due to TB occur in developing countries (Rajeswari et al; 1999).
The concentration of bacilli also depends on the ventilation of the surroundings and
exposure to ultraviolet light. Thus, overcrowding, poor housing and inadequate
ventilation predispose individuals to the development of TB.
However, the development of TB disease also depends on inherent immunologic
status of the host. Defects in cell-mediated immunity (CMI) is a major determinant for
development of this disease. In fact, infection with HIV is one of the most significant
risk factors for TB infection. Case rates for persons who are dually infected with HIV
and M. tuberculosis exceed the lifetime risk of persons with TB infection who are not
infected with HIV.
Malnutrition interferes with the CMI response and therefore accounts for much of the
increased frequency of TB in poor patients.Individuals with certain human leukocyte
antigen (HLA) types have a predisposition to TB. Hereditary factors such as presence
of Bcg gene also play a great role in acquiring this disease. Steroid therapy, cancer
chemotherapy, and hematologic malignancies also increase the risk of TB.
Tuberculosis has been also reported in patients treated for arthritis, inflammatory
bowel disease, and other conditions with tumor necrosis factor (TNF)-alpha
blockers/antagonists (Vandana Batra; Pediatric tuberculosis; 2011).
It is also mostly prevalent in people who abuse alcohol and use intravenous drugs. The
elder people are more prone to this disease and the healthcare workers who come in
contact with high-risk populations have high chance of acquiring it.
21
1.11 Stages of Tuberculosis
Generally development of TB in human body is divided into 5 stages. But several
people infected with M. tuberculosis never develop active TB. In those cases, the
development of disease may terminate in the initial stages. In people with weakened
immune systems, including those with HIV (human immunodeficiency virus), TB
organisms can overcome the body's defenses, multiply, and cause an active disease
and succeed to the fifth stage.
STAGE 1: EXPOSURE
This is the first stage of the development of TB in the body. This occurs when a
person has been in contact, or exposed to, another person who is thought to have or
does have TB. Healthy individuals may inhale the droplets of nuclei containing few
bacilli. These droplets may be generated by talking, coughing and sneezing of the
diseased ones.
The route of entry of the tubercle bacillus into the body is via the respiratory tract
through the inhalation of respiratory droplet nuclei, which are small enough in size to
allow passage into the lower respiratory tract (Riley et al; 1995). MTB is inhaled
through the lungs and is typically engulfed by alveolar macrophages, non-specifically.
The macrophages will not be activated, therefore unable to destroy the intracellular
organism. Droplets of a larger size are efficiently excluded from the lower respiratory
tract by the physical barriers of the nasopharynx and upper respiratory tract so don’t
develop disease. But the smaller droplet (1 to 2 µm or less) nuclei reach air sacs of the
lung that is alveoli (Wells; 1955). This way the infection begins and disease onset can
be observed. If the exposed person are examined then they will have a negative TB
skin test, a normal chest x-ray, and exhibit no symptoms of the disease.
Fig
STAGE 2
Once orga
(Dannenbe
bacilli, su
the future;
causing cl
Dis
g 8: Transmis
2 :DISEASE P
anisms have
erg; 1994). T
ch that the p
; the organism
linical disease
seased Individ
ssion of TB f
PROGRESSI
made their w
The initial hos
atient has no
ms can begin
e known as p
dual
22
from Disease
ION
way into the
st response ca
chance of de
to multiply a
primary tuber
Aerosol
d to a health
lung, they h
an be comple
eveloping tub
and grow imm
rculosis; bacil
Health
s
hy Individual
have four pot
tely effective
berculosis at
mediately aft
lli may becom
hy Individual
l
tential fates
e and kill all
any time in
er infection,
me dormant
23
and never cause disease at all, such that the patient has what is referred to as latent
infection, manifest only by a positive tuberculin skin test; or the latent organisms can
eventually begin to grow, with resultant clinical disease, known as reactivation
tuberculosis.
The second stage begins only 7-21 days after the initial infection. Other macrophages
from different parts diffuse from peripheral blood. They ultimately uptake TB by
phagocytosis and become inactivated as well. This inactivation makes them unable to
destroy TB. Phagocytosed TB cells multiply within the inactivated macrophages and
render them to burst.
STAGE 3 : DISEASE PROGRESSION
The immune response to M. tuberculosis is T cell dependent. They recognize TB
antigen. This results in T-cell activation and the release of Cytokines, including
interferon (IFN). The release of IFN causes the activation of macrophages, which can
release lytic enzymes and reactive intermediates that facilitate immune pathology and
develop CMI response. This also causes formation of tubercle, which contains a semi-
solid or “cheesy” consistency. TB cannot multiply within tubercles due to low pH and
anoxic environment, but can persist within these tubercles for extended periods.
STAGE 4: DISEASE PROGRESSION
Despite the fact that many macrophages get activated and surround the tubercles,
almost all macrophages are either inactivated or poorly activated. TB uses these
macrophages to replicate causing the tubercle to grow. The growing tubercle tends to
invade bronchus, causes an infection which may spread to other parts of the lungs. It
may also invade artery or other blood supply by the process called haematogenesis.
Spreading of TB may cause small lesions having size of millet grain so it is also called
as miliary tuberculosis, which may cause secondary lesions. Secondary lesions occur
in bones, joints, lymph nodes, genitourinary system and peritoneum.
STAGE 5
The initiation of the last stage starts with the liquefaction of the damaged tissues
(caseous center) of tubercles. This liquid is very crucial for the growth of TB, and
24
therefore it multiplies rapidly and extracellularly. This later turns into a large antigen
load, and causes the walls of nearby bronchi to become necrotic and ultimately
ruptures. This leads to cavity formation and allows TB to spread rapidly into other
airways and to other parts of the lung.
Calcification of primary lesions may lead to formation of Ghon complex. Small
metastatic foci may also calcify to form foci containing viable organisms, called as
Simon foci. They are readily visible upon chest X-ray. Later in this stage the person
exhibits symptoms of an active infection. The person would have a positive skin test,
a positive chest x-ray, and might be ill.
Fig 9: Infection of Tuberculosis and role of immune cells
1.12 Nature of MTB
Mycobacterium tuberculosis is an obligate aerobe. For this reason, in the classic case
of tuberculosis, MTB complexes are always found in the well-aerated upper lobes of
the lungs. The bacterium is a facultative intracellular parasite, usually of macrophages,
and has a slow generation time, 15-20 hours, a physiological characteristic that may
contribute to its virulence.
MTB is not classified as either Gram-positive or Gram-negative because it does not
have the chemical characteristics of either, although the bacteria do contain
25
peptidoglycan (murein) in their cell wall. If a Gram stain is performed on MTB, it
stains very weakly Gram-positive or not at all (cells referred to as "ghosts").
1.13 Genome of MTB
The genome of M. tuberculosis is 4,411,522 base pairs long with 3,924 predicted
protein-coding sequences, and a relatively high G+C content of 65.6%. At 4.4 Mbp,
M. tuberculosis is one of the largest known bacterial genomes Of the genome of M.
tuberculosis, 90.8% of the genome contains protein-coding sequences with only 6
pseudogenes, compared to the 1,116 pseudogenes on the M. leprae genome.
1.14 Immune system roles in MTB
Generally protective immunity to tuberculosis is mainly due to T-cell-mediated
immunity, with CD4+ T cells playing a crucial role. Different immunological and
genetic studies support that innate immunity is related in tuberculosis. The first step in
the innate host defense is cellular uptake of M. tuberculosis, which involves different
cellular receptors and humoral factors. The next step is the immune recognition of M.
tuberculosis by Toll-like receptors. The inflammatory response is regulated by
production of pro- and anti-inflammatory cytokines and chemokines. Different natural
effector mechanisms for killing of M. tuberculosis have now been identified. Finally,
the innate host response is necessary for induction of adaptive immunity to M.
tuberculosis( SCHLUGER and ROM; 1998)
1.15 Binding of M. tuberculosis to Monocytes and Macrophages
The first line of defense against infection with M. tuberculosis after it reaches the
lower respiratory tract is by the alveolar macrophage. This cell inhibits growth of the
bacillus through phagocytosis and plays a great role in cellular immunity through the
process of antigen presentation and formation of T-lymphocytes (Riley; 1996). Other
antigen-presenting cells such as dendritic cells are present in large numbers in the
airways but their exact role in host defense against tuberculosis has not been well
established till date (Steinman; 1993). Processes involved in phagocytosis include
binding of the bacterium to the host cell, internalization, and finally growth inhibition
or killing. As a general phenomenon, phagocytosis usually begins with the
26
phagocytic cell engulfing the invading microbe by engulfing it in a membrane-
bound tight vacuole (Schlesinger; 1996).
1.16 Overview of T-cell Function and cytokine production
Many types of T-lymphocytes (including α / β CD4+ and CD8+ cells, cytotoxic T-
lymphocytes, and / T-lymphocytes) play different roles in host defense
against M. tuberculosis. But the major effector cell in cell-mediated immunity in
tuberculosis is the CD4+ T-lymphocyte (Boom; 1996). Studies demonstrate
enrichment of CD4+ T-cells at sites of disease, and this response is diminished in
HIV-infected patients ( Law et al; 1996). Although blood monocytes
sequester M. tuberculosis from CD4+ T-cells in vitro, there is no evidence that this
occurs in the lungs in patients, underscoring the importance of comparing in vitro to in
vivo investigation ( Pancholi et al; 1993).
A new model about the functions of CD4+ T-cells and their relationship to the
manifestations of disease has been developed these days which suggests that CD4+
helper T-cells can be separated into at least two phenotypic classes, TH1 and TH2.
Fig 10: Overview of macrophage-lymphocyte interactions in tuberculosis.
Type 1 CD4+ T-lymphocytes (TH1) and natural killer T-lymphocytes (NK cells)
secrete interferon gamma, which leads to activation of alveolar macrophages to
produce a variety of substances. These substances include reactive oxygen and
nitrogen species, which are involved in growth inhibition and killing of mycobacteria.
Macrophages can also secrete interleukin-12 (IL-12) in a positive feedback loop to
amplify this pathway. Although interleukin-4 and -10 can inhibit macrophage
function, there is no convincing evidence that these cytokines are present in
27
great amounts in the lungs of patients with tuberculosis, perhaps because of interferon-
mediated suppression of TH2 (type 2 CD4+ T-lymphocytes) cell function
(Schluger and Rom; 1998).
Fig 11: Inflammatory response of phagocytic cells.
Immune recognition of M. tuberculosis by macrophages and dendritic cells is followed
by an inflammatory response with a crucial role for cytokine production. Initial events
in this cellular response include nonspecific host defense mechanisms, which may lead
to early killing or containment of infection. In addition, various cellular products,
including cytokines and cell surface markers, are involved in these processes as
depicted in the figure (in italics). (Crevel; 2002)
1.17! Diagnosis of Tuberculosis
Tuberculosis is diagnosed by finding Mycobacterium tuberculosis bacteria in a clinical
specimen taken from the patient. A complete medical evaluation for tuberculosis (TB)
must include a medical history, a physical examination, a chest X-ray and
microbiological examination (of sputum or some other appropriate sample). It may
also include a tuberculin skin test, other scans and X-rays, surgical biopsy.
28
1.17.1. Medical history
The medical history includes obtaining the symptoms of pulmonary TB: productive,
prolonged cough of three or more weeks, chest pain,low grade remittent fever, chills,
night sweats, appetite loss, weight loss, easy fatiguability, and production of sputum
that starts out mucoid but changes to purulent. Other parts of the medical history
include prior TB exposure, infection or disease; past TB treatment; demographic risk
factors for TB; and medical conditions that increase risk for TB disease such as HIV
infection. Tuberculosis should be suspected when a pneumonia-like illness has
persisted longer than three weeks, or when a respiratory illness in an otherwise healthy
individual does not respond to regular antibiotics.
1.17.2. Physical examination
A physical examination is done to assess the patient's general health and find other
factors which may affect the TB treatment plan. It cannot be used to confirm or rule
out TB.
1.17.2.1. Chest X-ray
In active pulmonary TB, infiltrates and/or cavities are often seen in the upper lungs
However, lesions may appear anywhere in the lungs. In disseminated TB a pattern of
many tiny nodules throughout the lung fields is common - the so called miliary TB. In
HIV and other immunosuppressed persons, any abnormality may indicate TB or the
chest X-ray may even appear entirely normal.
