automotive new catalogue 2010

16
Materials for Automotive Training Materials for Automotive Training Branchflowers UK Garage and Test Equipment Distributors Paradise Close, Cothelstone TAUTON, Somerset. TA4 3DT Tel. 01823 432 000 Fax 01823 430 500 E-mail: info@branchflowers.co.uk www.crypton-uk.com

Upload: zaleq-yunos

Post on 29-Nov-2014

275 views

Category:

Documents


0 download

DESCRIPTION

for more info, contact me..

TRANSCRIPT

Page 1: Automotive New Catalogue 2010

Materials

for AutomotiveTrainingMaterials

for AutomotiveTraining

Branchfl owers UKGarage and Test Equipment Distributors

Paradise Close, Cothelstone

TAUTON, Somerset. TA4 3DT

Tel. 01823 432 000

Fax 01823 430 500

E-mail: info@branchfl owers.co.uk

www.crypton-uk.com

Page 2: Automotive New Catalogue 2010

02

Our training equipments:

Al l the data sheets of our

p ro d u c t s a re ava i l a b l e o n

w w w.exxotest .com

Training Console Motronic injection training console DTP2000 05 Pre and post heating training console DTP6001 05 Fans cooling management training console DTP6030 05 Anti-lock system training console DTP-ABS1000 05

Training Modules Electronic logic modules DTM3000 05 Lighting and signaling modules DTM7000 05 Windscreen wiper modules DTM7020 05 Lighing and trailor socket signaling modules DTM7030 05 Bases of multiplexing study modules DTM-MUX8000 05

Engine Bench Engine, fuel supply, electrical system, cooling, security MT-Moteur-xx 10 Chassis, control desk 1 1

Breakdown Box and Software Evolutive box failure 54, 108, 162, 216, 270,… ways BAPxxx 12-13 2, 3, 4, 5, 6 ways engine connector box BAP Mini 6 13

DT-C Series Command and controlling: electric motors, injection, locking… DT-C00x 08

DT-M Series Measure: angle, position, speed, voltage sensors DT-M00x 09

Training Bench CAN bus and LIN network with xenon light training board MT-CAN-LIN-BSI 06 Robotized gearbox training board MT-BVR 06 Electric power steering training board MT-DAE 06 Automotive front / rear wheel-axle unit with adjustment MT-Twingo 06 Very basic System car boby alignment controller MT-HD-xx 06 Parking assistance system model MT-AAS 07 Involuntary lane crossing alert system model MT-AFIL 07 Download ECU software configuration, key learning MT-TÉLÉ 07 CAN bus architecture network training board MT-ARCHI 07

Training Bench Brake, torque and stability car on the road training board MT-ESP1000 03 12V alternator and startor training board MT-4002V 04 Automotive air conditioning simulator MT-C5000 04 Petrol Injection training board MT-E5000 04 Common Rail training board MT-H9000 04 Real components model MT-C7000 04

References Pages

Accessories and Acquisition SoftwareAccessories

0-40 bars pressure sensor with variable voltage output DP40 14 CAN bus acquisitions USB-MUX-xxx 14 CAN bus Software MUX-Trace 14

Page 3: Automotive New Catalogue 2010

03

Studying at analyzing the car attitude in different confi gurations based embedded systems ABS, TCS and / or ESP

The model MT-ESP1000, the fi rst support innovative teaching: Virtualization in service training and for the study of systems:

Antilock Braking,Traction controle system,Electronic stability program.

Steel frame with 2 touch screens (to prevent scratching 6 mm) and computer.

Screen No. 1: display shelf of conduct, choice of meteorological conditions (dry, rain, snow), choice of technology in the vehicle (ABS, TCS and ESP), the visual setting (wide, zoom, ...) curve display

Screen No. 2: Visualization of the hydraulic block, displacement of fl uid in the ducts of the shares on wheels.