Abnormalities on chest radiographs may be suggestive of, but are never diagnostic of
TB. However, chest radiographs may be used to rule out the possibility of pulmonary
TB in a person who has a positive reaction to the tuberculin skin test and no symptoms
of disease.
1.17.2.2. Abreugraphy
A variant of the chest X-Ray, abreugraphy! was a small radiographic image, also
called miniature mass radiography (MMR) or miniature chest radiograph. Though its
resolution is limited it is sufficiently accurate for diagnosis of tuberculosis.
29
Much less expensive than traditional X-Ray, MMR was quickly adopted and
extensively utilized in some countries during 1950s. The procedure went out of favor,
as the incidence of tuberculosis dramatically decreased, but is still used in certain
situations, such as the screening of prisoners and immigration applicants.
1.17.3. Acid Fast Staining/ Ziehl-Neelsen staining(AFB TEST)
Since M. tuberculosis has a cell wall rich of mycolic acid, it usually takes poor gram
stain and is generally useless. So Acid Fast Staining (Ziehl-Neelsen staining) is
usually performed. It is a popular and cheaper diagnostic technique for tuberculosis
but it also gives positive stains for other mycobacteria.
The lipid capsule of the acid-fast organism takes up carbolfuchsin and resists
decolorization with a dilute acid rinse. The lipid capsule of the mycobacteria is of such
high molecular weight that it is waxy at room temperature and successful penetration
by the aqueous based staining solutions (such as Gram's) is prevented
1.17.4. Tuberculin skin test (TST)/ PPD skin test
Tubercuin test is the standard method of determining whether a person is infected with
Mycobacterium tuberculosis. Basically it is uesd to detect latent tubreculosis. The TST
is performed by injecting 0.1 ml of tuberculin purified protein derivative (PPD)
antigen into the inner surface of the forearm. This provokes a hypersensitivity skin
reaction (a red raised bump) in those who may have been infected by M.
tuberculosis. The injection should be made with a tuberculin syringe, with the needle
bevel facing upward. The TST is an intradermal injection. When placed correctly, the
injection should produce a pale elevation of the skin 6 to 15 mm in diameter. The skin
test reaction should be read between 48 and 72 hours after administration. The
reaction should be measured in millimeters of the induration (palpable, raised,
hardened area or swelling).TST is only an evidence for significant exposure to TB.
The results of this test must be interpreted carefully. The person's medical risk factors
determine at which increment (5mm, 10mm, or 15mm) of induration the result is
considered positive. A positive result indicates TB exposure.
5mm or more is positive in
30
• HIV-positive person
• Recent contacts of TB case
• Persons with nodular changes on chest x-ray consistent with old healed TB
• Patients with organ transplants and other immunosuppressed patients
10mm or more is positive in
• Recent arrivals (less than 5 years) from high prevalence countries
• injection drug users
• Residents and employees of high-risk congregate settings (e.g., prisons,
nursing homes, hospitals, homeless shelters, etc.)
• Mycobacteriology lab personnel
• Persons with clinical conditions that place them at high risk (e.g., diabetes,
leukemia, end-stage renal disease, low body weight, etc.
1.17.5. CULTURE:
Culture is considered as the gold standard for both diagnosis and drug sensitivity
testing In addition to the preparation of a direct, acid-fast stained smear, it is
recommended that the sputum samples should be cultured for M. tuberculosis
whenever this disease is clinically suspected. It is expensive to culture all sputum
samples routinely for tubercle bacilli and this is not recommended. Sputum from
patients with tuberculosis often contains some solid particles of material derived from
the lungs, and this material should be selected for culture whenever it is found.
However, even infected sputum is coughed up through the throat and mouth and
contamination with the normal flora is inevitable. These contaminating bacteria must
be killed, if the LJ cultures are not to become overgrown. A concentration
(decontamination) procedure is therefore necessary for all specimens collected from a
site where a normal flora is present.
The growth of MTB may take 6 to 8 weeks from day of inoculation. Many different
media have been devised for cultivating! M. tuberculosis bacilli, and the three main
groups can be categorized as:
1. egg-based media (Lowestein-Jensen medium, OGAWA medium, Petragnini
medium and Dorset medium)
31
2. agar-based media (BACTEC medium, Middlebrook 7H10 and 7H11 Agar Medium)
3. liquid media.(Herman-Kirchner Liquid Medium, Dubosoleic Acid-Albumin Liquid
Medium, Middlebrook 7H9 Broth, Proskauer and Beck's medium, Sula's medium,
Sauton's medium)
1.17.5.1. Few widely used culture System
1.17.5.1.1. The rapid radiometric culture system
The rapid radiometric culture system or BACTEC (Becton-Dickinson) has been
accepted for the culture isolation of mycobacteria using an enriched Middlebrook
7H12 containing 14C labeled palmitic acid(1). This medium is otherwise called
BACTEC 12B. Mycobacterial growth is determined by the utilization of 14C with
release of 14CO2 by the multiplying mycobacteria and is! detected in an ionic
chamber with electronic detector in the BACTEC instrument. In comparison! to the
conventional M. tuberculosis culture using Lowenstein-Jensen Media, the BACTEC
system! gives early culture results with differentiation of M. tuberculosis from
mycobacteria other than! M. tuberculosis.
1.17.5.1.2. Lowestein-Jensen medium culture system
The Lowenstein-Jensen medium, more commonly known as LJ medium, is a growth
medium specially used for culture of Mycobacterium, notably Mycobacterium
tuberculosis.
When grown on LJ medium, M. tuberculosis appears as brown, granular colonies
(sometimes called "buff, rough and tough"). The media must be incubated for a
significant length of time, usually four weeks, due to the slow doubling time of M.
tuberculosis compared with other bacteria (15-20 hours).
1.17.6. Nucleic Acid Amplification Test(NAAT)
NAAT techniques require strong laboratory capacities, good quality control
procedures,and remain relatively expensive. The use of NAAT techniques remains
technically! challenging. Despite being usually highly specific, NAA tests have lower
(and greatly! variable) sensitivity. A positive NAA test is considered good evidence
32
of infection but a! negative result is not informative enough. Use of NAA tests has
not been recommended ! for sputum negative patients. As these tests cannot
distinguish live from dead bacteria,! they cannot be used for patients receiving
treatment. One study considered that current! NAA tests cannot replace microscopy
or culture, and should be used only in conjunction! with these tests and clinical data.
1.17.7. Amplified Mycobacterium tuberculosis direct test (AMDT)
AMDT Test is a target-amplified nucleic acid probe test for the in vitro diagnostic
detection of rRNA of Mycobacterium tuberculosis complex in acid-fast bacilli (AFB)
smear positive and negative sputum samples. This is a polymerase chain reaction
(PCR) that use oligonucleotides based on the repetitive sequence (IS986) of
Mycobacterium tuberculosis as a primer. The Amplified Mycobacterium Tuberculosis
Direct Test (AMDT) is a combination of an M. tuberculosis rRNA amplification
method with the hybridization protection assay, which were used for detection of M.
tuberculosis in clinical samples. This test relies on the enzymatic amplification of
ribosomal RNA via DNA intermediates, with detection of the amplified product by an
acridinium-ester-labeled DNA probe. MTB complex. It’s an isothermal transcription-
mediated amplification (TMA) test in which the target is the mycobacterial 16SrRNA.
The entire process is performed at 42ºC. MTB culture-positive specimens that were
smear-negative were detected by AMDT in 77% of cases.
1.17.7.1. In-house PCR
Most protocols use the repeat insertion sequence IS6110 as a target for amplification.
This sequence is specific to the M. tuberculosis complex and is present in many copies
in the M. tuberculosis genome. It is often cheaper than commercial kits but lack of
standardization may make it difficult to compare between different centers or studies.
Each test needs its own validation studies.
1.17.7.2. Real-time PCR
Real-time PCR is also known as Quantitative PCR(QPCR). The name “Real-Time”
indicates that this system allows us to actually view the increase in the amount of
DNA as it is amplified. Different probes have been used like the TaqMan probe,
fluorescence resonance energy transfer (FRET) probes, molecular beacons and
33
bioprobes. Real-time PCR was initially applied to M. tuberculosis strains but more
recently it has been successfully applied directly in clinical samples.
Real Time PCR for Mycobacterium tuberculosis is performed in IS6110 like target,
with 12.5Kb of insertional region that is very specific to M.tuberculosis and not
M.bovis. To insure and eliminate false positive and false negative scenarios, an
internal control is also simulatneously amplified along with the target.
1.18 Treatment of TB
The overall goals for treatment of tuberculosis are:
• to cure the individual patient, and
• to minimize the transmission of Mycobacterium tuberculosis to other persons
Thus, successful treatment of tuberculosis has benefits both for the individual patient
and the community in which the patient resides. The standard recommended treatment
regimen includes 4 antituberculosis drugs: Isoniazid (INH), Rifampicin (RIF),
Pyrazinamide (PZA), and either ethambutol (EMB) or streptomycin (SM) given daily
for 2 months (60 doses), followed by 4 months of 2 drugs (usually INH + RIF; 120
doses).
1.18.1 First line Treatment:
Tuberculosis, which results from an infection with Mycobacterium tuberculosis, can
usually be cured with a combination of first-line drugs taken for several months. Here
are the four drugs in the standard regimen of first-line drugs and their modes of action.
1.18.2 Second line Treatment
There are six classes of second-line drugs (SLDs) used for the treatment of TB. A drug
may be classed as second-line instead of first-line for one of three possible reasons:
1. it may be less effective than the first-line drugs
2. it may have toxic side-effects
3. it may be unavailable in many developing countries
• aminoglycosides: e.g., amikacin (AMK), kanamycin (KM);
34
• polypeptides: e.g., capreomycin, viomycin, enviomycin;
• Fluoroquinolones: e.g., ciprofloxacin (CIP), levofloxacin, moxifloxacin
(MXF);
• thioamides: e.g. ethionamide, prothionamide
• cycloserine (the only antibiotic in its class);
• p-aminosalicylic acid (PAS or P).
1.18.3 Third line Treatment
These drugs may be considered "third-line drugs" and are listed here either because
they are not very effective (e.g., clarithromycin) or because their efficacy has not been
proven.
Other drugs that may be useful, but are not on the WHO list of TLDs:
• rifabutin
• macrolides: e.g., clarithromycin (CLR)
• linezolid (LZD)
• thioacetazone (T)
• thioridazine
• arginine
• vitamin D
• R207910
1.19 DOTS THERAPY
Directly Observed Therapy Short Course (DOTS) means that a supervisor watches the
client swallowing the medication for all doses over the course of treatment. This
ensures that a TB client takes the correct drugs, the correct dose, and at the correct
times. Treatment with properly implemented DOTS has a success rate exceeding 95%
and prevents the emergence of further multi-drug resistant strains of tuberculosis.
Administering DOTS, decreases the possibilities of tuberculosis from recurring,
resulting in a reduction in unsuccessful treatments.
1.20 Drug Resistant Tuberculosis
35
Drug resistant tuberculosis is a type of TB that cannot be killed by the most common
kinds of TB antibiotics. Drug resistant TB develops when TB medicines are used
inappropriately, i.e. non-adherence, allowing the TB germ to change itself so that the
medications no longer work. Resistance can happen when treatment fails.
Treatment might fail if:
• Not enough medication is given (too small a dose)
• The whole dose is not taken
• TB medicines are not taken together
• Too many doses are missed
• Medication is frequently started and stopped
• Wrong medication prescribed/used
People can also get drug resistant TB by breathing in a germ that is already drug
resistant or if their medication treatment for TB had failed in the past. In some
countries TB drugs can be purchased by anyone without a prescription. This has
contributed to incorrect use of the drugs and the development of drug resistant TB. In
other cases doctors who are not experienced with TB have prescribed medications
incorrectly, again leading to drug resistant TB. Directly observed therapy also helps
prevent drug resistant TB by helping clients take their medicine correctly. There are
limited numbers of medicines that are effective against TB. If one or more of these
medicines are not effective because the germ has become resistant, the treatment
becomes longer and more complicated. Preventing drug resistant TB is very important.
36
Chapter II
LITERATURE REVIEW
37
2.1 The Mycobacterium tuberculosis Genome Analysis of H37Rv strain
The complete genome sequence of the best-characterized strain of Mycobacterium
tuberculosis, H37Rv, has been determined and analysed. The genome comprises
4,411,529 base pairs, contains around 4,000 genes, and has a very high guanine +
cytosine content that is reflected in the biased amino-acid content of the proteins. M.
tuberculosis differs radically from other bacteria in that a very large portion of its
coding capacity is devoted to the production of enzymes involved in lipogenesis and
lipolysis, and to two new families of glycine-rich proteins with a repetitive structure
that may represent a source of antigenic variation.
On the basis of the systematic sequence analysis of 26 loci in a large number of
independent isolates, it was concluded that the genome of M. tuberculosis is either
unusually inert or that the organism is relatively young in evolutionary terms.
(Sreevatsan et al.,m 1997). Sequence analysis of the H37Rv culminated in a composite
sequence of 4,411,529 base pairs (bp), with a G + C content of 65.6%. Several regions
showing higher than average G + C content were detected; these correspond to
sequences belonging to a large gene family that includes the polymorphic G + C-rich
sequences (PGRSs).
The original sequence and annotation of Mycobacterium tuberculosis strain H37Rv
identified 3974 genes (Cole et al., 1998). This included 3924 genes thought to encode
proteins and 50 encoding stable RNA. Following the re-annotation, 82 additional
genes have been included. All of the new genes are believed to encode polypeptides
and no change has been detected in the number of RNA molecules (Camus et al.,
2002).
38
Fig 12: Circular map of M. tuberculosis H37Rv strain
from DNASTAR software. (Source: Cole et. al., 1998)
2.2 IS6110 gene
The identification of genetic differences among members of the M . tuberculosis
complex will also lead to a better understanding of virulence and host range
differences displayed by the members of the complex.
Southern blotting, sequence analysis and PCR experiments showed that
Mycobacterium bovis and Mycobacterium bovis BCG lack a 12.7 kb fragment present
39
in the genome of Mycobacterium tuberculosis. This region is 337 bp downstream of
the RD2 region, which was previously described as being absent from some M. bovis
BCG strains. The 12.7 kb fragment should be useful as a target for a PCR test to
differentiate M. tuberculosis and M. bovis. An analysis of the 12.7 kb region suggests
that it represents a deletion in M. bovis rather than an insertion in M. tuberculosis. The
deletion removes most of the mce-3 operon, one of four highly related operons which
may be involved in cell entry, and therefore it may contribute to differences in
virulence or host range in the two species.
A pair of primers that amplified only M . bovis DNA and not M . tuberculosis DNA
was designed; the amplified fragment was named MBSS (for Mycobacterium bovis
Specific Sequence). However, this fragment hybridized to DNA of both species,
showing a strong polymorphisin between M . bovis and M . tuberculosis. This region
is downstream of the RD2 region of the M . bovis genome identified by Mahairas et al.
(1996). Following the complete sequencing of the M . tuberculosis genome (Cole et
al., 1998), Zumarraga et al. ,1999 were able to analyse this region and identified a
novel and important genetic difference between M . tuberculosis and M . bovis.
Four pairs of primers were used. One of them was composed of primer 1Umbss
(ATCTACTTGCTCACCCTAACG), which anneals to the region common to both M.
bovis and M. tuberculosis located upstream of the M. tuberculosis 12.7 kb fragment,
and primer 3L12505 (CTGTGCTGCGGGCTGCCG), which anneals to the 12.7 kb
fragment near its 5' end, giving an amplification product of 1867 bp in M.
tuberculosis. Another pair was composed of primer 2U415
(ATGAAGGCAAACACCACG), which anneals to the 12-7 kb fragment near the 3'
end, and primer 6Lmbss (GCCGCCAAGGCAGCAGAGCAC), which anneals to the
region common to both M . bovis and M . tuberculosis located downstream of the 12.7
kb fragment, giving an amplification product of 969 bp in M. tuberculosis. A third pair
was formed by 4U4849 (CCGTGACAACGAAACTCA) and 5L5984
(CCAGTCCTCGCTGTAGGT) , which anneal to the central part of the 12.7 kb
fragment, giving a 1135 bp product in M. tuberculosis. Amplifications with 1Umbss
and 6Lmbss, which both anneal outside the 12-7 kb fragment, gave a 2198 bp product
in M . bovis. (Zumarraga et al. ,1999)
40
Fig 13: Schematic representation of the 12.7 kb fragment.
(Source: Zumarraga et al. ,1999)
MBSS (for Mycobacterium bovis Specific sequence) fragment hybridized to DNA of
both species. A search for the M . bovis MBSS sequence in the M . tuberculosis
H37Rv sequence database (Cole et al., 1998) at the Sanger Centre (Cambridge, UK)
revealed that the MBSS region was disrupted in this species by a 12.7 kb fragment.
The same result was observed when the genome of the M. tuberculosis CSU 93 strain
was sequenced at the Institute for Genomic Research (TIGR, Manassas, VA, USA).
To assess the distribution of the 12.7 kb deletion/ insertion in strains of the M .
tuberculosis complex, a PCR-based strategy was followed. Three pairs of primers
directed to both junctions and to the central part of the 12.7 kb region were used. Only
the M. tuberculosis genome was amplified with primers 4U4849 and 5L5984 giving
products of the expected sizes; no amplification was observed in M . bovis, M .
microti, M . africanum and mycobacterial strains isolated from wild seals. M.
tuberculosis DNA, but not M . bovis DNA, was amplified with the other two pairs of
primers, directed to both junctions.
An additional band of 800 bp of unknown nature was observed in the amplification
reactions with primers 1Umbss and 3L12505. Amplifications with lUmbss and
6Lmbss gave a 2198 bp product only in M . bovis. To ensure that the genomic M .
tuberculosis and M . bovis DNA in the samples could be amplified, PCRs were
performed in parallel using primers against the IS6110 sequence that is present in both
species. These PCRs always amplified a product of the expected size for IS6110.
(Zumarraga et al. ,1999).
41
When cloning the region downstream of the mp6-64 gene using a PCR based
Approach, there was amplification of M. bovis DNA; no amplification was seen with
M. tuberculosis DNA. The lack of amplification in M. tuberculosis was not because
this sequence is unique to M. bovis, but because a fragment of 12.7 kb is present
between the annealing sites of the primers in M. tuberculosis. The 12.7 kb
insertion/deletion was present in all the M. tuberculosis strains tested, which included
isolates from Argentina, Brazil and Venezuela. IS6110 RFLP data were not related. In
addition, the strain sequenced at the TIGR Center also has the insert. All this data
could suggested that the 12.7 kb insertion is a general property of M. tuberculosis
strains (Zumarraga et al. ,1999).
The region also does not appear to contain large repeated sequence and, furthermore,
its G + C content is similar to that of the whole genome, indicating that it has not been
recently acquired by M. tuberculosis from another organism. This locus is however
different from another 12.7 kb region described by Brosch et al. (1998), as being;
absent from bovine tubercle strains. According to sequence analysis, most of the ORFs
appear to encode membrane or exported proteins. ORF Rv1966 is homologous to the
Mcep invasin-like protein described by Riley and colleagues (Arruda et al., 1993)
which has been designated mce-3 by Cole et al. (1998). Therefore, this region could
play an essential role in cell entry, virulence and/or host range characteristics of M.
tuberculosis.
From an evolutionary point of view, one may hypothesize that an ancestor strain
having the 12.7 kb fragment diverged toward M. tuberculosis and M . bovis, and then
M . bovis lost the fragment. The deletion must have occurred soon after the divergence
because all M. tuberculosis and M . bovis strains analysed to date were identical with
respect to the fragment content.
The 12-7 kb region may serve as a very useful species-specific probe for
differentiating M. bovis from M . tuberculosis isolates.
To date, two species-specific mycobacterial DNA elements in the M. tuberculosis
complex have been described: the M. tuberculosis mpt-40 gene (Del Portillo et al.,
1991) and a 500 bp fragment specific for M. bovis (Rodriguez et al., 1995). The mpt40
42
was originally described as being produced only by M. tuberculosis, though later
studies showed that it could also be detected in M. africanum and some M . microti
isolates (Liebana et al., 1996). Further problems with the use of the mpt-40 gene for
speciation were reported by Weil et al. (1996) who showed that some strains of M.
tuberculosis also lack this locus. The 500 bp M. bovis specific sequence described by
Rodriguez et al. (1995) is present in all M. bovis isolates tested but not in M.
tuberculosis. However, database searches indicated that the 3' portion of this 500 bp
sequence is also present in M. tuberculosis, hence allowing hybridization in Southern
blot conditions.
Hence from the above studies, it was found that IS6110 gene was found only in
Mycobacterium tuberculosis and not in Mycobacterium bovis or any other
Mycobacterium tuberculosis complexes. Detection of this sequence is the basis for the
detection of Mycobacterium tuberculosis which is highly specific. The primers for this
sequence are used to amplify this sequence. FAM and VIC dyes are used in the Real
Time PCR based methods for the efficient fluorescence detection based method and
concentration of the bacterial load can be easily determined for this highly specific
sequence.
2.3 IS6110 mediated deletion mechanism in H37Rv strain of Mycobacterium
tuberculosis
Homologous recombination between directly repeated IS6110 elements has been
proposed as a likely mechanism for genomic deletions in clinical isolates. On
insertion, the IS6110 element generates 3- or 4-bp duplications of the sequence
immediately flanking the point of insertion and the absence of these 3- or 4-bp direct
repeats (DRs) is interpreted to reflect homologous recombination events between two
IS6110 elements. This knowledge was used in conjunction with in silico analysis of
sequences flanking the 16 IS6110 elements in the Mycobacterium tuberculosis H37Rv
genome to identify the deletions RvD3, RvD4, and RvD5. Similarly, analysis of
sequences immediately flanking IS6110 elements in a 20-kb variable region of the
chromosome provides further examples of the absence of flanking DRs, again
implying IS6110-mediated deletion events.
43
The DR region exhibits polymorphism in M. tuberculosis, and this has been exploited
for strain typing using a novel PCR-based fingerprinting method known as
spoligotyping, which is dependent on the presence or absence of variable spacer
sequences between the DRs. The present understanding is that homologous
recombination between adjacent or spatially distant DR elements is responsible for the
observed variability. In addition, mutational events mediated by IS6110 also
contribute to diversification of this region. These events can include transposition and
recombination leading to deletion (Sampson et al., 2003).
Previous studies have described IS6110-mediated polymorphism as an important
driving force in Mycobacterium tuberculosis genome evolution and have provided
indirect evidence for IS6110-driven deletion events. Sampson et. al., 2004 study
provides the first description of an IS6110-mediated deletion event in truly isogenic
strains. Their study also provide further support for the hypothesis that the region from
Rv1754 to Rv1765 is a hot spot for IS6110 insertion and deletion events.
Fig 14: IS6110 based deletion mechanism in RvD2 region of Mycobacterium
tuberculosis
(Source: Intrepid Nepal)
2.4 IS6110 sequence of various Mycobacterium tuberculosis strains
The IS6110 belongs to the family of insertion sequences (IS) of the IS3 category. This
insertion sequence was reported to be specific for Mycobacterium tuberculosis and
hence is extensively exploited for laboratory detection of the agent of tuberculosis and
for epidemiological investigations based on polymerase chain reaction. IS6110 is
1361-bp (Sankar et. al., 2011) long and within this sequence different regions have
44
been utilized as targets in the identification of M. tuberculosis by PCR. However, the
results are not always consistent, specific and sensitive. In recent years, a few clinical
investigations raised concerns over IS6110 specificity and sensitivity in the diagnosis
of tuberculosis due to false-positive (homology with other target DNA besides M.
tuberculosis) or false negative (due to absence of copies of IS6110) results with
IS6110 specific primers.
To unravel the variations in IS6110 sequences, an insilico analysis of IS6110 sequence
of different strains of M. tuberculosis was carried out. Comparative analysis of IS6110
insertion sequences of M. tuberculosis complex suggests that, IS6110 insertion
sequences harbored variations in its sequence, which is evident from the phylogenetic
analysis. Importantly, IS6110 sequence has divergence within the copies of same
strain and formed different clusters. A list of IS6110 specific primers used in various
clinical investigation of tuberculosis is listed in appendix. Emphasis on the need to
develop PCR assays (multiplex format) targeting more than one region of the genome
of M. tuberculosis (Sankar et. al., 2011).