A electric panel with many parameters: signal valves, wheel sensors, networks CAN HS and LS…

A pedal block with:accélérteur pedal and brake for the vehicle driving on the circuit.

MT-ESP1000

))))

n nd d

eee

03

cicic rcrcuiuit.t

Page 4: Automotive New Catalogue 2010

04

MT-C7000Model of car air conditioning cooling. With real parts: variable compressor, condenser, filter drier, expansion valve and evaporator. Discovery of a simple circuit and visual action potential: recovery of fluid, vacuum and charging with your air conditioning station on the valves of the system.

Table in option

Training Bench

MT-E5000Petrol injection educational support with phase sensor based on TU petrol engine 1,6 l 16V, simulated with motorized butterfly valve and EOBD.

The aim of this simulation is to visualize, analyze and understand a modern injection system. It is delivered with an OBD Scantool.

MT-4002VTraining bases of electricity in a environement START 12V load with starter and alternator fixed plates associated with a panel pre and post heating diesel, a turntable equipped with various consumers, a variable speed motor of the alternator. The bench comes with a charge controller startup MI250, real diagnostic tool

MT-C5000Designed to study the operation and diagnosis of automotive regulated air conditioning.Based on an actual real part ECU Peugeot systems

This is an autonomous system composed of tree panels: "Cockpit", "Power" and "Control"

MT-H9000 Diesel Injection Common Rail educational Support modeling engine turbo diesel injection Common Rail.

The bench is used to visualize and understand the common rail system with a display of pressure, temperature, engine speed, air and fuel flow fuel, …

ThThhhThThTheeee e iiiaiaiaiaimmm mm m ofofofofof t tthihihis s sisis mumulalalaatititionononon i ii is ss s totototototototttotototottototto v vvvv viiiiisiiisisiisisuauauaauaualililiizezezeze,, , , ananananannnalalalalalyzyzyzyzy eeee anananannndd dd ununununuundededededersrsrsrsrstatatataandnddnddd aaaa aaa mm mmmodododdoddodoodododooddo ererererernn nnnn ininininnjejejejejjejeej ctctctcttctcctcctioioioooioioonn n nnn

sysysystststtstststememememmemem. ItItItItItItItI i i iiii iis ssss sss s dedededededededdeeeddedelililililillilllivevvevevveveeeveveverererererereerered d dd ddd ddd wiwiwiwiiiwwiwwiww ththththththhththhthh a aaaaa a ann nnnn nn n OBOBOBOBOOOBOBOBOBDD D D DDDD SSSScScSScScScSS ananananananana tttototototott ololollool...

This is an autonomous systemem composed of tree panels:

"Cockpit", "Power" and "Controll""

Thehehehe bbbbbbbbbeneneneneneneneeee chchchchchcchchchcchch iii is sss ususususususu edededededed t t t tttttto o ooooo vivivvvivvisusususualalalalizizizize e ee

anannnd dd ununnndedededersrsrsrsrsrsssrsrsrsrsssrsstatatatatatatatatatatatattandndndndndndndnddndnnd ttttt t ttttheheheheheheheheehehe cccccccc c comomomomomomoomoommmommmomomommmm n n n rararararararaaiililililili ss s sssysysyssssyyyssssysteteteteeeemmmmmmmm mmm wwwwwititittth h a aa aaaa a a dididididididididd spspspplalaay y y ofofof p p prereressssssururururrure,e,ee,e,e,e tt t ttt temememememeempepepepepepepepeperrararrarararr tutuuuuuuuututurerererer , , , enenengigigigigigigg neneneeneennnnnen sssssspepepeppepeeededededde , , , aiaiair r r r anananananaaaaandddd d fufufufufuuelelelele fff ffflolololololooow w ww w wwww ffffufuufuffffff eleeleeeleleeel,, , ………

TaTaTaablblblblble e ee ee inininininin o ooo oooooppp

uuuididdemem

ddd,,,mm...