2.5 Efficiency of PCR over conventional methods for detectection of TB and
Universal Sample Processing (USP) Methodology
Various studies have been done regarding the comparative studies of Acid Fast Bacilli
(AFB) test/smear microscopy test, culture and PCR. From studies it has been found
that PCR has the highest sensitivity, reliability and efficiency of all conventional tests
used for detection of Mycobacterium tuberculosis.
In a study of Kocagoz et. al., a total of 78 sputum specimens prepared by heating were
examined by PCR, and the results were compared with the results of acid-fast stained
smears, cultures, and clinical data. M. tuberculosis was detected by PCR in all smear-
and culture-positive and smear-negative, culture-positive cases. Additionally, PCR
was capable of detecting four of nine cases which were smear and culture negative but
clinically suspected of tuberculosis. DNA amplification by PCR is a sensitive and
specific method for the diagnosis (Kocagoz et. al., 1993).
Goel et. al. in 2001 compared four conventional methods of diagnosing tuberculous
lymphadenophathy (TL)--namely fine needle aspiration cytology (FNAC), Zeihl-
45
Neelsen staining of smears for acid-fast bacilli (AFB), culture for
Mycobacterium tuberculosis (MTB) and lymph node biopsies--with the polymerase
chain reaction (PCR). It was seen from their results that correct diagnosis
of tuberculosis could be made in 94.87% of cases by a combination of the four
methods. Sensitivity, specificity, positive predictive value (PPV) and negative
predictive value of PCR were 94.44%, 38.23%, 44.73% and 92.85%, respectively,
when culture alone was considered the gold standard. However, specificity (38.23-
92.30%) and PPV (44.73-97.36%) of PCR increased remarkably when response to
treatment was taken as the final arbiter. The four conventional tests were found to be
the methods of choice for the diagnosis of TL in developing countries. PCR was seen
to be important for problem cases (Goel et. al., 2001).
In the other study conducted by Chakravorty et. al., 2005 this technology was
evaluated on extrapulmonary specimens collected from 87 patients. USP-processed
specimens were submitted to smear microscopy for detection of acid-fast bacilli
(AFB), culture, and two PCR tests targeting devR (Rv3133c) and IS6110 gene
sequences. The low yields by smear and culture were attributed to the paucibacillary
load in the specimens. The highest sensitivity in PCR was achieved when devR and
IS6110 test results were combined; the sensitivity and specificity values were 83 and
93.8%, 87.5 and 100%, and 66.7 and 75%, respectively.. In conclusion, the application
of USP technology, together with clinicopathological characteristics, promises to
improve the accuracy and confidence of extrapulmonary tuberculosis diagnosis
(Chakravorty et. al., 2005).
In the study conducted by Rosso et. al., 2011, 98 patients with pleural TB and 52 with
pleural effusion secondary to other disease were performed TB diagnosis using acid-
fast bacilli (AFB) smear or culture for mycobacteria and/or histopathologic
examination in 94 cases and by clinical findings in 4 cases. Sensitivity, specificity,
positive and negative predictive values of PCR testing for pleural TB diagnosis were
42.8% (95% CI 38.4 - 44.8), 94.2% (95% CI 85.8 - 98.0), 93.3% (95% CI 83.6 - 97.7),
and 48.5% (95% CI 44.2 - 50.4), respectively. The real-time PCR test improved
TB detection from 30.6% to 42.9% when compared to AFB smear and culture
methods performed on pleural fluid specimens, although the best sensitivity was
achieved by combining the results of culture and histopathology of pleural tissue
46
specimens. The real-time PCR test of pleural fluid specimens is a useful and non-
invasive additional assay for fast diagnosis of pleural TB (Rosso et. al., 2011).
2.6 Real Time PCR
Real-time PCR suggests a “kinetic” rather than an “equilibrium” paradigm for PCR
(Wittwer et al., 1997). Conventional PCR is usually considered as a repetitive process
where three reactions occur at three temperatures three times during each cycle. In
contrast, the kinetic paradigm emphasizes temperature transitions. Denaturation and
annealing times are often reduced to “zero” and the temperature may always be
changing. Denaturation, annealing and extension occur at different rates, and,
depending on the temperature, multiple reactions may occur simultaneously. The
kinetic paradigm is more correct, theoretically and practically. Sample temperatures
do not change instantaneously but occur as smooth transitions. Most protocols,
however, do not use zero second denaturation times (Wittwer et al., 1991, 1994). The
easiest way to monitor PCR during amplification is with the use of fluorescence
technology. Many applications require only a double strand-specific dye such as
SYBR® Green I (Morrison et.al., 1998). Using a generic dye eliminates the cost and
problems associated with probe synthesis. However, certain applications require
greater sequence specificity, and a variety of fluorescently-labeled oligonucleotide
probes can be used to monitor the progress of PCR (Pritham and Wittwer, 1998).
These include exonuclease (TaqMan®) probes and hybridization probes.
Reactions are generally run for 40-50 cycles. There are three major steps that make up
a qPCR reaction. (1) denaturation —The temperature should be appropriate to the
polymerase chosen (usually 95°C). The denaturation time can be increased if template
GC content is high, (2) annealing—Use appropriate temperatures based on the
calculated melting temperature (Tm) of the primers (5°C below the Tm of the primer);
(3) extension—At 70–72°C, the activity of the DNA polymerase is optimal, and
primer extension occurs at rates of up to 100 bases per second. When an amplicon in
qPCR is small, this step is often combined with the annealing step using 60°C as the
temperature. (InvitrogenTM, 2009)
47
2.7 The Taqman Principle of Real Time PCR based method
TaqMan probes are hydrolysis probes that are designed to increase the specificity
of real-time PCR assays. The method was first reported in 1991 by researchers at
Cetus Corporation, and the technology was subsequently developed by Roche
Molecular Diagnostics for diagnostic assays and by Applied Biosystems for research
applications. The TaqMan probe principle relies on the 5´–3´ exonuclease activity
of Taq polymerase to cleave a dual-labeled probe during hybridization to the
complementary target sequence and fluorophore-based detection. As in other real-
time PCR methods, the resulting fluorescence signal permits quantitative
measurements of the accumulation of the product during the exponential stages of the
PCR. However, the TaqMan probe significantly increases the specificity of the
detection. TaqMan probes were named after the videogame PacMan (Taq Polymerase
+ PacMan = TaqMan) as its mechanism is based on the PacMan principle (Holland et.
al., 1991).
TaqMan probes consist of a fluorophore covalently attached to the 5’-end of
the oligonucleotide probe and a quencher at the 3’-end. Several different fluorophores
(e.g. 6-carboxyfluorescein, acronym: FAM, or tetrachlorofluorescin, acronym: TET)
and quenchers (e.g. tetramethylrhodamine, acronym: TAMRA,
or dihydrocyclopyrroloindole tripeptide minor groove binder, acronym: MGB) are
available. The quencher molecule quenches the fluorescence emitted by the
fluorophore when excited by the cycler’s light source via FRET (Fluorescence
Resonance Energy Transfer).
As long as the fluorophore and the quencher are in proximity, quenching inhibits any
fluorescence signals (Kutyavin et. al., 2000) TaqMan probes are designed such that
they anneal within a DNA region amplified by a specific set of primers. As the Taq
polymerase extends th eprimer and synthesizes the nascent strand, the 5' to
3' exonuclease activity of the polymerase degrades the probe that has annealed to the
template.
48
Fig 15: Taqman Principle chemistry
(Taqman Principle, Wikipedia)
Degradation of the probe releases the fluorophore from it and breaks the close
proximity to the quencher, thus relieving the quenching effect and allowing
fluorescence of the fluorophore. Hence, fluorescence detected in the real-time
PCR thermal cycler is directly proportional to the fluorophore released and the amount
of DNA template present in the PCR.
A positive TaqMan result is reflected by increasing the fluorescent intensity of the
reporter dye, FAM, and by decreasing the fluorescent intensity of the second
fluorescent tag, TAMRA. Other fluorescent components present in this procedure are
ROX, which is mixed in the PCR buffer to a constant concentration and therefore may
be used to normalise fluorescent signals when subtle differences in the volume of the
49
PCR reaction mix occur. Background fluorescence is produced by the plastic of the
96-well plate as well as the optic devices of the detection unit. (Leutenegge, 2001)
Fig 16: Visualization of PCR
Two ways in which a positive result from a TaqMan PCR analysis is visualised: The
two fluorescent tags bound to the TaqMan probe are 6-carboxyfluorescein (FAM) and
6-carboxy-tetramethyl-rhodamine (TAMRA). A positive TaqMan result is reflected
by an increase in the fluorescent intensity of FAM and a decrease in the fluorescent
intensity of TAMRA. (Source: Leutenegge, 2001)
Positive Control is used for the copy number determination and for PCR set-up. It is
used in standard curve of pathogen copy number/ Ct value. At least one positive
control reaction must be included in the run for every use of the kit. Positive control
can be used at single dilution too. This is done for samples not requiring full
quantitative analysis. Positive result denotes the proper work of the primers and
probes for the detection of target pathogen gene. Negative results are invalid and must
be repeated. Positive control must not contaminate the samples which may give rise to
false positivity. Hence, the component handling must be done in Post PCR
environment. (Anonymous, InvitrogenTM)
Negative control is done for the confirmation of absence of contamination. Instead of
template as in positive control, RNAse/DNAse free water is used. Positive results
must be ignored and repeated for that sample. In Internal Extraction Control, the
50
exogeneous source of DNA template is spiked into the lysis buffer. This control DNA
is co-purified with the sample DNA and used as a positive control for the extraction
process. Co-purification is done to confirm absence of PCR inhibitors. Multiplexing
with target sequence primers is possible due to the presence of primers at PCR
limiting concentrations.For exogeneous DNA, a separate primer and probe mix is
supplied. Even in low copy number of target DNA, amplification of control DNA
doesn’t interfere in its detection. Internal control is detected through VIC channel and
CT value is 26+/-3.
In Exogeneous ACTB control, Primer and probe mix has an ACTB (Actin Beta) gene
to confirm valid biological template. ACTB is detected by FAM channel and
multiplexing is not possible for ACTB gene and pathogen primers. Poor signal of
ACTB indicates insufficient biological material.
2.8 Real Time PCR Data Analysis
The baseline of the real-time PCR reaction refers to the signal level during the initial
cycles of PCR, usually cycles 3 to 15, in which there is little change in fluorescent
signal. The low-level signal of the baseline can be equated to the background or the
“noise” of the reaction. The baseline in real-time PCR is determined empirically for
each reaction, by user analysis or automated analysis of the amplification plot. The
baseline should be set carefully to allow accurate determination of the threshold cycle
(Ct).
The threshold of the real-time PCR reaction is the level of signal that reflects a
statistically significant increase over the calculated baseline signal. The threshold
cycle (Ct) is the cycle number at which the fluorescent signal of the reaction crosses
the threshold. The Ct is used to calculate the initial DNA copy number, because the Ct
value is inversely related to the amount of starting template. For example, in
comparing two real-time PCR reactions, one with twice as much starting template as
the other, the reaction with the 2X starting amount will have a Ct one cycle earlier.
This assumes that the PCR is operating at 100% efficiency (i.e., the amount of product
doubles perfectly during each cycle) in both reactions. The Ct value is decided by
setting up a threshold line on a standard curve made by plotting the Ct value with the
51
initial DNA concentration. The threshold line is a factor that influences the standard
curve and this relationship is shown on Figure 19 (Wang 2006).
Fig 17: Log plot of amplification curves
comparing baseline, threshold, and threshold cycle (Ct) values. (Source: InvitrogenTM)
A dilution series of known template concentrations can be used to establish a standard
curve for determining the initial starting amount of the target template or for assessing
the reaction efficiency. The log of each known concentration in the dilution series (x-
axis) is plotted against the Ct value for that concentration (y-axis). From this standard
curve, information about the performance of the reaction as well as various reaction
parameters (including slope, y-intercept, and correlation coefficient) can be derived.
The concentrations chosen for the standard curve should encompass the expected
concentration range of the target. (InvitrogenTM, 2009)
The correlation coefficient is a measure of how well the data fit the standard curve.
The R2 value reflects the linearity of the standard curve. Ideally, R2 = 1, although
0.999 is generally the maximum value. (AppliedBiosystemsTM, 2010)
The y-intercept corresponds to the theoretical limit of detection of the reaction, or the
Ct value expected if the lowest copy number of target molecules denoted on the x-axis
52
gave rise to statistically significant amplification. Though PCR is theoretically capable
of detecting a single copy of a target, a copy number of 10 is commonly specified as
the lowest target level that can be reliably quantifi ed in real-time PCR applications.
This limits the usefulness of the y-intercept value as a direct measure of sensitivity.
However, the y-intercept value may be useful for comparing different amplification
systems and targets. (InvitrogenTM)
The slope of the log–linear phase of the amplification reaction is a measure of reaction
efficiency. To obtain accurate and reproducible results, reactions should have an
efficiency as close to 100% as possible, equivalent to a slope of –3.32. A PCR
efficiency of 100% corresponds to a slope of –3.32, as determined by the following
equation: Efficiency = 10(-1/slope) –1 (InvitrogenTM)
Absolute quantification describes a qPCR experiment in which samples of known
quantity are serially diluted and then amplified to generate a standard curve. An
unknown sample can then be quantified based on this curve. Relative quantification
describes a real-time PCR experiment in which the gene of interest in one sample (i.e.,
treated) is compared to the same gene in another sample (i.e., untreated). The results
are expressed as fold up- or down-regulation of the treated in relation to the untreated.
A normalizer gene (such as β-actin) is used as a control for experimental variability in
this type of quantification. (AppliedBiosystemsTM, 2010)
A melting curve charts the change in fluorescence observed when doublestranded
DNA (dsDNA) with incorporated dye molecules dissociates, or “melts”, into single-
stranded DNA (ssDNA) as the temperature of the reaction is raised. During the early
cycles of the PCR reaction, there is little change in the fluorescent signal. As the
reaction progresses, the level of fluorescence begins to increase with each cycle. The
reaction threshold is set above the baseline in the exponential portion of the plot. This
threshold is used to assign the threshold cycle, or Ct value, of each amplification
reaction. (AppliedBiosystemsTM, 2010)
53
Fig 18: Melting curve analysis.
It can detect the presence of nonspecific products, as shown by the additional peaks to
the left of the peak for the amplified product in the melt curve. (Source: InvitrogenTM)
54
CHAPTER III
MATERIALS AND METHODS
55
3.1 Pulmonary sputum samples collection, transportation and storage
Total of 30 sputum samples were collected from Shukra Raj Tropical and Infectious
Disease Hospital, Teku, Kathmandu, Nepal. Patients were instructed to take at least
three deep breath and expectorate were collected in sterile specimen cup. Each patient
was asked to submit three sputum specimen collected and was labelled as: Spot
specimens on first visit, Early morning collection by patient on next day and Spot
specimen during second visit.
These samples were tested microscopically using Ziehl Neelsen staining
method at Shukra Raj Tropical and Infectious Disease Hospital, Teku,
Kathmandu, Nepal. For DNA extraction and Real time PCR, samples were
transported at 4°C to Intrepid Nepal laboratory and stored at -20°C. Culture
was performed at Kathmandu University, Department of Biotechnology, Kavre,
Nepal.
3.2 AFB (Acid Fast Bacilli test) staining/ smear Microscopy
3.2.1 Materials used for AFB (Acid Fast Bacilli test) staining/ smear Microscopy:
1. Glass slides
2. Diamond pencil
3. Inoculating Loop
4. Biosafety cabinet
5. Carbol fuchsin
6. Methylene blue
7. Sulphuric Acid
8. Distilled water
9. Stacking rack
10. Burner or flame source
11. Microscope
56
3.2.2 Procedure for AFB (Acid Fast Bacilli test) staining/ smear Microscopy:
AFB microscopy test was performed at Shukra Raj Tropical and Infectious Disease
Hospital, Teku, Kathmandu, Nepal.
For smear Preparation, non-frosted slides were labeled with diamond pencil. Labeling
included laboratory serial number and specimen number. Uniform and consistent
smears were made with loop taking purulent portion of sputum sample. Smear was
heat fixed by passing the smear through the flame 2-3 times.
For staining, slides were arranged in serial order with smear side up on stacking rack.
About a finger-thickness gap was kept between the smears. Slides were flooded with
carbol fuchsin then heated to steaming once from down side by burning cotton plug
with alcohol in a burning stick. These were left for 10 minutes and rinsed with water
and drained properly. Suphuric acid was applied for 3 minutes, rinsed, drained and
then counterstained with methylene blue for 3 minutes. The rinsed slides were air
dried completely before taking any observation in microscope.
3.3 Real Time PCR (Q-PCR)
3.3.1 Materials Required for DNA Extraction and Q-PCR:
Reagents:
1. ShineGene DNA extraction kit
2. Absolute ethanol
3. 4%NaOH
4. 0.8%NaCl
5. Tris-EDTA buffer
6. Primer DesignTM Mycobacterium tuberculosis Quantification kit
7. PrecisionTM 2X qPCR Mastermix
8. RNAse/ DNAse free water
Instruments and consumables:
1. Real-time PCR instrument
57
2. Centrifuge
3. BioSafety Level II cabinet(BSC-II)
4. MicroPipettors and Filter tips
5. Vortex
6. 200µl PCR reaction tubes
7. 1.5ml and 2ml tubes
8. Incubator
Procedure for DNA Extraction from sputum samples
Pretreatment of sputum sample: DNA extractions from sputum samples were
performed in BSC-II cabinet. Sputum samples were thawed at the room temperature.
Pooling of the sample was done and 1ml of the sputum sample was added to 1ml 4%
NaOH in the 2ml eppendorf tubes. The mixture was vortexed for about 15 seconds and
incubated at 550C for 30 minutes.After incubation, it was centrifuged at 14,000 rpm
for 5 minutes. Supernatants were discarded. To the pellet, 1ml of 0.8% NaCl was
added and vortexed. Tubes were then centrifuged at 14,000 rpm for 5 minutes. The
process was repeated and pellet was suspended in 200 µl TE buffer.
Extraction of DNA: To TE suspended pellet, 500 µl TBM buffer and 4 µl IEC were
added respectively and vortexed intensely. To the mixture, 10 µl Proteinase K was
added, vortexed and then incubated at 55oC overnight. After incubation, samples were
centrifuged at 5000 rpm for 2 minutes. Supernatants were transferred correspondingly
to a new correctly labelled eppendorf tube and 260 µl chilled absolute alcohol was
added and gently inverted. 400 µl of the supernatant was transferred to the spin
column and centrifuged at 8000rpm for 1 minute. The flow through was discarded,
500 µl of wash solution was added and centrifuged at 8000rpm for 1 minute. This step
was repeated, flow through was discarded and centrifuged at 10,000 rpm for 2
minutes. Collection tube was replaced with 1.5ml eppendorf tube and 30 µl elution
buffer was added to spin column. Incubation was done at 50oC for 2 minutes and
centrifuged at 10,000 rpm for 1 minute. Spin column was discarded and 30 µl eluted
DNA was stored at -20oC.
58
Spiked sample preparation was performed by mixing 50 µl of known positive human
sputum sample with 950 µl of negative sputum sample. For every batch of Q-PCR,
spiked samples were extracted and processed.
3.3.3 Procedure for Real Time PCR for detection of Mycobacterium tuberculosis
from human sputum samples
Preparation of DNA for PCR: Extracted DNA samples were prepared by diluting 5 µl
of extracted sample in 90 µl of RNase/DNase free water and used for PCR.
Real-time PCR: Real time PCR was performed using Primer DesignTM Mycobacterium
tuberculosis quantitation kit. The kit is based on Taqman primciple. For each batch
processing, 15 µl of mastermix per reaction/sample was prepared for TB detection, TB
Standard detection and Biological sample detection(ACTB) individually as follows:
15µl of TB Detection mix were prepared by adding 10 µl of 2X Precision Master-Mix,
1 µl of TB specific Primer/Probe Mix, 1 µl of IEC Primer/probe mix and 3 µl of
RNAse/DNAse free water.
Standard Mix was made for 5 different standard samples. 15 µl of TB standard mix
was prepared by adding 1 µl of TB Primer/probe mix to 10 µl of 2X Precision Master-
Mix, and 4 µl of RNAse/DNAse free water.
ACTB Mix was prepared by adding 1 µl of Endogeneous ACTB Primer/Probe and 4
µl of RNAse/DNAse free water to 10 µl of 2X Precision Master-Mix.
To 15 µl of each mix, 5 µl of respective samples and standards were added to prepare
20 µl of PCR reaction. For No template Control, 5 µl of molecular grade water was
added.
Eppendorf Realplex thermal cycler was used for Real-time PCR. The thermal cycler
protocol used was as follows: Activation of emzyme (95oC for 5min) followed by 50
cycle of Denaturation(95oC for 10sec) and Annealing(60oC for 1 min). Data collection
was set at annealing temperature. After the completion of the cycles, results were
analyzed using standard curves, efficiency observation and concentration analysis.
59
3.4 Culture
3.4.1 Materials Required for Culture:
1 Lowenstein Jenson medium
Composition of L.J. Medium
Ingredients Gms / Litre
L-Asparagine 3.600
Monopotassium phosphate 2.400
Magnesium sulphate 0.240
Magnesium citrate 0.600
Potato starch, soluble 30.000
Malachite green 0.400
2 Screw capped tubes
3 Biosafety cabinet
4 Centrifuge
5 Centrifuge tubes
6 Pipettes
7 Deionized water
8 NaOH
9 Absolute Ethanol
10 Incubator
11 Egg emulsion
3.4.2 Procedure for Culture
The culture of the sputum samples was performed at Kathmandu University,
Department of BioTechnology, Dhulikhel, Kavre, Nepal. Lowenstein-Jenson medium
was used for detection of Mycobacterium spp. in the sputum samples.
Medium Preparation was done by dissolving 37.24 grams of L.J. medium in 600 ml
distilled water containing 12 ml of glycerol. Solution was heated and agitated slightly
60
to dissolve the medium completely. Sterilization was done by autoclaving at 15 lbs
pressure (121oC) for 15 minutes. Medium was cooled to 45-50oC. 1000 ml of whole
egg emulsion was collected aseptically and mixed gently to obtain uniform mixture.
The medium was distributed in sterile screw capped tubes. Tubes were arranged in a
slanted position and left to coagulate at 85oC for 45 minutes.
Inoculum preparation was done by treating samples with NaOH. Twice the amount of
NaOH than the amount of sputum samples was added. Tubes were centrifuged at 3000
rpm for 15 minutes. Supernatant was discarded and the process repeated for one more
time. 10 ml of deionized water was added and centrifuged at 3000 rpm for 15 minutes.
Supernatant was discarded. Pellet was suspended with the little amount of remained
supernatant.
Inoculation was done by using 10µl of this sample as inoculum and poured slowly
over the surface of media in an inclined position. Screw cap was capped tightly. Tube
was rotated in all direction to make sample distributed homogenously over the surface
of media.Thus inoculated tubes were kept in inclined position 4 hours at 37 0C. Then
incubated at 30oC for 4-6 weeks.