Page 5: Automotive New Catalogue 2010

05

DTM3000Set of 9 electronic logic

modules for learning the logical functions: monostable, bistable, scales, bipolar, transistor,… through

the explication of a car alarm. These modules can be studied

individually or connecter together.

DTM7000Set of 10 lighting and signa-

ling modules to create the wiring harness of a car.

Application of the laws of electricity, ohm’s law… through the different

modules: fuses, switches, bulb, relay… Each module can be studied separately.

DTM7020Set of 5 Windscreen wiper

modules to create the harness wiring of a car, used real parts: levers, timed relay, motor,

control electronic, actuator, … Each module can be studied separately.

DTM7030Set of 4 trailer socket lighting and

signaling modules to create the harness wiring of

the trailor, and the connection with the

car.

Ideal for understanding the wiring and fixing a trailer socket.

DTM-MUX8000Set of multiplexing basics modules toteache the basic of the serial data bus communication.Easily to see, analyse and decode the differentsframe of the system.

DTP2000Motronic Petrol Injectiontraining desk. Viewing and modifying many parameters It can create breakdowm faults at the back

DTP6001Renault system Pre and post heating training desk which allows user to visualize all the different.

DTP6030Engine cooling training desk, managing the 2 fans with a 3 relays command system (parallel or serial).The teacher wires the relays inside the desk, with or without breakdown.The student wires the relays in the front part with or without the template of the electric diagram.

DTP-ABS1000ABS training desk with dynamic visualization of operation. It can display the pressure and way followed by the fluids, the activation of the actuators, the wheel slip, etc. It consists of an ECU panel to access all signals, in and out. The vehicle’s speed adjustments, wheel adherence, etc. This desk has a system for both recording and reading sequences. Analyse Pc software inclued

Training Console

Training Modules

iiplplexe ingess ttoossicic o off

a bubus soon.n.

DTMSeSeSeSSeSeSeSet tttt tt

momomomomomomomm dudududdududdufufuncnctitiioooscscscsccscscalalalalaalallesesesees, , ,

thtththtthtttt e e ee eee TTTTTT Thhhhhhhh

ininininintotott

DTM7SSSSeSeSeSeSS tt tt ofoofofofo

lililliiiingngngnggggggnngwiww ririririnnnnnn

ApAppofoffththth

momomomomomomomomoomomoodudduddududdududududududududududd lelelelelelelelellleeeeees:s:s:ss:s:s:sss: f f ffffffff fffusususussussusususussususususussesesssessesesee ,, , ,, swswswswwwitititititititttchchchchchchchchchesessesesseeeees, , bubbububububuulblbbblbblbbblb,,,

DDSeSeettttt

mommomomomomomomoddddddddddwwwlelelele

cococonnnEaEaEaaaEE chchchchhh m m m m mooo

DAAAAvvttttffffftttttttpppppTTTTTTaaaaabbbbAA

k, s

e

c ye,

U.lr.

ge

DEnmcocoThdeThpael

DD

cll,

h

drrrr

DTM7030Set of 4 trailer sock

signaling mthe h

thco

car

Ideal for wiring asocket.

Page 6: Automotive New Catalogue 2010

06

MT-CAN-LIN-BSITraining aid tool with real parts for the study of communication networks: CAN High Speed, CAN low speed and Lin in modern vehicle. Xenon lighting technology with height and rotation adjustment.

Integrated breakdown box

for all parameters.

MT-Twingo Twingo’s front and rear wheel-axle adjustment training model, scale 1/1 that can be used with a control station to setting of front and rear wheel-axle. Visual demonstration, modification of all possible angles.

MT-BVR Robotized manual gear box training bench, driven by an electric engine for a dynamic visual display of the lucht and gear change actuators depending on the order given by the driver.

Integrated breakdown box for all parameters.

MT-DAE Electric power-steered of modern vehicle. A multidisc brake has been mounted at the end of the rack so as to create an effort.