3.5 Statistical Analysis:
Sensitivity, Specificity, Positive predictive value(PPV) and Negative predictive
value(NPV) of AFB and QPCR were calculated with respect to the WHO gold
standard (culture) and the results were compared. Calculations were done by using
following formula:
61
Table 2: List of new test study vs. reference standard
True positive: A diseased person may have a positive test-result
False positive: A non-diseased persons may have a positive test-result
True negative: A non-diseased person may have a negative test-result
False negative: A diseased person may have a negative test-result
We used following formula for the calculation:
Specificity: [a/(a+c)] X 100%
Sensitivity: [d/(b+d)] X 100%
Positive Predictive value: a/(a+b) X 100%
Negative Predictive value: d/(c+d) X 100%
True Status(or reference standard)
New
+ - total
test under + True positives (a) False positives (b) a+b
study - False negatives (c) True negatives (d) b+d
total a+c b+d
a+b+c+d
(Total number of
samples)
62
CHAPTER IV
RESULTS
63
4.1 Result of AFB, QPCR and culture:
Table 3: Result of AFB, QPCR and Culture
SAMPLE AFB Result Q PCR Result(DNA copies/ml) Culture Result M002 Positive Positive Positive M008 Negative negative Negative
M009 Negative negative Negative M010 Negative negative Negative M012 Positive Positive Positive M013 Negative negative Negative
M014 Negative Positive Positive M015 Negative Negative Negative M016 Negative Negative Negative M017 Negative Negative Negative
M018 Positive 3.272X102 Positive
M021 Negative Positive Negative M022 Negative Negative Negative M023 Negative Negative Negative
M024 Negative Negative Negative M025 Negative Negative Negative
M026 Negative Positive Positive M027 Negative Negative Negative
M028 Negative Negative Negative M029 Negative Negative Negative
M031 Positive Negative Negative M032 Positive Positive Positive
M033 Positive Positive Positive M034 Positive Positive Positive M035 Positive Positive Positive M037 Positive Positive Positive
M038 Positive Negative Negative M039 Positive Positive Positive M040 Positive Positive Positive M044 Positive Positive Positive
64
Of the thirty samples analyzed; Thirteen samples were AFB positive and Seventeen
samples were AFB negative. Fourteen were PCR positive and Sixteen were PCR
Negative. Four AFB negative samples were found to be PCR positive. Two AFB
positive samples were found to be PCR negative. Thirteen samples were found to be
Culture Positive and Seventeen samples were found to be culture negative. Two
culture Negative samples were found to be PCR positive. One culture Negative
samples were found to be AFB positive and two culture positive samples were found
to be AFB Negative.
Table 4: Summary of Result
Positive Negative
AFB 13 17
Culture 13 17
QPCR 14 16
65
4.2 Standard Curve for the Real Time PCR tests
Slope -3.483
Y-intercept 27.11
R2 0.999
Efficiency 0.94
Fig 19: Standard Curve of QPCR
66
4.3 Validity measurement for QPCR.
Table 5: True Positive and True Negative calculation between QPCR and Gold
standard (culture).
Sensitivity: 13 X 100 = 100 %
13
Specificity: 16 X 100 = 94.11%
17
Positive predictive value: 13 X 100= 92.86%
14
Negative predictive value: 16 X 100 = 100%
16
culture
+ - total
QPCR + 13 1 14
- 0 16 16
Total 13 17
67
4.4 Validity measurement for AFB
Table 6: True Positive and True Negative calculation between AFB test and Gold
standard (culture).
Sensitivity: 11 X 100 = 84.61 %
13
Specificity: 15 X 100 = 88.24%
17
Positive predictive value: 11 X 100= 84.61%
13
Negative predictive value: 15 X 100 = 88.24%
17
culture
+ - total
AFB + 11 2 13
- 2 15 17
Total 13 17
68
From the calculations, the sensitivity with respect to gold standard (culture) for AFB
was found to be 84.61% while for Q-PCR it increased to 100%; specificity for AFB
was found to be 88.24% while for Q-PCR, it increased to 94.11%; Positive predictive
value for AFB was found to be 84.61% while for Q-PCR, it increased to 92.86% ;
Negative predictive value was found to be 88.24%, while for Q-PCR, it increased to
100%. These statistics clearly show that Q-PCR is highly efficient for the diagnosis of
TB.
69
CHAPTER V
DISCUSSION
70
The diagnosis of Tuberculosis is very important for a number of reasons: lack of
adequate samples or volumes, allocating of sample for various diagnostic tests
(histology/ cytology, biochemical analysis, microbiology and PCR, the non-uniform
distribution of the organisms, paucibacillary nature of the specimens, presence of
inhibitors, lack of efficient sample processing technique. The conventional
microbiological techniques being followed in Nepal have very poor performance in
diagnosis of TB. But even if the performance of QPCR is high, clinicans haven’t
started the use of QPCR for the diagnosis of TB in Nepal. And nor have they started or
stopped DOTS treatment based on the diagnosis of QPCR. We used the Universal
Sample Processing (USP) techniques and evaluated the test results against AFB,
culture and QPCR methods. The universal sample processing (USP) multipurpose
methodology was developed for the diagnosis of TB combining AFB smear
microscopy, Culture and QPCR based methods.
We have shown here that QPCR method is more reliable, efficient, specific and faster
when conventional processes fail to detect presence of the infection. But QPCR
method based on our study has shown that even in the lowest load of the
Mycobacterium tuberculosis, the earliest possible diagnosis can be made by this
process. And if this diagnosis process could be started in Nepal, we can highly
minimize the death rates of TB incidence in Nepal and also the DOTS treatment
would be made available who are indeed a true diseased patients.
Of the thirty samples analyzed; Thirteen samples (43%) were AFB positive and
Seventeen (57%) samples were AFB negative. Fourteen of the samples (47%) were
PCR positive and Sixteen (53%) were PCR Negative. Three of AFB negative samples
were found to be PCR positive. Two AFB positive samples were found to be PCR
negative. Thirteen samples (43%) were found to be Culture Positive and Seventeen
samples (57%) were found to be culture negative. One culture Negative samples was
found to be PCR positive. Two culture Negative samples were found to be AFB
positive and two culture positive samples were found to be AFB Negative.
WHO has regarded Culture test for diagnosis of TB as a gold standard, hence our
study focuses the comparison of our result of QPCR and AFB with the gold standard.
From the calculations, the sensitivity with respect to gold standard (culture) for AFB
was found to be 84.61% while for Q-PCR it increased to 100%; specificity for AFB
71
was found to be 88.24% while for Q-PCR, it increased to 94.11%; Positive predictive
value for AFB was found to be 84.61% while for Q-PCR, it increased to 92.86% ;
Negative predictive value was found to be 88.24%, while for Q-PCR, it increased to
100%. These statistics clearly show that Q-PCR is highly efficient for the diagnosis of
TB.
Three AFB negative samples M014, M021 & M20 were PCR positive with the DNA
copies/ml value 2.43 X 103, 3.64 X103 & 5.98 X 101 respectively. This shows that
even a very high DNA copies/ml are not detected by AFB statining. Thus very
infectitious and late stage TB are not detected by AFB staining. This proves
inefficiency of AFB over Q-PCR. Similarly two AFB positive samples M031 and
M038 were PCR neagative. Comapring this result with culture shows both samples
Culture Negative. Here PCR and Culture results matches while AFB results proves to
be contradictory. This proves that Q-PCR is more efficient than AFB.
One Culture negative sample M021 was found to be PCR positive which was also a
AFB negative. To this sample a triplet PCR was carried out in three different batches.
But all the PCR result showed it to be a PCR positive with the DNA copies/ml of 3.64
X 103. Culture didn’t show any growth within 4 weeks. Culture growth was then
carried out for two more weeks but no growth was observed. This result proves that Q-
PCR is more efficient than culture.
The statistical values obtained in our study were best among all the other studies
carried out in this field. From the calculations sensitivity was found to be 100% with
specificity of 94.11%. Study carried out by BIege et al, 1995, found sensitivity 98%
and specificity 70%. Similarly Goel et al. 2001, found sensitivity, specificty, PPV and
NPV of 94.44%, 38.23%, 44.73% and 92.85% respectively. Similar othe study
conducted by Chakravorty et. al., 2005, found sensitivity 68.6% and specificity
92.6%. The other study carried out by Halder et. al. 2007, found sensitivity 95% and
specificity 92.9%. Our result is more better and reliable than results from all the
studies performed earlier. This shows that though similar type of studies were carried
out in the past, they didn’t prove to be efficient and reliable comapared to our study
result.
72
Earlier studies on this field were carried out with traditional PCR based methods. All
the studies compared AFB, culture or fluroscent microscopy with the PCR results. But
our study was focused the use of realtime PCR method indicating a new step ahead.
We were able to determine Mycobacterim DNA load in the sample. This result can be
used to determine the stage of TB progresssion direclty. Those with high DNA load
can be of late TB stages and more chronic than other. DNA load can be direclty
related to the Mycobacterim in the body. Thus a new result can be obtained and
analysed.
From various literatures, it is seen that smear microscopy tests and culture are far more
superior to the conventional methods but fall short of QPCR. The Universal Sample
Processing (USP) technique we used in culture also shows high reliability mainly due
to following possible reasons: efficient recovery of bacilli by centrifugation at higher
speed, use of relatively more specimen for analysis and removal of contaminants prior
to the culture. The conventional processes used in histological processes for diagnosis
of TB might have fall short mainly because of the smaller fraction of the sample being
observed. Since the bacillus is not uniformly distributed and due to the low amount of
presence of bacilli, there is a high possibility of bacilli to be missed in detection of TB
by AFB processes and culture. But since the QPCR is based on the Nucleic acid
amplification principle, even the smallest amount of DNA present can be replicated in
high amount to be detected using this technology.
Other literatures states that various strains of Mycobacterium tuberculosis have been
found and they are responsible for the contrasting results in PCR based methods
targeting IS6110 sequence. This idea and concept can be utilized in our study too. As
some samples like M021 gave a different result from expected earlier. This can be
based on the similar facts of having different strains of TB.
Hence from our study we have found that the higher reliability, efficiency, specificity
and senstitivity of QPCR for the diagnosis of TB will be very effective and specially
in a developing country like Nepal where the incidence and mortality of TB patients is
high. The control of this disease at the earliest possible level must be employed. The
patients are given the DOTS treatment only if the conventional methods show positive
results for TB. But it may not necessarily be a positive result. Similarly, the patients
with negative results for conventional diagnosis are not given DOTS treatment or even
73
stopped for unrecovered disease of TB. This can be solved by detecting the disease at
its primitive stage and the patients needing DOTS treatment would benefit and
patients not needing DOTS treatment would be correctly identified.
Since QPCR will help this issue in the context of Nepal, the technology of Universal
Sample Processing by combining AFB, culture and QPCR must be developed in Nepal
and the diagnosis must be started based on it. Hence, we conclude that the diagnosis of
TB by QPCR is highly recommended in the hospitals and laboratories of Nepal and
the availability of this technology should be made in the cheaper prices in Nepal so
that every Nepalese would be benefitted from it.
74
CHAPTER VI
CONCLUDION
&
RECOMMENDATION
75
In Nepal, the conventional based methods for diagnosis of TB are still used such as
Acid Fast Staining, culture, X-ray, Tuberculin test, Fluorescein test, etc. which are
cheaper but fail to produce early diagnosis of tuberculosis. Even culture process is not
carried out effectively. Early diagnosis of TB is very critical for the proper treatment
of the disease. Also, elimination of false positive results and false negative results is
very important.
From the result it was found that Out of the thirty samples analyzed; Thirteen samples
(43%) were AFB positive and Seventeen (57%) samples were AFB negative.
Fourteen of the samples (47%) were PCR positive and Sixteen (53%) were PCR
Negative. Thirteen samples (43%) were found to be Culture Positive and Seventeen
samples (57%) were found to be culture negative. From the calculations, the
sensitivity with respect to gold standard (culture) for AFB was found to be 84.61%
while for Q-PCR it increased to 100%; specificity for AFB was found to be 88.24%
while for Q-PCR, it increased to 94.11%; Positive predictive value for AFB was found
to be 84.61% while for Q-PCR, it increased to 92.86% ; Negative predictive value was
found to be 88.24%, while for Q-PCR, it increased to 100%. These statistics clearly
show that Q-PCR is highly efficient for the diagnosis of TB.
The use of QPCR based methods can solve this problem by employing Universal
Sample Processing technology (USP) combining AFB smear, culture and QPCR tests
to provide earliest diagnosis with high specificity, reliability, sensitivity and
efficiency. And eliminate the long duration of 6-8 weeks of culture diagnosis of TB
and high chances of improper diagnosis by AFB.
Our study was carried out with 30 samples. This sample size must be increased for
further studies. Also comparison with other detection methods like Fluorescent
microscopy, X-ray and other can be carried out. We also recommend performing
culture on BACTEC media as it was found more efficient than LJ media. Further
study can also analyze the PCR with more targeting sites than IS6110 region. Analysis
with different sets of primers can be carried out to perform this test.
Hence, the use of QPCR based methods must be employed in the hospitals and
laboratories of Nepal and should be started for diagnosis at convenient offsetting
economic partiality.
76
References:
American Thoracic Society and Centers for Disease Control and Prevention.
Diagnostic standards and classification of tuberculosis in adults and children. Am J
Respir Crit Care Med. 2000;161(4 pt 1):1376–1395
Andersen, P. 2002. TB vaccines: progress and problems. Trends Immunol 22: 160-
168.
Arruda, S., Bomfim, G., Knights, R., Huima-Byron, T. & Riley, L. W. 1993. “Cloning
of an M . tuberculosis DNA fragment associated with entry and survival inside cells”.
Science 261, 1454-1457.
Barnes, D. S. 2000. Historical perspectives on the etiology of tuberculosis. Microbes
Infect. 2: 431-440
Bhamidi S. 2009. "Mycobacterial Cell Wall Arabinogalactan". Bacterial
Polysaccharides: Current Innovations and Future Trends. Caister Academic Press.
Boom, W. H.. 1996. The role of T-cell subsets
in Mycobacterium tuberculosis infection. Infect. Agents Dis. 5: 73-81
Braun, MM, Truman BI, Maguire B et al. Increasing incidence of tuberculosis in a
prison inmate population. JAMA 1989;261:393–97.
Brennan, P. J. & Draper, P. in Tuberculosis: Pathogenesis, Protection, and Control
(ed. Bloom, B. R.) 271–284 (Am. Soc. Microbiol., Washington DC, 1994).
Brosch, R., Gordon, S.V., Billault, A., Garnier, T., Eiglmeier, K., Soravito, C., Barrell,
B. G. & Cole, S.T., 1998. “Use of a Mycobacterium tuberculosis H37Rv bacterial
artificial chromosome library for genome mapping, sequencing, and comparative
genomics”. lnfect lmmun 66, 2221-2229.
77
Brosch, R., S. V. Gordon, M. Marmiesse, P. Brodin, C. Buchrieser, K. Eiglmeier, T.
Garnier, C. Gutierrez, G. Hewinson, K. Kremer, L. M. Parsons, A. S. Pym, S. Samper,
D. van Soolingen, and S. T. Cole. 2002. A new evolutionary scenario for
theMycobacterium tuberculosis complex. Proc. Natl. Acad. Sci. USA 99:3684-3689.
Brosch, R., W. J. Philipp, E. Stavropoulos, M. J. Colston, S. T. Cole, and S. V.
Gordon., 1999. “Genomic analysis reveals variation between Mycobacterium
tuberculosis H37Rv and the attenuated M. tuberculosis H37Ra strain”. Infect. Immun.
67. 5768–5774.
Camus, J.C., 2002. “Re-annotation of the genome sequence of Mycobacterium
tuberculosis H37Rv”. 148, 2967–2973.
Chakravorty S, Sen M.K., Tyagi J.S., 2005. “Diagnosis of
extrapulmonary tuberculosis by smear, culture, and PCR using universal sample
processing technology”. J Clin Microbiol. 43(9) :4357-62.
Chakravorty, S., Dudeja, M., Hanif, M. and Tyagi, J. S., 2005. “Utility of Universal
Sample Processing Methodology, Combining Smear Microscopy, Culture, and PCR,
for Diagnosis of Pulmonary Tuberculosis”. J Clin Microbiol. 43(6): 2703–2708
Chaudun, N. 2000. Haussmann Au Crible. Editions des Syrtes, Paris, France.. The
white plague. Little, Brown and Co, Boston, Mass.
Cole, S.T. et al. 1998. Deciphering the biology of Mycobacterium tuberculosis from
the complete genome sequence. 396, 537-543.
Collins, F. M. 1998. Tuberculosis research in a cold climate. Tubercle Lung
Dis. 78: 99-107.
Daniel, T. M., J. H. Bates, and K. A. Downes. 1994. History of tuberculosis, p. 13-
24. In B. R. Bloom (ed.), Tuberculosis: pathogenesis, protection, and control.
American Society for Microbiology, Washington, D.C.
78
Dannenberg, A. M. Jr.. 1994. Roles of cytotoxic delayed-type hypersensitivity and
macrophage-activating cell-mediated immunity in the pathogenesis of
tuberculosis. Immunobiology 191: 461-473
Del Portillo, P., Murillo, L. A. & Patarroyo, M. E., 1991. “Amplification of a species-
specific DNA fragment of Mycobacterium tuberculosis and its possible use in
diagnosis”. J Clin Microbiol 29, 2163-2168.
Dubos, R., and J. Dubos. 1952. The white plague. Little, Brown and Co, Boston,
Mass.
Fredrickson J.K., Zachara J.M., Balkwill D.L. et al. (2004). "Geomicrobiology of
high-level nuclear waste-contaminated vadose sediments at the Hanford site,
Washington state". Applied and Environmental Microbiology 70 (7): 4230–41.
Frieden, T. R., P. I. Fujiwara, R. M. Washko, and M. A. Hamburg. 1995. Tuberculosis
in New York City—turning the tide. N. Engl. J. Med. 333:229-233
Greenacre, M. Theory and Application of Correspondence Analysis (Academic,
London, 1984).
Haas, F., and S. S. Haas. 1996. The origins of Mycobacterium tuberculosis and the
notion of its contagiousness, p. 3-19. InW. N. Rom and S. Garay (ed.), Tuberculosis.
Little, Brown and Co., Boston, Mass.
Haldar S., Chakravorty S., Bhalla M., De Majumdar S., Tyagi J.S., 2007. “Simplified
detection of Mycobacterium tuberculosis in sputum using smear microscopy
and PCR with molecular beacons”. 56(Pt 10):1356-62
Hogan, C.M. 2010. Bacteria. Encyclopedia of Earth. eds. Sidney Draggan and
C.J.Cleveland, National Council for Science and the
Holland, P.M., Abramson, R.D., Watson, R., Gelfand, D. H., 1991. "Detection of
specific polymerase chain reaction product by utilizing the 5'----3' exonuclease activity
79
of Thermus aquaticus DNA polymerase". Proceedings of the National Academy of
Sciences of the United States of America 88. 7276–7280.
Honoré-Bouakline S., Vincensini J.P., Giacuzzo V., Lagrange P.H., Herrmann J.L.,
2003.“Rapid diagnosis of extrapulmonary tuberculosis by PCR: impact of sample
preparation and DNA extraction”. J Clin Microbiol. 41(6) : 2323-9
Iseman, M. 1994. Evolution of drug resistant tuberculosis: a tale of two species. Proc.
Natl. Acad. Sci. USA 91:2428-2429
Kaye, K., and T. R. Frieden. 1996. Tuberculosis control: the relevance of classic
principles in an era of acquired immunodeficiency syndrome and multidrug resistance.
Epidemiol. Rev. 18:52-63
Kocagoz, T., Yilmaz, E., Ozkara, E., Kocagoz, S., Hayran, M., Sachdeva, M. and
HENRY F., 1993. “Detection of Mycobacterium tuberculosis in Sputum Samples by
Polymerase Chain Reaction Using a Simplified Procedure”. American Society for
Microbiology 31: 1435-1438
Koch, R. 1882. Die Aetiologie der Tuberkulose. Berl. Klin. Wochenschr. 19:221-230.
[Reprint, Am. Rev. Tuberc. 25:285-323, 1932.]
Kolattukudy, P. E., Fernandes, N. D., Azad, A. K., Fitzmaurice, A. M. & Sirakova, T.
D., 1997. Biochemistry and molecular genetics of cell-wall lipid biosynthesis in
mycobacteria. Mol. Microbiol. 24, 263–270.
Kutyavin I.V., Afonina I.A., Mills A., Gorn V.V., Lukhtanov E.A., Belousov E.S.,
Singer MJ, Walburger DK, Lokhov S.G., Gall A.A., Dempcy R., Reed M.W., Meyer
R.B., Hedgpeth J., 2000. "3'-minor groove binder-DNA probes increase sequence
specificity at PCR extension temperatures". Nucleic Acids Res 28 (2): 655–661.
Law, K. F., J. Jagirdar, M. D. Weiden, M. Bodkin, and W. N. Rom.
1996. Tuberculosis in HIV-positive patients: cellularresponse and immune activation
in the lung. Am. J. Respir. Crit. Care Med. 153(4, Pt. 1):1377-1384.
80
Lee RB, Li W, Chatterjee D, Lee RE. Rapid structural characterization of the
arabinogalactan and lipoarabinomannan in live mycobacterial cells using 2D and 3D
HR-MAS NMR: structural changes in the arabinan due to ethambutol treatment and
gene mutation are observed. Glycobiology. 2005;15(2):139–151.
Lipsitch, M., and A. O. Sousa. 2002. Historical intensity of natural selection for
resistance to tuberculosis. Genetics 161:1599-1607.
LitSbana, E., Aranaz, A., Francis, B. & Cousins, D., 1996. “Assessment of genetic
markers for species differentiation within the Mycobacterium tuberculosis complex”. J
Clin Microbiol 34, 933-936.
Mahairas, G. G et al., 1996. Molecular analysis of genetic differences between
Mycobacterium bovis BCG and virulent M . bovis. J Bacteriol 178, 1274-1282.
Nepal Central Bureau of Statistics: Census 2001 population report. Kathmandu:
Government of Nepal; 2001.
Nepal National Planning Commission: Nepal Living Standards Survey
2004. Kathmandu: Government of Nepal; 2004.
O'Brien, R. J. 2001. Tuberculosis: scientific blueprint for tuberculosis drug
development. Global Alliance for TB Drug Development, New York, N.Y.
Pancholi, P., A. Mirza, N. Bhardwaj, and R. M. Steinman. 1993. Sequestration
from immune CD4+ T cells of mycobacteria growing in human
macrophages. Science 260: 984-986
Philipp, W. J. et al., 1996. “An integrated map of the genome of the tubercle bacillus,
Mycobacterium tuberculosis H37Rv, and comparison with Mycobacterium leprae.”
Proc. Natl Acad. Sci. USA 93, 3132– 3137.
Rajeswari R, Balasubramanian R, Muniyandi M, Geetharamani S, Thresa X,
Venkatesan P. Socio-economic impact of tuberculosis on patients and family in
India. Int J Tuberc Lung Dis 1999; 3 : 869–77.
81
Riley, L. 1996. Phagocytosis of M. tuberculosis. In W. Rom and S. Garay, editors.
Tuberculosis. Little, Brown, Boston,MA. 281-289.
Riley, R. L., C. C. Mills, W. Nyka, N. Weinstock, P. B. Storey, L. U. Sultan, M. C.
Riley, and W. F. Wells. 1995. Aerialdissemination of pulmonary tuberculosis: a two-
year study of contagion in a tuberculosis ward, 1959. Am. J. Epidemiol.142: 3-14
Rodriguez, 1. G., Mejia, G. A., Del Portillo, P., Patarroyo, M. E. & Murillo, L. A.,
1995. “Species-specific identification of Mycobacterium bovis by PCR”. Microbiology
141, 2131-2138.
Rosso F., Michelon C.T., Sperhacke R.D., Verza M., Olival L., Conde M.B., Guerra
R.L., Zaha A., Rossetti M.L., 2011. “Evaluation of Real-time PCR of Patient Pleural
Effusion for Diagnosis of Tuberculosis”. BMC Res Notes. 4(1) :279
Ryan, F. 1992. The forgotten plague. Little, Brown and Co., Boston, Mass.
Ryan, K.J. and Ray, C.G. 2004. Sherris Medical Microbiology (4th ed.). McGraw
Hill. ISBN 0-8385-8529-9.
Sampson, S. L., R. M. Warren, M. Richardson, T. C. Victor, A. M. Jordaan, G. D. van
der Spuy, and P. D. van Helden., 2003. “IS6110-mediated deletion polymorphism in
the direct repeat region of clinical isolates of Mycobacterium tuberculosis”. J.
Bacteriol. 185. 2856–2866.
Sampson, S.L., Richardson, M., Helden P.D.V and Warren, R.M., 2004. “IS6110-
Mediated Deletion Polymorphism in Isogenic Strains of Mycobacterium
tuberculosis”. J. Clinical Microbiol. 42. 895–898.
Schlesinger, L. S.. 1996. Entry of Mycobacterium tuberculosis into mononuclear
phagocytes. Curr. Top. Microbiol. Immunol. 215: 71-96
Sears, C.L. 2005. "A dynamic partnership: celebrating our gut flora". Anaerobe 11 (5):
247–51.
82
Servin, J.A., Herbold CW, Skophammer RG, Lake JA (January 2008)."Evidence
excluding the root of the tree of life from the actinobacteria".Mol. Biol. Evol. 25 (1):
1–4.