All parameters can be measured with the integrated breakdown box.

Training Bench

MT-HD-xxEducational system train control wheel, simple and effective. Mounting head with laser sight on rule. Checking and adjusting parallelisme, camber, castor and KPI.

Table of different models:

MT-HD-10 Private vehicle

MT-HD-20 Farm tractor

MT-HD-30 Truck

Inntetegrg ated brb eakdown boboboboxx xx

for all paraamememeteet rs

aar r bobox xxnnna a f f f ffee e eee

xxxxxxx

rrrededediiidididiscscsc

dd aat t thththe e ee eeccrerereatatatate eee

bbbe e errrrrrrrrratatatattataa edededededdedde

r wheel-axle adjustmmenent t training moddelel,,used with a control sstatatition to setting g ofof axle. Visual demonstrtratatioi n, modificatatioionn

Page 7: Automotive New Catalogue 2010

07

MT-AASThe MT-AAS model is a real parts training system,dedicated to the study and the understanding of the "parking assistance" system.

This function allows the detection of obstacles present in the blind spot area behind the vehicle.Elements analyses and identification, signals survey…

CAN low Speed network.

MT-AFILThe MT- AFIL is a real parts training system, dedicated to the study and the understanding of the communication networks used "involuntary lane crossing alert" AFIL system.

CAN low Speed and LIN networks.

MT-TÉLÉReal parts model (ECU, dashboard, transponder, contact key…)

This model allows to apply, as on any vehicule, the operations:

ECU’s software downloading Key learning Options tele-coding / config Parameters and faults codes

reading, fault codes deleting with the help of real diagnostic tool.

With this training set, which is delivered with workshop tools, all aspects of diagnosing of modern vehicles can be addressed.For all training levels, it applies the real parts, a whole vehicle is reproduced with simulation panels.All electric measurement can be easily taken.

The diagnosis methods included in this simulator allow the user to work on analogic and multiplexed parts, to understand the interaction between the equipments, the progression of information…

MT-ARCHI

aaaininininngg g ggg sysysyyyyststststememmmmemem,,,,,ddderereerstststststananannananaaaa ddididdidddingngnggtttttememeemememem...

nnnn,,,,,

: ggggg

ngngnggnggggcccccc ttt t toooooooooooollll.l.l.

Page 8: Automotive New Catalogue 2010

08

Order or MeasureExxotest offers a new range of educational materials with real components. Each module provides access to the power, the wiring and the measurement of one or more sensor / actuators.The educational use of these modules ranges from simple analysis of the functioning of the sensor to the integration of actuators development projects more complete. All signals to be analyzed: pwm, inductive, Hall effect, magneto resistive, ...

Comes with: A notebook of resource use and educational A lot of wire depending of the system Power 12v or 5v depending on the system

DT-C001To command control direct current motor:Electric winder: command in 2 directions, Rearview mirror: ordered 2 motors in 2 directions.

Electric winder motor Rearview mirror motors Electric winder and Rearview mirror real button

DT-C002To command diesel and petrol injectors and ignition coil

Petrol injector Piezo common rail diesel injector Ignition coil with glow plug

DT-C003To command pulse width modulation motor

Motorized throttle Air stop in diesel engine EGR valve

DT-C004To command lock system:Coffre, porte, …

Door lock Trunk lock Petrol door lock

DT-C005To command step by step motor:

Idle actuator Air recycling motor Setting up lights

DT-Cxxx Series

ala bbutton

Page 9: Automotive New Catalogue 2010

09

DT-M001Measuring steering wheel angle:Work on COM2000 with steering wheel angle way out on CAN high speed.

DT-M002Measuring positions:Car body position, brake electric captor, accelerator pedal position.

Accelerator pedal Redundant brake contactor Sensor analog and digital ride height

DT-M003Measuring the speed of a wheel:Magnéto-resistive sensor.