Sreevatsan, S. et al. 1997. “Restricted structural gene polymorphism in the
Mycobacterium tuberculosis complex indicates evolutionarily recent global
dissemination”. Proc. Natl Acad. Sci. USA 94, 9869– 9874.
Sreevatsan, S., X. Pan, K. E. Stockbauer, N. D. Connell, B. N. Kreiswirth, T. S.
Whittam, and J. M. Musser. 1997. Restricted structural gene polymorphism in
the Mycobacterium tuberculosis complex indicates evolutionarily recent global
dissemination. Proc. Natl. Acad. Sci. USA 94:9869-9874
Stead, W. W. 1997. The origin and erratic global spread of tuberculosis. How the past
explains the present and is the key to the future. Clin. Chest Med. 18:65-77
Steinman, R. M., M. Witmer-Pack, and K. Inaba. 1993. Dendritic cells: antigen
presentation, accessory function and clinical relevance. Adv. Exp. Med. Biol. 329: 1-9
Trudeau, E. L. 1887. Environment in its relation to the progress of bacterial invasion
in tuberculosis. Am. J. Sci. 94:118-123.
Ventura M, Canchaya C, Tauch A, et al. (September 2007). "Genomics of
Actinobacteria: tracing the evolutionary history of an ancient phylum".Microbiol. Mol.
Biol. Rev. 71 (3): 495–548.
Waaler, H. T. 2002. Tuberculosis and poverty. Int. J. Tubercle Lung Dis. 6:745-746.
Weil, A., Plikaytis, B. B., Butler, W. R., Woodley, C. L. & Shinnick, T. M., 1996.
“The mtp40 gene is not present in all strains of Mycobacterium tuberculosis”. Clin
Microbiol34, 2309-231 1.
Wells, W. 1955. Airborne Contagion and Air Hygiene. Harvard University Press,
Cambridge, MA.
83
Wong, D. K., B. Y. Lee, M. A. Horwitz, and B. W. Gibson. 1999. Identification of fur,
aconitase, and other proteins expressed by Mycobacterium tuberculosis under
conditions of low and high concentrations of iron by combined two-dimensional gel
electrophoresis and mass spectrometry. Infect. Immun. 67:327-336
World Health Organization: 2007 Tuberculosis Fact Sheet. Gebeva: World Health
Organisation; 2007.
World Health Organization: TB in South East Asia. Edited by World Health
Organization. Geneva: World Health Organization; 2006.
84
Appendix
85
FIRST BATCH RESULTS FOR QPCR: M012, M014, M015, M016, M035
SECOND BATCH RESULTS FOR QPCR: M015, M024, M025, M027, M028,
M031, M032, M033
86
THIRD BATCH RESULTS FOR QPCR: M002, M008, M010, M018, M021, M027,
M028, M031, M034, M038, M040
FOURTH BATCH QPCR RESULTS: M009,M013, M014, M022, M023, M026,
M029, M032, M037, M039, M044
87
SAMPLES WITH ‘-‘ve AFB and ‘+’ QPCR RESULTS:
M014:
M021:
Cycle41403938373635343332313029282726252423222120191817161514131211109876543210
Fluo
resc
ence
(nor
m)
14001300120011001000900800700600500400300200100
0-100
Threshold: 33 (Adjusted manually)
Baseline settings: automatic, Drift correction OFF
Cycle50494847464544434241403938373635343332313029282726252423222120191817161514131211109876543210
Fluo
resc
ence
(nor
m)
1200
1100
1000
900
800
700
600
500
400
300
200
100
0
Threshold: 131 (Adjusted manually)
Baseline settings: automatic, Drift correction OFF
88
M026
M040:
Cycle50494847464544434241403938373635343332313029282726252423222120191817161514131211109876543210
Fluo
resc
ence
(nor
m)
1100
1000
900
800
700
600
500
400
300
200
100
0
Threshold: 130 (Noiseband)
Baseline settings: automatic, Drift correction OFF
Cycle50494847464544434241403938373635343332313029282726252423222120191817161514131211109876543210
Fluo
resc
ence
(nor
m)
1100
1000
900
800
700
600
500
400
300
200
100
0
Threshold: 130 (Noiseband)
Baseline settings: automatic, Drift correction OFF
89
SAMPLES WITH Positive AFB and Negative QPCR RESULTS:
M031:
M038
Cycle50494847464544434241403938373635343332313029282726252423222120191817161514131211109876543210
Fluo
resc
ence
(nor
m)
1300
1200
1100
1000
900
800
700
600
500
400
300
200
100
0
Threshold: 134 (Noiseband)
Baseline settings: automatic, Drift correction OFF
Cycle50494847464544434241403938373635343332313029282726252423222120191817161514131211109876543210
Fluo
resc
ence
(nor
m)
1200
1100
1000
900
800
700
600
500
400
300
200
100
0
Threshold: 131 (Adjusted manually)
Baseline settings: automatic, Drift correction OFF
90
Various strains of Mycobacterium tuberculosis
MTB Strain Genome
Size
No. of
Genes
No. of
Proteins
Mycobacterium tuberculosis H37Rv (MTB_H37Rv) 4.41 Mbp 4047 3988
Mycobacterium tuberculosis H37Ra (MTB_H37Ra) 4.40 Mbp 4084 4034
Mycobacterium tuberculosis CDC1551 4.41 Mbp 4293 4189
Mycobacterium tuberculosis F11 (MTB_F11) 4.42 Mbp 3998 3941
Mycobacterium tuberculosis KZN1435 4.30 Mbp 4107 4059
(Source: Mycobacterium tuberculosis Proteome Comparison Database, Retrieved on
August 5, 2011)
FASTA format Mycobacterium tuberculosis IS6110 IS-like element in NCBI
GenBank: X17348.1 GenBank Graphics
>gi|48695|emb|X17348.1| Mycobacterium tuberculosis IS6110 IS-
like element
CGATGAACCGCCCCGGCATGTCCGGAGACTCCAGTTCTTGGAAAGGATGGGGTCATGTCAGGTGGTTCAT
CGAGGAGGTACCCGCCGGAGCTGCGTGAGCGGGCGGTGCGGATGGTCGCAGAGATCCGCGGTCAGCACGA
TTCGGAGTGGGCAGCGATCAGTGAGGTCGCCCGTCTACTTGGTGTTGGCTGCGCGGAGACGGTGCGTAAG
TGGGTGCGCCAGGCGCAGGTCGATGCCGGCGCACGGCCCGGGACCACGACCGAAGAATCCGCTGAGCTGA
AGCGCTTAGCGGCGGGACAACGCCGAATTGCGAAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCT
TCGCGGCCGAGCTCGACCGGCCAGCACGCTAATTAACGGTTCATCGCCGATCATCAGGGCCACCGCGAGG
GCCCCGATGGTTTGCGGTGGGGTGTCGAGTCGATCTGCACACAGCTGACCGAGCTGGGTGTGCCGATCGC
CCCATCGACCTACTACGACCACATCAACCGGGAGCCCAGCCGCCGCGAGCTGCGCGATGGCGAACTCAAG
GAGCACATCAGCCGCGTCCACGCCGCCAACTACGGTGTTTACGGTGCCCGCAAAGTGTGGCTAACCCTGA
ACCGTGAGGGCATCGAGGTGGCCAGATGCACCGTCGAACGGCTGATGACCAAACTCGGCCTGTCCGGGAC
CACCCGCGGCAAAGCCCGCAGGACCACGATCGCTGATCCGGCCACAGCCCGTCCCGCCGATCTCGTCCAG
CGCCGCTTCGGACCACCAGCACCTAACCGGCTGTGGGTAGCAGACCTCACCTATGTGTCGACCTGGGCAG
GGTTCGCCTACGTGGCCTTTGTCACCGACGCCTACGTCGCAGGATCCTGGGCTGGCGGGTCGCTTCCACG
ATGGCCACCTCCATGGTCCTCGACGCGATCGAGCAAGCCATCTGGACCCGCCAACAAGAAGGCGTACTCG
ACCTGAAAGACGTTATCCACCATACGGATAGGGGATCTCAGTACACATCGATCCGGTTCAGCGAGCGGCT
CGCCGAGGCAGGCATCCAACCGTCGGTCGGAGCGGTCGGAAGCTCCTATGACAATGCACTAGCCGAGACG
ATCAACGGCCTATACAAGACCGAGCTGATCAAACCCGGCAAGCCCTGGCGGTCCATCGAGGATGTCGAGT
TGGCCACCGCGCGCTGGGTCGACTGGTTCAACCATCGCCGCCTCTACCAGTACTGCGGCGACGTCCCGCC
GGTCGAACTCGAGGCTGCCTACTACGCTCAACGCCAGAGACCAGCCGCCGGCTGAGGTCTCAGATCAGAG
AGTCTCCGGACTCACCGGGGCGGTTCACGA
91
Graphical Representation of IS6110 element in NCBI
Graphical view of some Possible primers for IS6110 as designed by NCBI
Primer-BLAST
92
Field work in pictures at ShukraRaj Tropical and Infectious Disease Hospital,
Teku, Kathmandu, Nepal for Acid Fast Bacilli (AFB) test of TB.
Fig: Sputum Sample Handling Fig: Labeling glass slide
Fig: Making Sputum Smear Fig: Treating with dye and heating
Fig: Glass slides in rack
93
QPCR workfield at CMDN affiliated Intrepid Nepal, Thapathali, Kathmandu,
Nepal.
Fig: BioSafety Cabinet Level-2 Fig: Vortex and Spinning Machine
Fig: QPCR Bench Fig: QPCR Instrument
94
Culture Images performed at Kathmandu University, Department of
BioTechnology, Dhulikhel, Kavre, Nepal.
Fig- Culture Positive Fig- Culture negative
Fig: Culture of Sputum samples for MTP
95
Assessment of detection efficacy of Mycobacterium tuberculosis in sputum samples by Real time PCR based method
����� ������ ������
Questionnaire Hello, My name is Suresh Banjara/Basanta Dahal/Sarbesh Dangol/Sundar Hengoju/Kul Shrestha. I have come from Kathmandu University. We are studying B.Tech. in BioTechnology and we are conducting our project on “Assessment of detection efficacy of Mycobacterium tuberculosis in sputum samples by Real time PCR based method”. The main aim of our study is detection efficacy of TB by Real time PCR. I’d like to request you to participate in this study. Though you won’t be able to benefit directly from your participation, your information shall help this study to progress and be beneficiary to the society in the future. Your privacy will be maintained and your participation will be as accordance to your will. You have a right to stop this interview at any time during the questionnare. But since your information will be very important for our study, I hope for your active participation. If you would like to participate in this interview, I would like to grant the permission from your side.
Personal Details Name of Patients: ……………………………….. Sex: Male Female Age: ………years Marital Stauts: Married Unmarried Divorced Widowed Address: ………………………………………………………………… Residency: Rural Town Type of House: ……………………………………. Type of Fuel: …………………………………………… Family Status: Low Medium High Family Number: …………. Education: Illiterate Can read and Write School Level Higher Education Occupation: Farmer Student HouseWife Daily Labour Merchant Government Others: …………………… Currently Working: Yes No Monthly income: ……………………………….. Religion: …………………. Cast: …………………………. Language: ……………………………………..
96
Medical Histroy Is there a BCG Scar ? Yes No If present size in mm: ……………….. Personal Habits: Smoking Non Smoking Alcoholic Non Alcoholic Tobacco Non Tobacco What was the first symptom of your current illness that you noticed? Cough hemoptysis Fever Weight Loss
Night Sweats Weakness Loss of Appetite
Stomache Others Do you have following clinical manifestations? Hemoptysis Fever Weight Loss Chest Pain Night Sweats Weakness Loss of Appetite Others: ……………………………… Do you have other illness? Yes No If yes specify: …………………………………………………………….. Any family members who suffered from TB: ………………………………………………………….
Diagnosis Date and Time of collection of samples: …………………… Volume of collected Sputum: ………………………….. Quality of sputum sample: saliva mixed Bloody Muco purulent Purulent Knowledge about TB: ……………………………………………………………………………………………………………… ………………………………………………………………………………………………………………………………………………. Declaration by the Interviewee I have been involved in this Research study of TB. I have provided my sputum samples to the respected Researcher as per my will and consideration for the conduction of his Research Project.
Name of the Patient: Signature: ____________________ Date: Signature of the interviewer