Bearing with magnetic sensor

DT-M004measuring the characteristics of air:Pressure temperature flow.

Temperature sensor Pressure air sensor Air flow sensor

DT-M005Measuring tension and current, create the harness wiring

Bulb, resistance, relay, wire, …

DT-M006Measuring engine speed captor, inductive, hall effect and magnetic-resisitive:

Flywheel speed captor Camshaft hall effect speed captor Crankshaft magnetic-resistive speed captor

DT-M007Measruring liquid levels:Oil, coolant, fuel and window washing fluid.

Fuel level sensor Windows washing fluid level sensor Coolant level sensor Oil level sensor

DT-Mxxx Series

ionn.

eeeee hh h heieeie ghghghg ttt

llllllllll::::::

ororrrororroororor

ffffff a aiiirr

gggggg

rrrrr::

ucucucucucuctttttttiitittiiiivvvveveveveveveve,, , , , ,,tititititititivevvvvvveveeveveveveveveveveveev ,,

ororororrorrooror

Page 10: Automotive New Catalogue 2010

10

The engineAs in the vehicle, the engine is equipped with all systems as:Injection system, wiring harness, injection management ECU, …Brand-new car manufacturer origin set.

Diesel engine: 1.4 L DV4TD (PSA) :Diesel direct common rail injection with turbo, piezo injector, Siemens SID806 model.Petrol engine: 1.6 L 16 S TU5JP4 (PSA) :Electronique sequential fuel-injection Bosch ME7.4.5, catalytic converter, 2 lambda sensorPetrole engine: 1.6 L 16 S EP6 (PSA/BMW) :Electronique sequential fuel-injection Bosch MEV 17.4, catalytic converter, 2 lambda sensor, phase on the 2 camshaft, variable valve lift (valve tronic). Petrole engine: 1.6 L 16 S EP6DT (PSA/BMW) :Direct electronique sequential fuel-injection Bosch MED 17.4, catalytic converter, 2 lambda sensor,phase on 1 camshaft, turbo twin scroll.

Fuel Supply systemThe fuel supply is provided by the submerged gauge and pump system form the vehicle.(level display on the dashboard).

Electrical systemAll wiring harness are in conformity with the car manufacturer requirements.The electrical supply il located at the front of the training bench in a closed and secured casing in which we fi nd:

The vehicle’s battery, A battery cut-out switch, An automatic battery charger, The mains plug of the battery charger (230v).

CoolingIdentical to the original vehicle’s system, it is placed at the front of the chassis. The cooling system includes the radiator, the fans system, hoses and an expansion bottle.

The engine on its pedagogical bench is a part of the vehicle extracted form its original environment. It is then considered as a swiveling machine. As to respect the norms linked to that kind of machine, Exxotest protects the hot( up to 55°C) and swiveling parts.

The transparent bonnet totally covers the engine, it is jointed and supported, by thrustos. The closed position allows a maximum security during the running of the engine while preserving

a full visibility of the system. The opened position offers an large access to the engine and helps along the interventions on the system. The locking of the bonnet is allowed by an electrical locking device driven from the chassis control desk.

The electrical system supply is protected by a removable bonnet. A recovery tank is placed under the engine to prevent any liquid leaks or wrong operation.

Security

MT-Moteur Brand-new engine, always efficeint with battery charger,

fuel gauge… Optimized ergonomics Total security Complete transverse engine with large visibility and accessibility

Engine Bench

d form its ororiggininaal envvvvviririrrooononnnnnnnonono mmemmmemememmmememmmmmmentttttnntntnttntnttttt..... . . linked to ththatat kkkiniininnddddddd

ts.

edededed, bybybybyby t ttthrhrhrrusssususssstotot s.s.eeeengngngngininine ee whwhwwhwhililililileeeeeeeee prprpprpp eesesssesesseeerreereere viviviviiviviviviiiivvivvivivivivviv nnngnnggggggnggngngngnngngngnnnngg

hhhhe eee iinini tetervrvenennenntitiitiitiionnononoooo s s onononnnononnn ttt ttt tttttthhhhehehehhh sssssssyyysysyysyyyyy teteeeteeeeeeteteteeeeeeeeemm.m.mmmmmmmrorororomm m m ththththe eee chchchchaassaa iisiisiss ss cocoococcococoocooc ntntntttnttttnttntrrooooroorr llll lllllllll ll dddddeeddddddeddddeddddd skskskkskkkskkkkkkkkkskkk...

wwrororor ngngng o opepepp rarattitit onononono .

, yyy , ,lvve e liliftft ( (vavalvlve e trttrononiciccic).).).).

A/BMBMW)W) ::nnjejectctioion n Boooscscsccchhhhh h MEMEMEMEMEMEMEM DDDDD DD D 1717171717171777..444444444,,, , cacacaccacccccacacacacatatataattatttaatatallylylyylylyllylylyttititittittticccccc cc c cocooococococococoococonvnvnnvnvnnnvnnnvnvn errrererrrrereerrertttttetetetetetetett rr,r,rr,r,, 222222222 llllllll l lamamamamamamamamammmbdbdbdbdbdbddbdbddbdbbdbdbdbdbdbdbddaaaaaaaaa a a a seesssessesseess nsnsnsnsnsllll.

erged ggggauuuuauugggegeeeeegg

s.

hicle extracted

ttttttleleeeleee..

d form its ororigini alal eenvviririrononononnnnnnnnmm

Page 11: Automotive New Catalogue 2010

11

Metalic ChassisRugged and light, the EXXOTEST designed bench is built using high resistance aluminium an its surface is cover with an epoxy paint.

The whole system stand on Ø 160mm wheels (2 fi xed wheels and 2 directional and 1 with brake).To allow an easy moving of the chassis.

Control deskIt is composed of:

Contact key, emergency stop button, bonnet unlocking control, electronic throttle control level.

Analogic displayers: Tachometer, water temperature, fuel gauge, alert light, clock

High resolution screen displaying engine’s data from the CAN bus and optional sensors (see details here below).

Diagnostic plug: The EXXOTEST CL500 is supplied with the training bench. It integrates an EOBD tools, 2 channels oscilloscope and 2 inputs voltmeter functions.

Any diagnostic tools or OBD scantool can be used as on any original vehicle.

i i ll

Engine speed Torque Driver will Engin’s cooling liquid temperature Oil temperature Water temperature alert Diagnostic Mil light Instantaneous fuel consumption Preheating light (diesel engine) Start in progress information Engine running information Battery voltageTese data are displayes onthe dashboard screen

Engin Information

in real time

opopopopop bb b b bututtutututtototototootootoototootototototooot n,n,n,n,nnn

lllleveevevvelelelel. ..

rarararararararatutututurrerere, , , fufufufuufufueleelelele gg g gggggauauauauauaauauggegeggeeeeggggegggg , , ,

ppppppplaaaayiyiyy ngngnggng e e ee ee eeengngngngn ininninne’’’ee s s ss ss dadadaaadaddaadaaaad ttatatatatttttttt titititiononononalalalal s s s senenennneneneensososorsrsssrsrs

mperaturep

t

sumptionpi )

all v vehehiciccle.vvehehiciccle

ngngng b benene hcch..ggg bbbenenenenee chchchchh..

isc

)))..

s builtover

..

Page 12: Automotive New Catalogue 2010

12

BAPxxxBox failures Exxotest is placed in series between the "vehicle harness" and the calculator

BAP108-L 108 way breakdown box on trolley without harnessBAP54C-L 54 way breakdown box on trolley without harness

They facilitate the measurements and can create failures in safety (without damage or modification of the system studied).

32 way engine interface color grey, black and brown 48 way engine interface color grey, black and brown 53 way engine interface color grey, black and brown BSI FULL CAN connector interface Other calculator interface: embedded electronics, sliding side door, sliding roof, DAE, BSM, Air conditioning panel, information panel, COM2000,…

Interface kit

Evolutive Box failures54, 108, 162, 216, 270,… voies

BAP108-L BAP54C-Land/or +

+=Interface kit Harness Front and inside panel

Box Failures

Interface kitInterface kit Front and inside panelFront and inside panel

f l bbl kk dd b

eerfaacccce kkiitt

2 wwayay484888 ww w wwwayayayaayayay

333 wwwwwayayaaySISISISISI F FFUU

OOOOthththtt erer llidididddininininnininingggggananananneleelele ,,

IIIIIInnnttteeeInnttee

344445353

BBBB O OOO

slslsls pppp ppp

BAP108-L BAP54C-Land/or

Page 13: Automotive New Catalogue 2010

13

BAP25 25 way breakdown boxBAP35 35 way breakdown boxBAP55 55 way breakdown box PSA with 3 lines BAP55/R 55 way breakdown box Renault with 2 lines BAP68 68 way breakdown box

BAP mini 6 + Breakout box interface Progress in education: study of the operation of sensors and actuators in making their signals easily accessible.Assistance dianostic and simulate fault using this switch on each track.

Box failure 6 way with harness interchangeablewith original connectors, plugs into many sensor or actuator range of PSA with 2 to 6 lanes as:

Accelerator pedal Temperature sensor Throttle motor Air flow meter

Small and lightweight mini-box failures 6 lanes used in or around the vehicle. The switches allow you to open the electrical connections. Serial connections.

fafafafaffaililili urururure e e e 66666 w ww wwwwwwwwwwayayayayayayayayayay hh hhhharararnenenen ssssss iiiiiiiiinttntntntttteerereee chchhhchchchcchanananananangeggggeg abbbabababablellle

SmSmmala l anaana d ddususeded iinn or a

aaailililururee 666 wwwwwwwwwayayayayayay SmSmmala l anaa

Page 14: Automotive New Catalogue 2010

14

Software and Accessories

CAN BUS Software

Mux-Trace SoftwareThe Mux-Trace software allows the user to study, transmit and analize communication with CAN HS and LS-FT, LIN and VAN protocol networks:It allows viualization ot frame, frequency, bus error staus and undecoded data.

It can work simultaneously with 5 networks.

USB-MUX-xxx BoxesExxotest USB boxes devoted to multi-plexing can be connected to CAN HS, CAN LS, VAN and LIN.

This equipment offers a unique price / quality ratio and allows visualization of several networks simultaneously depending on configuration.

Each reference comes with the Mux-Trace software.

USB-MUX-C3VL USB box – 1 CAN HS ou 1 LS-FT, 3 VAN and 1 LINUSB-MUX-4C2L USB box – 1 CAN HS, 1 CAN HS or LS-FT, 2 CAN LS and 2 LIN

DP400-40 bar pressure sensor. 0-8 V voltage output for acquisition system or multimeter.

Pression Measure

multi-HS,

Page 15: Automotive New Catalogue 2010

15

Page 16: Automotive New Catalogue 2010

Distributed by:

ANNECY ELECTRONIQUE - Parc Altaïs - 1 rue Callisto - 74650 CHAVANOD ANNECY - FRANCETél. 33(0) 450 02 34 34 - Fax 33(0) 450 68 58 93 - www.exxotest.com

- 04

50

67 9

9 00

- P

hoto

s : A

nnec

y El

ectr

oniq

ue -

Janu

ary

2010

JAnuary 2010

Branchfl owers UKGarage and Test Equipment Distributors

Paradise Close, Cothelstone

TAUTON, Somerset. TA4 3DT

Tel. 01823 432 000

Fax 01823 430 500

E-mail: info@branchfl owers.co.uk

www.crypton-uk.com